SNP site of co(a-b-) blood group causing immune hemolytic transfusion reaction, blood group identification kit, identification method and application

Abstract

This invention provides a SNP site for Co(a-b-) blood type that triggers immune hemolytic transfusion reactions, a blood typing kit, a method for identification, and its application, relating to the field of biotechnology. The SNP site includes a c.168delC deletion mutation at position 168, starting from the start codon in the AQP1 gene coding region. This mutation is a pathogenic SNP site for Co(a-b-) blood type, and the alleles it forms prevent the normal expression of Aquaporin-1 protein on the erythrocyte membrane, resulting in the absence of Co... a Antigen, and no Co b The antigen was identified as the Co(a-b-) phenotype. This provides a genetic variation basis for the establishment of rare blood type banks and the assurance of transfusion compatibility, and can be used for Co(a-b-) blood type identification. The identification of the new allele also provides a new research target for exploring the association mechanism between Colton blood type and certain diseases, contributing to the optimization of personalized medicine strategies.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a SNP site for Co(ab-) blood type that can trigger immune hemolytic transfusion reactions, a blood typing kit, a typing method, and its applications. Background Technology

[0002] The Colton blood group system (ISBT number 024) is a blood group system for human red blood cells and plays an indispensable role in transfusion medicine. This system includes Co... a Co b Two core antigens, and the high-frequency antigen Co3. Co a Co b The codominant alleles on the AQP1 gene encode products that form phenotypes such as Co(a+b-), Co(a-b+), and Co(a+b+). The Co(ab-) phenotype, also known as the Co_null phenotype, is extremely rare due to the lack of functional Aquaporin-1 protein, and its distribution frequency in the global population is very low, highlighting the challenge of its clinical identification.

[0003] The Colton blood group system plays an indispensable role in transfusion medicine. Anti-Co... a Anti-Co b Antibodies can trigger severe and potentially fatal transfusion reactions. Colton antibodies are also a significant cause of hemolytic disease of the newborn (HDFN). In particular, antibodies against the high-frequency antigen Co3 (anti-Co3) often exhibit broad-spectrum reactions, making blood typing extremely difficult. Therefore, accurate identification of Colton blood type status is crucial for ensuring transfusion safety and optimizing perinatal management.

[0004] The genetic basis of the Colton blood group system is regulated by the AQP1 gene located on the short arm of chromosome 7 (7p14), which encodes the Aquaporin-1 (AQP1) protein, essentially an aquaporin. The Co(ab-) blood type is usually caused by homozygous or compound heterozygous mutations in the AQP1 gene, resulting in the loss of functional AQP1 protein. Because individuals with the Co(ab-) phenotype must be matched with equally rare Co(ab-) donor blood for transfusions, and because they are more likely to produce potent broad-spectrum antibodies against the Co3 antigen, the difficulty and risk of blood matching are greatly increased. Therefore, clarifying the genetic variation basis of the Co blood group system, especially novel mutation sites, is a crucial prerequisite for establishing a comprehensive rare blood group donor bank and ensuring transfusion safety.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] One of the objectives of this invention is to provide a substance for detecting SNP sites of the AQP1 gene for use in Co(ab-) blood typing or the preparation of Co(ab-) blood typing products, so as to at least solve one of the technical problems existing in the prior art.

[0007] The second objective of this invention is to provide a reagent for Co(ab-) blood typing.

[0008] The third objective of this invention is to provide a kit for Co(ab-) blood typing.

[0009] The fourth objective of this invention is to provide a Co(ab-) blood type identification method.

[0010] The fifth objective of this invention is to provide the above-mentioned substance for detecting SNP sites of the AQP1 gene, and the above-mentioned reagent or kit for use in assessing the risk of immune hemolytic transfusion reactions or in preparing products for assessing the risk of immune hemolytic transfusion reactions.

[0011] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: In a first aspect, the present invention provides the application of a substance for detecting SNP sites of the AQP1 gene in Co(ab-) blood typing or in the preparation of Co(ab-) blood typing products, wherein the SNP site includes the c.168delC deletion mutation at position 168, starting from the start codon of the coding region of the AQP1 gene.

[0012] Furthermore, the product includes a substance for detecting the c.168delC deletion mutation at position 168, starting from the start codon in the coding region of the AQP1 gene.

[0013] Furthermore, the substance used to detect the c.168delC deletion mutation at position 168 starting from the start codon in the AQP1 gene coding region includes one or more of the following: reagents for nucleic acid extraction and amplification, reagents for detecting nucleic acid amplification products, or reagents for sequencing.

[0014] Furthermore, the substance for detecting the c.168delC deletion mutation at position 168 starting from the start codon in the coding region of the AQP1 gene includes a primer pair for amplifying the c.168delC deletion mutation at position 168 starting from the start codon in the coding region of the AQP1 gene, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0015] Secondly, the present invention provides a reagent for Co(ab-) blood typing, including amplification primers for detecting the c.168delC deletion mutation at position 168, starting from the start codon of the AQP1 gene coding region.

[0016] Furthermore, the nucleotide sequences of the amplification primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0017] Furthermore, it also includes sequencing primers, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0018] Thirdly, the present invention provides a kit for Co(ab-) blood typing, comprising the reagents described above.

[0019] Fourthly, the present invention provides a Co(ab-) blood type identification method, which uses the above-mentioned kit to amplify the blood sample to be tested, and performs sequencing and genotyping on the amplification products. If the blood sample to be tested is homozygous for c.168delC, the blood type of the blood sample to be tested is determined to be Co(ab-).

[0020] Fifthly, the present invention provides the above-described substance for detecting SNP sites of the AQP1 gene, and the use of the above-described reagent or kit in assessing the risk of immune hemolytic transfusion reactions or in preparing products for assessing the risk of immune hemolytic transfusion reactions. The reaction includes the reaction by Co a or Co b Immunological hemolytic transfusion reaction caused by antigen-antibody incompatibility.

[0021] The application of the substance provided by this invention for detecting SNP sites in the AQP1 gene in Co(ab-) blood typing or the preparation of Co(ab-) blood typing products. The c.168delC deletion mutation at position 168 of the start codon in the AQP1 gene coding region is a pathogenic SNP site for Co(ab-) blood typing. The allele formed by this mutation results in the inability of Aquaporin-1 protein to be normally expressed on the erythrocyte membrane, thus preventing Co(ab-) blood typing. a Antigen, and no Co b The antigen was identified as Co(ab-) phenotype. When they received Co from a regular blood donor... a + or Co b When red blood cells are transfused, the immune system recognizes them as "foreign antigens"; the body produces anti-Co... a or anti-Co bAntibodies; during re-transfusions or pregnancy, antibodies rapidly bind to the transfused red blood cells, leading to hemolytic transfusion reactions (HTR) or hemolytic disease of the newborn. This provides a genetic basis for the establishment of rare blood type banks and the assurance of transfusion compatibility, and can be used for Co(ab-) blood typing. The identification of new alleles also provides new research targets for exploring the association mechanisms between Colton blood type and certain diseases, contributing to the optimization of personalized medicine strategies. Attached Figure Description

[0022] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0023] Figure 1 Sanger sequencing sequence maps of the proband and family members provided in this embodiment of the invention; Figure 2 This is the result of detecting the Co(ab-) phenotype of the proband using the microcolumn gel card method provided in Example 2 of the present invention. Wells 1-3 contain cells and anti-Co... a Antibody reaction, wells 4-6 are for cells and anti-Co. b Antibody reactions. Wells 1, 2, 4, and 5 show the results of antibody reactions with known Co(a+b+) profiles, while wells 3 and 6 show the results of antibody reactions with proband erythrocytes. Figure 3 The empty vector, wild-type Co(a+), and Co(ab-) provided in Embodiment 3 of the present invention 168delC Co(ab-) 308_309insT Co mutant in vitro expression cell line a Volcano plot of APC fluorescence distribution of antigen expression, with empty vector cell line as negative control, and positive cell expression within the box; Figure 4 The empty vector, wild-type Co(a+), and Co(ab-) provided in Embodiment 3 of the present invention 168delC Co(ab-) 308_309insT Co mutant in vitro expression cell line a The single-parameter fluorescence intensity histogram and the average fluorescence intensity statistical graph show the expression of the antigen. In this graph, A is the single-parameter fluorescence intensity histogram and B is the average fluorescence intensity statistical graph. Figure 5 The empty carrier and normal Co(b+) provided in Embodiment 3 of the present invention 134C>T Co(ab-) 168delC Co(ab-)308_309insT Co mutant in vitro expression cell line b Volcano plot of APC fluorescence distribution of antigen expression, with empty vector cell line as negative control, and positive cell expression within the box; Figure 6 The empty carrier and normal Co(b+) provided in Embodiment 3 of the present invention 134C>T Co(ab-) 168delC Co(ab-) 308_309insT Co mutant in vitro expression cell line b The single-parameter fluorescence intensity histogram and the average fluorescence intensity statistical graph show the expression of the antigen. In the figure, A is the single-parameter fluorescence intensity histogram and B is the average fluorescence intensity statistical graph. Detailed Implementation

[0024] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms shall be clear; however, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definitions. In this application, unless otherwise stated, the use of "or" means "and / or". Furthermore, the use of the term "comprising" and other forms is non-limiting.

[0025] Generally, the nomenclature and techniques used in cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization, together with those described herein, are those well-known and commonly used in the art. Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well-known in the art and described in various general and more specific references, which are cited and discussed throughout this specification. Enzymatic reactions and purification techniques are carried out according to the manufacturer's instructions, as commonly practiced in the art, or as described herein. The nomenclature, laboratory procedures, and techniques used in analytical chemistry, synthetic organic chemistry, and medical and medicinal chemistry, together with those described herein, are those well-known and commonly used in the art.

[0026] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] The AQP1 gene reference sequence involved in this invention includes a coding sequence and a genomic sequence. The coding sequence reference is accession number NM_198098.4, used for mutation nomenclature (c.168delC) and protein function annotation (p.F56Lfs*3). The genomic sequence reference is accession number NG_007475.2, used for Sanger sequencing result alignment, primer design, and genomic coordinate localization.

[0028] This invention provides the application of a substance for detecting SNP sites in the AQP1 gene in Co(ab-) blood typing or in the preparation of Co(ab-) blood typing products, wherein the SNP site includes the c.168delC deletion mutation at position 168 starting from the start codon in the coding region of the AQP1 gene.

[0029] The c.168delC deletion mutation at position 168, starting from the start codon in the AQP1 gene coding region, is a pathogenic SNP site for Co(ab-) blood type. According to the reference sequence (NCBI accession number NG_007475.2), this SNP site is located in exon 1 of the AQP1 gene coding region. The wild-type gene sequences of exon 1 of the AQP1 gene and its upstream and downstream flanking regions are shown in SEQ ID NO.1. The c.168delC deletion mutation is a novel, previously unreported mutation. The allele formed by this mutation results in the abnormal expression of Aquaporin-1 protein on the erythrocyte membrane, thus preventing Co(ab-) blood type. a Antigen, and no Co b The antigen was identified as Co(ab-) phenotype. When they received Co from a regular blood donor... a + or Co b When red blood cells are transfused, the immune system recognizes them as "foreign antigens"; the body produces anti-Co. a or anti-Co b Antibodies; during re-transfusions or pregnancy, antibodies rapidly bind to the transfused red blood cells, leading to hemolytic transfusion reactions (HTR) or hemolytic disease of the newborn. This provides a genetic basis for the establishment of rare blood type banks and the assurance of transfusion compatibility, and can be used for Co(ab-) blood typing. The identification of new alleles also provides new research targets for exploring the association mechanisms between Colton blood type and certain diseases, contributing to the optimization of personalized medicine strategies.

[0030] In some specific embodiments, the product includes a substance that detects the c.168delC deletion mutation at position 168, starting from the start codon in the coding region of the AQP1 gene.

[0031] In some specific embodiments, the substance used to detect the c.168delC deletion mutation at position 168 starting from the start codon in the AQP1 gene coding region includes one or more of the following: reagents for nucleic acid extraction and amplification, reagents for detecting nucleic acid amplification products, or reagents for sequencing.

[0032] Specifically, substances used to detect the c.168delC deletion mutation at position 168, starting from the start codon in the AQP1 gene coding region, include, but are not limited to, primers, enzymes for nucleic acid amplification reactions, fluorescent labels, buffer reagents, dNTPs, and salts. Depending on the specific detection method, those skilled in the art can select the above-mentioned reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for constructing sequencing libraries, and reagents for sequencing, based on the methods described in general and more specific textbooks, references, process manuals, product instructions, and standard documents. This invention does not impose any limitations on these selections.

[0033] In some specific embodiments, the substance for detecting the c.168delC deletion mutation at position 168 starting from the start codon of the AQP1 gene coding region includes a primer pair for amplifying the c.168delC deletion mutation at position 168 starting from the start codon of the AQP1 gene coding region, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0034] According to another aspect of the present invention, a reagent for Co(ab-) blood typing is also provided, comprising amplification primers for detecting the c.168delC deletion mutation at position 168, starting from the start codon of the AQP1 gene coding region.

[0035] In some specific embodiments, the nucleotide sequences of the amplification primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0036] In some specific embodiments, sequencing primers are also included, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0037] According to another aspect of the present invention, a kit for Co(ab-) blood typing is also provided, comprising the reagents described above.

[0038] According to another aspect of the present invention, a Co(ab-) blood type identification method is also provided, wherein the above-mentioned kit is used to amplify the blood sample to be tested, and the amplification product is sequenced and genotyped. If the blood sample to be tested is a homozygous c.168delC genotype, the blood type of the blood sample to be tested is determined to be Co(ab-) blood type.

[0039] Compared to traditional serological testing, genotyping technology, by directly analyzing the AQP1 gene sequence, can accurately determine the Co blood group allelic composition at the molecular level, thus clarifying blood type status, and has higher accuracy, specificity, and stability. In clinical applications, Co blood group genotyping technology has irreplaceable value: First, it effectively overcomes the limitations of serological testing. For example, in patients with complex antibody expression, weak expression, or unclear serological results, genotyping can directly confirm the Co blood group genotype, guiding individualized and precise blood transfusions and avoiding potential hemolytic reactions. Second, it enables efficient screening of rare Co blood types, such as Co(ab-) blood group carriers, rapidly identifying rare phenotypes through large-scale genotyping, expanding the rare blood type donor pool, and providing life-saving support for special patients.

[0040] It should be noted that this Co(ab-) blood type identification method is not for diagnostic or treatment purposes.

[0041] In some specific implementations, the method for determining the c.168delC homozygous genotype includes comparing it with the wild-type AQP1 gene sequence shown in SEQ ID No.1. If the sequencing map shows no C base peak at position c.168, the blood sample to be tested is determined to be the c.168delC homozygous genotype.

[0042] The discovery of new alleles in the Co blood group system involved in this invention will not only greatly enrich the human blood group gene variation map and provide key data support for gene function research, comparative genomics and molecular evolution analysis, but also directly promote the development of precise screening technology for rare blood types. By identifying new mutation sites, targeted detection methods can be established to achieve early identification and warning of such Co(ab-) blood types, thereby significantly reducing the risk of transfusion.

[0043] According to another aspect of the present invention, the above-described substance for detecting SNP sites of the AQP1 gene is also provided, and the above-described reagent or kit is used in assessing the risk of immune hemolytic transfusion reaction or in preparing products for assessing the risk of immune hemolytic transfusion reaction. The reaction includes the reaction by Co a or Co b Immunological hemolytic transfusion reaction caused by antigen-antibody incompatibility.

[0044] The present invention will be further illustrated by the following examples. Unless otherwise specified, the materials in the examples are prepared according to existing methods or purchased directly from the market.

[0045] Example 1 1. The discovery of the proforensic witness The proband was a mother whose newborn (female) suffered from hemolytic disease of the newborn and was submitted for testing. The mother's serum tested positive for all spectral cells (1+) using the saline method; gel card testing showed a positive result for all spectral cells (2+). The mother's serum also tested positive for both her husband's and daughter's red blood cells. This indicates the possible presence of unknown antibodies in the mother's serum, and the corresponding blood group antigen alteration cannot be determined. The specific procedures are as follows: (1) Identification by postpartum serum saline method: 1 drop of enzyme spectrum cells (batch number: 732509, REAGENSKft) was added to 11 test tubes, 2 drops of postpartum serum were added, mixed well, centrifuged at 1000g for 15s, and the cell tubes were gently shaken. It was found that the serum of the proband and the spectrum cells all showed a positive reaction of 1+ hemolysis.

[0046] (2) Microcolumn gel card method: 25 µL of maternal serum and 50 µL of 0.8% Sanquin 16 cells and Hungarian-produced enzyme cells were added to a BIO-RAD low-ion anti-human globulin microcolumn gel card (batch number: 0674483629, BIO-RAD). After mixing, the mixture was incubated at 37°C for 15 minutes and then centrifuged at 1035 rpm for 10 minutes using a dedicated centrifuge. Observation results showed that the proband's serum and Sanquin 16 cells all showed a 2+ agglutination reaction, and the serum and Hungarian-produced enzyme cells all showed a 3+ agglutination reaction.

[0047] Because the antibodies in the proband's serum were homoglucosidated with the spectral cells, and excluding autoantibodies, this unknown antibody could not be identified. Therefore, it was impossible to detect and determine which rare red blood group antigen the proband possessed. The next step is to perform whole-genome exon sequencing.

[0048] 2. Collect blood samples from family members Whole-genome exome sequencing was used to perform whole-genome sequencing on the proband and family members to identify possible gene mutations.

[0049] (1) Preparation of human genomic DNA With informed consent from the prior witnesses, 200 µL of whole blood was collected for testing. Genomic DNA was extracted according to the instructions of the Pre-Filled Cartridge Reagent kit (catalog number: 101@S4100-22157, RBC Bioscience), and the concentration and purity of the genomic DNA were determined.

[0050] (2) Exon sequencing of the genome was performed at Hangzhou Lianchuan Biotechnology Co., Ltd. The sequencing results are shown in Table 1. A homozygous deletion mutation of c.168delC was found in exon 1 of the AQP1 gene in the proband, resulting in a frameshift mutation after the amino acid at position 56 changed from proline (Phe, F) to leucine (Leu, L). This prematurely terminated protein translation, resulting in a truncated protein that could not produce the functional Aquaporin-1 protein. The parents were heterozygous for the c.168delC mutation, meaning they were carriers of this mutation. Therefore, the proband inherited a homozygous c.168delC mutation, resulting in the Co(ab-) phenotype. Their offspring were also carriers of this mutation. Family pedigree analysis conforms to Mendelian inheritance laws.

[0051] Table 1. Genomic exome sequencing results of the proband and family members.

[0052] 3. The genotype was verified using the first-generation PCR-SBT genotyping method to confirm the correctness of the gene mutation.

[0053] Detection sequence (wild-type genomic DNA fragments of exon 1 of the AQP1 gene and its upstream and downstream flanking regions): CCAGAGGAGGTCTGTGTGGTGTGGGGCGGGCCAGGAGCGAAGAGAGGCCTTCCTCCCTTTGTGCTCCCCCCGCCCCCCGGCCCTATAAATAGGCCCAGCCCAGGCTGTGGCTCAGCTCTCAGAGGGAATTGAGCACCCGGCAGCGGTCTCAGGCCAAGCCCCCTGCCAGCATGGCCAGCGAGTTCAAGAAGAAGCTCTTCTGGAGGGCAGTGGTGGCCGAGTTCCTGGCCACGACCCTCTTTGTCTTCATCAGCATCGGTTCTGCCCTGGGCTTCAAATACCCGGTGGGGAACAACCAGACGGCGGTCCAGGACAACGTGAAGGTGTCGCTGGCCTTCGGGCTGAGCATCGCCACGCTGGCGCAGAGTGTGGGCCACATCAGCGGCGCCCACCTCAACCCGGCTGTCACACTGGGGCTGCTGCTCAGCTGCCAGATCAGCATCTTCCGTGCCCTCATGTACATCATCGCCCAGTGCGTGGGGGCCATCGTCGCCACCGCCATCCTCTCAGGCATCACCTCCTCCCTGACTGGGAACTCGCTTGGCCGCAATGACGTGAGTGGGGTGTCCCTGGGCTTGGGGGGGTTCTAGAATGATGCTGAAAGGCACTGGTTCCATCCTCTGCCCATTGTGCAGATGGGGACACTGAGGAACGGAGAGGACAAGAGGTTGCTGGAGGTCACGTAGAGAGCTGGGGGGAAGAGCTGGGGCTGGAACTCAGCTATGCATGC (SEQ ID NO.1).

[0054] Specifically, it includes the following steps: (1) Design amplification primers according to the position of the mutation site. The specific sequences are as follows: Primer F: 5'-CCAGAGGAGGTCTGTGTGGT-3' (SEQ ID NO.2).

[0055] Primer R: 5'-GCATGCATAGCTGAGTTCCA-3' (SEQ ID NO.3).

[0056] Dilute the amplification primers to 10 μmol / L with pure water.

[0057] (2) PCR amplification and direct sequencing method to detect the mutation site of the AQP1 gene in the proband. Prepare GXL enzyme (product number: R053A, TaKaRa), RNase-free H2O, and the DNA prepared above as PCR amplification template, and prepare the PCR reaction system according to Table 2 below.

[0058] Table 2 Amplification reaction system

[0059] The amplification conditions were as follows: 94℃ pre-denaturation for 1 min, 98℃ denaturation for 10 s, 60℃ annealing for 15 s, 68℃ extension for 2 min, for 30 cycles; 68℃ extension for 10 min, and incubation of the amplified product at 4℃. After PCR amplification, 2 µL of PCR product from each sample was taken for agarose gel electrophoresis to determine the specificity of the amplified fragment.

[0060] The amplified products were digested with 1 µL of shrimp alkaline phosphatase (product number: 55953500, Roche) and 2 µL of exonuclease I (product number: AL21979A, TaKaRa) at 37°C for 30 min, and then inactivated at 80°C for 15 min.

[0061] The purified PCR product was diluted with 20 µL of pure water and mixed well. Two oligonucleotide sequencing primers (nucleotide sequences as shown in SEQ ID No. 2 and SEQ ID No. 3) were diluted with pure water to a concentration of 3.2 μmol / L. Sequencing reaction was performed using BigDyeterminator v3.1 sequencing kit (catalog number: 4336699, ABI) and the two sequencing primers were used for sequencing.

[0062] like Figure 1 As shown in Table 3, the genotyping results, compared with the reference sequence (NCBI accession number NG_007475.2), are as follows: the proband has a homozygous c.168delC mutation; her father, mother, daughter, and son are all heterozygous for c.168delC / C, and the sequencing chromatogram shows a frameshift in one strand, resulting in disordered peaks; her husband and sister are wild-type c.168C / C. The PCR-SBT sequencing results are consistent with the whole-genome exon sequencing results.

[0063] The c.168delC deletion mutation is a novel, unreported mutation. The allele resulting from this new mutation is not yet included in the ISBT Allele Database (https: / / blooddatabase.isbtweb.org / system / CO), published by the International Society of Blood Transfusion (ISBT), indicating that this mutated allele is a new allele of the APQ1 gene, leading to the abnormal expression of Aquaporin-1 protein on the erythrocyte membrane, thus eliminating Co. a Antigen, and no Co b Antigen, identified as Co(a) b Phenotype. When they receive Co from regular blood donors a + or Co b When red blood cells are transfused, the immune system recognizes them as "foreign antigens"; the body produces corresponding antibodies; during subsequent transfusions or pregnancy, these antibodies rapidly bind to the transfused red blood cells, leading to hemolytic transfusion reaction (HTR) or hemolytic disease of the newborn. This provides a genetic basis for the establishment of rare blood type banks and the assurance of transfusion compatibility, and can be used for Co(ab-) blood typing.

[0064] Table 3. PCR-SBT results of the proband and his / her family.

[0065] Example 2: Antigen verification of the Co(ab-) phenotype of the proband In the case of a mutation in the Co blood group gene, microcolumn gel cards were used to confirm its antigen. The results showed that the proband's phenotype was indeed Co(ab-). The specific procedure is as follows: Microcolumn gel card assay: Cells were selected from proband erythrocytes and control cells with a clearly defined Co(a+b+) phenotype. Cells were washed three times with physiological saline and then prepared to a 0.8% concentration using LISS buffer. 25 µL of anti-Co was added to each BIO-RAD low-ion anti-human globulin microcolumn gel card (batch number: 0674483629, BIO-RAD). a Antibody (catalog number: 240825, ANTITOXIN GmbH) and anti-Co b Antibody (catalog number: 070525, ANTITOXIN GmbH) and 50 µL of 0.8% cells were mixed, incubated at 37°C for 15 minutes, and then centrifuged at 1300 rpm for 10 minutes using a dedicated centrifuge. The results are as follows. Figure 2 As shown, the proband's antigen-antibody reaction was negative, while the cells in the known Co(a+b+) spectrum showed 2+ agglutination, which serologically confirmed that the patient's Co(ab-) phenotype was caused by a novel mutation in the AQP1 gene, c.168delC.

[0066] Figure 2 In the middle, wells 1-3 contain cells and anti-Co. a Antibody reaction, wells 4-6 are for cells and anti-Co. b Antibody reaction. Wells 1, 2, 4, and 5 contain known Co(a+b+) spectrum cells and anti-Co. a Antibodies, anti-Co b The antibody reaction was 2+ positive, indicating that the antibody used had good activity, the detection system was functioning normally, and the antibody was suitable for detection. Wells 3 and 6, where the proband's red blood cells reacted with the antibody, showed negative results, indicating that the surface of their red blood cells completely lacked Co. a and Co b The antigen confirmed that the blood type was Co(ab-). This result is consistent with the molecular mechanism by which c.168delC / delC leads to complete loss of function of the AQP1 protein.

[0067] Example 3: In vitro cell expression experiment verification This embodiment uses in vitro cell expression to demonstrate that the c.168delC mutation in the AQP1 gene can directly lead to the Co(ab-) phenotype. The specific steps are as follows: (1) Construction of wild-type and mutant expression plasmids With wild-type AQP1 gene CO*01.01 Using the full-length cDNA (NM_198098.4) as the wild-type, an AQP1 full-length cDNA template containing the following mutations was designed. Wild-type plasmid: Co(a+); Mutant plasmid: Normal Co(b+). 134C>T Co(ab-) 168delC Co(ab-) 308_309insT Where Co(ab-) 168delC It's a newly discovered mutation, Co(ab-). 308_309insT The mutation was the known Co(ab-) mutation published by ISBT, serving as a control with the same Co(ab-) phenotype. Simultaneously, based on the needs of the expression experiment, a kozak sequence was added to the 5' end of the sequence to enhance expression. The wild-type and mutant gene cDNAs were all synthesized by Nanjing GenScript and cloned into the pcDNA3.1(+) expression vector. The recombinant plasmid was verified by full-sequence sequencing.

[0068] Wild-type AQP1 gene cloned into expression vector CO*01.01 The full-length cDNA sequence (including modified sequences) is shown in SEQ ID NO.4. Co(b+) 134C>T The sequence is shown in SEQ ID NO.5. Co(ab-) 168delCThe mutant clone sequence is shown in SEQ ID NO.6. Co(a-b-) 308_309insT The mutant clone sequence is shown in SEQ ID NO.7.

[0069] AQP1 gene CO*01.01 Full-length cDNA sequence: GCCACC ATGGCCAGCGAGTTCAAGAAGAAGCTCTTCTGGAGGGCAGTGGTGGCCGAGTTCCTGGCCACGACCCTCTTTGTCTTCATCAGCATCGGTTCTGCCCTGGGCTTCAAATACCCGGTGGGGAACAACCAGACGGCGGTCCAGGACAACGTGAAGGTGTCGCTGGCCTTCGGGCTGAGCATCGCCACGCTGGCGCAGAGTGTGGGCCACATCAGCGGCGCCCACCTCAACCCGGCTGTCACACTGGGGCTGCTGCTCAGCTGCCAGATCAGCATCTTCCGTGCCCTCATGTACATCATCGCCCAGTGCGTGGGGGCCATCGTCGCCACCGCCATCCTCTCAGGCATCACCTCCTCCCTGACTGGGAACTCGCTTGGCCGCAATGACCTGGCTGATGGTGTGAACTCGGGCCAGGGCCTGGGCATCGAGATCATCGGGACCCTCCAGCTGGTGCTATGCGTGCTGGCTACTACCGACCGGAGGCGCCGTGACCTTGGTGGCTCAGCCCCCCTTGCCATCGGCCTCTCTGTAGCCCTTGGACACCTCCTGGCTATTGACTACACTGGCTGTGGGATTAACCCTGCTCGGTCCTTTGGCTCCGCGGTGATCACACACAACTTCAGCAACCACTGGATTTTCTGGGTGGGGCCATTCATCGGGGGAGCCCTGGCTGTACTCATCTACGACTTCATCCTGGCCCCACGCAGCAGTGACCTCACAGACCGCGTGAAGGTGTGGACCAGCGGCCAGGTGGAGGAGTATGACCTGGATGCCGACGACATCAACTCCAGGGTGGAGATGAAGCCCAAATAG (SEQ ID NO.4).

[0070] Co(b+)134C>T Sequence: GCCACC ATGGCCAGCGAGTTCAAGAAGAAGCTCTTCTGGAGGGCAGTGGTGGCCGAGTTCCTGGCCACGACCCTCTTTGTCTTCATCAGCATCGGTTCTGCCCTGGGCTTCAAATACCCGGTGGGGAACAACCAGACGGTGGTCCAGGACAACGTGAAGGTGTCGCTGGCCTTCGGGCTGAGCATCGCCACGCTGGCGCAGAGTGTGGGCCACATCAGCGGCGCCCACCTCAACCCGGCTGTCACACTGGGGCTGCTGCTCAGCTGCCAGATCAGCATCTTCCGTGCCCTCATGTACATCATCGCCCAGTGCGTGGGGGCCATCGTCGCCACCGCCATCCTCTCAGGCATCACCTCCTCCCTGACTGGGAACTCGCTTGGCCGCAATGACCTGGCTGATGGTGTGAACTCGGGCCAGGGCCTGGGCATCGAGATCATCGGGACCCTCCAGCTGGTGCTATGCGTGCTGGCTACTACCGACCGGAGGCGCCGTGACCTTGGTGGCTCAGCCCCCCTTGCCATCGGCCTCTCTGTAGCCCTTGGACACCTCCTGGCTATTGACTACACTGGCTGTGGGATTAACCCTGCTCGGTCCTTTGGCTCCGCGGTGATCACACACAACTTCAGCAACCACTGGATTTTCTGGGTGGGGCCATTCATCGGGGGAGCCCTGGCTGTACTCATCTACGACTTCATCCTGGCCCCACGCAGCAGTGACCTCACAGACCGCGTGAAGGTGTGGACCAGCGGCCAGGTGGAGGAGTATGACCTGGATGCCGACGACATCAACTCCAGGGTGGAGATGAAGCCCAAATAG (SEQ ID NO.5).

[0071] Co(a-b-) 168delC Sequence: GCCACCATGGCCAGCGAGTTCAAGAAGAAGCTCTTCTGGAGGGCAGTGGTGGCCGAGTTCCTGGCCACGACCCTCTTTGTCTTCATCAGCATCGGTTCTGCCCTGGGCTTCAAATACCCGGTGGGGAACAACCAGACGGCGGTCCAGGACAACGTGAAGGTGTCGCTGGCCTTGGGCTGAGCATCGCCACGCTGGCGCAGAGTGTGGGCCACATCAGCGGCGCCCACCTCAACCCGGCTGTCACACTGGGGCTGCTGCTCAGCTGCCAGATCAGCATCTTCCGTGCCCTCATGTACATCATCGCCCAGTGCGTGGGGGCCATCGTCGCCACCGCCATCCTCTCAGGCATCACCTCCTCCCTGACTGGGAACTCGCTTGGCCGCAATGACCTGGCTGATGGTGTGAACTCGGGCCAGGGCCTGGGCATCGAGATCATCGGGACCCTCCAGCTGGTGCTATGCGTGCTGGCTACTACCGACCGGAGGCGCCGTGACCTTGGTGGCTCAGCCCCCCTTGCCATCGGCCTCTCTGTAGCCCTTGGACACCTCCTGGCTATTGACTACACTGGCTGTGGGATTAACCCTGCTCGGTCCTTTGGCTCCGCGGTGATCACACACAACTTCAGCAACCACTGGATTTTCTGGGTGGGGCCATTCATCGGGGGAGCCCTGGCTGTACTCATCTACGACTTCATCCTGGCCCCACGCAGCAGTGACCTCACAGACCGCGTGAAGGTGTGGACCAGCGGCCAGGTGGAGGAGTATGACCTGGATGCCGACGACATCAACTCCAGGGTGGAGATGAAGCCCAAATAG (SEQ ID NO.6).

[0072] Co(a-b-) 308_309insT Sequence: GCCACCATGGCCAGCGAGTTCAAGAAGAAGCTCTTCTGGAGGGCAGTGGTGGCCGAGTTCCTGGCCACGACCCTCTTTGTCTTCATCAGCATCGGTTCTGCCCTGGGCTTCAAATACCCGGTGGGGAACAACCAGACGGCGGTCCAGGACAACGTGAAGGTGTCGCTGGCCTTCGGGCTGAGCATCGCCACGCTGGCGCAGAGTGTGGGCCACATCAGCGGCGCCCACCTCAACCCGGCTGTCACACTGGGGCTGCTGCTCAGCTGCCAGATCAGCATCTTCCGTGCCCTCATGTACATCATCGCCCAGTGCGTTGGGGGCCATCGTCGCCACCGCCATCCTCTCAGGCATCACCTCCTCCCTGACTGGGAACTCGCTTGGCCGCAATGACCTGGCTGATGGTGTGAACTCGGGCCAGGGCCTGGGCATCGAGATCATCGGGACCCTCCAGCTGGTGCTATGCGTGCTGGCTACTACCGACCGGAGGCGCCGTGACCTTGGTGGCTCAGCCCCCCTTGCCATCGGCCTCTCTGTAGCCCTTGGACACCTCCTGGCTATTGACTACACTGGCTGTGGGATTAACCCTGCTCGGTCCTTTGGCTCCGCGGTGATCACACACAACTTCAGCAACCACTGGATTTTCTGGGTGGGGCCATTCATCGGGGGAGCCCTGGCTGTACTCATCTACGACTTCATCCTGGCCCCACGCAGCAGTGACCTCACAGACCGCGTGAAGGTGTGGACCAGCGGCCAGGTGGAGGAGTATGACCTGGATGCCGACGACATCAACTCCAGGGTGGAGATGAAGCCCAAATAG (SEQ ID NO.7).

[0073] Among them, the underlined part in the sequence is the KOZAK sequence.

[0074] (2) Transfection and stable screening of 293 cells One day before transfection, inoculate 1×10 5Cells were cultured overnight at 37°C with 5% CO2. Transfection was performed the following day after cells reached approximately 70% confluence. Lipofectamine was used. TM Liposome transfection of cells was performed using reagent 3000 (lot number: L3000075, Thermo Fisher). The specific procedure was as follows: 125µL of Opti-MEM was used... TM Culture medium with 5 µL Lipofectamine TM Mix the 3000 reagent thoroughly. Then use 125µL Opti-MEM. TM Dilute 2.5 µg of DNA in the culture medium to prepare a DNA premix, then add 5 µL of P3000 reagent and mix thoroughly. Add the diluted Lipofectamine to each tube. TM Diluted DNA (1:1 ratio) was added to 3000 reagent and mixed by pipetting. The mixture was incubated at room temperature for 15 minutes to prepare the DNA-liposome complex. The liposomes were added to the cells and gently mixed in a figure-eight motion. The cells were incubated at 37°C for 48 hours. After 48 hours, the cells were screened with 1000 μg / ml G418 (batch number: 10131035, Gibco) to select positive clones. Positive clones were obtained after 2 weeks of G418 screening.

[0075] (3) Flow cytometry detection of Co on cell surface a and Co b Antigen expression Flow cytometry was used to detect Co on red blood cells using an indirect method. a Antigen expression. Briefly as follows: Prepare 50 µL of cell suspension, with approximately 5 × 10⁶ cells. 5 Add 50µL of primary antibody to each sample; the IgG-type Co... a Antibody (catalog number: 240825, ANTITOXIN GmbH) and anti-Co b The antibody (catalog number: 070525, ANTITOXIN GmbH) was incubated for 1 hour, washed 3 times with PBS, and then APC-labeled IgG secondary antibody was added. The mixture was mixed and reacted at room temperature in the dark for 30 minutes. After centrifugation and washing once with PBS, 500µL of PBS was added and the mixture was immediately loaded onto the instrument.

[0076] The stained cells were analyzed on a BD FACSuite flow cytometer. Fluorescence was detected in 10,000 cells obtained using BD FACSuite software. The distribution of positive cells, average fluorescence intensity, and cell surface Jk were used as the basis for analysis. a Antigen expression status. The analysis results are as follows: Figures 3-6 As shown: Using 293 cells transfected with an empty plasmid as a negative control, comparisons of positive cell distribution and average fluorescence intensity revealed that wild-type cells successfully expressed a large amount of CO. a Antigen. Normal Co(b+) 134C>T Successfully expressed a large amount of CO b Antigen. And the mutant Co(ab-) 168delC Antigen expression status compared to empty plasmids and known Co(ab-) plasmids. 308_309insT The mutant strains showed largely consistent in vitro expression, but did not express CO. a antigen and CO b Antigen. Mutant Co(ab-) 168delC The in vitro expression of c.168delC mutation in cells indicates a necessary direct causal relationship between the c.168delC mutation and the Co(ab-) phenotype. Furthermore, in the case of the proband with a homozygous c.168delC mutation in the AQP1 gene, the proband will inevitably exhibit the Co(ab-) phenotype.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of a substance for detecting SNP sites of the AQP1 gene in Co(ab-) blood typing or the preparation of Co(ab-) blood typing products, characterized in that, The SNP site includes the c.168delC deletion mutation at position 168, starting from the start codon in the coding region of the AQP1 gene.

2. The application according to claim 1, characterized in that, The product includes a substance that detects the c.168delC deletion mutation at position 168, starting from the start codon in the coding region of the AQP1 gene.

3. The application according to claim 2, characterized in that, The substance used to detect the c.168delC deletion mutation at position 168, starting from the start codon in the AQP1 gene coding region, includes one or more of the following: reagents for nucleic acid extraction and amplification, reagents for detecting nucleic acid amplification products, or reagents for sequencing.

4. The application according to claim 3, characterized in that, The substance for detecting the c.168delC deletion mutation at position 168 starting from the start codon in the coding region of the AQP1 gene includes a primer pair for amplifying the c.168delC deletion mutation at position 168 starting from the start codon in the coding region of the AQP1 gene, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.

3.

5. A reagent for Co(ab-) blood typing, characterized in that, This includes amplification primers for detecting the c.168delC deletion mutation at position 168, starting from the start codon in the coding region of the AQP1 gene.

6. The reagent according to claim 5, characterized in that, The nucleotide sequences of the amplification primers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

7. The reagent according to claim 6, characterized in that, It also includes sequencing primers, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.

3.

8. A reagent kit for Co(ab-) blood typing, characterized in that, Includes the reagents described in any one of claims 5 to 7.

9. A method for Co(ab-) blood typing, characterized in that, The blood sample to be tested is amplified using the kit described in claim 8, and the amplification products are sequenced and genotyped. If the blood sample to be tested is homozygous for c.168delC, the blood type of the blood sample to be tested is determined to be Co(ab-) blood type.

10. The use of the substance for detecting SNP sites of the AQP1 gene as described in claim 1, or the reagent as described in any one of claims 5 to 7, or the kit as described in claim 8, in assessing the risk of immune hemolytic transfusion reactions or in preparing products for assessing the risk of immune hemolytic transfusion reactions; The reaction includes the reaction by Co a or Co b Immunological hemolytic transfusion reaction caused by antigen-antibody incompatibility.

Images