A method of brassica crop transgenesis and / or gene editing mediated by a co-transformation strategy

By using a co-transformation strategy with developmental regulator vectors and target gene vectors, the problem of low gene editing efficiency in Brassica crops in existing technologies has been solved. This has enabled efficient and stable gene editing and transformation, avoiding abnormal plant phenotypes, and is applicable to Brassica crops such as Chinese cabbage, non-heading Chinese cabbage, and kale.

CN122344587APending Publication Date: 2026-07-07HEBEI AGRICULTURAL UNIV.
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610450954.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-08
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Existing genetic transformation methods are insufficient for efficient and stable gene editing in Brassica crops, and the continuous expression of developmental regulators can lead to abnormal plant phenotypes.

Method used

A co-transformation strategy was adopted, in which developmental regulator vectors (such as pB-WIP-RUBY vector) and target gene vectors (such as GFP expression vector or CRISPR/Cas12a gene editing vector) were co-transformed, and different types of transgenic/gene-edited plants were obtained by screening through fluorescent labeling and phenotypic observation.

Benefits of technology

This method enables the efficient acquisition of transgenic/gene-edited plants that integrate only the target gene vector without causing abnormal plant phenotypes. It simplifies the operation process, improves transformation efficiency, and is applicable to other Brassica species.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122344587A_ABST
    Figure CN122344587A_ABST
Patent Text Reader

Abstract

The application discloses a method for transgene and / or gene editing of Brassica crops mediated by co-transformation strategy, and belongs to the technical field of genetic engineering.The method comprises the following steps: transforming a development regulator vector and a target gene vector into Agrobacterium rhizogenes K599 respectively to prepare a mixed bacteria solution of double strains; infecting a Brassica vegetable explant; inducing adventitious buds after co-culturing; and screening different types of transgenic buds through fluorescence labeling, phenotype observation and molecular identification.The method is simple and efficient, and can effectively avoid adverse phenotypes such as transgenic plant deformity caused by continuous overexpression of the development regulator, and can obtain a gene editing homozygous mutant in the T0 generation, so that the method has a wide application prospect in the research of Brassica crop functional genomics, gene editing and crop genetic improvement.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically to a method for transgenic and / or gene-editing of Brassica crops mediated by a co-transformation strategy. Background Technology

[0002] Brassica crops are important economic crops in my country, but their genetic transformation still faces problems such as low transformation efficiency, cumbersome transformation procedures, long cycles, difficulty in optimizing the types and ratios of hormones in the culture medium, and genotype dependence. Therefore, existing genetic transformation methods struggle to obtain highly efficient, normally fertile transgenic plants. With the development of gene editing technology, current genetic transformation systems are insufficient to meet the delivery needs of gene editing tools, severely restricting functional gene research in Brassica crops and the application of gene editing technology.

[0003] To improve crop genetic transformation efficiency, researchers have used overexpression of developmental regulators (such as WUS, AtIPT, AtPLT5, BBM, WOX5, GRF4, and GIF) to enhance transformation efficiency. However, sustained expression of these regulators can lead to phenotypes such as malformation and sterility. How to specifically utilize these developmental regulators to improve the genetic transformation efficiency of Brassica crops remains a challenge.

[0004] Therefore, how to provide a technical solution for the stable and efficient genetic transformation of Brassica crops without introducing developmental regulators and avoiding abnormal plant phenotypes is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a method for transgenic and / or gene-editing of Brassica crops mediated by a co-transformation strategy.

[0006] The purpose of this invention is to obtain transgenic and gene-edited plants of Brassica spp. by co-transformation of a developmental regulator vector and a target vector. The vector containing the developmental regulator may integrate into the genome or may be transiently expressed and exert its effect, ultimately yielding transgenic / gene-edited plants that integrate only the target vector, transgenic / gene-edited plants that integrate both the developmental regulator vector and the target vector, and transgenic plants that integrate only the developmental regulator vector.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] A method for transgenic and / or gene-editing of Brassica crops mediated by a co-transformation strategy, comprising the following steps: (1) Transform the developmental regulator vector and the target gene vector into Agrobacterium to prepare a mixed bacterial culture of two strains; The developmental regulatory factor vector is a vector containing a WIP fragment; (2) Infecting explants of Brassica crops; (3) Inducing adventitious buds after co-culture; (4) Different types of transgenic buds were obtained by fluorescent labeling, phenotypic observation and molecular identification screening.

[0009] Furthermore, the developmental regulatory factor vector is a pB-WIP-RUBY vector.

[0010] The pB-WIP-RUBY vector is constructed as follows: the WIP and RUBY fragments are amplified separately, and homologous recombination is performed to ligate them into the pBSE401 vector to obtain pB-WIP-RUBY.

[0011] Furthermore, the target gene vector is a GFP expression vector or a gene editing vector.

[0012] Furthermore, the GFP expression vector is a 35S-eGFP-nosT vector.

[0013] Furthermore, the gene editing vector is a CRISPR / Cas12a knockout vector.

[0014] Furthermore, the gene editing vector is PDS Gene knockout vector.

[0015] Furthermore, the aforementioned PDS The method for constructing gene knockout vectors is as follows: by PDS Based on the sequencing sequence of the target gene, the 23bp sequence after TTTV PAM is the target sequence. The fragment is amplified by primer self-ligation. The PCR product is purified and recovered, and constructed into the pB-RBpttCas12a vector by enzyme digestion and ligation (RPS5A and BpttCas12a fragments are amplified separately, and homologous recombination is ligated into the pBSE401 vector). The primer sequences are shown in SEQ ID No. 9 to SEQ ID No. 13.

[0016] Furthermore, in the dual-strain mixed bacterial solution, the volume ratio of K599 bacterial solution containing the developmental regulatory factor vector and the target gene vector is 1:1, and the OD of the bacterial solution is... 600 It ranges from 0.8 to 1.0.

[0017] Furthermore, the explant is a rootless seedling.

[0018] Furthermore, the Brassica genus crops mentioned are Chinese cabbage, non-heading Chinese cabbage, and kale.

[0019] Furthermore, when the target gene vector is a GFP expression vector, co-transformed shoots are screened by GFP fluorescent labeling.

[0020] Furthermore, when the target gene vector is PDS When using gene knockout vectors, select co-transformed shoots that are white or pink.

[0021] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects: (1) This invention utilizes a developmental regulator vector (which can promote the formation of transgenic callus and adventitious shoots. The developmental regulator vector contains developmental regulators and the RUBY gene, referred to as pB-WIP-RUBY vector) and a target gene vector to successfully achieve transgenic and / or gene editing of Brassica crops through co-transformation. It does not require complex hormone ratios and antibiotic screening, and the operation is simple and efficient.

[0022] (2) Vectors containing developmental regulators may integrate into the genome or may transiently express and function (the pB-WIP-RUBY vector may transiently express as a protein and perform its function, but it may not integrate into the genome; it may also stably integrate into the genome and stably express the protein and perform its function). After co-transformation, transgenic / gene-edited plants containing only the target gene vector, transgenic / gene-edited plants co-transformed with developmental regulators and the target gene vector, and transgenic plants containing only developmental regulators can be obtained.

[0023] (3) The method of the present invention is convenient and quick, and can obtain homozygous edited plants in the T0 generation. It does not require complex vector construction and has significant advantages in genetic transformation. It is suitable for application in other Brassica species. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0025] Figure 1 This refers to the induction of adventitious buds in Example 1 of the present invention.

[0026] Figure 2 The image shows a transgenic Chinese cabbage seedling with GFP fluorescence in Example 1 of this invention. The left image shows the seedling under normal light, and the right image shows the seedling under a handheld GFP portable screening and observation lamp.

[0027] Figure 3This is a PCR analysis of the integration of the pB-WIP-RUBY vector into the plants obtained through the co-transformation strategy in Example 1 of this invention.

[0028] Figure 4 This is a PCR analysis of the integration of the 35S-eGFP-nosT vector into the plants obtained through the co-transformation strategy in Example 1 of this invention.

[0029] Figure 5 These are transgenic seedlings of Chinese cabbage co-transformed in Example 2 of this invention, where the left image is the control and the right image is pB-WIP-RUBY and PDS Knockout vectors that were all integrated pink buds and only PDS Knock out the white buds that integrate with the carrier.

[0030] Figure 6 This is a PCR analysis of the integration of the pB-WIP-RUBY vector into the plants obtained through the co-transformation strategy in Example 2 of the present invention.

[0031] Figure 7 This is a PCR analysis of the knockout vector integration of plants obtained through a co-transformation strategy in Example 2 of the present invention.

[0032] Figure 8 The transformed plant of Example 2 of this invention PDS PCR analysis of gene deletion.

[0033] Figure 9 The above are the sequencing results of albino Chinese cabbage seedlings in Example 2 of this invention, where green represents the PAM sequence of the target site and black represents the Chinese cabbage seedlings. PDS The gene has four target site sequences. Red indicates the base sequence where editing and insertion occurred, and --- indicates the base sequence where editing and deletion occurred.

[0034] Figure 10 The images show transgenic seedlings co-transformed with non-heading Chinese cabbage in Example 3 of this invention, where the left image is the control and the right image is... PDS Pink shoots co-transformed with the knockout vector and pB-WIP-RUBY.

[0035] Figure 11 The images show transgenic cabbage seedlings co-transformed in Example 4 of this invention, where the left image is the control and the right image is... PDS Pink shoots co-transformed with the knockout vector and pB-WIP-RUBY.

[0036] Figure 12 This is the result of Comparative Example 1 of the present invention.

[0037] Figure 13 The image shows the results of transforming the pB-WIP-RUBY vector in Comparative Example 2 of this invention. The left image shows the results of plant leaves, and the right image shows the PCR analysis.

[0038] Figure 14 This is the result of co-transformation of two vectors, pB-WIP-RUBY and 35S-eGFP-nosT, in Comparative Example 2 of this invention. Detailed Implementation

[0039] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0040] Example 1 Transgenic Chinese cabbage plants were obtained through co-transformation. 1. Preparation of explants Select plump Chinese cabbage seeds (Beijing New No. 3) into 50 mL centrifuge tubes. Disinfect with 75% alcohol for 5-10 seconds, then with 10% hydrogen peroxide for 12 minutes. Rinse three times with sterile water for 3 minutes each time. Blot dry the seeds on filter paper and sow 30 seeds evenly into culture flasks containing 1 / 2 MS medium. Culture conditions: temperature (24±1)℃, LED light source, light intensity 100 µmol·m⁻¹. -2 ·s -1 The photoperiod was 16 hours of light / 8 hours of darkness. After 3 days of culture, rootless seedlings were cut off 0.5-1 cm below the growth point. The MS solid medium was MS basal medium supplemented with 8 g / L agar, 20 g / L sucrose, and pH 5.8.

[0041] 2. Preparation of mixed bacterial culture with two strains pB-WIP-RUBY and the GFP expression vector (35S-eGFP-nosT) were transformed into K599 Agrobacterium rhizogenes, respectively. After colony PCR verification, single colonies were selected and inoculated into TY liquid medium, and cultured at 28°C in the dark with shaking at 200 rpm until OD. 600 The concentration was 0.8~1.0. The bacterial cultures containing 35S-eGFP-nosT and pB-WIP-RUBY were mixed in a 1:1 volume ratio, centrifuged at 5000 rpm for 10 minutes at room temperature, the supernatant was removed, the bacterial cells were resuspended in 1 / 2 MS liquid medium, and incubated in a 28℃ incubator for 30 minutes.

[0042] The pB-WIP-RUBY vector construction method is as follows: Amplify the RUBY fragment using the following primers: RUBY-F: cgacggccagtgccaagcttgtccccagattagccttttc, SEQ ID No. 1; RUBY-R: cgaacgaaagctctgagctccccgatctagtaacatagat, SEQ ID No. 2.

[0043] The pBSE401 vector was digested with HindIII and SacI. The RUBY fragment and the digested vector were then gel-cleaved and transformed using homologous recombinase to obtain the pB-RUBY vector.

[0044] Homologous recombination system: 100 ng PCR product, 50 ng pBSE401 gel-recovered product, 5 μL 2xCEmix, and ddH2O added to 10 μL.

[0045] Connection reaction conditions: 50℃ for 15 min.

[0046] Primers for amplifying the WIP fragment are as follows: WIP-F: gaagaagaagaagtgagctctgagacttttcaacaaaggg, SEQ ID No. 3; WIP-R: cgaacgaaagctctgagctcgatctggattttagtactgg, SEQ ID No. 4.

[0047] The pB-RUBY vector was digested with SacI, and the WIP fragment and the digested vector were recovered by gel extraction and ligation using homologous recombinase to obtain the pB-WIP-RUBY vector.

[0048] Homologous recombination system: 100 ng PCR product, 50 ng pB-RUBY gel-recovered product, 5 μL 2xCEmix, and ddH2O added to 10 μL.

[0049] Connection reaction conditions: 50℃ for 15 min.

[0050] 3. Explant infection Place the explants in a culture dish, pour the incubated Agrobacterium mixed bacterial solution into the culture dish, incubate for 10 minutes, then place the explants on filter paper to blot off the residual Agrobacterium solution on the surface; place the explants on MS solid medium supplemented with 100 μM acetylsyl syringone (AS) and co-culture for 2 days at 25°C in the dark.

[0051] 4. Induction of adventitious buds and observation of GFP fluorescence The co-cultured explants were transferred to MS solid medium supplemented with 100 mg / mL TMT (Timentin) and cultured under a 16-hour photoperiod at 25°C. Adventitious shoots were observed after two weeks of culture. TMT was used to inhibit the growth of Agrobacterium. Figure 1 Using a handheld GFP portable screening lamp, GFP fluorescence was detected in all different types of transgenic adventitious shoots obtained through the co-transformation strategy. Green adventitious shoots were identified as GFP-positive, demonstrating the feasibility of the co-transformation method. Figure 2 ).

[0052] 5. Molecular biological identification of co-transformed plants Co-transformed Chinese cabbage showed normal growth and good vigor. DNA was extracted from different types of transgenic shoots obtained through the co-transformation strategy, and PCR analysis was performed using the pB-WIP-RUBY vector and the 35S-eGFP-nosT vector (primers used are listed below). Vector integration was statistically analyzed. pB-WIP-RUBY transformation efficiency: total number of transgenic plants integrating only pB-WIP-RUBY and those integrating both pB-WIP-RUBY and 35S-eGFP-nosT / total number of explants inoculated; 35S-eGFP-nosT transformation efficiency: total number of transgenic plants integrating only 35S-eGFP-nosT and those integrating both pB-WIP-RUBY and 35S-eGFP-nosT / total number of explants inoculated; Co-transformation efficiency: total number of transgenic plants integrating both pB-WIP-RUBY and 35S-eGFP-nosT / total number of explants inoculated. The experiment was repeated three times.

[0053] WIP-F':ATCCTCCGGATCTGGTTCAT, SEQ ID No.5; WIP-R': CTGATTGCGTCGTAGATGTGG, SEQ ID No. 6; GFP-F: TGAAGTTCATCTGCACCAC, SEQ ID No. 7; GFP-R: CCATGTACAGCTCGTCCAT, SEQ ID No. 8.

[0054] Six transgenic seedlings (numbered 1-6) and one non-transgenic seedling (ck as negative control) were selected for identification. Electrophoresis results showed that only seedling number 4 integrated with the pB-WIP-RUBY vector. Figure 3 Only plants No. 2 and No. 6 integrated the 35S-eGFP-nosT vector. Figure 4Plant number 1 was the plant that simultaneously integrated the pB-WIP-RUBY and 35S-eGFP-nosT vectors. The transformation efficiency of the 35S-eGFP-nosT vector was calculated to be 50%; the transformation efficiency of the pB-WIP-RUBY vector was 33.3%; and the total transformation efficiency was 16.7%.

[0055] The results showed that co-transformation of Chinese cabbage yielded four types of transgenic plants: ① integration of only the pB-WIP-RUBY vector; ② integration of only the 35S-eGFP-nosT vector; ③ integration of both vectors; and ④ non-integration of either vector. Integration of only the 35S-eGFP-nosT vector avoids the overexpression of the pB-WIP-RUBY growth factor, which can cause seedling malformation, and also avoids the complex problem of subsequent separation of the two vectors (integration of the pB-WIP-RUBY vector leads to a high frequency of malformation in transgenic seedlings; what we need are ① the pB-WIP-RUBY vector momentarily exerts its effect but does not integrate, with only the 35S-eGFP-nosT vector integrating; ② integration of both vectors but normal growth and development). This invention successfully obtained transgenic Chinese cabbage plants through co-transformation, without the need for hormone treatment or antibiotic screening, and is simple and efficient.

[0056] Example 2 Gene-edited Chinese cabbage plants were obtained through co-transformation. 1. Preparation of explants Select plump Chinese cabbage seeds (Beijing New No. 3) into 50 mL centrifuge tubes. Disinfect with 75% alcohol for 5-10 seconds, then with 10% hydrogen peroxide for 12 minutes. Rinse three times with sterile water for 3 minutes each time. Blot dry the seeds on filter paper and sow 30 seeds evenly into culture flasks containing 1 / 2 MS medium. Culture conditions: temperature (24±1)℃, LED light source, light intensity 100 µmol·m⁻¹. -2 ·s -1 The photoperiod was 16 hours of light / 8 hours of darkness. After 3 days of culture, rootless seedlings were cut off 0.5-1 cm below the growth point. The MS solid medium was MS basal medium supplemented with 8 g / L agar, 20 g / L sucrose, and pH 5.8.

[0057] 2. Preparation of mixed bacterial culture with two strains pB-WIP-RUBY and PDS The knockout vectors were transformed into K599 Agrobacterium rhizogenes. After colony PCR verification, single colonies were selected and inoculated into TY liquid medium. The cultures were then incubated at 28°C in the dark with shaking at 200 rpm until OD200 was reached. 600 The values ​​range from 0.8 to 1.0, and will contain [various components]. PDSThe bacterial cultures of the knockout vector and the pB-WIP-RUBY vector were mixed in a 1:1 volume ratio, centrifuged at 5000 rpm for 10 minutes at room temperature, the supernatant was removed, the bacterial cells were resuspended in 1 / 2 MS liquid medium, and incubated in a 28°C incubator for 30 minutes.

[0058] PDS The method for constructing the knockout vector is as follows: ① Target site design and linkage transformation by PDS Based on the sequencing sequence of the target gene, the 23bp sequence after TTTV PAM is the target sequence. The fragment is amplified by primer self-ligation, in which five primers contain four target sites and DR repeat sequences.

[0059] ② Constructing primer sequences for vectors: BrPDS-F1: ATGGTCTCGTAGATtctgcatctttccgtagtgctccTAATTTCTAC, SEQ ID No. 9; BrPDS-F2: gctccTAATTTCTACTAAGTGTAGATataccaatctccatcttcatcctTAATT, SEQID No. 10; BrPDS-F3: atcttcatcctTAATTTCTACTAAGTGTAGATtctggccatgtcagcatctc, SEQ IDNo.11; BrPDS-R1:TTGGTCTCGGGCCatagtggttccatcagtgagtaaATCTACACTTAG, SEQ IDNo.12; BrPDS-R2: gtaaATCTACACTTAGTAGAAATTAaacgagatgctgacat, SEQ ID No. 13.

[0060] ③ The PCR product was purified and recovered, and then constructed into the pB-RBpttCas12a vector by enzyme digestion and ligation. The specific reaction system is as follows: Enzyme digestion and ligation system: PCR product 100ng, pB-RBpttCas12a 200ng, 10×T4 Buffer 0.5μL, T4 ligase 1μL, BSA 1μL, BsaI 0.5μL, ddH2O added to 10μL.

[0061] Enzyme digestion and ligation reaction conditions: 37℃ digestion for 2 h, 37℃ for 5 min and 16℃ for 10 min cycles for 12 times, 50℃ for 5 min, 80℃ for 5 min, and 12℃ for 10 min storage.

[0062] The pB-RBpttCas12a vector is constructed as follows: Amplify the BpttCas12a fragment using the following primers: BpttCas12a-F: tagagtcgaagtagtgattgaaattactgatgagtccgtg, SEQ ID No. 14; BpttCas12a-R: tgatacgaacgaaagctctgccgatgatacgaacgaaagc, SEQ ID No. 15.

[0063] The pBSE401 vector was digested with BsaI and SacI. The BpttCas12a fragment and the digested vector were then gel-cleaved and transformed using homologous recombinase to obtain the pB-BpttCas12a vector.

[0064] Homologous recombination system: 100 ng PCR product, 50 ng pBSE401 gel-recovered product, 5 μL 2xCEmix, and ddH2O added to 10 μL.

[0065] Connection reaction conditions: 50℃ for 15 min.

[0066] Amplify the RPS5A fragment using the following primers: RPS5A-F: Caagcttgcatgcctgcaggctccccataatcgtgagtaga, SEQ ID No. 16; RPS5A-R: gcttttgctttaaaagaaatgatttaaatggctgtggtgagagaaacag, SEQ ID No. 17.

[0067] The pB-BpttCas12a vector was digested with PstI and SwaI. The RPS5A fragment and the digested vector were then gel-cleaved and transformed using homologous recombinase to obtain the pB-RBpttCas12a vector.

[0068] Homologous recombination system: 100 ng PCR product, 50 ng pB-BpttCas12a gel-recovered product, 5 μL 2xCEmix, and ddH2O to 10 μL.

[0069] Connection reaction conditions: 50℃ for 15 min.

[0070] ④ Transform 5 µL of the ligation product into 50 µL of competent E. coli cells and incubate overnight at 37°C on LB solid culture dishes containing Kan resistance. Perform colony PCR identification on the growing single clones, select positive single clones for sequencing, and then store the vector bacterial culture with correct sequencing results at -80°C.

[0071] 3. Explant infection Place the explants in a culture dish, pour the incubated Agrobacterium mixed bacterial solution into the culture dish, incubate for 10 minutes, then place the explants on filter paper to blot off the residual Agrobacterium solution on the surface; place the explants on MS solid medium supplemented with 100 μM acetylsuccinone (AS) and co-culture for 2 days at 25°C in the dark.

[0072] 4. Induction of adventitious buds and PDS Observation of albino seedlings The co-cultured explants were transferred to MS solid medium supplemented with 100 mg / mL TMT and cultured under a 16-hour photoperiod at 25°C. Adventitious shoots were observed after two weeks of culture. This method was applied to explants co-transformed with pB-WIP-RUBY and... PDS Observing the adventitious shoots of the knockout vector revealed four scenarios: ① When the pB-WIP-RUBY vector carried the reporter gene RUBY, and only the pB-WIP-RUBY vector was integrated, the transgenic shoot turned red, confirming it as a transgenic positive shoot; ② pB-WIP-RUBY and... PDS When all knockout vectors are integrated, the red and white traits overlap to produce a pink color, which is identified as a co-transformation bud. Figure 5 ); ③ pB-WIP-RUBY is not integrated, PDS When the vector is knocked out and integrated, it appears white, indicating that it is a positive bud that has undergone editing. Figure 5 ); ④ pB-WIP-RUBY and PDS When the knockout vector does not integrate, it presents a normal green color and is identified as a negative bud.

[0073] 5. Molecular biological identification of co-transformed plants The co-transformed Chinese cabbage plants grew normally and vigorously. DNA was extracted from the co-transformed shoots and processed using the pB-WIP-RUBY vector and... PDS PCR analysis of the knockout vector (primers used are listed below) was performed to analyze vector integration. pB-WIP-RUBY transformation efficiency: integration of only pB-WIP-RUBY and simultaneous integration of pB-WIP-RUBY and... PDS Total number of transgenic plants / Total number of explants inoculated; PDS Conversion efficiency: Integration only PDS And simultaneously integrate pB-WIP-RUBY and PDSTotal number of transgenic plants / total number of explants inoculated; co-transformation efficiency: simultaneous integration of pB-WIP-RUBY and PDS The total number of transgenic plants / the total number of explants inoculated was calculated, and the experiment was repeated three times.

[0074] WIP-F':ATCCTCCGGATCTGGTTCAT, SEQ ID No.5; WIP-R': CTGATTGCGTCGTAGATGTGG, SEQ ID No. 6; PDS-F: AGCTCGAGAAATTCACCAAC, SEQ ID No. 18; PDS-R: TATGCCGGCGCTAGAGTAT, SEQ ID No. 19.

[0075] Six co-transformed seedlings (numbered 1-6) and one non-transformed seedling (ck as negative control) were selected for identification. Electrophoresis results showed that only seedling number 6 integrated with the pB-WIP-RUBY vector. Figure 6 ),only PDS The plantlet that was integrated with the knockout vector was number 3 ( Figure 7 ), pB-WIP-RUBY vector and PDS Plants that were simultaneously integrated with the knockout vector were plants numbered 1, 2, 4, and 5. Calculations showed that... PDS The conversion efficiency of the vector was 83.3%; the conversion efficiency of the pB-WIP-RUBY vector was 83.3%; and the co-conversion efficiency was 66.7%.

[0076] PCR analysis was performed on the editing of six co-transformed seedlings. Four target sites were designed to simultaneously target Chinese cabbage. PDS Two copies of the target site can produce deletions of different sizes after editing. Primers can be used to amplify fragments containing four... PDS Fragments of the target can be observed PDS Both copies contain deletions of different fragment sizes. Figure 8 ).

[0077] PDS1F: GGGAGTAGGTAGTGTGTGTGG, SEQ ID No. 20; PDS1R: AGATGGAATGCAAATTCAGA, SEQ ID No. 21; PDS2F: TGTTGTTAGGTAGTTTGTGTGG, SEQ ID No. 22; PDS2R: GCATATGAAGTAGGATCCCTT, SEQ ID No. 23.

[0078] Select PCR products from plant No. 1 for pairing PDS Sequencing of two copies PDS1 Different sizes of base deletions occurred at target sites 1, 2, 3, and 4. PDS2 At target site 1, a base insertion occurred, while at targets 3 and 4, base deletions occurred. Figure 9 ).

[0079] The results showed that the co-transformation method for Chinese cabbage could produce homozygous edited plants in the T0 generation without the need for complex vector construction, which has significant advantages in genetic transformation and is suitable for application in other Brassica species.

[0080] Example 3 Gene-edited non-heading Chinese cabbage plants were obtained through co-transformation. 1. Preparation of explants Select plump, non-heading Chinese cabbage seeds (Youqing 49) into 50 mL centrifuge tubes. Disinfect with 75% alcohol for 3 minutes, then with 5% sodium hypochlorite for 12 minutes. Rinse three times with sterile water for 3 minutes each time. Place the seeds on filter paper to absorb any remaining moisture. Sow 30 seeds evenly in culture flasks containing 1 / 2 MS medium, using the same culture conditions as above. After 3 days of culture, cut rootless seedlings 0.5–1 cm below the growing point.

[0081] 2. Preparation of mixed bacterial culture with two strains pB-WIP-RUBY and PDS The knockout vector (construction method as in Example 2) was transformed into K599 Agrobacterium rhizogenes. After colony PCR verification, single colonies were selected and inoculated into TY liquid medium, and cultured at 28°C in the dark with shaking at 200 rpm until OD. 600 The values ​​range from 0.8 to 1.0, and will contain [various components]. PDS The knockout vector and pB-WIP-RUBY bacterial culture were mixed in a 1:1 volume ratio, centrifuged at 5000 rpm for 10 minutes at room temperature, the supernatant was removed, the bacterial cells were resuspended in 1 / 2 MS liquid medium, and incubated in a 28°C incubator for 30 minutes.

[0082] 3. Explant infection Place the explants in a culture dish, pour the incubated Agrobacterium mixed bacterial solution into the culture dish, incubate for 10 minutes, then place the explants on filter paper to blot off the residual Agrobacterium solution on the surface; place the explants on MS solid medium supplemented with 100 μM acetylsuccinone (AS) and co-culture for 2 days at 25°C in the dark.

[0083] 4. Induction of adventitious buds and PDS Observation of albino seedlings The co-cultured explants were transferred to MS solid medium supplemented with 100 mg / mL TMT and cultured under a 16-hour photoperiod at 25°C. Adventitious shoots were observed after two weeks of culture. This method was applied to explants co-transformed with pB-WIP-RUBY and... PDS Observing the adventitious shoots of the knockout vector revealed four scenarios: ① When the pB-WIP-RUBY vector carried the reporter gene RUBY, and only the pB-WIP-RUBY vector was integrated, the transgenic shoot turned red, confirming it as a transgenic positive shoot; ② pB-WIP-RUBY and... PDS When all knockout vectors are integrated, the red and white traits overlap to produce a pink color, which is identified as a co-transformation bud. Figure 10 ); ③ pB-WIP-RUBY is not integrated, PDS When the knockout vector is integrated, it appears white, indicating a positive bud that has undergone editing; ④pB-WIP-RUBY and PDS When the knockout vector does not integrate, it presents a normal green color and is identified as a negative bud.

[0084] Example 4 Gene-edited cabbage plants were obtained through co-transformation. 1. Preparation of explants Select plump seeds of Zhonggan 21 and place them in 50 mL centrifuge tubes. Disinfect with 75% alcohol for 3 minutes, then with 3% sodium hypochlorite for 8-9 minutes. Rinse three times with sterile water for 3 minutes each time. Blot the seeds dry on filter paper and sow 30 seeds evenly into culture flasks containing 1 / 2 MS medium. Culture conditions: temperature (24±1)℃, LED light source, light intensity 100 µmol·m⁻¹. -2 ·s -1 The photoperiod is 16 hours of light / 8 hours of darkness. After 3 days of cultivation, rootless seedlings are cut off 0.5-1 cm below the growth point.

[0085] 2. Preparation of mixed bacterial culture with two strains pB-WIP-RUBY and PDS The knockout vectors were transformed into K599 Agrobacterium rhizogenes. After colony PCR verification, single colonies were selected and inoculated into TY liquid medium. The cultures were then incubated at 28°C in the dark with shaking at 200 rpm until OD200 was reached. 600 The values ​​range from 0.8 to 1.0, and will contain [various components]. PDS The knockout vector and pB-WIP-RUBY bacterial culture were mixed in a 1:1 volume ratio, centrifuged at 5000 rpm for 10 minutes at room temperature, the supernatant was removed, the bacterial cells were resuspended in 1 / 2 MS liquid medium, and incubated in a 28°C incubator for 30 minutes.

[0086] 3. Explant infection Place the explants in a culture dish, pour the incubated Agrobacterium mixed bacterial solution into the culture dish, incubate for 8-9 minutes, then place the explants on filter paper to blot off the residual Agrobacterium solution on the surface; place the explants on MS solid medium supplemented with 100 μM acetylsyl syringone (AS) and co-culture for 2 days at 25°C in the dark.

[0087] 4. Induction of adventitious buds and PDS Observation of albino seedlings The co-cultured explants were transferred to MS solid medium supplemented with 100 mg / mL TMT and cultured under a 16-hour photoperiod at 25°C. Adventitious shoots were observed after two weeks of culture. This method was applied to explants co-transformed with pB-WIP-RUBY and... PDS Observation of adventitious buds revealed four scenarios: ① When the pB-WIP-RUBY vector carried the reporter gene RUBY, and only the pB-WIP-RUBY vector was integrated, the transgenic bud turned red, confirming it as a transgenic positive bud; ② pB-WIP-RUBY and... PDS When all knockout vectors are integrated, the red and white traits overlap to produce a pink color, which is identified as a co-transformation bud. Figure 11 ); ③ pB-WIP-RUBY is not integrated, PDS When the knockout vector is integrated, it appears white, indicating a positive bud that has undergone editing; ④pB-WIP-RUBY and PDS When the knockout vector does not integrate, it presents a normal green color and is identified as a negative bud.

[0088] Comparative Example 1 Replace the pB-WIP-RUBY vector with the 35-RUBY vector, and follow the same procedures as in Example 1 to induce adventitious shoots. The difference between the two vectors is whether or not WIP growth factor is added.

[0089] The results are as follows Figure 12 As shown, transformation of the 35-RUBY vector resulted in the growth of only red roots, without the formation of callus or adventitious buds. However, transformation of the pB-WIP-RUBY vector resulted in the formation of callus and adventitious buds.

[0090] Comparative Example 2 The pB-WIP-RUBY vector, pB-WIP-RUBY and 35S-eGFP-nosT vectors were co-transformed, and the remaining operations were the same as in Example 1, to induce adventitious shoots.

[0091] The results of transforming the pB-WIP-RUBY vector are as follows: Figure 13 As shown, the leaves of plants transformed with the pB-WIP-RUBY vector are red ( Figure 13(Left) Five red plants were selected for PCR identification of pB-WIP-RUBY vector integration. All plants showed bands, indicating complete vector integration. CK was the wild-type control. Figure 13 right).

[0092] The results of co-transformation with the two vectors pB-WIP-RUBY and 35S-eGFP-nosT are as follows: Figure 14 As shown, the plant leaves have four types: ① red leaves with no GFP fluorescence expression; ② green leaves with GFP fluorescence expression; ③ red leaves with GFP fluorescence expression; ④ green leaves with no GFP fluorescence expression.

[0093] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0094] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for transgenic and / or gene-editing of Brassica crops mediated by a co-transformation strategy, characterized in that, The steps include the following: (1) Transform the developmental regulator vector and the target gene vector into Agrobacterium to prepare a mixed bacterial culture of two strains; The developmental regulatory factor vector is a vector containing a WIP fragment; (2) Infecting explants of Brassica crops; (3) Inducing adventitious buds after co-culture; (4) Transgenic / gene-edited plants containing only the target gene vector, transgenic / gene-edited plants co-transformed with developmental regulators and the target gene vector, and transgenic plants containing only developmental regulators were obtained by fluorescent labeling, phenotypic observation and molecular identification screening.

2. The method as described in claim 1, characterized in that, The developmental regulatory factor vector is the pB-WIP-RUBY vector.

3. The method as described in claim 1, characterized in that, The target gene vector is a GFP expression vector or a gene editing vector.

4. The method as described in claim 3, characterized in that, The GFP expression vector is the 35S-eGFP-nosT vector.

5. The method as described in claim 3, characterized in that, The gene editing vector is a CRISPR / Cas12a knockout vector.

6. The method as described in claim 3, characterized in that, The gene editing vector is PDS Gene knockout vector.

7. The method as described in claim 1, characterized in that, In the mixed bacterial culture of the two strains, the volume ratio of K599 bacterial culture containing developmental regulatory factor vector and target gene vector was 1:1, and the OD of the bacterial culture was... 600 It ranges from 0.8 to 1.

0.

8. The method as described in claim 1, characterized in that, The explants were rootless seedlings.

9. The method according to any one of claims 1-8, characterized in that, The Brassica genus crops mentioned are Chinese cabbage, non-heading Chinese cabbage, and kale.