A genetically engineered strain for high-yield d-allulose and a construction method and application thereof

By introducing the D-allulose synthase system and the CRISPR/Cpf1 system into Escherichia coli and optimizing expression regulation, the problems of low conversion rate and complex separation in D-allulose production were solved, achieving efficient and stable D-allulose fermentation production with a significant increase in yield.

CN122357409APending Publication Date: 2026-07-10HENAN ZHONGDA HENGYUAN BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HENAN ZHONGDA HENGYUAN BIOTECH CO LTD
Filing Date
2026-04-13
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Existing technologies have low industrial production conversion rates for D-allulose, and the separation process is complex, costly, and difficult to achieve efficient and stable microbial synthesis.

Method used

We constructed an efficient D-allulose synthase system by introducing D-allulose-6-phosphate-3-epimerase and D-allulose-6-phosphate phosphatase, combined with the CRISPR/Cpf1 system to knock out competing metabolic genes, and finely regulated the promoter and ribosome binding sites to optimize expression levels.

Benefits of technology

It significantly improved the yield and conversion efficiency of D-allulose, achieving efficient and stable fermentation production with a 2.25-fold increase in yield. It has the potential for industrial scale-up, reaching a yield of 33.05 g/L.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention relates to the fields of synthetic biology and metabolic engineering, and particularly to a genetically engineered strain producing high levels of D-allulose, its construction method, and its applications. The strain uses *Escherichia coli* as the starting strain and constructs a phosphorylation / epimerization / dephosphorylation synthetic pathway by introducing *AlsE* from *E. coli* and *CtA6PP* from *Clostridium thermocellum*. Competitive metabolic genes *pgm*, *zwf*, *pfkA*, and *rpiB* are knocked out to enhance carbon flux directing. Furthermore, the expression of *AlsE* and *CtA6PP* is precisely regulated at the transcriptional and translational levels through promoter engineering and RBS engineering to obtain the optimal expression combination. The engineered strain achieves a D-allulose yield of 5.26 g / L in in vitro fermentation and 33.05 g / L in a 5L fed-batch fermenter, exhibiting advantages of high yield, stability, and ease of scale-up, making it suitable for industrial production of D-allulose.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and metabolic engineering, and in particular to a genetically engineered Escherichia coli strain that efficiently synthesizes D-allulose via phosphorylation / epimerization / dephosphorylation pathway, as well as its construction method, fermentation process and applications. Background Technology

[0002] D-Allulose, the C-3 epimer of D-fructose, is a rare natural sugar with advantages such as low calories, high sweetness, and various physiological activities, and is widely used in the food, pharmaceutical, and functional ingredient industries. Currently, the industrial production of D-allulose mainly utilizes the epimerization reaction of D-fructose; however, limited by thermodynamic equilibrium, the conversion rate is only about 30%, and subsequent complex separation processes such as simulated moving bed chromatography are required, resulting in high costs and energy consumption.

[0003] In recent years, microbial synthesis strategies based on phosphorylation / epimerization / dephosphorylation pathways have attracted much attention due to their thermodynamic advantages and high yield potential. This pathway achieves efficient conversion from D-glucose to D-allulose by introducing D-allulose-6-phosphate-3-epimerase (A6PE) and D-allulose-6-phosphate phosphatase (A6PP). Previous studies have attempted to construct this pathway in microorganisms, but shortcomings remain in enzyme combination selection, competitive pathway blocking, and expression regulation optimization, resulting in yields and conversion efficiencies that do not reach industrial application levels.

[0004] Therefore, developing a genetically engineered strain that produces high levels of D-allulose, optimizing its metabolic pathways and expression regulation, and achieving efficient, stable, and scalable fermentation production has significant industrial value and scientific importance. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a genetically engineered strain that produces high levels of D-allulose, its construction method, and its application. Through systemic metabolic engineering and expression regulation optimization, the efficient conversion of D-glucose to D-allulose is achieved, thereby increasing yield and production intensity.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides a genetically engineered strain comprising:

[0008] (I) D-allulose-6-phosphate-3-epimerase gene (A6PE); and / or

[0009] (II) D-allulose-6-phosphate phosphatase gene (A6PP);

[0010] Not included:

[0011] (i) phosphoglucosuricase gene (pgm); and / or

[0012] (ii) glucose-6-phosphate dehydrogenase gene (zwf); and / or

[0013] (iii) 6-phosphofructokinase I gene (pfkA); and / or

[0014] (iv) L-ribose-5-phosphate isomerase B gene (rpiB);

[0015] The chassis strain of the genetically engineered strain is Escherichia coli BL21(DE3).

[0016] In some specific embodiments of the present invention, the above-mentioned genetically engineered strain is based on Escherichia coli BL21(DE3) as the starting strain and has undergone the following modifications:

[0017] (a) Introducing the D-allulose-6-phosphate-3-epimerase gene and the D-allulose-6-phosphate phosphatase gene;

[0018] (b) Knock out one or more genes that compete with sugar phosphate intermediates for metabolism, wherein the genes that compete with sugar phosphate intermediates for metabolism are selected from at least one of the following: glucose-6-phosphate dehydrogenase gene, fructose-6-phosphate kinase I gene, and L-ribose-5-phosphate isomerase B gene;

[0019] (c) The expression levels of the D-allulose-6-phosphate-3-epimerase gene and the D-allulose-6-phosphate phosphatase gene are regulated by promoter engineering and ribosome binding site engineering.

[0020] In some specific embodiments of the present invention, the D-alokulose-6-phosphate-3-epimerase gene of the above-mentioned genetically engineered strain is the AlsE gene from Escherichia coli, with GenBank accession number NP_418509.1.

[0021] In some specific embodiments of the present invention, the D-alokulose-6-phosphate phosphatase gene of the above-mentioned genetically engineered strain is the CtA6PP gene from Clostridium thermocellum, with GenBank accession number WP_003512401.1.

[0022] In some specific embodiments of the present invention, the phosphoglucoside mutase gene of the above-mentioned genetically engineered strain is the pgm gene of Escherichia coli.

[0023] In some specific embodiments of the present invention, the glucose-6-phosphate dehydrogenase gene of the above-mentioned genetically engineered strain is the zwf gene of Escherichia coli.

[0024] In some specific embodiments of the present invention, the 6-phosphofructokinase I gene of the above-mentioned genetically engineered strain is the pfkA gene of Escherichia coli.

[0025] In some specific embodiments of the present invention, the L-ribose-5-phosphate isomerase B gene of the above-mentioned genetically engineered strain is the rpiB gene of Escherichia coli.

[0026] In some specific embodiments of the present invention, the regulation of the expression level of the above-mentioned genetically engineered strain includes the selection of P J23119 P J23100 P J23107 P tac P trc At least one promoter in the process is regulated.

[0027] In some specific embodiments of the present invention, the regulation of the expression level of the above-mentioned genetically engineered strain includes regulation using at least one RBS sequence selected from RBS29, RBS30, RBS31, RBS32, and RBST7.

[0028] In some specific embodiments of the present invention, the knockout order of the genes related to the competitive metabolism of sugar-phosphate intermediates in the above-mentioned genetically engineered strains is to knock out the pgm gene, the zwf gene, the pfkA gene, and the rpiB gene in sequence.

[0029] In some specific embodiments of the present invention, the transcription of the D-allulose-6-phosphate-3-epimerase gene of the above-mentioned genetically engineered strain is initiated by promoter P. J23119 Translation is controlled by the RBS sequence RBST7.

[0030] In some specific embodiments of the present invention, the transcription of the D-allulose-6-phosphate phosphatase gene of the above-mentioned genetically engineered strain is initiated by promoter P. trc Translation is controlled by the RBS sequence RBS32.

[0031] In some specific embodiments of the present invention, the pgm gene, zwf gene, pfkA gene, and rpiB gene of the above-mentioned genetically engineered strain are knocked out, and pET-P is included. J23119 -AlsE and pCD-P trc -CtA6PP.

[0032] This invention also provides the application of the above-mentioned genetically engineered strain in the production of D-allulose.

[0033] The present invention also provides a method for constructing the above-mentioned genetically engineered strain, comprising:

[0034] Construct recombinant plasmids expressing AlsE and CtA6PP;

[0035] The recombinant plasmid was transformed into Escherichia coli BL21(DE3);

[0036] The pgm, zwf, pfkA and rpiB genes of the *E. coli* BL21(DE3) were sequentially knocked out using the CRISPR / Cpf1 system to obtain the genetically engineered strain.

[0037] In some specific embodiments of the present invention, the recombinant plasmid in the above construction method is pET-P. J23119 -AlsE and pCD-P trc -CtA6PP.

[0038] The present invention also provides a method for producing D-allulose, which is based on the above-mentioned genetically engineered strain.

[0039] In some specific embodiments of the present invention, the above-mentioned production method includes:

[0040] The genetically engineered strain was inoculated into a carbon-containing medium and cultured to the logarithmic growth phase. IPTG, an inducer, was added, and fermentation was carried out. The fermentation broth was collected, and D-allulose was isolated.

[0041] The carbon source is D-glucose, with an initial concentration of 20 g / L;

[0042] The fermentation was carried out in a 5 L fermenter, with the glucose concentration maintained at 8-12 g / L.

[0043] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0044] (1) A highly efficient and specific D-allulose synthase system was constructed. This invention screened A6PE and A6PP enzymes from different sources and, for the first time, identified the optimal combination of AlsE (from *E. coli*) and CtA6PP (from *Clostridium thermocellum*) in *E. coli* BL21(DE3). This combination not only possesses high catalytic activity and specificity but also effectively promotes the reaction equilibrium towards D-allulose synthesis, laying the foundation for subsequent metabolic engineering.

[0045] (2) The system interrupts the competing metabolic pathways, significantly improving carbon flux redirection efficiency. This invention uses the CRISPR / Cpf1 system to sequentially knock out four competing genes, pgm, zwf, pfkA, and rpiB, achieving systematic blocking of three competing branches: D-glucose-6-phosphate, D-fructose-6-phosphate, and D-aloxulose-6-phosphate. This allows intermediate metabolic flux to be efficiently directed to the target product, increasing the yield by 2.25 times compared to the original engineered bacteria.

[0046] (3) This invention achieves precise dual regulation of key enzymes at both the transcriptional and translational levels. It not only utilizes promoter engineering (P...) J23119 P J23100 P J23107 P tac P trc The transcriptional intensity of AlsE and CtA6PP was optimized, and their translation efficiency was finely tuned through RBS engineering (RBS29, RBS30, RBS31, RBS32, RBST7), ultimately obtaining the optimal pET-P combination for expression balance. J23119 -RBST7-AlsE and pCD-P trc -RBS32-CtA6PP enabled a test tube fermentation yield of 5.26 g / L;

[0047] (4) A scaleable, high-yield fed-batch fermentation process was established. In a 5 L fermenter, by controlling the glucose concentration at 8-12 g / L, inducing at an appropriate cell density, and supplementing with yeast extract in the later stage, a D-allulose yield of 33.05 g / L was finally achieved within 52 h, which has good potential for industrial scale-up. Attached Figure Description

[0048] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art are briefly introduced below.

[0049] Figure 1 This diagram shows the D-allulose yield produced by fermentation using strains BL-01 to BL-06 in Example 1 of this invention.

[0050] Figure 2 This diagram shows the D-allulose yield produced by strains BL-07 to BL-10 in Example 2 of this invention.

[0051] Figure 3 This diagram shows the D-allulose yield produced by fermentation using strains BL-11 to BL-34 in Example 3 of this invention.

[0052] Figure 4 This diagram shows the D-allulose yield produced by strains BL-35 to BL-59 in Example 4 of this invention.

[0053] Figure 5 This invention demonstrates the D-allulose production and OD of strain BL-58 during a 52-h fermentation cycle in Example 5 of the present invention. 600 Change diagram. Detailed Implementation

[0054] This invention discloses a genetically engineered strain that produces high levels of D-allulose, its construction method, and its applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0055] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.

[0056] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.

[0057] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.

[0058] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and does not constitute a limitation on the scope of the invention. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.

[0059] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.

[0060] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in this invention are all commercially available products and can be purchased from the market.

[0061] This invention provides a genetically engineered strain producing high levels of D-allulose, its construction method, and its applications. The strain uses *Escherichia coli* BL21(DE3) as the starting strain. A phosphorylation / epimerization / dephosphorylation synthetic pathway is constructed by introducing the D-allulose-6-phosphate-3-epimerase gene (AlsE) from *E. coli* and the D-allulose-6-phosphate phosphatase gene (CtA6PP) from *Clostridium thermocellum*. Furthermore, the competing metabolic genes pgm, zwf, pfkA, and rpiB are knocked out using the CRISPR / Cpf1 system to enhance carbon flux guidance. The expression of AlsE and CtA6PP is further precisely regulated at the transcriptional and translational levels through promoter engineering and ribosome binding site (RBS) engineering, resulting in the optimal expression combination. The engineered strain can produce up to 5.26 g / L of D-allulose in in vitro fermentation and up to 33.05 g / L in fed-batch fermentation in a 5L fermenter. It has the advantages of high yield, stability and easy scale-up, and is suitable for industrial production of D-allulose.

[0062] In practice, the genetically engineered strain uses Escherichia coli BL21(DE3) as the starting strain and undergoes the following genetic modification:

[0063] A. Introducing key enzyme genes:

[0064] The D-allulose-6-phosphate-3-epimerase (A6PE) gene and the D-allulose-6-phosphate phosphatase (A6PP) gene were introduced to construct a complete phosphorylation / epimerization / dephosphorylation pathway;

[0065] B. Knock out competing metabolic genes:

[0066] Knock out at least one gene that competes with sugar-phosphate intermediates for metabolism, including but not limited to: pgm (encoding glucose-6-phosphate mutase), zwf (encoding glucose-6-phosphate dehydrogenase), pfkA (encoding 6-phosphofructokinase I), and rpiB (encoding L-ribose-5-phosphate isomerase B).

[0067] C. Optimization of expression regulation:

[0068] Through promoter engineering and ribosome binding site (RBS) engineering, the transcriptional and translational levels of the A6PE and A6PP genes are precisely regulated to achieve expression balance and maximize pathway throughput.

[0069] Preferably, the A6PE gene is the AlsE gene from Escherichia coli (GenBank accession number: NP_418509.1), and the A6PP gene is the CtA6PP gene from Clostridium thermocellum (GenBank accession number: WP_003512401.1).

[0070] Preferably, the promoter is selected from the constitutive promoter P. J23119 P J23100 P J23107 or inductive promoter P tac P trc One or more of them.

[0071] Preferably, the RBS sequence is selected from one or more of RBS29 (GTTCACACAGGAAACC, SEQ ID NO. 11), RBS30 (GATTAAGAGGAGAAA, SEQ ID NO. 12), RBS31 (GTCACACAGGAAACC, SEQ ID NO. 13), RBS32 (GTCACACAGGAAAG, SEQ ID NO. 14) or RBST7 (AAGAAGGAGA, SEQ ID NO. 15).

[0072] In practice, the method for constructing the above-mentioned genetically engineered strains includes the following steps:

[0073] Step 1: Construction of recombinant plasmids

[0074] AlsE (GenBank: NP_418509.1) from Escherichia coli, with the nucleotide sequence shown in SEQ ID NO.1; PspA6PE (GenBank: WP_039379501.1) from Pantoea, with the nucleotide sequence shown in SEQ ID NO. 2 (codon optimized); and TtA6PE (GenBank: WP_013298194.1) from pyrolytic anaerobic bacteria, with the nucleotide sequence shown in SEQ ID NO. 3 (codon optimized), were cloned into the expression vector pETDuet-1. HxpB (GenBank: NP_416241.1), an endogenous gene from *E. coli*, with the nucleotide sequence shown in SEQ ID NO. 4, and CtA6PP (GenBank: WP_003512401.1), a gene from *Clostridium thermocellum*, with the nucleotide sequence shown in SEQ ID NO. 5 (codon optimized), were cloned into pCDFDuet-1 to construct recombinant plasmids pET-AlsE, pET-PspA6PE, pET-TtA6PE, pCD-HxpB, and pCD-CtA6PP.

[0075] Step 2: Competitive gene knockout

[0076] Using the CRISPR / Cpf1 system, the pgm, zwf, pfkA, and rpiB genes were knocked out sequentially.

[0077] Step 3: Start the sub-project

[0078] Using reverse PCR technology, the original promoter was replaced with promoters of different strengths to construct a 5*5 promoter library; preferably, the promoters were selected from promoter P. J23119 The nucleotide sequence is shown in SEQ ID NO. 6, P J23100 The nucleotide sequence is shown in SEQ ID NO. 7, P J23100 The nucleotide sequence is shown in SEQ ID NO. 8, P J23107 The nucleotide sequence is shown in SEQ ID NO. 9, P tac The nucleotide sequence is shown in SEQ ID NO. 10.

[0079] Step 4: RBS Optimization

[0080] By using point-to-point replacement, the original RBS sequence is replaced with RBS sequences of different intensities to construct a 5*5 RBS library;

[0081] Step 5: Strain Screening

[0082] By combining promoters with RBS, multiple engineered strains were constructed, and high-yield strains were obtained through in vitro fermentation screening.

[0083] Step 6: Fermentation Verification

[0084] The selected strains were validated through fed-batch fermentation to assess their production performance.

[0085] In practice, the application of the above-mentioned strains in the fermentation production of D-allulose includes the following steps:

[0086] Fermentation culture: Inoculate the cells into M9-YE-Glucose medium (containing 20 g / L glucose and 10 g / L yeast extract) and incubate at 37°C until OD500. 600 ≈0.6, add 0.5 mM IPTG for induction;

[0087] Induction of expression: Incubate at 30℃ and 200 rpm for another 72 h;

[0088] Product detection: The content of D-allulose in the fermentation broth was detected by HPLC.

[0089] In practice, the aforementioned efficient fermentation process for producing D-allulose includes using the aforementioned genetically engineered strain and conducting fed-batch fermentation in a 5 L fermenter. Specifically, this includes: initial culture medium: M9 medium supplemented with 10 g / L yeast extract; culture conditions: temperature 37℃, pH 6.8, dissolved oxygen maintained at 40%; feeding strategy: after 4 h of fermentation, glucose is continuously added to maintain its concentration at 8-12 g / L; induction timing: when OD... 600 When the temperature reaches 25°C, 0.5 mM IPTG is added for induction; fermentation period: 52 h, and the final D-allulose yield can reach 33.05 g / L.

[0090] This invention utilizes a full-chain metabolic engineering strategy of "enzyme screening - pathway blocking - expression optimization - process scale-up" to construct a high-yield, stable, and easily industrially scaled-up D-allulose-producing strain, providing an efficient, economical, and sustainable technical solution for the green biomanufacturing of D-allulose.

[0091] The plasmids, restriction enzymes, PCR enzymes, column-based DNA extraction kits, and DNA gel recovery kits used in this invention are commercially available products, and the specific operations were performed according to the kit instructions. Conventional procedures such as colony PCR, nucleic acid agarose gel electrophoresis, protein SDS-PAGE gel electrophoresis, heat shock transformation, electrotransformation, preparation of competent cells, and extraction and preservation of bacterial genomes were performed according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0092] The culture medium involved in this invention includes:

[0093] (1) LB liquid medium: yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L.

[0094] (2) LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder.

[0095] (3) M9-YE-Glucose medium: 33.7 mM disodium hydrogen phosphate, 22 mM potassium dihydrogen phosphate, 8.6 mM sodium chloride, 9.4 mM ammonium chloride, 2 mM magnesium sulfate heptahydrate, 0.1 mM calcium chloride, 10 g / L yeast extract and 20 g / L glucose; the A5 trace metals added to M9 were 2.86 mg / L boric acid, 1.81 mg / L manganese chloride tetrahydrate, 0.079 mg / L copper sulfate pentahydrate and 49.4 µg / L cobalt nitrate hexahydrate.

[0096] The antibiotic concentrations involved are: kanamycin 50 mg / L, spectinomycin 50 mg / L, ampicillin 100 mg / L, and streptomycin 50 mg / L.

[0097] Fermentation production of D-allulose: The constructed strain was inoculated into 4 mL of M9-YE-Glucose liquid medium (antibiotic-free or containing the corresponding antibiotic) and cultured at 37°C and 200 rpm until OD500 was reached. 600 The concentration was 0.6, and IPTG was added to a final concentration of 0.5 mM. The mixture was then induced and cultured at 30°C and 200 rpm for 72 h.

[0098] Detection of D-allulose: The final fermentation broth was centrifuged, and the supernatant was filtered off to prepare a sample for the quantification of extracellular metabolites. The optical density (OD) was measured at 600 nm using a spectrophotometer. 600 Cell growth was monitored. Simultaneously, the concentrations of D-allulose and D-glucose in the supernatant were determined by high-performance liquid chromatography (HPLC). HPLC analysis used a 300 mm × 6.5 mm column, maintained at 85 °C, with a mobile phase of 0.122 mM / L EDTA-Ca and a flow rate of 0.4 mL / min. The yield of D-allulose in the fermentation system was calculated by substituting the D-allulose standard curve.

[0099] The plasmids involved in this invention are shown in Table 1.

[0100] Table 1: Plasmids involved in this invention

[0101]

[0102]

[0103]

[0104] The strains involved in this invention are shown in Table 2.

[0105] Table 2: Strains involved in this invention

[0106]

[0107]

[0108]

[0109] The primers involved in this invention are shown in Table 3.

[0110] Table 3: Statistics of Selected Primers

[0111]

[0112]

[0113]

[0114]

[0115] The promoter sequences involved are as follows.

[0116] SEQ ID NO. 1:

[0117] Atgaaaatctccccctcgttaatgtgtatggatctgctgaaatttaaagaacagatcgaatttatcgacagccatgccgattacttccacatcgatatcatggacggtcactttgtccccaatctgacactctcaccgttcttcgtaagtcaggttaaaaaactggcaactaaaccgctcgactgtcatctgatggtgacgcggccgcaggattacattgctcaactggcgcgtgcgggagcagatttcatcactctgcatccggaaaccatcaacggccaggcgttccgcctgattgatgaaatccgccgtcatgacatgaaagtggggctgatccttaacccggagacgccagttgaggccatgaaatactatatccataaggccgataaaattacggtcatgactgtcgatcccggctttgccggacaaccgttcattcctgaaatgctggataaacttgccgaactgaaggcatggcgtgaacgagaaggtctggagtacgaaattgaggtggacggttcctgcaaccaggcaacttacgaaaaactgatggcggcaggggcggatgtctttatcgtcggcacttccggcctgtttaatcatgcggaaaatatcgacgaagcatggagaattatgaccgcgcagattctggctgcaaaaagcgaggtacagcctcatgcaaaaacagcataa;

[0118] SEQ ID NO. 2:

[0119] ATGCGTATCCAAATTAGCCCGTCTCTGATGTGTATGAATCTGATGGAGATTAAACATCAGCTGCAGGTTCTGGATTCTCGCGCGGACTTCCTGCACGTGGACATTATGGATGGCCACTACGTGAAAAACATCACCCTGTCTCCGTTCTTCATCGAACAGATCCGCCCGTACACTCGCGTTACCATCGACGTTCACCTGATGGTTGAAGAACCGACTGATTTCATTGAAGCTGTAGCCCGCGCAGGTGCCGACTACATCTGCCCGCACGCTGAAACTATCAACCGCGATGCGTTCCGTGTGATTAATCTGATCCGTTCTTTCGGCAAGAAAGTTGGCGTGGTACTGAATCCAGCGACTCCTGTCAGCTTTATCCAGCACTATATCCATCTGCTGGATAAGATCACCGTAATGACTGTGGACCCGGGTTACGCGGGCCAGCCGTTCATCCCGGAAATGGTGGAGAAAGTGCGTGAACTGAAAACCCTGAAACAGCAGCACGGCTATCACTACCTGGTTGAAATTGACGGTTCTTGCAACACCCGTACCTACAACCAACTGATCGGTGCAGGTGCAGAGGTTCTGATCGTTGGCACCAGCGGCCTGTTCAATATTCACGATGACCTGGCAACCGCCTGGGAAATGATGCGTGATTCCATCGATGAAGCTCAAGGTCTGACCCAGGTATCTGCCTAA;

[0120] SEQ ID NO. 3:

[0121] ATGAAATATCTGTTTTCTCCGAGCCTGATGTGCATGAACCTGATTAAACTGAACGAGCAGATTAGCGTTCTGAACAGCAAAGCAGATTTCCTGCACGTAGACATCATGGACGGCCACTTTGTGAAAAACATCACCCTGAGCCCATTCTTCATCGAACAAATCAAATCCTACGTGAACATTCCGATCGATGCGCACCTGATGGTGGAAAACCCGGGCGATTACATCGAAATCTGTGAAAAAAGCGGTGCTAGCTTTATCACCATCCACGCTGAGACCATCAACCGCGAGGCATTCCGTATCATCGACCGTATTAAATCTCACGGCCTGATGGTGGGTATCGCGCTGAATCCAGCCACTCCGATCTCCGAGATTAAGCACTACATCAACAAAATCGACAAGATCACCATCATGACTGTTGACCCAGGTTTCGCAGGTCAACCATTTATTCCGGAAGTTCTGGAAAAGATCCGTGACCTGAAACGTCTGAAAGATGACAACAACTACAACTACCTGATCGAGGCGGACGGCTCTTGCAACAAAAACACCTTCCAAGTGCTGAAAGACGCCGGTTGCAAGGTTTTTGTGCTGGGCAGCTCCGGTCTGTTCAACCTGTCTGACGATCTGGGTAAAGCATGGGAAATCATGATCGGTAACTTCAACGGTTAA;

[0122] SEQ ID NO. 4:

[0123] atgtcaaccccgcgtcagattcttgctgcaatttttgatatggatggattacttatcgactcagaacctttatgggatcgagccgaactggatgtgatggcaagcctgggggtggatatctcccgtcgtaacgagctgccggacaccttaggtttacgcatcgatatggtggtcgatctttggtacgcccggcaaccgtggaatgggccaagccgtcaggaagtagtagaacgggttattgcccgtgccatttcactggttgaagagacacgtccattattaccaggcgtgcgcgaagccgttgcgttatgcaaagaacaaggtttattggtgggactggcctccgcgtcaccactacatatgctggaaaaagtgttgaccatgtttgacttacgcgacagtttcgatgccctcgcctcggccgaaaaactgccttacagcaagccgcatccgcaagtatatctcgactgcgcagcaaaactgggcgttgaccctctgacctgcgtagcgctggaagattcggtaaatggcatgatcgcctctaaagcagcccgcatgcgttccatcgtcgttcctgcgccagaagcgcaaaatgatccacgttttgtattagcagacgtcaaactttcatcgctgacagaactcaccgcaaaagaccttctcggttaa;

[0124] SEQ ID NO. 5:

[0125] ATGATAAAGTATAAAGCTGTATTTTTCGATTTCGACTACACCCTGGCGGATTCGAGCAAAGCTGTGATTGAGTGCATTAACTATGCGCTGCAAAAGATGGGCTATCCGGAATCCTCCCCGGAGAGCATTTGTCGTACGATTGGTTTGACCCTGGCAGAAGCATTTAAGATCCTGAGCGGCGATACCAGCGATTCTAATGCCGACTTGTTCCGCCAGTACTTCAAAGAACGTGCAGACTTAGTCATGTGCGATCGTACGGTCATGTATTCCACCGTGGAATGCGTTCTGAAGAAGCTGAAAAAGGCTGACGTGAAGACCGGCATCGTTAGCACCAAATACCGCTACCGCATTGAGGACATCCTGAAGCGTGATAAACTGCTTCAATACTTTGATGTGATCGTGGGCGGTGAAGACGTCGCGGCGCACAAACCAGATCCGGAGGGTCTGCTGAAGGCGATCAGTATGGTGGGTTGTCAGAAAGAGGAAGTTCTGTTCGTTGGCGATAGCACTGTAGACGCACGTACCGCGAAAAACGCGGGTGTTGACTTCGTGGCCGTTCTCACTGGTACGACCGGTGCTAATGAATTTAGCGAGTATAACCCGGGTGCCGTTATCGAGGATTTGTCTGGCCTATTGGACATGTTTATGCTGTAA;

[0126] SEQ ID NO. 6:

[0127] Tctgtgcggtatttcacaccgcatatgctggatccttgacagctagctcagtcctaggtataatgctagc;

[0128] SEQ ID NO. 7:

[0129] TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC;

[0130] SEQ ID NO. 8:

[0131] TTTACGGCTAGCTCAGCCCTAGGTATTATGCTAGC;

[0132] SEQ ID NO. 9:

[0133] Catcataacggttctggcaaatattctgaaatgagctgttgacaattaatcatcggctcgtataatgtgt;

[0134] SEQ ID NO. 10:

[0135] ttgacaattaatcatccggctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagacc.

[0136] In the above sequences, lowercase letters represent endogenous genes that have not undergone codon optimization; uppercase letters represent exogenous genes that are nucleotide sequences synthesized based on the original GenBank sequences after codon optimization.

[0137] The present invention will be further illustrated below with reference to the embodiments.

[0138] Example 1: Construction of recombinant plasmids

[0139] Three D-allulose-6-phosphate-3-epimerase genes (A6PE) and two D-allulose-6-phosphate phosphatase genes (A6PP) from different sources were screened and introduced into Escherichia coli BL21(DE3) to construct six strains.

[0140] (1) Import pET-P J23119 -AlsE and pCD-P J23119 -HxpB yielded strain BL-01.

[0141] (2) Import pET-P J23119 -AlsE and pCD-P J23119 -CtA6PP was used to obtain strain BL-02.

[0142] (3) Import pET-P J23119 -PspA6PE and pCD-P J23119 -HxpB yielded strain BL-03.

[0143] (4) Import pET-P J23119 -PspA6PE and pCD-P J23119 -CtA6PP was used to obtain strain BL-04.

[0144] (5) Import pET-P J23119 -TtA6PE and pCD-PJ23119 -HxpB yielded strain BL-05.

[0145] (6) Import pET-P J23119 -TtA6PE and pCD-P J23119 -CtA6PP was used to obtain strain BL-06.

[0146] The following steps, using strain BL-01 as an example, illustrate the specific steps:

[0147] Step 1-1: Using primers AlsE-F / R, the endogenous gene AlsE in E. coli was amplified by PCR to obtain the AlsE fragment, which was cloned into MCS1 of the vector pETDuet-1. The PCR product was then transformed into competent E. coli JM109 cells using chemical transformation. The cells were then plated on LB solid medium containing ampicillin and cultured at 37°C for 8-12 h. Single colonies were picked and expanded, and plasmids were extracted and sequenced.

[0148] Steps 1-2: Using reverse PCR with primers pET-J23119-F / R, replace the original promoter of MCS1 in pET-AlsE with P J23119 The PCR product was chemically transformed into competent *E. coli* JM109 cells, then plated on LB agar containing ampicillin and incubated at 37°C for 8–12 h. Single colonies were picked and expanded, plasmids were extracted, and sequenced. pCD-P was obtained using the same method. J23119 -HxpB.

[0149] Steps 1-3: Add plasmid pET-P J23119 -AlsE and pCD-P J23119 -HxpB was transformed into Escherichia coli strain BL21(DE3) by chemical transformation, spread on LB solid medium containing ampicillin and streptomycin, and cultured at 37°C for 12 h. The bacteria that grew after resistance screening were strain BL-01.

[0150] Example 2: Competitive Gene Knockout

[0151] Using CRISPR / Cpf1 gene editing technology, the following genes were knocked out: pgm (encoding glucose-6-phosphate dehydrogenase), zwf (encoding glucose-6-phosphate dehydrogenase), pfkA (encoding 6-phosphofructokinase I), and rpiB (encoding L-ribose-5-phosphate isomerase B). Specifically:

[0152] (1) Knock out the pgm gene encoding phosphoglucose mutase in Escherichia coli BL21(DE3) and introduce pET-P J23119 -AlsE and pCD-P J23119-CtA6PP yielded strain BL-07;

[0153] (2) Knock out the zwf gene encoding glucose-6-phosphate dehydrogenase in Escherichia coli BL21(DE3) and introduce pET-P J23119 -AlsE and pCD-P J23119 -CtA6PP yielded strain BL-08;

[0154] (3) Knock out the pfkA gene encoding 6-phosphofructokinase I in Escherichia coli BL21(DE3) and introduce pET-P J23119 -AlsE and pCD-P J23119 -CtA6PP yielded strain BL-09;

[0155] (4) Knock out the rpiB gene encoding L-ribose-5-phosphate isomerase B in Escherichia coli BL21(DE3) and introduce pET-P J23119 -AlsE and pCD-P J23119 -CtA6PP yielded strain BL-010.

[0156] The following section uses strain BL-07, which has the pgm gene knocked out, as an example to illustrate the specific steps:

[0157] Step 2-1: Using the Escherichia coli BL21(DE3) genome as a template, the upstream and downstream fragments of the pgm gene were amplified by PCR using primers Δpgm-UP-F / R and Δpgm-DH-F / R, and the fragments were purified by gel recovery; the fragments obtained by ligating the upstream and downstream amplifications by overlapping PCR were used as donor DNA fragments.

[0158] Step 2-2: The plasmid containing pEcCpf1 was chemically transformed into Escherichia coli strain BL21(DE3) to prepare electrocompetent cells;

[0159] Steps 2-3: Using PCR amplification technology, with pgm-FN23-F / R as primers, the N23 sequence on plasmid pcrEG was replaced with a specific 23 bp sequence on the pgm gene (designed by the website CRISPR RGEN). The PCR product was used to remove the original plasmid template DNA with DpnI enzyme, and then transformed into E. coli JM109 competent cells using the heat shock transformation method. After being plated on LB solid medium containing spectinomycin and cultured at 37°C for 8-12 h, single colonies were picked for expansion culture, plasmid was extracted and sequenced to obtain the plasmid pcrEG-pgm carrying the target pgm.

[0160] Steps 2-4: Electroporate the pcrEG-pgm plasmid and the fragment obtained in step 2-1 into Escherichia coli BL21(DE3) electrocompetent cells, plate them on LB solid medium containing kanamycin and spectinomycin, incubate at 37°C for 12 h, and perform PCR colony verification to obtain positive clone colonies.

[0161] Steps 2-5: Pick the positive clones from Step 2-4 into 4 mL of LB liquid medium containing a final concentration of 10 mM rhamnose and 4 μL Kan, and incubate at 37°C for 12 h to remove the pcrEG-pgm plasmid, obtaining E. coli strain B1 containing the pEcCpf1 plasmid with the pgm gene knocked out, which will be used for the next round of knockout.

[0162] Steps 2-6: The bacteria with successfully removed pcrEG-pgm plasmid were inoculated into liquid LB medium containing 5 g / L glucose and cultured at 37°C and 200 rpm for 12 h. Then, about 5 μL of the bacterial culture was streaked onto a plate containing 5 g / L glucose and 10 g / L sucrose and cultured at 37°C for 12 h. This process removed the pEcCpf1 plasmid, resulting in the pgm gene-knockout E. coli strain B1.

[0163] Steps 2-7: Add plasmid pET-P J23119 -AlsE and pCD-P J23119 -CtA6PP was transformed into Escherichia coli strain B1 by chemical transformation, spread on LB solid medium containing ampicillin and streptomycin, and cultured at 37°C for 12 h. The bacteria that grew after resistance screening were strains BL-07.

[0164] Example 3: Startup Sub-project

[0165] Five promoters with different transcription strengths, P, were selected. J23119 P J23100 P J23107 P tac P trc A 5x5 strain library (BL-10 ~ BL-34) was obtained through permutation and combination, as shown in Table 2. The specific steps are as follows:

[0166] Step 3-1: Same as step 1, obtain pET-P J23119 / P J23100 , / P J23107 / P tac / P trc -AlsE and pCD- P J23119 / P J23100 / P J23107 / P tac / P trc -CtA6PP;

[0167] Step 3-2: Combine the plasmids from Step 3-1 in pairs and transform them into Escherichia coli strain B4 through chemical transformation. Spread the mixture on LB solid medium containing ampicillin and streptomycin and incubate at 37°C for 12 h. The bacteria that grow after resistance screening are strains BL-10 to BL-34.

[0168] Example 4: RBS Optimization

[0169] Five strains of RBS29 / RBS30 / RBS31 / RBS32 / RBST7 with different translation intensities were selected, and 5*5 strain libraries (BL-35 ~ BL-59) were obtained through permutation and combination, as shown in Table 2. The specific steps are as follows:

[0170] Step 4-1: Using primer pET-J23119-RBS29-AlsE-F / R reverse PCR technology, pET-P J23119 -The original RBS of MCS1 in AlsE was replaced with RBS29. The PCR product was transformed into E. coli JM109 competent cells using the heat shock transformation method, and then plated on LB solid medium containing ampicillin and incubated at 37°C for 8-12 h. Single colonies were picked and expanded, and plasmids were extracted and sequenced to obtain pET-P. J23119 -RBS29-AlsE. Similarly, pET-P was obtained. J23119 -RBS29 / RBS30 / RBS31 / RBS32 / RBST7-AlsE and pCD-P trc -RBS29 / RBS30 / RBS31 / RBS32 / RBST7-CtA6PP.

[0171] Step 4-2: Combine the plasmids from Step 4-1 in pairs and transform them into Escherichia coli strain B4 through chemical transformation. Spread the mixture on LB solid medium containing ampicillin and streptomycin and incubate at 37°C for 12 h. The bacteria that grow after resistance screening are strains BL-35 to BL-59.

[0172] Example 5: Strain Screening

[0173] I. In vitro culture method

[0174] The strains were inoculated into 4 mL of M9-YE-Glucose liquid medium containing ampicillin and streptomycin, respectively, and cultured at 37°C and 200 rpm until OD500. 600 The concentration was 0.6-0.8, and IPTG was added to a final concentration of 0.5 mM for induction. The temperature of all strains was lowered to 30℃ and induction culture was continued at 200 rpm for 72 h.

[0175] The D-allulose content in the fermentation system was detected, and the yield of D-allulose in the fermentation system was calculated. The results are shown in [the table below]. Figures 1-4 .

[0176] II. Results Analysis

[0177] 1. From Figure 1 It can be seen that after 72 h of induction, the D-allulose yields of strains BL-01, BL-02, BL-03, BL-04, BL-05, and BL-06 were 60 mg / L, 320 mg / L, 80 mg / L, 52 mg / L, 143 mg / L, and 123 mg / L, respectively. Among them, strain BL-02 had the highest D-allulose yield, OD... 600 It is 4.36.

[0178] 2. From Figure 2 It can be seen that the D-allulose yields of the initial strain BL-02 and strains BL-07, BL-08, BL-09, and BL-10 (which had genes knocked out in different competing pathways) were 320 mg / L, 402 mg / L, 435 mg / L, 560 mg / L, and 720 mg / L, respectively. Among them, strain BL-10, which simultaneously knocked out pgm, zwf, pfkA, and rpiB, had the highest yield and OD... 600 It is 4.07.

[0179] 3. From Figure 3 It can be seen that different promoter combinations at the transcriptional level also affect the production of D-allulose. The D-allulose production of strains BL-10 to BL-34 were 0.72 g / L, 2.05 g / L, 0.33 g / L, 0.43 g / L, 2.92 g / L, 0.14 g / L, 1.52 g / L, 0.87 g / L, 0.52 g / L, 0.87 g / L, 0.15 g / L, 0.14 g / L, 0.02 g / L, 0.63 g / L, 0.06 g / L, 0.39 g / L, 0.74 g / L, 0.42 g / L, 0.24 g / L, 1.47 g / L, 0.16 g / L, 1.45 g / L, 0.27 g / L, 1.52 g / L, and 1.50 g / L, respectively. g / L, with strain BL-14 having the highest yield, OD 600 It is 3.74.

[0180] 4. From Figure 4It can be seen that different promoter combinations at different translation levels also affect the production of D-allulose. The D-allulose production of strains BL-35~BL-59 were 2.06 g / L, 2.05 g / L, 1.06 g / L, 2.16 g / L, 1.65 g / L, 2.46 g / L, 2.01 g / L, 2.07 g / L, 1.94 g / L, 1.45 g / L, 0.55 g / L, 3.29 g / L, 1.06 g / L, 0.65 g / L, 0.58 g / L, 4.57 g / L, 2.14 g / L, 1.08 g / L, 2.20 g / L, 3.66 g / L, 3.34 g / L, 2.57 g / L, 1.62 g / L, 5.26 g / L, and 2.65 g / L, respectively. g / L, with strain BL-58 having the highest yield, OD 600 It is 3.53.

[0181] Example 6: Fed-batch fermentation culture

[0182] I. Method of Staged Shake Flask Fermentation Culture

[0183] Fed-batch fermentation was performed in a 5 L fermenter to further validate the modified strain. 2 L of M9-YE-Glucose liquid medium was added to the reactor, then sterilized at 115°C for 30 min, and cooled to 37°C before commissioning. Before inoculation, the pH of the medium was adjusted to approximately 6.8 by adding 50% (v / v) ammonia, maintaining a dissolved oxygen level of approximately 40%, and the agitation speed was automatically correlated. Using flame inoculation, 10% (v / v) of the seed culture was inoculated into the fermenter. The entire fermentation process was carried out at 37°C, with D-glucose as the sole carbon source. When OD... 600 When the concentration reached 25, IPTG was added to a final concentration of 0.5 mM to induce dual plasmid expression.

[0184] II. Results Analysis

[0185] The optimal engineered strain BL-58 was cultured in a 5-L bioreactor using a batch feed method. After 4 hours of culture, D-glucose was continuously supplied to maintain its concentration at 8–12 g / L. The fermentation process was monitored for over 52 hours. Figure 5 As shown by the red arrow in the middle, when OD 600 When the concentration reached 25, IPTG was added to a final concentration of 0.5 mM. During the initial 24 hours, OD... 600 The concentration gradually increases to over 40, after which cell growth slows significantly. For example... Figure 5 As shown by the black arrow, adding 5 g / L of yeast extract to enhance culture viability ultimately led to increased OD. 600The yield of D-allulose reached a peak of 53 g / L during fermentation. The yield of D-allulose steadily increased during fermentation, reaching a maximum of 33.05 g / L at 52 h.

[0186] Therefore, the strain BL-58 constructed in this invention can achieve efficient conversion of D-glucose to D-allulose, and has the advantages of high yield, stability and easy scale-up, making it suitable for industrial production of D-allulose.

[0187] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A genetically engineered strain, characterized in that, include: (I) D-allulose-6-phosphate-3-epimerase gene; and / or (II) D-allulose-6-phosphate phosphatase gene; Not included: (i) phosphoglucosuric enzyme gene; and / or (ii) Glucose-6-phosphate dehydrogenase gene; and / or (iii) 6-phosphofructokinase I gene; and / or (iv) L-ribose-5-phosphate isomerase B gene; The chassis strain of the genetically engineered strain is Escherichia coli BL21(DE3).

2. The genetically engineered strain as described in claim 1, characterized in that, Starting with Escherichia coli BL21(DE3) as the starting strain, the following modifications were made: (a) Introducing the D-allulose-6-phosphate-3-epimerase gene and the D-allulose-6-phosphate phosphatase gene; (b) Knock out one or more genes that compete with sugar phosphate intermediates for metabolism, wherein the genes that compete with sugar phosphate intermediates for metabolism are selected from at least one of the following: glucose-6-phosphate dehydrogenase gene, fructose-6-phosphate kinase I gene, and L-ribose-5-phosphate isomerase B gene; (c) The expression levels of the D-allulose-6-phosphate-3-epimerase gene and the D-allulose-6-phosphate phosphatase gene are regulated by promoter engineering and ribosome binding site engineering.

3. The genetically engineered strain as described in claim 1, characterized in that, include: The D-allulose-6-phosphate-3-epimerase gene is the AlsE gene from Escherichia coli; The D-alokulose-6-phosphate phosphatase gene is the CtA6PP gene from Clostridium thermocellum; The phosphoglucoside mutase gene is the pgm gene from Escherichia coli; The glucose-6-phosphate dehydrogenase gene is the zwf gene from Escherichia coli; The 6-phosphofructokinase I gene is the pfkA gene from Escherichia coli; The L-ribose-5-phosphate isomerase B gene is the rpiB gene from Escherichia coli.

4. The genetically engineered strain as described in claim 2, characterized in that, include: The expression level regulation includes the selection of P J23119 P J23100 P J23107 P tac P trc Regulation by at least one promoter; The expression level regulation includes regulation using at least one RBS sequence selected from RBS29, RBS30, RBS31, RBS32, and RBST7.

5. The genetically engineered strain as described in claim 2, characterized in that, The knockout order of the genes related to the competitive metabolism of sugar phosphate intermediates is as follows: knock out the pgm gene, the zwf gene, the pfkA gene, and the rpiB gene in sequence.

6. The genetically engineered strain as described in claim 1 or 2, characterized in that, include: The transcription of the D-allulose-6-phosphate-3-epimerase gene is initiated by the promoter P. J23119 Translation is controlled by the RBS sequence RBST7; The transcription of the D-allulose-6-phosphate phosphatase gene is initiated by the promoter P. trc Translation is controlled by the RBS sequence RBS32.

7. The method for constructing the genetically engineered strain according to any one of claims 1 to 6, characterized in that, include: Construct recombinant plasmids expressing AlsE and CtA6PP; The recombinant plasmid was transformed into Escherichia coli BL21(DE3); The pgm, zwf, pfkA and rpiB genes of the *E. coli* BL21(DE3) were sequentially knocked out using the CRISPR / Cpf1 system to obtain the genetically engineered strain.

8. The construction method as described in claim 7, characterized in that, The recombinant plasmid is pET-P J23119 -AlsE and pCD-P trc -CtA6PP.

9. A method for producing D-allulose, characterized in that, Production based on the genetically engineered strains according to any one of claims 1 to 6.

10. The production method as described in claim 9, characterized in that, include: The genetically engineered strain was inoculated into a carbon-containing medium and cultured to the logarithmic growth phase. IPTG, an inducer, was added, and fermentation was carried out. The fermentation broth was collected, and D-allulose was isolated. The carbon source is D-glucose, with an initial concentration of 20 g / L; The fermentation was carried out in a 5 L fermenter, with the glucose concentration maintained at 8-12 g / L.