Lactic acid bacteria with probiotic properties and their use
By screening out the acid- and sugar-tolerant lactic acid bacteria strain cc_Lp14 for fruit and vegetable juice fermentation, the problem of low fermentation efficiency of commercial lactic acid bacteria in fruit and vegetable juices has been solved, thereby improving the quality and enhancing the health value of fruit and vegetable juices.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-31
- Publication Date
- 2026-07-10
AI Technical Summary
Existing commercial lactic acid bacteria have low fermentation efficiency and insufficient functional release in fruit and vegetable substrates with high acidity, high sugar and complex nutrients, making it difficult to meet the needs of the fruit and vegetable juice industry.
The endogenous lactic acid bacteria strain Lactiplantibacillus plantarum cc_Lp14 was screened from citrus fruits. This strain has the characteristics of acid resistance, sugar resistance and bile salt resistance, and is adapted to the natural substrate environment of fruit and vegetable juices, and can be used for fruit and vegetable juice fermentation.
It significantly increases the flavonoid content and antioxidant activity in fruit and vegetable juices, promotes the biotransformation of phenolic substances, and enhances the health value and fermentation efficiency of fruit and vegetable juices.
Smart Images

Figure CN122357348A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and in particular relates to a lactic acid bacteria with probiotic properties and its applications. Background Technology
[0002] Lactic acid bacteria ( Lactic acid bacteria Lactobacillus (LAB) is a group of Gram-positive bacteria that can ferment carbohydrates to produce large amounts of lactic acid. It includes multiple groups such as Lactobacillus, Bifidobacterium, and Streptococcus. As a recognized safe (GRAS) microorganism, its significant effects in regulating the balance of intestinal flora, promoting the digestion and absorption of nutrients, and enhancing the body's immunity have attracted much attention.
[0003] Among the many lactic acid bacteria strains, *Lactobacillus plantarum* (… Lactobacillus plantarum Due to its wide distribution and diverse functions, *Lactobacillus plantarum* has become a research hotspot. It is widely present on the surface and in the pulp of fruits and vegetables, and is a dominant microbial community in the natural fermentation process. Studies have shown that *Lactobacillus plantarum* can produce various natural active substances such as lactobacillusin, polyphenols, and flavonoids during fermentation. These substances possess multiple physiological activities, including antibacterial, antioxidant, immunomodulatory, cholesterol-lowering, antitumor, and gut microbiota-improving activities. They can extend the shelf life of food and endow products with higher health value, demonstrating outstanding application potential in the field of food fermentation.
[0004] Fruit and vegetable juices are made from fresh fruits and vegetables through processes such as pressing. They retain the natural flavor and rich nutrients of fruits and vegetables, and are rich in vitamins, minerals, flavonoids, and polyphenols, making them an important daily beverage for supplementing nutrition. However, traditional non-fermented fruit and vegetable juices have significant quality defects: their nutrients are mostly in bound forms, such as bound phenols and large-molecule polysaccharides, resulting in low bioavailability of these nutrients by the human body; at the same time, non-fermented fruit and vegetable juices have a limited flavor profile and are not easy to store for long periods due to the lack of natural antibacterial components. In addition, the fresh-pressing process leads to the loss of dietary fiber and high concentration of sugars, further affecting the nutritional value of the product.
[0005] With the rapid development of probiotic fermentation technology, it has become an effective way to improve the quality of fruit and vegetable juices. The combination of probiotics and fruit and vegetable juices represents a scientific nutritional synergy. The polysaccharides, vitamins, and active substances in fruit and vegetable juices provide an ideal environment for probiotic growth, while the metabolic activities of probiotics enable a comprehensive quality upgrade of the juices: not only improving the sensory characteristics and optimizing flavor and taste, but also promoting the biotransformation of phenolic substances, converting bound phenols into free forms that are more easily absorbed by the human body, significantly enhancing the product's antioxidant activity. Simultaneously, it enriches functional factors such as organic acids, free amino acids, and active polysaccharides, reducing the product's sugar content and alleviating the digestive burden on the stomach and intestines, thus giving fruit and vegetable juices higher health value. Currently, probiotic-fermented fruit and vegetable juices, with their dual advantages of "natural base + probiotic function," have become a hot topic in functional beverages, filling a market gap.
[0006] Despite the promising market prospects for fermented fruit and vegetable juices and the increasingly abundant reserves of lactic acid bacteria resources, its industrial development remains constrained by the core bottleneck of "strain-substrate mismatch." Currently, most commercially available lactic acid bacteria strains widely used in fruit and vegetable fermentation originate from dairy fermentation systems. Their metabolic characteristics are significantly incompatible with fruit and vegetable substrates, resulting in low fermentation efficiency and difficulty in meeting the demands of industrial production. Some commercially available lactic acid bacteria strains exhibit significant "acclimatization problems" when fermenting citrus juices and other fruit and vegetable juices: because these commercial lactobacilli cannot tolerate the high concentrations of citric acid (pH 2.8–3.5) and pectin in fruit and vegetable juices, fermentation cycles are often prolonged, acid production stagnates, and the fermentation process may even fail to complete normally. Furthermore, traditional commercial strains have low utilization rates of bitter phenolic substances unique to fruits and vegetables (such as hesperidin and naringin in citrus), making it difficult to fully release the antioxidant active ingredients in fruits and vegetables and thus failing to fully realize the nutritional potential of fruit and vegetable juices. Therefore, screening out specialized lactic acid bacteria strains that are highly adaptable to the acidic, high-sugar, and complex nutritional environments of fruits and vegetables is key to solving problems such as low fermentation efficiency and insufficient functional release of commercial strains, and promoting the industrial upgrading of fermented fruit and vegetable juice. Summary of the Invention
[0007] The technical problem this invention aims to solve is to overcome the problems of low fermentation efficiency and insufficient functional release of commercially available lactic acid bacteria in high-acid, high-sugar, and complex nutrient-rich fruit and vegetable substrates. This invention provides a lactic acid bacteria with probiotic properties screened from citrus fruits and its applications. The lactic acid bacteria are endogenous, superior lactic acid bacteria strains screened from natural fermentation substrates. These endogenous strains have long adapted to their natural substrate environment, exhibiting advantages such as rapid growth and reproduction, high metabolic efficiency, and strong environmental adaptability, enabling them to better adapt to the fermentation requirements of the substrate. Simultaneously, citrus fruits also contain various endogenous lactic acid bacteria. These strains have long adapted to the acidic environment (pH 2.5–4.0), high sugar (≥15%), and complex nutrient environment of citrus fruits. Through long-term natural domestication, their metabolic characteristics are highly compatible with citrus substrates and they possess potential probiotic application value. They are expected to become superior strains specifically for the fermentation of citrus and other fruit and vegetable juices, providing a new technical path to solve the bottlenecks in the industrialization of fermented fruit and vegetable juices.
[0008] To address the aforementioned technical problems, this invention provides a lactic acid bacteria with probiotic properties, wherein the lactic acid bacteria is *Lactobacillus plantarum* (…). Lactiplantibacillus plantarum )cc_Lp14, deposited at the China General Microbiological Culture Collection Center, accession number CGMCC No.37211, deposit date: December 26, 2025.
[0009] Based on a general technical concept, the present invention provides an application of the aforementioned lactic acid bacteria in the preparation of fermented fruit and vegetable juices.
[0010] The above application, further, includes the following steps: After activating the lactic acid bacteria, they are inoculated into fruit and vegetable juice and fermented to obtain fermented fruit and vegetable juice.
[0011] In the above application, further, the inoculum amount of the lactic acid bacteria is 5 v / v%, and the bacterial concentration of the lactic acid bacteria solution is 10%. 8 CFU / mL or higher.
[0012] In the above application, the fermentation culture temperature is 37°C.
[0013] Furthermore, in the above applications, the fruit and vegetable juice is prepared using the following method: Carrots are blanched and then mixed with distilled water in a 1:1 volume ratio to obtain carrot puree; oranges are peeled, juiced, and filtered to obtain orange puree; fresh peaches are peeled, cut, pureed, and filtered to obtain peach puree. The prepared carrot puree, orange puree, and peach puree were pasteurized at 75℃ for 20 minutes, and then blended in a volume ratio of 1:2:1 to obtain fruit and vegetable juice.
[0014] Compared with the prior art, the advantages of the present invention are as follows: This invention provides a probiotic lactic acid bacterium. Lactic acid bacterium cc_Lp14 was screened from citrus pulp through a series of identification analyses. It has the characteristics of acid resistance, sugar resistance and bile salt resistance, and has high growth activity in fruit and vegetable substrates. When used for compound fruit and vegetable juice fermentation, it can significantly increase the flavonoid content and antioxidant activity. It not only has significant application potential in the field of fruit and vegetable juice fermentation, but also provides an important strain resource for the development of a new generation of probiotic starter cultures.
[0015] Lactic acid bacteria, named cc_Lp14, classified as: *Lactobacillus plantarum* ( Lactiplantibacillus plantarum The accession number is CGMCC No.37211, the accession date is December 26, 2025, and the depository is China General Microbiological Culture Collection Center, No.3, No.1 Beichen West Road, Chaoyang District, Beijing. Attached Figure Description
[0016] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.
[0017] Figure 1 This represents the survival rate of different strains under pH 2.5 conditions in Experiment 2 of this invention.
[0018] Figure 2 The survival rate of different strains in Experiment 3 of this invention is shown.
[0019] Figure 3 The survival rate of different strains under a bile salt concentration of 1.5 mg / mL in Experiment 4 of this invention is shown.
[0020] Figure 4 This is the growth curve of the strain in Experiment 5 of this invention in the compound fruit and vegetable juice.
[0021] Figure 5 The results show the detection of total phenols and flavonoids in fermented fruit and vegetable juices in Experiment Six of this invention.
[0022] Figure 6 This is the result of the antioxidant capacity assessment in Experiment Seven of this invention. Detailed Implementation
[0023] The present invention will be further described below with reference to specific preferred embodiments, but this does not limit the scope of protection of the present invention.
[0024] The materials, reagents, and instruments used in the following examples are all commercially available. Unless otherwise specified, the experimental methods used in the following examples are conventional methods in the art.
[0025] Example 1 A probiotic lactic acid bacterium, cc_Lp14, screened from citrus fruits, is classified as *Lactobacillus plantarum*. Lactiplantibacillus plantarum )cc_Lp14, accession number: CGMCC No.37211, accession date: December 26, 2025, depositary institution: China General Microbiological Culture Collection Center, No.3, No.1 Beichen West Road, Chaoyang District, Beijing.
[0026] The citrus endogenous lactic acid bacteria in this embodiment were obtained by screening using the following method: (1) Wash the purchased citrus raw materials, use a blender to extract juice with sterile water at a ratio of 1:1, divide the juice into conical flasks, and place them on a shaker at 37°C for 48 hours for fermentation.
[0027] (2) After diluting the fermented fruit pulp, the strains were inoculated into MRS agar medium with bromocresol purple and MRS agar medium with calcium carbonate respectively and cultured. The strains that showed yellow color on MRS agar medium with bromocresol purple and had calcium dissolution zone on MRS agar medium with calcium carbonate were selected for use.
[0028] (3) After diluting the bacterial solution, the smear was fixed by flame, Gram staining was performed, and the strains were observed under a microscope to screen for Gram-positive strains that turned purple.
[0029] (4) The isolated and identified strains were inoculated into MRS broth medium and activated at 37°C for at least 18 hours to achieve a strain concentration of 1×10⁻⁶. 7 CFU / mL or higher, the activated bacterial culture was cultured with 50% glycerol at a 1:1 ratio and stored at -80℃ for later use. The cultures were named cc_Lp4, cc_Lp5, cc_Lp6, cc_Lp7, cc_Lp8, cc_Lp9, cc_Lp10, cc_Lp11, cc_Lp13, cc_Lp14, cc_Lp19, cc_Lp20, cc_Lp21, cc_Lp22, cc_Lp23, and cc_Lp24, respectively.
[0030] Experiment 1: Molecular biological identification of the lactic acid bacteria from Example 1.
[0031] 1.1 The genomic DNA of the selected lactic acid bacteria was obtained using a bacterial genomic DNA extraction kit (Tiangen). The specific operation was performed according to the instructions, and the extraction results were detected by agarose gel electrophoresis.
[0032] 1.2 Using the extracted genomic DNA as a template, PCR amplification was performed using universal primers 27F and 1541R as upstream and downstream primers. The gene sequence of universal primer 27F is: AGAGTTTGATCCTGGCTCAG; the gene sequence of universal primer 1541R is: AAGGAGGTGATCCAGCC.
[0033] PCR amplification system (25 μL): Mix-Taq enzyme 12.5 μL, template DNA 1.0 μL, forward primer (27F) 1 μL, reverse primer (1541R) 1 μL, double-distilled water (ddH2O) 9.5 μL.
[0034] PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 10 s, 55℃ annealing for 1 min, 72℃ extension for 90 s, for a total of 30 cycles; 72℃ extension for 10 min.
[0035] 1.3 Recovery and purification of PCR products: After detecting the above PCR products by 1% agarose gel electrophoresis, the fragments that meet the target were recovered using a gel extraction kit.
[0036] 1.4 Sequencing and Result Analysis: The obtained fragments were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were submitted to the NCBI database for BLAST alignment. The results are shown in Table 1.
[0037] Table 1: Results of genomic DNA alignment of lactic acid bacteria.
[0038]
[0039] The results in Table 1 show that: 1 of the 16 strains has a gene similarity of 96.3% with *Lactobacillus plantarum*, and 11 strains have a gene similarity of over 98% with *Lactobacillus plantarum*, so it can be preliminarily determined that these 12 strains are all *Lactobacillus plantarum*; 4 strains are similar to *Lactobacillus pentosaccharide* (…). Lactiplantibacillus pentosus The gene similarity was over 98%, and it was initially identified as Lactobacillus pentosus.
[0040] Experiment 2: Acid resistance analysis.
[0041] 2.1 Prepare MRS liquid culture medium with pH 2.5, inoculate the activated bacteria into the liquid culture medium, and culture at 37℃ and 220 rpm for 3 h with shaking.
[0042] 2.2. Take 1 mL of the bacterial culture after 0 and 3 hours of incubation and dilute it to 10⁻⁶ with physiological saline. -7 The CFU / mL concentration was plated on MRS solid medium and incubated at 37°C for 48 h. The survival rate of the strain under acidic conditions was obtained by referring to the formula.
[0043] Survival rate (%) = (3 h viable bacteria count / 0 h viable bacteria count) × 100.
[0044] Figure 1 The figure shows the survival rate of each strain under acidic conditions. As can be seen from the figure, there are significant differences in the growth performance of the 16 lactic acid bacteria to be screened under a simulated acidic environment of pH 2.5. The survival rate of eight strains, Lp4, Lp5, Lp8, Lp9, Lp14, Lp21, Lp23, and Lp24, was higher than 80% after 3 hours, showing strong acid tolerance.
[0045] Experiment 3: Sugar tolerance analysis.
[0046] 3.1 Prepare MRS liquid medium with 30% glucose by mass, inoculate the activated bacteria into the liquid medium, and culture at 37℃ and 220 rpm for 3 h with shaking.
[0047] 3.2. Take 1 mL of the bacterial culture after 0 h and 3 h of culture and dilute it to 10⁻⁶. -7 The CFU / mL strain was spread onto MRS solid medium and incubated at 37°C for 48 h. The survival rate of the strain under high sugar conditions was obtained by referring to the formula.
[0048] Survival rate (%) = (3 h viable bacteria count / 0 h viable bacteria count) × 100.
[0049] Figure 2 The figure shows the survival rate of each strain under high sugar conditions. As can be seen from the figure, all thirteen strains (Lp4, Lp5, Lp6, Lp7, Lp8, Lp9, Lp11, Lp14, Lp19, Lp20, Lp21, Lp23, and Lp24) multiplied after 3 hours of cultivation in a high sugar environment, with a survival rate exceeding 100%. This indicates that these strains can tolerate hyperosmolar environments and play a potentially advantageous role in juices with high sugar content, such as grapes, citrus fruits, and peaches.
[0050] Experiment 4: Salt tolerance analysis of the lactic acid bacteria from Example 1.
[0051] 4.1 Prepare MRS liquid culture medium with a bile salt concentration of 1.5 mg / mL, inoculate the activated bacteria into the liquid culture medium, and culture at 37℃ and 220 rpm for 3 h with shaking.
[0052] 4.2. Take 1 mL of the bacterial culture after 0 and 3 hours of incubation and dilute it to 10⁻⁶. -7 The CFU / mL strain was spread onto MRS solid medium and incubated at 37°C for 48 h. The survival rate of the strain under high bile salt conditions was obtained by referring to the formula.
[0053] Survival rate (%) = (3 h viable bacteria count / 0 h viable bacteria count) × 100.
[0054] Figure 3 The figure shows the survival rate of each strain in a high bile salt environment. As can be seen from the figure, strains Lp4, Lp5, Lp8, Lp9, Lp14, Lp21, Lp23, and Lp24 have a stronger tolerance to bile salts than other strains, with a survival rate of over 70%, demonstrating good bile salt tolerance stability. They can grow normally in the human intestine and regulate the intestinal flora.
[0055] Based on a comprehensive analysis of experiments two through four, eight target bacteria—cc_Lp4, cc_Lp5, cc_Lp8, cc_Lp9, cc_Lp14, cc_Lp21, cc_Lp23, and cc_Lp24—were selected for growth activity testing.
[0056] Example 2 The application of lactic acid bacteria cc_Lp14 from Example 1 in increasing the flavonoid content in compound fruit and vegetable juices. The application method includes: (1) Preparation of compound fruit and vegetable juice concentrate: Carrots were blanched and then added to distilled water at a volume ratio of 1:1. After blending, carrot concentrate was obtained. Oranges were peeled, juiced, and filtered to obtain orange concentrate. Fresh peaches were peeled, cut, blended, and filtered to obtain peach concentrate. The prepared carrot juice, orange juice, and peach juice were pasteurized at 75℃ for 20 min and then blended at a volume ratio of 1:2:1.
[0057] (2) Inoculate the compound fruit and vegetable juice concentrate with activated bacterial cultures of cc_Lp4, cc_Lp5, cc_Lp8, cc_Lp9, cc_Lp14, cc_Lp21, cc_Lp23, and cc_Lp24 at a 5% (v / v) inoculation rate, maintaining the bacterial concentration at 10. 8 Incubate at 37°C with CFU / mL or higher, and take samples every 3 hours.
[0058] Experiment 5: Investigating the growth curve of lactic acid bacteria fermentation.
[0059] The absorbance of the sample at 600 nm wavelength was measured using an ELISA reader, and the growth curve was plotted.
[0060] Figure 4 Growth curves for cc_Lp4, cc_Lp5, cc_Lp8, cc_Lp9, cc_Lp14, cc_Lp21, cc_Lp23, and cc_Lp24 were obtained. Strains exhibiting strong growth and rapid proliferation in fruit and vegetable juice substrates were screened for subsequent fermentation characteristic experiments.
[0061] Experiment 6: Investigate the content of total phenols and flavonoids.
[0062] The total phenols and flavonoids in fermented fruit and vegetable juices were determined using a kit (Boxbio). The specific operation was performed according to the instructions.
[0063] Figure 5 The results show the detection of total phenols (A) and flavonoids (B) in fermented fruit and vegetable juices. As can be seen from the figure, the total phenol content of fermented fruit and vegetable juices from cc_Lp14 and cc_Lp23 was significantly higher than that of the control group, reaching 0.480 mg / mL and 0.473 mg / mL, respectively. The flavonoid content of fermented fruit and vegetable juice from cc_Lp14 reached 0.127 mg / mL, more than three times higher than that of the control group, indicating that this strain can more effectively promote the release and conversion of flavonoids during fermentation.
[0064] Experiment 7: Examining antioxidant capacity.
[0065] The antioxidant capacity of fermented fruit and vegetable juices was determined using the DPPH radical scavenging assay kit (Boxbio) and the ABTS radical scavenging assay kit (Boxbio). Specific procedures were performed according to the instructions.
[0066] Figure 6 The graph shows the antioxidant capacity of fermented fruit and vegetable juices. In the graph, A represents the DPPH free radical scavenging rate, and B represents the ABTS free radical scavenging rate. As can be seen from the graph, the DPPH free radical scavenging rate of the fermented fruit and vegetable juice using cc_Lp14 reached 46.9%, an increase of 8.8% compared to the unfermented juice. The ABTS free radical scavenging rate of the fermented fruit and vegetable juice using cc_Lp14 reached 56.7%, an increase of approximately 15% compared to the unfermented juice.
[0067] Based on the comprehensive fermentation performance test results, cc_Lp14 exhibits stable growth in fruit and vegetable juices. After fermentation, it promotes the release of flavonoids in the juices and enhances their antioxidant capacity.
[0068] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the spirit and technical essence of the present invention. Therefore, any simple modifications, equivalent substitutions, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solutions of the present invention shall still fall within the protection scope of the technical solutions of the present invention.
Claims
1. A type of lactic acid bacteria with probiotic properties, characterized in that, The lactic acid bacteria is *Lactobacillus plantarum* (… Lactiplantibacillus plantarum )cc_Lp14, deposited at the China General Microbiological Culture Collection Center, accession number CGMCC No.37211, deposit date: December 26, 2025.
2. The application of the lactic acid bacteria according to claim 1 in the preparation of fermented fruit and vegetable juice.
3. The application according to claim 2, characterized in that, The application includes the following steps: After activating the lactic acid bacteria, they are inoculated into fruit and vegetable juice and fermented to obtain fermented fruit and vegetable juice.
4. The application according to claim 3, characterized in that, The inoculation amount of the lactic acid bacteria is 5 v / v, and the bacterial concentration of the lactic acid bacteria solution is 10%. 8 CFU / mL or higher.
5. The application according to claim 3, characterized in that, The fermentation culture temperature was 37°C.
6. The application according to any one of claims 3 to 5, characterized in that, The fruit and vegetable juice was prepared using the following method: Carrots are blanched and then mixed with distilled water in a 1:1 volume ratio to obtain carrot puree; oranges are peeled, juiced, and filtered to obtain orange puree; fresh peaches are peeled, cut, pureed, and filtered to obtain peach puree. The prepared carrot puree, orange puree, and peach puree were pasteurized at 75°C for 20 minutes, and then blended in a volume ratio of 1:2:1 to obtain fruit and vegetable juice.