Salt-tolerant gene shpp2c.f2-1 of saccharum officinarum and encoding protein and application thereof
By overexpressing the sugarcane salt-tolerant gene ShPP2C.F2-1 in rice, and utilizing its peroxidase-dominated antioxidant system and ion homeostasis regulation, the growth inhibition problem of sugarcane under salt stress was solved, thereby improving the salt tolerance of rice and the genetic improvement of sugarcane.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- FUJIAN AGRI & FORESTRY UNIV
- Filing Date
- 2026-04-08
- Publication Date
- 2026-07-10
AI Technical Summary
Sugarcane growth is inhibited under salt stress, resulting in reduced yield and impaired sugar quality. Current research on the PP2C gene in sugarcane is weak, and there is a lack of effective methods to improve salt tolerance.
We provide the sugarcane salt tolerance gene ShPP2C.F2-1 and its encoded protein, which enhances the salt tolerance of plants through a dual pathway of peroxidase-led antioxidant system and ion homeostasis regulation. Specifically, by overexpressing the ShPP2C.F2-1 gene in rice, we regulate the content of reactive oxygen species and malondialdehyde in the plant, maintain potassium ion homeostasis, reduce sodium ion content, and activate the expression of antioxidant system and ion homeostasis-related genes.
It significantly improved the survival rate and salt tolerance of rice under salt stress, reduced reactive oxygen species and oxidative damage, optimized ion homeostasis, and enhanced the salt stress resistance of sugarcane, providing new genetic resources for the genetic improvement of sugarcane and rice.
Smart Images

Figure CN122357584A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular biology and genetic engineering, specifically relating to a sugarcane salt tolerance gene. ShPP2C.F2-1 Its encoded proteins and applications. Background Technology
[0002] Sugarcane (Saccharum spp. hybrids) is an important sugar crop, bioenergy crop, and also a significant feed crop. my country is a major producer and consumer of sugarcane, with sugarcane sugar production accounting for approximately 90% of the national sugar consumption. However, modern sugarcane cultivars are closely related and lack genetic diversity, which significantly limits their potential for further yield increases and improvement in resistance to various abiotic stresses. Sugarcane is a moderately salt-tolerant crop; salt stress significantly inhibits its growth and development, leading to reduced yield and impaired sugar quality. Studies have confirmed that sugarcane undergoes a series of physiological changes under salt stress, such as chlorophyll degradation, cell membrane damage, decreased water content, weakened chlorophyll fluorescence intensity, and reduced photosynthetic efficiency. In India, soil salinization has caused sugarcane yield losses of 20%-40%.
[0003] PP2C protein phosphatase is a class of monomeric serine / threonine protein phosphatases, and is the most abundant family of protein phosphatases in plants. Its activity depends on magnesium. 2+ or Mn 2+ It broadly regulates various physiological and biochemical processes in plants and signaling pathways centered on abscisic acid (ABA), involving multiple aspects such as plant growth and development regulation, seed dormancy and germination, stomatal movement regulation, trauma response, and biotic and abiotic stress responses. PP2C Many members of the AtPP2CG1 gene family are directly involved in the salt tolerance process in plants. They alleviate osmotic and ion challenges caused by salt stress by regulating ion transport and stress response signaling pathways. In Arabidopsis thaliana, AtPP2CG1 enhances salt tolerance by upregulating ABA-dependent genes such as RD29A / B, DREB2A, and KIN1, while AtPP2C49 inhibits the sodium ion osmotic capacity of AtHKT1, thus suppressing the adaptation of Arabidopsis thaliana to salt stress. Silencing PP2C49 increases sodium ion osmotic capacity. + ABI2 retention in the roots protects the aboveground tissues from ion toxicity. ABI2 assists in salt stress adaptation by regulating the salt hypersensitivity (SOS) pathway. It functions through CPK12-mediated SOS2 activation, where SOS2 phosphorylates and activates Na+. + / H +The antitransporter SOS1 promotes ion homeostasis. Overexpression of TaPP2C1 in wheat (Nicotiana benthamiana) enhances salt tolerance by activating antioxidant systems and non-ABA-dependent gene transcription. OsPP65 negatively regulates osmotic and salt stress tolerance in rice by modulating JA and ABA signaling pathways and raffinose family oligosaccharide metabolism pathways. Overexpression of the BpPP2C1 gene in birch (Betula platyphylla) confers salt tolerance by mitigating oxidative stress damage, upregulating oxidative stress response, flavanol metabolism, and anion transport-related gene expression, while knockout of the BpPP2C1 gene leads to increased salt stress sensitivity in birch. These studies demonstrate that PP2C protein phosphatases play diverse and important roles in regulating salt stress response and ion homeostasis in different plant species.
[0004] Currently, the PP2C gene has been extensively studied in plants such as Arabidopsis thaliana, cotton, tomato, wheat, and rice, but research on it in sugarcane remains relatively weak. Only in the wild sugarcane species *Saccharum spontaneum* has the expression of the PP2C gene been found to be significantly induced by drought and low-temperature stress, while the biological function of the PP2C gene in cultivated varieties remains unclear. Therefore, in-depth research into the sugarcane PP2C gene and elucidation of its salt stress response mechanism are of great significance for promoting the breeding of salt-tolerant sugarcane varieties. Summary of the Invention
[0005] To overcome the shortcomings of existing technologies, the purpose of this invention is to provide a sugarcane salt tolerance gene. ShPP2C.F2-1 The study also explored the encoded protein and its applications, clarifying the function of this gene in improving plant salt tolerance through a dual pathway of peroxidase (POD)-dominated antioxidant system and ion homeostasis regulation, providing new gene resources and technical support for the genetic improvement of sugarcane salt tolerance.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] In a first aspect, the present invention provides a sugarcane salt-tolerant gene. ShPP2C.F2-1 Its nucleotide sequence is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2.
[0008] Secondly, the present invention provides the above-mentioned sugarcane salt tolerance gene. ShPP2C.F2-1 The relevant biomaterials include any one or more combinations of the following biomaterials:
[0009] (1) Contains the gene according to any one of claims 1 or 2 ShPP2C.F2-1 The expression box;
[0010] (2) Contains the gene as described in any one of claims 1 or 2 ShPP2C.F2-1 Recombinant expression vectors;
[0011] (3) A recombinant expression vector containing the expression cassette described in (1);
[0012] (4) Contains the gene as described in any one of claims 1 or 2 ShPP2C.F2-1 Recombinant bacteria;
[0013] (5) Recombinant bacteria containing the expression cassette described in (1);
[0014] (6) Recombinant bacteria containing the recombinant expression vector described in (2) or (3);
[0015] (7) Contains the gene as described in any one of claims 1 or 2 ShPP2C.F2-1 Transgenic cells;
[0016] (8) Transgenic cells containing the expression cassette described in (1);
[0017] (9) Transgenic cells containing the recombinant expression vector described in (2) or (3).
[0018] Thirdly, the present invention provides the above-mentioned sugarcane salt tolerance gene. ShPP2C.F2-1 The above-mentioned biomaterials may be used in any of the following aspects:
[0019] (a) Improve plant salt tolerance;
[0020] (b) Regulate the activity of the plant's antioxidant system, primarily composed of peroxidase;
[0021] (c) Regulate the content of reactive oxygen species and malondialdehyde in plants;
[0022] (d) Regulate sodium and potassium ion homeostasis in plants;
[0023] (e) Regulate the expression of plant genes related to salt stress response.
[0024] Furthermore, the plant in question is rice or sugarcane.
[0025] Furthermore, the application is achieved through overexpression in plants. ShPP2C.F2-1 Genetic implementation.
[0026] Furthermore, overexpression in plants ShPP2C.F2-1 After gene modification, at least one of the following effects will be achieved:
[0027] (a) Improve plant salt tolerance (increase the survival rate of plants under salt stress);
[0028] (b) Increases plant peroxidase activity (leading to enhanced antioxidant system) while decreasing superoxide dismutase and catalase activity;
[0029] (c) Reduces the content of reactive oxygen species and malondialdehyde in plants (reduces oxidative damage);
[0030] (d) Reduce sodium ion content in plants and maintain potassium ion content (ion homeostasis optimization).
[0031] (e) Improve OsPrx109, OsMADS27, OsSOS1, OsNHX1, OsHKT1;1 Gene expression levels; reduced OsRSODB and OsCATB Gene expression levels.
[0032] Fourthly, the present invention provides the above-mentioned sugarcane salt tolerance gene. ShPP2C.F2-1 The application of the aforementioned biological materials in breeding rice varieties with enhanced salt stress resistance specifically involves overexpressing genes in plants. ShPP2C.F2-1 To improve the salt stress resistance of rice.
[0033] Fifthly, the present invention provides a method for cultivating salt-tolerant plants, specifically by overexpressing in plants... ShPP2C.F2-1 Genes are used to improve the salt tolerance of plants.
[0034] Furthermore, the plants mentioned are rice and sugarcane.
[0035] The present invention has the following advantages and effects compared with the prior art:
[0036] This invention isolates a salt tolerance gene from the leaf cDNA of the modern sugarcane cultivar XTT22 and names it... ShPP2C.F2-1 By building ShPP2C.F2-1 The gene expression vector was found to improve the tolerance of yeast cells to salt stress after overexpression in yeast cells (INVSc1); subsequently, overexpression of the gene in wild-type rice significantly improved the survival rate of transgenic rice seedlings under salt stress. ShPP2C.F2-1 The gene's salt stress resistance mechanism involves a significant increase in POD enzyme activity (primarily activating the antioxidant system), a significant decrease in reactive oxygen species (H2O2) and malondialdehyde (MDA) levels (reducing oxidative damage), and sodium (Na) levels. + The content of potassium (K) ions decreased significantly. + This gene achieves salt tolerance by maintaining stable ion levels (ion homeostasis optimization). It works synergistically through a POD-dominated antioxidant system and ion homeostasis regulation pathways, thereby enhancing plant salt tolerance. This provides new gene resources and key technological support for the genetic improvement of salt tolerance in crops such as sugarcane and rice, and has significant application value for breeding new salt-tolerant crop varieties. Attached Figure Description
[0037] Figure 1 For sequence analysis of ShPP2C.F2-1, note: (A) conserved domain analysis, (B) homologous sequence alignment, (C) phylogenetic tree analysis.
[0038] Figure 2 Schematic diagrams of overexpression vectors in Examples 2 and 3 of this invention. Note: (A) Schematic diagram of overexpression vector in yeast cells, (B) Schematic diagram of overexpression vector in rice.
[0039] Figure 3 In Embodiment 2 of the present invention, the transfer ShPP2C.F2-1 Phenotypes of yeast under salt stress. Note: (A) Phenotype in SG-Ura medium, (B) Phenotype in SG-Ura medium with 1.0 M NaCl.
[0040] Figure 4 The identification of transgenic rice in Example 4 of this invention: (A) Electrophoresis image of positive identification of transgenic plants; (B) Transgenic lines... ShPP2C.F2-1 The expression levels are OE9, OE12, and OE18, representing three transgenic lines.
[0041] Figure 5 Analysis of the phenotype and physiological indicators of transgenic rice under salt stress in Example 4 of this invention. Note: (A) Phenotype after salt stress, (B) Survival rate, (CE) Ion content, (F) MDA content, (G) H2O2 content, (HJ) POD, SOD and CAT enzyme activities.
[0042] Figure 6 In Example 5 of this invention, wild-type (WT) and transgenic animals under salt stress treatment ShPP2C.F2-1 Transcriptome differential analysis of gene lines (OE), Note: (A) Venn diagram of differentially expressed genes, (B) Bar chart of differentially expressed genes, (C) GO functional enrichment analysis of differentially expressed genes, (D) KEGG metabolic pathway enrichment analysis of differentially expressed genes.
[0043] Figure 7 Salt stress downturn in Example 5 of the present invention ShPP2C.F2-1 Co-expression network of differentially expressed genes in rice.
[0044] Figure 8 Real-time quantitative PCR analysis of gene expression levels in Example 5 of this invention. Detailed Implementation
[0045] To better understand the technical solution of the present invention, the following detailed description is provided in conjunction with specific embodiments and accompanying drawings, but this does not limit the scope of protection of the present invention.
[0046] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. All reagents or instruments without a specified manufacturer are commercially available, standard products.
[0047] Example 1 ShPP2C.F2-1 Gene cloning and sequence analysis
[0048] 1. RNA extraction and cDNA acquisition
[0049] Approximately 2g of leaf tissue from sugarcane variety XTT22 was collected, flash-frozen in liquid nitrogen, and then ground. Total RNA was extracted from the leaves using the Trizol method. The total RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Novozymes) reagent and stored at -20℃ for later use.
[0050] 2. Target gene ShPP2C.F2-1 Cloning
[0051] Using PCR primers ShPP2C.F2-1-F: ATGTTGTTGTTGTGTGCCCTGCTTG and ShPP2C.F2-1-R: CTACTTGTCATGGTGAAATTGCACA, PCR amplification was performed using the cDNA obtained in step 1 as a template and LA enzyme (Takara). The PCR reaction mixture (50 μL) consisted of: 0.5 μL LA enzyme, 2 μL each of forward and reverse primers, 2 μL cDNA, 25 μL 2×GC buffer, 4 μL DNTP, and ddH2O to a final volume of 50 μL. The PCR program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 45 s, 58℃ annealing for 30 s, 72℃ extension for 1 min 30 s, 35 cycles; and 72℃ final extension for 10 min. PCR products were recovered by 1% agarose gel electrophoresis and ligated into the pMD19-T (Takara) cloning vector. The vector was then transformed into *E. coli* DH5α competent cells, and positive clones were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Sequencing results showed that the amplified fragment contained a complete open reading frame of 717 bases, and the nucleotide sequence is shown in SEQ ID NO: 1. The fragment was named... ShPP2C.F2-1 The gene was translated into a protein sequence using SnapGene software. Its amino acid sequence, as shown in SEQ ID NO: 2, consists of 238 amino acid residues and is named the sugarcane ShPP2C.F2-1 protein. In addition, the pMD19-T-ShPP2C.F2-1 plasmid was obtained and stored for future use.
[0052] 3. ShPP2C.F2-1 sequence analysis
[0053] Analysis using the Conserved Domain Search tool in the NCBI database showed that the ShPP2C.F2-1 protein contains the highly conserved PP2Cc domain of the PP2C family (PF00481, CD number: cd00143), including MED, DGH, DG, and D residues that bind to divalent metal ions, but lacks R residues that bind to phosphate ions. Figure 1 A, 1B).
[0054] The amino acid sequence of sugarcane ShPP2C.F2-1 protein was searched for homology in the NCBI database using BLASTp, and the homology sequences were compared using MEGA software. Figure 1 B). The results showed that ShPP2C.F2-1 shared 95.38% sequence identity with PP2C (KA0514542.1) of sorghum (Sorghumbicolor), 87.39% with PmPP2C56 (RLN13312.1) of millet (Panicum miliaceum), 73.04% with MfPP2C13-X3 (XP_066370744.1) of Miscanthus floridulus, 70.82% with MfPP2C56-X2 (XP_066370743.1) of Miscanthus floridulus, 61.76% with PvPP2C56-X2 (XP_039806007.1) of switchgrass (Panicum virgatum), and [missing information - likely related to Phragmites australis]. The sequence identity of PaPP2C56 (XP_062228949.1) from *Os* australis was 57.76%, while its sequence identity with *Oryza sativa* OsPP2C13 (NP_001396893.1) was 48.48%, and with OsPP2C56-X1 (XP_015641624.1) was 44.42%. BLASTp search results did not yield any sugarcane-derived PP2C family genes explicitly annotated as homologous to ShPP2C.F2-1 in publicly available databases.
[0055] Representative sequences of each subtribe of the AL gene family of Arabidopsis thaliana PP2C were downloaded from the Phytozome database. The reported sequence of SsPP2C (AXH37648.1) from the wild sugarcane species Saccharum spontaneum was downloaded from NCBI. Sequence alignment was performed using Cluster assay with the sugarcane ShPP2C.F2-1 protein and homologous sequences screened using BLASTp in NCBI. Based on the alignment results, a phylogenetic tree was constructed using Neighbor-Joining (NJ) in MEGA software. Figure 1 C), 1000 Bootstrap replicate tests. The results showed that the sugarcane ShPP2C.F2-1 protein and all homologous sequences clustered in the same branch, and this branch was closely clustered with representative members of the Arabidopsis PP2C family F2 subfamily, indicating that it belongs to the PP2C family F2 subfamily; among them, ShPP2C.F2-1 is most closely related to MfPP2C13-X3 (XP_066370744.1) of Miscanthus floridulus, with 97.9% homology.
[0056] Example 2 Functional analysis of the ShPP2C.F2-1 gene in yeast
[0057] 1. Construction of yeast expression vector
[0058] Based on the In-Fusion seamless cloning method, a homologous recombination primer pYES2-ShPP2C.F2-1 was designed to seamlessly link ShPP2C.F2-1 with the yeast expression vector pYES2. TACCGAGCTCGGATCC ATGGAGGACTGTTATGACATTAAGTTAACTAAAACT;pYES2-ShPP2C-R: GATATCTGCAGAATTCThe vector pMD19-T-ShPP2C.F2-1 obtained in Example 1 was used for PCR amplification with PrimeSTAR® HS (Takara) high-fidelity enzyme. The PCR product was recovered and purified. The vector was digested with restriction endonucleases BamHI and EcoRI at 37°C for 30 min, and the linearized vector was obtained after recovery and purification. Homologous recombination of the linearized vector and the target fragment was performed using the seamless cloning ligase DNA Assembly Mix Plus (Lambolid) at 50°C for 30 min. The reaction system consisted of 5 μL DNA Assembly Mix, 2 μL linearized vector, and 2 μL target fragment. The homologous recombination product was transformed into DH5α competent cells, and single clones were picked and sequenced to obtain the recombinant plasmid pYES2-ShPP2C.F2-1.
[0059] 2. Yeast transformation and screening
[0060] The recombinant plasmid pYES2-ShPP2C.F2-1 and the empty vector pYES2 were transformed into yeast INVSC1 competent cells, respectively. The transformation method was as follows: 100 μL of competent cells were taken, and 2 μg of plasmid, 15 μL of carrier DNA, and 500 μL of PEG / LiAC were added sequentially. The mixture was then pipetted and incubated at 30°C for 30 min (inverting once during incubation), followed by incubation at 42°C for 15 min (inverting once during incubation). After centrifugation, the cells were collected, resuspended in ddH2O, plated on SD / -Ura (containing 2% glucose) plates, and cultured at 28°C for 3-5 days. Positive clones were then screened.
[0061] 3. Verification of yeast salt tolerance
[0062] Add 1% (by volume) of the positive bacterial culture to SD-Ura liquid medium and incubate with shaking until OD (dose-free ratio) is reached. 600 =1.2-1.4, then centrifuged to remove the supernatant, added SG-Ura medium (containing 2% galactose), and continued to incubate with shaking for 8 h. Adjust OD 600 After reaching 0.2, press 10. 0 10 -1 10 -2 10 -3 Take 10 μl of each of the dilution gradients and spot it onto SG-Ura solid medium and SG-Ura+1 MNaCl medium, and incubate at 28℃ for 3-5 days.
[0063] The results showed that the pYES2-ShPP2C.F2-1 yeast strain survived for 10 days on a medium containing 1 M NaCl. -3The gradient growth state was significantly better than that of the empty vector control. Figure 3 ),show ShPP2C.F2-1 Overexpression of the gene in yeast can significantly improve its salt tolerance.
[0064] Example 3: Obtaining and Verifying the Salt Tolerance of Transgenic Rice
[0065] 1. Construction and transformation of plant overexpression vectors
[0066] The overexpression vector was pBWA(V)HS-ccdb-3xflag (Boyuan), and homologous recombination primers were designed:
[0067] pBWA(V)HS-ShPP2C.F2-1-F:AACACGGGGGACTTTGCAACATGGAGGACTGTTATGACATTAAGTTAACTAAAACTGATG;
[0068] pBWA(V)HS-ShPP2C.F2-1-R:CCGTCGTGTCTTTGTAATCCTTGTCATGGTGAAATTGCACAACGATGC.
[0069] PCR amplification was performed using a high-fidelity enzyme. The pMD19-T-ShPP2C.F2-1 plasmid obtained in Example 1 was used as a template, and the PCR product was recovered and purified. The vector was digested with the restriction endonuclease Eco31I (BsaI) at 37℃ for 30 min, and the linearized vector was recovered and purified. Homologous recombination of the linearized vector and the target fragment was performed using 2*EasyClone Mix (Boyuan) enzyme at 37℃ for 30 min. The reaction system consisted of 10 μL of 2*EasyClone Mix, 5 μL of linearized vector, and 5 μL of target fragment. The homologous recombination product was transformed into DH5α competent cells, and single clones were picked and sequenced to obtain the recombinant plasmid pBWA(V)HS-ShPP2C.F2-1-3xflag. The recipient for the overexpression vector was Zhonghua 11. Agrobacterium transformation and transgenic experiments were commissioned to Wuhan Boyuan Biotechnology Co., Ltd.
[0070] 2. Positive identification of genetically modified rice
[0071] Genomic DNA was extracted from leaves of T0 generation rice. PCR identification was performed using gene-specific primer ShPP2C.F2-1-F and vector-specific primer R. PCR products were detected by 1% agarose gel electrophoresis; plants showing the target band were identified as positive transgenic plants. Total RNA was extracted from positive lines and reverse transcribed into cDNA using HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme). Real-time quantitative PCR (qRT-PCR) was performed using ChamQ Blue Universal SYBR qPCR Master Mix (Vazyme). The quantitative primer for ShPP2C.F2-1 was qShPP2C.F2-1-F / R. The internal control primer was Actin-F / R. Three lines with high ShPP2C.F2-1 expression were selected and propagated to T3 generation stable lines (OE9, OE12, and OE18) for subsequent experiments. Figure 4 ).
[0072] The primer sequences involved are shown below:
[0073] Gene-specific primer ShPP2C.F2-1-F: ATGGAGGACTGTTATGACA;
[0074] Vector-specific primer R: GTGGTCTTTGTAGTCTCC;
[0075] qShPP2C.F2-1-F: GGAAGAAGAGGTCAGCAGCTG;
[0076] qShPP2C.F2-1-R: CAATGGCATCCTCATTTCGC;
[0077] Actin-F: TGCTATGTACGTCGCCATCCAG;
[0078] Actin-R:AATGAGTAACCACGCTCCGTCA.
[0079] 3. Identification of salt stress phenotypes in transgenic ShPP2C.F2-1 rice
[0080] Choose plump turns ShPP2C.F2-1Genetically modified (GM) rice and wild-type (WT) rice seeds were treated with 50℃ warm water for 1.5 hours, then placed in a 30℃ constant temperature incubator for 2-3 days to germinate. Seeds showing uniform white sprouting were transferred to 96-well hydroponic boxes and cultured hydroponically using Yoshida nutrient solution under the following conditions: a 16-hour light / 8-hour dark photoperiod and a day / night temperature of 28℃ / 25℃. 50 mg·L⁻¹ of Yoshida nutrient solution was added to the GM rice nutrient solution. -1 Hygromycin B (Hyg) was used to select positive plants. After 7 days of continuous culture, yellowing and dead seedlings were removed, and the healthy positive plants were replaced with Yoshida nutrient solution for further culture. When the rice seedlings reached the three-leaf stage, salt stress treatment was applied: they were cultured in Yoshida nutrient solution containing 150 mM NaCl for 7 days, with the culture conditions remaining unchanged. After 7 days of stress treatment, the solution was replaced with fresh Yoshida nutrient solution without NaCl, and cultured for another 7 days. Phenotypic observation results showed that after salt stress treatment and recovery culture, almost all wild-type rice plants withered and died, while the transformed plants... ShPP2C.F2-1 Some plants of the genetically modified rice still maintained a good green phenotype, and the salt tolerance phenotypes of the two groups differed significantly. Figure 5 A). The survival rate of seedlings from different strains was statistically analyzed. The results showed that the survival rate of wild-type rice seedlings after salt stress was only 4%, while the survival rate of the three transformed strains was much higher. ShPP2C.F2-1 The survival rate of the genetically modified lines was 27%-39%, significantly higher than that of the wild type (P<0.05). Figure 5 B), indicating overexpression ShPP2C.F2-1 The gene can significantly improve the survival ability of rice under salt stress, that is, the ShPP2C.F2-1 gene positively regulates the salt tolerance of rice.
[0081] 4. Physiological indicator testing
[0082] Collect samples before salt stress, 7 days after salt stress treatment, and 7 days after recovery culture. ShPP2C.F2-1 The aboveground parts of genetically modified rice and wild-type rice were used as samples, with three biological replicates for each treatment. The following physiological indicators were measured: the activities of peroxidase (POD), superoxide dismutase (SOD), and catalase (CAT), as well as the contents of hydrogen peroxide (H2O2) and malondialdehyde (MDA), were measured using an ELISA kit; and the Na+ content in the leaves was measured using inductively coupled plasma mass spectrometry (ICP-MS). + K + The content of Na was calculated. + / K + ratio.
[0083] After 7 days of salt stress treatment, compared with the wild type, the transgenic rice lines showed significantly increased POD activity (18.61%-33.16%), decreased CAT activity (8.22%-32.88%), and significantly decreased SOD activity (6.92%-24.70%). The transgenic rice also showed significantly decreased H2O2 content (7.13%-38.04%) and MDA content (20.32%-28.15%). The transgenic rice also showed significantly decreased Na... + The content was reduced by 19.97%-26.46% compared to the wild type, K + The content of Na was not significantly different between transgenic lines and wild types, ultimately leading to Na + / K + The ratio decreased significantly by 25.36%-29.08% ( Figure 5 C-5J).
[0084] Seven days after recovery culture, compared with the wild type, the transgenic rice lines showed significantly increased POD activity (31.35%-64.38%), decreased CAT activity (20.78%-44.27%), and significantly decreased SOD activity (27.06%-49.72%); significantly decreased H2O2 content (25.83%-44.02%) and MDA content (19.96%-36.25%); and significantly decreased Na content. + The content was reduced by 25.90%-34.09% compared to the wild type, K + There was no significant difference in content, Na + / K + The ratio decreased significantly by 23.62%-32.47%.
[0085] The results show that ShPP2C.F2-1 Genes contribute to the antioxidant system dominated by POD and maintain ion homeostasis (reducing Na+). + Accumulate and maintain K + The synergistic effect of the dual pathways (stable) significantly improves the salt tolerance of rice.
[0086] Example 4: RNA Sequencing and Salt Tolerance Mechanism Analysis
[0087] 1. RNA sequencing
[0088] Salt stress was applied for 0 h and 24 h. ShPP2C.F2-1Twelve samples were collected from the aboveground parts of both wild-type and genetically modified rice, with three biological replicates per sample. Total RNA was extracted using the Trizol method. cDNA libraries were constructed by Shanghai MajorBio Technology Co., Ltd., and sequenced using the Illumina NovaSeq X Plus platform. Bioinformatics analysis, including raw data filtering, quality control, read alignment, differential expression analysis, and functional enrichment analysis, was performed using the MajorBio Cloud Platform (www.majorbio.com). Transcriptome sequencing data have been uploaded to the NCBI database, SRA: PRJNA1440055.
[0089] 2. Differentially expressed gene screening and enrichment analysis
[0090] Based on the transcriptome data obtained above, differentially expressed genes (DEGs) were screened using the DESeq2 software package in R. The screening criteria were |log2FC|≧1 and a false discovery rate (FDR) <0.05. Genes meeting these criteria were identified as significantly differentially expressed genes. Subsequently, functional enrichment analysis was performed on the significantly differentially expressed genes. GO functional enrichment analysis was completed using the Goatools tool in Python, and KEGG metabolic pathway enrichment analysis was performed using the Python scipy software. The significance threshold for enrichment was set as a Bonferroni-corrected P-value <0.05. This method was used to screen for significantly enriched GO terms and KEGG metabolic pathways, clarifying the core biological functions and regulatory pathways involved in differentially expressed genes.
[0091] The results showed that after 24 hours of salt stress treatment, the conversion... ShPP2C.F2-1 A total of 7143 significantly differentially expressed genes were identified in genetically modified rice (OE_24h vs OE_0h), including 1517 uniquely differentially expressed genes; a total of 11147 significantly differentially expressed genes were identified in wild-type rice (WT_24h vs WT_0h), including 5521 uniquely differentially expressed genes. Figure 6 A, B). GO functional enrichment analysis showed that significantly differentially expressed genes in transgenic rice were significantly enriched in biological processes such as antioxidant / reactive oxygen species (ROS) homeostasis regulation, salt and osmotic stress response, hormone signal transduction, and transcriptional regulation. Representative GO terms included: peroxidase activity (GO:0004601), oxidoreductase activity (GO:0016491), salt stress response regulation (GO:1901000), abscisic acid-activated signaling pathway (GO:0009738), and transcriptional regulatory factor activity (GO:0140110). Figure 6C). In contrast, the significantly differentially expressed genes in wild-type rice were significantly enriched in only two GO terms related to antioxidant and hormone signaling: oxidative stress response (GO:0006979) and hormone-mediated signaling pathway (GO:0009755).
[0092] Furthermore, KEGG metabolic pathway enrichment analysis showed that, under Bonferroni-corrected P-value <0.05, differentially expressed genes in wild-type rice were significantly enriched in 27 metabolic pathways, while those in transgenic rice were enriched in 27 pathways. ShPP2C.F2-1 The differentially expressed genes in transgenic rice were significantly enriched in 33 metabolic pathways. Notably, the differentially expressed genes in transgenic rice were significantly enriched in the phenylpropane biosynthesis pathway, the plant hormone signal transduction pathway, and the starch and sucrose metabolism pathway; while the differentially expressed genes in wild-type rice were not significantly enriched in these pathways. Figure 6 D).
[0093] 3. Weighted Gene Co-expression Network Analysis (WGCNA)
[0094] To further elucidate the transcriptional regulatory characteristics of the ShPP2C.F2-1 gene in response to salt stress, a weighted gene co-expression network (WGCNA) was constructed using the Meiji Bio Cloud Platform to identify co-expression modules for all differentially expressed genes in response to salt stress. The parameters were set with a soft threshold β=9, and genes with a module member correlation (kME) <0.3 were removed. Genes were clustered with a minimum module size ≥30, and similar modules were merged based on a cluster distance <0.3 to identify co-expression modules. Spearman correlation analysis was used to screen gene modules (R0) that were significantly associated with the salt stress phenotype. 2 (≥0.0.75, P≤0.001). Within the selected core modules, genes with a node weight >0.02 were screened, and the top 60 genes in terms of connectivity within the module were selected as Hub genes. GO functional enrichment and KEGG metabolic pathway enrichment analyses were performed on the genes in the core modules to screen core regulatory pathways and key Hub genes.
[0095] Co-expression network analysis identified five co-expression modules, distinguished by different colors: blue, green, brown, yellow, and gray. The number of co-expressed genes in each module was 4179, 8244, 211, 182, and 595, respectively. Spearman correlation analysis further explored the association between these modules and salt stress phenotypes. The results showed that the module eigenvalues of the brown and yellow modules were correlated with phenotypes after salt stress treatment. ShPP2C.F2-1 The phenotype of the gene-derived rice (OE_24h) showed a significant positive correlation (R0). 2>0.75, P<0.01, indicating that, compared to the wild type, differentially expressed genes in the above modules play a core regulatory role in the salt tolerance response of transgenic rice during salt stress treatment. Figure 7 A).
[0096] The top 60 genes by connectivity within each module were used to construct a co-expression network using Cytoscape 3.10.4 software, and the network was visualized and analyzed. Two core genes in the yellow module were found to be associated with salt stress: OsPrx109 (gene ID Os07g0676900, enzymology ID E1.11.1.7) and OsMADS27 (encoding a MADS box transcription factor, gene ID Os02g0579600). Figure 7 B). OsPrx109 belongs to class III peroxidases and is involved in various physiological processes, including the production and scavenging of reactive oxygen species (ROS), resistance to biotic and abiotic stresses, and lignin biosynthesis. Under abiotic stresses, overexpression of class III peroxidase genes can lead to higher peroxidase activity in plants.
[0097] The MADS-box transcription factor OsMADS27 is a key regulator controlling root development and adaptation to osmotic stress in rice. OsMADS27 directly binds to the promoter of OsHKT1;1 and activates its expression, thereby regulating Na+ in the roots. + The above results indicate that OsPrx109 (POD encoding gene) and OsMADS27 (ion transport regulatory gene) are the core regulatory factors of the ShPP2C.F2-1 gene-mediated salt tolerance response, corresponding to the POD-dominated antioxidant pathway and ion homeostasis regulation pathway, respectively.
[0098] 4. Real-time quantitative PCR (qRT-PCR) analysis
[0099] Total RNA was extracted from rice samples using the TriZol method. Reverse transcription of the sample RNA was performed using HIScript & II Q RT SuperMix for qPCR (+ gDNA wiper) (Vazyme). qRT-PCR reactions were performed using ChamQ Blue Universal SYBRqPCR Master Mix (Vazyme). Actin-F / R was used as the internal control primer. qRT-PCR data were analyzed using 2... -△△CTQuantitative analysis was performed. The expression patterns of the core hub genes identified above—OsPrx109 and OsMADS27; ion transport genes: OsSOS1 (Os12g0641100), OsNHX1 (Os07g0666900), OsHKT1;1 (Os04g0607500); and antioxidant defense genes: OsRSODB (Os07g0665200) and OsCATB (Os06g0727200)—were detected after 7 days of salt stress treatment and recovery. The primers used for detection are as follows:
[0100] qOsPrx109-F: CAGGCTTCTACAACGAGACCA;
[0101] qOsPrx109-R:TTCGACAGCAGGTTGGTGTA;
[0102] qOsMADS27-F: GCAGAAGCAGGTGGAGAATC;
[0103] qOsMADS27-R: TTGCTCAACAAGCTGACCTG;
[0104] qOsSOS1-F: CTCCGTGCTCATAGAATCGC;
[0105] qOsSOS1-R: ATACTCACTCAAGTGGGTCAATACC;
[0106] qOsNHX1-F:TGACCGTGAGGTTGCCCTTATGAT;
[0107] qOsNHX1-R: AGAATACGGTGAGAATGCCGCTCA;
[0108] qOsHKT1;1-F:ATTAGCAGAGCACTGTGGAGGAA;
[0109] qOsHKT1;1-R: CCGACGAACCCGTAGGAAG;
[0110] qOsRSODB-F: TGCCGGTGATCTTGGAAATA;
[0111] qOsRSODB-R: CTTGCTAAGCTCATGTCCAC;
[0112] qOsCATB-F: CAGAACCCCAGTTATTGTTCG;
[0113] qOsCATB-R:ACAGGCATATTGTTCCCAAC.
[0114] Real-time quantitative PCR (qRT-PCR) validation results showed that at two time points, 7 days after salt stress treatment (SS7 d) and 7 days after recovery culture (RW7 d), the transformation... ShPP2C.F2-1 In rice lines, OsPrx109 (POD encoding gene), OsMADS27 (ion transport regulatory gene), OsSOS1, OsNHX1, and OsHKT1;1 (Na+) are present. + The expression levels of transport-related genes were significantly higher in the OsRSODB and OsCATB genes than in the wild type, while the expression levels of these genes were significantly lower in the OsRSODB and OsCATB genes than in the wild type. Figure 8 This result corroborates the physiological index detection results in Example 3, indicating that the ShPP2C.F2-1 gene can regulate sodium ions (Na+) by strengthening the POD-based antioxidant defense system and simultaneously regulating the OsMADS27 gene. + The expression of transport-related genes (OsSOS1, OsNHX1, OsHKT1;1) maintains plant ion homeostasis and ultimately enhances rice's salt stress tolerance through the synergistic effect of two pathways: POD-led antioxidant defense and ion homeostasis regulation.
[0115] The above embodiments are merely preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and are included within the protection scope of the present invention.
Claims
1. A sugarcane salt tolerance gene ShPP2C.F2-1 Its characteristics Its nucleotide sequence is shown in SEQ ID NO:
1.
2. The sugarcane salt tolerance gene according to claim 1 ShPP2C.F2-1 Its features are: The amino acid sequence of the protein it encodes is shown in SEQ ID NO:
2.
3. The sugarcane salt tolerance gene as described in claim 1 ShPP2C.F2-1 The related biomaterials are characterized by: Includes any one or more combinations of the following biological materials: (1) Contains the gene according to any one of claims 1 or 2 ShPP2C.F2-1 The expression box; (2) Contains the gene as described in any one of claims 1 or 2 ShPP2C.F2-1 Recombinant expression vectors; (3) A recombinant expression vector containing the expression cassette described in (1); (4) Contains the gene as described in any one of claims 1 or 2 ShPP2C.F2-1 Recombinant bacteria; (5) Recombinant bacteria containing the expression cassette described in (1); (6) Recombinant bacteria containing the recombinant expression vector described in (2) or (3); (7) Contains the gene as described in any one of claims 1 or 2 ShPP2C.F2-1 Transgenic cells; (8) Transgenic cells containing the expression cassette described in (1); (9) Transgenic cells containing the recombinant expression vector described in (2) or (3).
4. The sugarcane salt tolerance gene as described in any one of claims 1 or 2 ShPP2C.F2-1 The application of the biomaterial as described in claim 3 in any of the following aspects: (a) Improve plant salt tolerance; (b) Regulate the activity of the plant's antioxidant system, primarily composed of peroxidase; (c) Regulate the content of reactive oxygen species and malondialdehyde in plants; (d) Regulate the sodium and potassium ion content in plants; (e) Regulate the expression of plant genes related to salt stress response.
5. The application according to claim 4, characterized in that: The plants mentioned are rice and sugarcane.
6. The application according to claim 4, characterized in that: The application is achieved through overexpression in plants. ShPP2C.F2-1 Genetic implementation.
7. The application according to claim 6, characterized in that: Overexpression in plants ShPP2C.F2-1 After gene modification, at least one of the following effects will be achieved: (a) Improve plant salt tolerance; (b) Increases plant peroxidase activity while decreasing superoxide dismutase and catalase activity; (c) Reduce the content of reactive oxygen species and malondialdehyde in plants; (d) Reduce sodium ion content in plants and maintain potassium ion content; (e) Improve OsPrx109, OsMADS27 , OsSOS1 , OsNHX1 , OsHKT1;1 Gene expression levels; reduced OsRSODB and OsCATB Gene expression levels.
8. The sugarcane salt tolerance gene as described in any one of claims 1 or 2 ShPP2C.F2-1 The application of the biomaterial as described in claim 3 in the cultivation of rice varieties with enhanced salt stress resistance, characterized in that: Overexpression genes ShPP2C.F2-1 To improve the salt stress resistance of rice.
9. A method for cultivating salt-tolerant plants, characterized in that: Overexpression in plants ShPP2C.F2-1 Genes are used to improve the salt tolerance of plants.
10. The method according to claim 9, characterized in that: The plants mentioned are rice and sugarcane.