Peanut plant type regulation gene ah erect1 and its mutants and application

Abstract

This invention belongs to the fields of molecular genetics and genetic engineering, and discloses a peanut plant type regulating gene, AhERECT1, its mutants, and their applications. The nucleotide sequence of the peanut plant type regulating gene AhERECT1 is shown in SEQ ID NO.1. Its mutant is caused by a single amino acid deletion due to the deletion of nucleotides 38-40 (CTC) in the open reading frame of the gene shown in SEQ ID NO.1, and its nucleotide sequence is shown in SEQ ID NO.2. This invention obtained the AhERECT1 gene through linkage mapping, fine mapping, and transcriptome analysis. Using CRISPR / Cas9 gene editing technology, the erect peanut variety Yuhua 9326 was successfully modified into a semi-vine type through targeted editing. The gene and its mutants of this invention provide key gene resources and efficient technical support for the precise improvement of peanut plant type, and can be widely applied to the breeding of peanut varieties with different plant types, which is of great significance for improving peanut yield and quality.

Description

Technical Field

[0001] This invention belongs to the fields of molecular genetics and genetic engineering technology, specifically relating to AhERECT1, a gene that regulates the growth habits of peanut lateral branches, a method for constructing its mutants, and the application of this gene in the genetic improvement of peanut plant type and molecular breeding. Background Technology

[0002] Peanuts are an important oilseed and economic crop worldwide. The cultivated peanut genome is allotetraploid (AABB), with two wild donor species being AA and BB diploids, respectively. Based on the growth habits of the first pair of lateral branches, cultivated peanut plants can be classified into four types: vining, semi-vining, upright and loose, and upright. Peanuts are a crop that flowers above ground and fruits underground. Plant type is closely related to the timing and concentration of the peanut pegs entering the soil, thus affecting the pod growth cycle and development, ultimately impacting yield and quality. Therefore, plant type is an important biological and agronomic trait of peanuts. Cloning and genetic studies of related genes are crucial for revealing the evolutionary process of peanuts and for improving peanut plant type through molecular breeding, thereby increasing peanut yield.

[0003] Currently, significant progress has been made in the genetic basis of plant architecture in monocotyledonous crops such as rice and maize. A number of key regulatory genes (such as sd1 in rice and tb1 in maize) have been cloned and successfully applied to molecular breeding. However, research on peanut plant architecture started later. Due to its complex tetraploid genome, there are no reports of cloning, functional verification, or application of peanut plant architecture-related genes in existing technologies, and the molecular mechanisms controlling peanut plant architecture remain unclear.

[0004] Therefore, cloning key genes regulating peanut plant architecture and establishing a precision improvement technology system based on gene editing are of great theoretical and practical significance for shortening the breeding cycle, improving the efficiency of plant architecture improvement, and cultivating high-yield and high-quality new peanut varieties. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a key gene AhERECT1 that regulates peanut plant architecture and its mutants, clarifying the effects of mutants and mutation sites on plant architecture;

[0006] This invention also provides the application of the AhERECT1 gene and its mutants in peanut plant architecture improvement and molecular breeding.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] AhERECT1, a peanut plant type regulatory gene, has the nucleotide sequence shown in SEQ ID NO.1.

[0009] A mutant gene regulating peanut plant type is described, which involves a CTC deletion of nucleotides 38-40 in the open reading frame of the gene AhERECT1, resulting in a deletion of one amino acid. Its nucleotide sequence is shown in SEQ ID NO.2.

[0010] A peanut plant or its seeds containing the mutated gene.

[0011] A CRISPR / Cas9 system for knocking out the peanut AhERECT1 gene, wherein the sgRNA target sequence of the system is GTTTTGGTGTGGTTGAGTCAT.

[0012] The application of the AhERECT1 gene or the mutant gene described herein in regulating peanut plant architecture.

[0013] The application of the AhERECT1 gene or its mutant gene in the breeding of peanut varieties with different plant types.

[0014] Beneficial effects of the present invention

[0015] (1) This invention cloned and verified AhERECT1, a key gene for regulating peanut plant type, for the first time, and clarified the function of this gene in regulating the growth habit of peanut lateral branches, filling the gap in the molecular genetic research of peanut plant type.

[0016] (2) This invention obtained a specific mutant of the AhERECT1 gene. By deleting 3 bp to cause amino acid deletion or 1 bp to cause frameshift mutation, it can stably transform upright peanut into semi-vine type, providing a clear molecular target for peanut plant type improvement.

[0017] (3) This invention establishes a precise editing system for peanut plant type based on CRISPR / Cas9 technology. It is efficient and stable in operation, and can significantly shorten the breeding cycle (from 5-8 years to 2-3 years) compared with traditional breeding.

[0018] (4) The gene and its mutants of the present invention can be applied to the improvement of plant type of different peanut varieties. According to production needs, varieties with upright, semi-vine and other plant types can be cultivated, which has important application value for improving peanut yield and resource utilization efficiency. Attached Figure Description

[0019] Figure 1 A map of the peanut CRISPR / Cas9 knockout vector;

[0020] Figure 2 Genotyping results of AhERECT1 gene knockout lines T1 and T3;

[0021] In the figure, A represents the mutant genotype of single plant g01059(5)-1A-5, and B represents the mutant genotype of single plant IIg01059(5-1). The base deletion positions are referenced to the target sequence of wild-type Yuhua 9326.

[0022] Figure 3 AhERECT1 gene knockout mutant strains;

[0023] In the figure, A: T1 generation mutant single plant g01059(5-1) (semi-vine type), B: T3 generation mutant single plant g01059(5)-1A-5 (semi-vine type), C: control Yuhua 9326 (upright type). Detailed Implementation

[0024] The technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0025] Unless otherwise specified, the instruments and equipment used in the examples are conventional instruments and equipment, the reagents are commercially available analytical grade reagents, and the experimental methods are conventional molecular biology and plant tissue culture methods.

[0026] Example 1: Fine mapping and cloning of QTL regions for the Arahy15 chromosome strain in peanut.

[0027] This invention utilizes the upright parent Yuhua 15 and the creeping parent W1202, and the upright parent Yuanza 9102 and the upright and loose parent wt09-0023 to construct recombinant inbred line populations (RILs). Through linkage and fine mapping, combined with candidate gene sequence difference analysis and transcriptome analysis among the parents, AhERECT1 was identified as a candidate gene for the chromosome Arahy15 plant type QTL.

[0028] QTL mapping: Peanut cultivar plant types can be divided into four categories, including erect, erect-loose, semi-vine, and vine. Based on the QTL interval of plant type on chromosome Arahy15, 13 SNP markers were designed (Table 1). Genotyping and phenotypic association analysis (GWAS GLM model) were performed on 226 natural populations. It was found that SNP markers adjacent to gene Arahy.QV02Z8 (such as P1273A26, P1273A29, etc.) were significantly associated with peanut plant type (corrected P value = 3.95E-05).

[0029] Table 1. SNPs that significantly correlate with Arahy15 chromosome QTL regions and peanut growth habits.

[0030]

[0031] Candidate gene screening: Based on sequence difference analysis between parents and transcriptome data, Arahy.QV02Z8 (encoding GA20 oxidase 2) was identified as a candidate gene and named AhERECT1.

[0032] Gene cloning: Three pairs of specific primers were designed (Table 2). Using the genomic DNA of *Yuhua 9326* as a template, PCR amplification was performed, followed by sequencing to obtain the full-length sequence of the AhERECT1 gene (SEQ ID NO.1). The amplification system and conditions are as follows:

[0033] Amplification reaction system (20 μL): 4 μL 5× buffer, 1.6 μL dNTP (2.5 mM), 0.4 μL RimeSTAR® GXL (Takara Bio Inc.) DNA polymerase (1.25 U / μL), 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), 1.5 μL genomic DNA (50 ng / μL), 11.5 μL ddH2O.

[0034] The amplification length of GH15-1F and GH15-1R was 814 bp; the amplification length of GH15-2F and GH15-2R was 1376 bp.

[0035] The amplification length of GH15-3F and GH15-3R is 1268 bp.

[0036] PCR reaction conditions: 95 ℃ pre-denaturation for 5 min; 35 cycles (95 ℃ denaturation for 10 s, 60 ℃ annealing for 15 s, 68 ℃ extension: GH15-1F / R for 49 s, GH15-2F / R for 1 min 23 s, GH15-3F / R for 1 min 16 s); 68 ℃ final extension for 7 min.

[0037] Table 2 Primers for AhERECT1 gene amplification

[0038]

[0039] The obtained AhERECT1 sequence of the Yuhua 9326 gene is as follows (SEQ ID NO.1):

[0040]

[0041] Example 2: AhERECT1 gene knockout sgRNA target design, CRISPR / Cas9 vector construction and genetic transformation

[0042] Based on previous QTL mapping and candidate gene screening results, the gene AhERECT1 (Arahy.QV02Z8) located on chromosome Arahy15 was identified as a key candidate gene for regulating peanut plant architecture. To verify the function of this gene, this invention used CRISPR / Cas9 gene editing technology to knock out the AhERECT1 gene in Yuhua 9326.

[0043] 1. sgRNA target synthesis and vector construction

[0044] AhERECT1 gene target design principles: 1) Knockout sites should be located in the coding sequence (CDS) region and preferably at the protein front or in an important functional domain; 2) They should cover a high proportion of transcripts; 3) There should be no off-target effects or off-target effects should be located in intergenic regions; 4) Targets with high editing efficiency should be preferred; 5) The sequence should have a relatively balanced GC content and be less prone to secondary structure formation.

[0045] The constructed single-target knockout gene editing vector is shown in [link to documentation]. Figure 1 .

[0046] The target sequence was selected from the coding region of the AhERECT1 gene: “GTTTTGGTGTGGTTGAGTCAT” (Tifrunner reference genome: Arahy15 chromosome 156855182 bp – 156855202 bp) (SEQ ID NO. 9). The vector was constructed by Weimi Biotechnology (Jiangsu) Co., Ltd., and the gene knockout vector map is shown below. Figure 1 As shown. The CRISPR-Cas9 vector was extracted and transformed into DH5α bacterial culture plasmid using the DP118 medium-volume plasmid extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The obtained plasmid concentration was approximately 1 μg / μL, which was then used for gene gun transformation.

[0047] 2. Genetic transformation of peanuts

[0048] (1) Embryogenic callus induction of Yuhua 9326: Take mature pods of Yuhua 9326, peel off the shells, select plump, smooth and sterile seeds, soak the seeds in 75% alcohol for 1 min and then remove the alcohol; then soak in 0.1% mercuric chloride for 8 min and then remove the mercuric chloride; finally rinse the seeds 5 times with sterile water and soak overnight.

[0049] (2) Embryogenic callus induction: The cotyledons, embryonic leaflets and hypocotyl of peanut seeds were removed in a clean bench. The epicotyl was placed on MS induction medium and subcultured at 28 ℃ every 3-4 weeks. After 3-4 subcultures, embryogenic callus that could be used later appeared. Embryogenic callus between 4-12 months was selected for subsequent experiments.

[0050] (3) Gene gun bombardment: Prepare bullets according to the instructions of Xinzhi Gene Gun (GJ-1000). Weigh 60 mg of gold powder and add 1 mL of anhydrous ethanol to a 2 mL centrifuge tube. Sonicate until the mixture feels slightly warm to the touch, centrifuge, and discard the supernatant. Add 1 mL of anhydrous ethanol, vortex for 3-5 min, let stand for 1 min, and discard the supernatant. Add 1 mL of sterile distilled water, vortex, centrifuge, and discard the supernatant. Add 50% sterile glycerol to prepare a 60 mg / mL gold powder suspension. Take 50 μL of the gold powder suspension, add 10 μL of CRISPR-Cas9 recombinant vector plasmid, vortex for 30 s, add 50 μL of 2.5 M calcium chloride, vortex for 30 s, add 20 μL of 0.1 M spermidine, vortex for 30 s, centrifuge, and discard the supernatant. Add 150 μL of 70% ethanol, pipette until the precipitate is evenly dispersed, centrifuge, discard the supernatant, add 150 μL of anhydrous ethanol, let stand for 1 min, discard the supernatant, add 60 μL of anhydrous ethanol, and disperse for later use.

[0051] (4) Peanut screening: The induced peanut embryogenic callus was placed on MS medium and bombarded with the GJ-1000 gene gun. After bombardment, it was cultured at 28 ℃ for 3 days and then transferred to MS medium containing 20 mg / L hygromycin for screening. After culturing for 1 month, new callus was selected and transferred to MS medium containing 20 mg / L hygromycin for subculture twice to propagate embryogenic callus for plant regeneration.

[0052] (5) Regeneration of peanut plants: The selected callus was transferred to MS medium and placed in a plant growth incubator with 30 ℃, 16 h light / 28 ℃, 8 h darkness to induce peanut seedlings. One month later, the peanut seedlings about 2 cm long were cut off and grafted onto the prepared rootstock. When the seedlings grew to 10-15 cm, they were transplanted to a greenhouse for cultivation.

[0053] (6) Obtaining new peanut germplasm through gene editing with altered plant architecture

[0054] Edited plants with homozygous or biallelic mutations were selected for propagation, and the next generation of seeds were harvested to obtain new peanut germplasm with altered plant morphology. The obtained T0 generation regenerated plants were grafted and transplanted to obtain a total of 20 T1 generation lines.

[0055] Example 3 Mutant Identification and Genotyping Analysis

[0056] 1. DNA extraction

[0057] After the peanut T0 plants matured, T1 generation peanut seeds (i.e., new peanut germplasm with altered plant type) were harvested from individual plants. T1 generation peanut seeds were sown individually in a greenhouse, and leaf DNA was extracted from the mutant line peanut seedlings using the TIANGEN Plant DNA Extraction Kit (DP350) following the product instructions.

[0058] 2. Detection of target site mutations in the AhERECT1 gene

[0059] (1) The specific primers for detecting the target sequence are as follows:

[0060] A15-1F:CCGAATTGCTCGAATTCTTT (SEQ ID NO.10),

[0061] A15-1R:TGAGTGAGTTACACCAATTGTCC (SEQ ID NO. 11);

[0062] (2) PCR amplification PCR system (20 μL): 4 μL 5× buffer, 1.6 μL dNTP (2.5 mM), 0.4 μL RimeSTAR® GXL (Takara Bio Inc.) DNA polymerase (1.25 U / μL), 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), 2 μL genomic DNA (50 ng / μL) and 11 μL ddH2O.

[0063] Reaction program: 95 °C pre-denaturation for 5 min, 35 cycles: 95 °C denaturation for 10 s, 57 °C annealing for 15 s, 68 °C extension for 48 s, 68 °C extension for 7 min.

[0064] Sanger sequencing: The amplified fragment of the AhERECT1 gene target sequence was 779 bp in length. The PCR amplification products were detected by agarose gel electrophoresis to determine whether the band size was correct. The PCR products were then subjected to Sanger sequencing. The primer sequence for sequencing the T3 single plant g01059(5)-1A-5 of strain g01059(5) was the forward primer A15-1F, and the primer sequence for sequencing the T1 single plant IIg01059(5-1) of strain IIg01059(5) was the reverse primer A15-1R. Figure 2 ).

[0065] Sequence alignment: The sequencing results were compared with the AhERECT1 gene sequence in the untransformed wild-type peanut Yuhua 9326 to detect the mutant genotype of the gene editing target sequence.

[0066] Sequencing results showed that a 3 bp (GAG) deletion occurred in the antisense strand of single plant g01059(5)-1A-5, and a 1 bp (C) deletion occurred in the sense strand of AhERECT1(Arahy.QV02Z8) in IIg01059(5-1). Specifically, single plants g01059(5)-1A-5 and IIg01059(5-1) experienced 3 bp (CTC) and 1 bp (C) deletions, respectively, in the coding region of the AhERECT1(Arahy.QV02Z8) gene, resulting in amino acid deletions and frameshift mutations. Both were homozygous mutants (see [link to relevant documentation]). Figure 2 ).

[0067] Example 4: Functional verification and map-based cloning of the peanut plant type gene AhERECT1 after gene knockout.

[0068] Several AhERECT1 knockout lines with different mutation types were obtained through gene editing. Among them, the plant types of two lines, g01059(5) and IIg01059(5), were significantly changed compared with the control Yuhua 9326, becoming upright and loose or semi-vine type. Figure 3 (These are T1 and T3 semi-vine single plants of the g01059(5) strain).

[0069] To further verify the accuracy of the mutation site, three pairs of specific primers were designed for gene cloning of the AhERECT1 gene knockout mutant plant g01059(5)-1A-5. Full-length sequencing results showed that the mutant plant had a 3bp deletion compared to the control Yuhua 9326 sequence (sequence shown in SEQ ID NO.2), and no other variations in the AhERECT1 gene sequence were found that differed from the control Yuhua 9326. The sequences of the three primer pairs used are shown in Table 2.

[0070] As can be seen, this invention successfully obtained mutant lines with plant type variation based on AhERECT1 gene knockout in the upright variety Yuhua 9326. This invention clarifies the function of this gene in peanut plant type regulation, providing important technical support and gene resources for achieving precise and efficient improvement of peanut plant type.

[0071] The nucleotide sequence of the AhERECT1 gene in the mutant single plant g01059(5)-1A-5 in Example 4 is shown in SEQ ID NO. 2:

[0072]

Claims

1. AhERECT1, a peanut plant architecture regulatory gene, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. A mutant gene regulating peanut plant architecture, characterized in that, The gene AhERECT1 described in claim 1 has a CTC deletion at positions 38-40 of its open reading frame, resulting in the deletion of one amino acid, and its nucleotide sequence is shown in SEQ ID NO.

2.

3. A peanut plant or its seeds containing the mutant gene of claim 2.

4. A CRISPR / Cas9 system for knocking out the AhERECT1 gene in peanuts, characterized in that, The sgRNA target sequence of the system is GTTTTGGTGTGGTTGAGTCAT.

5. The application of the AhERECT1 gene as described in claim 1 or the mutant gene as described in claim 2 in regulating peanut plant architecture.

6. The application of the AhERECT1 gene as described in claim 1 or the mutant gene as described in claim 2 in the breeding of peanut varieties with different plant types.

Images