A loop-mediated isothermal amplification primer composition for detecting planococcus ficus, a biological material and application thereof
By designing a specific loop-mediated isothermal amplification (LAMP) primer composition FSCOI and combining it with a visualization detection method, the problem of rapid and accurate detection of hibiscus mealybug was solved, achieving detection results with high sensitivity and good stability.
Patent Information
- Application Number
- CN202610305637.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-13
- Publication Date
- 2026-07-10
AI Technical Summary
Existing technologies are insufficient for the rapid, accurate, sensitive, specific, and stable detection of the hibiscus mealybug, which affects the effectiveness of quarantine and monitoring.
Using loop-mediated isothermal amplification (LAMP) technology, a primer combination FSCOI specifically for detecting the hibiscus mealybug was designed. It consists of outer primer pairs FSCOI-F3 and FSCOI-B3, and inner primer pairs FSCOI-FIP and FSCOI-BIP. Combined with a visual detection method, the presence of the hibiscus mealybug is determined by color change.
It achieves high sensitivity, strong specificity, good reproducibility and strong stability in the detection of hibiscus mealybug, and can identify hibiscus mealybugs from different sources and developmental stages, providing technical support for rapid detection and accurate identification.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention specifically relates to a loop-mediated isothermal amplification primer composition, biomaterial, and its application for detecting the hibiscus mealybug. Background Technology
[0002] Hibiscus mealybug Phenacoccus solenopsis The hibiscus mealybug (Pseudococcidae) is a quarantine pest widely distributed worldwide. Hibiscus mealybugs primarily damage host plants by sucking sap from petioles, leaves, and young branches, causing twisted and deformed branches and leaves, weakened growth, slowed or even stopped growth, dehydration, and reduced fruit production. Fruits are poorly developed and deformed. The honeydew secreted by the hibiscus mealybug easily leads to sooty mold and hinders photosynthesis, causing yellowing and leaf drop, and in severe cases, even widespread death of the host plant. Adult females have a high reproductive capacity, lay many eggs, and experience significant generation overlap, engaging in both sexual and parthenogenesis.
[0003] The hibiscus mealybug can damage 55 species of plants from 18 families, posing a significant threat to the safe production of various crops such as cotton and tomatoes. Therefore, strengthening quarantine and monitoring necessitates the establishment of a rapid and accurate molecular detection method. Developing a detection method that is highly sensitive, specific, rapid, simple, reproducible, and stable is a technical problem that needs to be solved by those skilled in the art. Summary of the Invention
[0004] The technical problem solved by this invention is how to detect the hibiscus mealybug with high sensitivity, strong specificity, good reproducibility and strong stability.
[0005] To address the aforementioned issues, this application provides a visual loop-mediated isothermal amplification (LAMP) primer composition, biomaterial, and its application for identifying the hibiscus mealybug.
[0006] The primer composition FSCOI consists of outer primer pairs FSCOI-F3 and FSCOI-B3, and inner primer pairs FSCOI-FIP and FSCOI-BIP. Wherein, FSCOI-F3 is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No.1, or a DNA molecule of SEQ ID No.1 that has undergone nucleotide substitution and / or deletion and / or addition and has the same function as SEQ ID No.1; The FSCOI-B3 is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No.2, or a DNA molecule with the same function as SEQ ID No.1, but with nucleotide substitution and / or deletion and / or addition. The FSCOI-FIP is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No. 3, or a DNA molecule with the same function as SEQ ID No. 1, which has undergone nucleotide substitution and / or deletion and / or addition. The FSCOI-BIP is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No. 4, or a DNA molecule with nucleotide substitution and / or deletion and / or addition of SEQ ID No. 4 that has the same function as SEQ ID No. 1.
[0007] In the primer composition FS-COI described above, the molar ratio of FSCOI-F3 to FSCOI-B3 is 1:1, and the molar ratio of FSCOI-FIP to FSCOI-BIP is 1:1.
[0008] To address the aforementioned issues, this application also provides biological materials for primer compositions used to identify the hibiscus mealybug.
[0009] The biomaterial includes any of the following: D1) Loop-mediated isothermal amplification (LAMP) reagent containing the above primer composition; D2) A kit containing the primer composition described above or the loop-mediated isothermal amplification (LAMP) kit described in D1); D3) A detection instrument containing the above primer composition, the loop-mediated isothermal amplification (LAMP) reagent described in D1), or the kit described in D2).
[0010] The use of the above primer composition in any of the following: E1) Application in assisting in the detection or detection of whether the mealybug to be tested is the hibiscus mealybug; E2) Application in the preparation of products for auxiliary detection or detection of whether the mealybug to be tested is hibiscus mealybug.
[0011] The application of the above-mentioned biomaterials in any of the following: E1) Application in assisting in the detection or detection of whether the mealybug to be tested is the hibiscus mealybug; E2) Application in the preparation of products for auxiliary detection or detection of whether the mealybug to be tested is hibiscus mealybug.
[0012] In the above text, the mealybug to be tested may be at least one of the following: Hibiscus mealybug, New pineapple mealybug, Banyan mealybug, Oceanic mealybug, Pineapple mealybug, Jack Bell's mealybug, Liby's mealybug, Citrus spiny mealybug, Glandular spiny mealybug, Long-tailed mealybug, South Pacific mealybug, Citrus spiny mealybug, Sugarcane cluster mealybug, Papaya mealybug, Wax mealybug, Lycoris mealybug, and Hibiscus syriacus mealybug.
[0013] In the above applications, the mealybug to be tested is at least one of the following: Hibiscus mealybug, New pineapple mealybug, Banyan mealybug, Oceanic mealybug, Pineapple mealybug, Jack Bell's mealybug, Liby's mealybug, Citrus spiny mealybug, Glandular spiny mealybug, Long-tailed mealybug, South Pacific mealybug, Citrus spiny mealybug, Sugarcane cluster mealybug, Papaya mealybug, Wax mealybug, Lycoris mealybug, and Hibiscus syriacus mealybug.
[0014] To address the aforementioned issues, this application provides a visual loop-mediated isothermal amplification detection method for detecting the hibiscus mealybug and its detection primers.
[0015] The method includes performing visual loop-mediated isothermal amplification (LAMP) on the target mealybug using the primer composition or the biological material described above, and determining whether the target mealybug is *Hippophae rhamnoides* based on the color change of the reaction product of the visual loop-mediated isothermal amplification (LAMP).
[0016] This application utilizes visual loop-mediated isothermal amplification (LAMP) for specific amplification.
[0017] In the above text, the visualization loop-mediated isothermal amplification (LAMP) reaction system can be a 25 μl system, which includes 12.5 µL of 2× MasterMix, 4 µL of FIP (10 µmol / L), 4 µL of BIP (10 µmol / L), 0.5 µL of F3 (10 µmol / L), 0.5 µL of B3 (10 µmol / L), 2 µL of template DNA, and 1.5 µL of sterile double-distilled water (ddH2O).
[0018] In the above text, the visualization loop-mediated isothermal amplification (LAMP) program can be set to 60°C for 30 minutes.
[0019] In the above text, the product of the loop-mediated isothermal amplification reaction can be defined as whether or not the color of the product of the loop-mediated isothermal amplification reaction changes.
[0020] In the above method, the mealybug to be tested is at least one of the following: Hibiscus mealybug, New pineapple mealybug, Banyan mealybug, Oceanic mealybug, Pineapple mealybug, Jack Bell's mealybug, Liby's mealybug, Citrus spiny mealybug, Glandular spiny mealybug, Long-tailed mealybug, South Pacific mealybug, Citrus spiny mealybug, Sugarcane cluster mealybug, Papaya mealybug, Wax mealybug, Lycoris mealybug, and Hibiscus syriacus mealybug. In the above method, in the loop-mediated isothermal amplification (LAMP), the molar ratio of FIP to BIP is 1:1, and the molar ratio of F3 to B3 is 1:1.
[0021] In the above text, the amplification system is 25 μL.
[0022] The reaction system contained 0.05 μM F3, 0.05 μM B3, 0.4 μM FIP, 0.4 μM BIP, 12.5 μM 2× Master Mix, and dd H2O as the solvent.
[0023] The reaction system described above also includes 2 µL of the mealybug template DNA to be tested.
[0024] The Master Mix mentioned above was purchased from NEB, with part number M1800S.
[0025] In the above method, the reaction conditions for loop-mediated isothermal amplification (LAMP) are a reaction temperature of 60°C and a reaction time of 30 min.
[0026] This invention designs a primer composition FSCOI for the specific detection of *Metacladus hibiscus* using the COI gene, based on the visualization loop-mediated isothermal amplification (LAMP) of *Metacladus hibiscus*. The primer composition FSCOI consists of outer primer pairs FSCOI-F3 and FSCOI-B3, and inner primer pairs FSCOI-FIP and FSCOI-BIP. FSCOI-F3 is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No. 1; FSCOI-B3 is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No. 2; FSCOI-FIP is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No. 3; and FSCOI-BIP is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No. 4. Using genomic DNA from *Hibiscus mealybug*, *Neoprothodon mealybug*, *Ficus mealybug*, *Oceano mealybug*, *Pineapple mealybug*, *Jack Bell's mealybug*, *Libyllie's mealybug*, *Citrus spiny mealybug*, *Glandular mealybug*, *Long-tailed mealybug*, *South Pacific mealybug*, *Citrus spiny mealybug*, *Sugarcane cluster mealybug*, *Papaya mealybug*, *Hemiberles mealybug*, *Lycoris mealybug*, and *Hibiscus rosa-sinensis mealybug* as templates, loop-mediated isothermal amplification (LAMP) was performed on the genomic DNA using the outer primer pairs FSCOI-F3 and FSCOI-B3, and the inner primer pairs FSCOI-FIP and FSCOI-BIP of the aforementioned primer combination FSCOI. The results showed that only the reaction product of *Hibiscus mealybug* changed from pink to light yellow. The primer combination FSCOI, consisting of the outer primer pairs FSCOI-F3 and FSCOI-B3 and the inner primer pairs FSCOI-FIP and FSCOI-BIP, was demonstrated to specifically amplify the hibiscus mealybug.
[0027] Furthermore, further studies were conducted on *Tobacco simonii* (collected on October 20, 2022) from COFCO Haijia in Xiamen, *Bougainvillea chinensis* (collected on October 9, 2022) from Thailand, *Gynostemma pentaphyllum* (collected on December 1, 2017) from Taiwan, *Hibiscus rosa-sinensis* (collected on October 6, 2024) from Xianyue Mountain Park in Xiamen, *Hibiscus rosa-sinensis* (collected on January 9, 2024) from Haicang in Xiamen, *Solanum lyratum* (collected on November 9, 2022) from Hailong Wharf in Xiamen, *Hippophae rhamnoides* (collected on August 1, 2019) from Jimei in Xiamen, *Hypericum perforatum* (collected on September 1, 2017) from Jimei in Xiamen, *Hypericum perforatum* (collected on December 5, 2017) from Zhaoyin Port in Zhangzhou, and *Hypericum vulgare* (collected in Zhangzhou). Genomic DNA of mealybugs from *Hymenochloa crus-galli* (collected August 10, 2017), *Hymenochloa chinensis* (collected October 9, 2019), *Pharbitis nil* (collected August 26, 2022), *Nelumbo nucifera* (collected July 12, 2022), and *Lantana camara* (collected July 28, 2022) at Xiamen Tongwei Feed Co., Ltd. was used as templates. Loop-mediated isothermal amplification of the genomic DNA was performed using the outer primer pairs FSCOI-F3 and FSCOI-B3, and the inner primer pairs FSCOI-FIP and FSCOI-BIP. The results were consistent with the detection results, all identifying *Hymenochloa crus-galli* as mealybugs.
[0028] Its sensitivity was further verified, and the results showed that the reaction system established in this invention can amplify 10 -4 The DNA template of *Hibiscus mealybug* at a certain concentration can also amplify the DNA template of a single egg, a single first instar nymph, a single second instar nymph, a single third instar nymph, and a single adult remains of *Hibiscus mealybug*.
[0029] As shown above, using outer primers for FSCOI-F3 and FSCOI-B3, and inner primers for FSCOI-FIP and FSCOI-BIP, has the advantages of high sensitivity, strong specificity, good reproducibility and strong stability.
[0030] This invention addresses the problem of the hibiscus mealybug, which easily spreads with the movement of host plants, posing a significant threat to agricultural and forestry production, yet is difficult to identify quickly and accurately. It employs species-specific loop-mediated isothermal amplification (LAMP) technology based on the COI gene to study a rapid detection technique from a monitoring perspective. Simultaneously, 16 species of mealybugs from other genera frequently intercepted at ports of entry are used as controls for species-specific testing. The application of this technology is validated using hibiscus mealybugs from different sources and at different developmental stages and instars. The establishment of this detection technology system provides a basis for the visual, rapid detection and accurate identification of the hibiscus mealybug, offering technical support for effectively preventing its further spread and damage in my country. Attached Figure Description
[0031] Figure 1 This is a visual detection result of the primer composition FS-COI on the mealybug and its closely related species. 1. Hibiscus mealybug (meatbug 1); 2. New pineapple mealybug (meatbug 15); 3. Banyan mealybug (meatbug 16); 4. Pacific mealybug (meatbug 17); 5. Pineapple mealybug (meatbug 18); 6. Jack Bell's mealybug (meatbug 19); 7. Liby's mealybug (meatbug 20); 8. Citrus spiny mealybug (meatbug 21); 9. Glandular spiny mealybug (meatbug 22); 10. Long-tailed mealybug (meatbug 23); 11. South Pacific mealybug (meatbug 24); 12. Citrus spiny mealybug (meatbug 25); 13. Sugarcane cluster mealybug (meatbug 26); 14. 15. Papaya mealybug (meatybug 27); 16. Wax mealybug (meatybug 28); 17. Lycoris mealybug (meatybug 29); 18. Hibiscus mealybug (meatybug 30); 19. Blank control.
[0032] Figure 2 Electrophoresis diagram showing the visualization detection results of the primer composition FS-COI on the hibiscus mealybug.
[0033] Figure 3 This is a visualization of the detection results of the primer composition FS-COI on different hosts of the hibiscus mealybug in different countries and regions. 1. Hibiscus mealybug (meatbug 1); 2. Hibiscus mealybug (meatbug 2); 3. Hibiscus mealybug (meatbug 3); 4. Hibiscus mealybug (meatbug 4); 5. Hibiscus mealybug (meatbug 5); 6. Hibiscus mealybug (meatbug 6); 7. Hibiscus mealybug (meatbug 7); 8. Hibiscus mealybug (meatbug 8); 9. Hibiscus mealybug (meatbug 9); 10. Hibiscus mealybug (meatbug 10); 11. Hibiscus mealybug (meatbug 11); 12. Hibiscus mealybug (meatbug 12); 13. Hibiscus mealybug (meatbug 13); 14. 15. Blank control; 16. Blank control.
[0034] Figure 4 This image shows the results of loop-mediated isothermal amplification visualization (LAMP) of different concentrations of DNA from the hibiscus mealybug (mealybug 1) using the primer combination FS-COI. 1. 10 0 2.10 -1 3.10 -2 ; 4. 10 -3 5. 10 -4 6.10 -4 7. Blank control.
[0035] Figure 5This image shows the results of loop-mediated isothermal amplification visualization (LAMP) detection of single eggs, single newly hatched nymphs, single second-instar nymphs, single third-instar nymphs, and single adult remains of the sugarcane mealybug using the primer combination FS-COI. 1. Single egg; 2. Single newly hatched nymph; 3. Single second-instar nymph; 4. Single third-instar nymph; 5. Single adult remains; 6. Single adult; 7. Blank control. Detailed Implementation
[0036] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0038] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0039] Example 1: Visual detection results of primer composition FSCOI against hibiscus mealybug 1. Obtaining the mealybug: This invention obtained 30 samples, which were numbered as Sample 1 to Sample 30. Adult mealybugs were extracted from the samples. The adult mealybugs obtained from Sample 1 to Sample 30 were numbered as Mealybug 1 to Mealybug 30 (as shown in Table 1).
[0040] Based on classic morphological identification methods (see Table 2), morphological observation of mealybugs 1-30 under a microscope revealed that mealybugs 1-14 are *Hibiscus mealybugs*. Phenacoccus solenopsis Tinsley, Pink Scale 15 is a new pineapple gray pink scale. Dysmicoccus neobrevipes (Beardsley), mealybug 16 is the fig mealybug. Pseudococcus baliteus Lit, Pink Crab 17 is a large oceanic pink crab. Planococcus minor (Maskell), 18 is a pineapple gray mealybug. Dysmicoccus brevipes (Cockerell), mealybug 19 is Jack Bell's mealybug. Pseudococcus jackbeardsleyi Gimpel & Miller, Pink Crab 20 is Liebil's Grey Pink Crab Dysmicoccus lepelleyi Betrem, mealybug 21 is a citrus spiny mealybug.Pseudococcus cryptus (Hempel), mealybug 22 is the glandular-spined mealybug. Ferrisia virgata Cockerell, the long-tailed mealybug (also known as the mealybug 23) Pseudococcus longispinus (Targioni & Tozzetti), Pink Scale 24 is a South Sea Pink Scale with rump markings. Planococcus lilacinus Cockerell, Pink Crab 25 is a citrus-scented pink crab. Planococcus citri (Risso), mealybug 26 is sugarcane cluster mealybug. Exallomochlus hispidus (Morrison), Pink Crab 27 is Papaya Show Pink Crab Paracoccus marginatus Williams & Granarade Willink, mealybug 28 is a wax mealybug. Nipaecoccus vastator Maskell, mealybug 29 is Lycoris radiata mealybug. Phenacoccus solani Ferris, 30 is Hibiscus syriacus mealybug. Maconellicoccus hirsutus (Green).
[0041] Table 1. Source and species identification of 30 mealybug samples
[0042] Table 2 Morphological identification criteria for mealybugs
[0043] 2. Preparation of mealybug template DNA 1) Preparation method of template DNA from mealybug 1-meatybug 30: Genomic DNA was extracted using the Dneasy Blood and Tissue Nucleic Acid Extraction Kit (centrifuge column type) (QIAGEN, NO: 69504), including the following steps: (1) Place a single adult mealybug to be tested in a 1.5 mL centrifuge tube, add about 1 mL of pure water, tighten the cap, shake on a circumferential shaker for 15 s, remove the mealybug and place it on a high-temperature sterilized filter paper to absorb the moisture, and air dry to allow the mealybug body to dry fully, thus obtaining a clean and dry mealybug body.
[0044] (2) Take a new 1.5mL centrifuge tube, put the washed and dried mealybugs into it, and use the tip as a homogenizer to grind them thoroughly.
[0045] (3) Add 180µL of Buffer ATL to the centrifuge tube (while cleaning the tip), then add 20µL of Proteinase K, shake gently to mix, and centrifuge.
[0046] (4) Place the centrifuge tube in a 56°C constant temperature water bath shaker and shake (650 rpm) for 30 min. After removing it, centrifuge for 10 s.
[0047] (5) Add 200µL of Buffer AL to the centrifuge tube, vortex to mix, centrifuge for 10s, and let stand at 56℃ for 10min.
[0048] (6) Add 200µL of anhydrous ethanol to the centrifuge tube, vortex to mix, and centrifuge for 3 min.
[0049] (7) Transfer the mixture in the centrifuge tube to a 2 mL collection tube containing DNeasy mini, centrifuge at 12000 rpm for 1 min, and discard the filtrate and collection tube.
[0050] (8) Place the spin column back into the 2mL collection tube, add 500µL Buffer AW1, centrifuge at 8000rpm for 1min, and discard the filtrate and collection tube.
[0051] (9) Place the spin column back into the 2 mL collection tube, add 500 µL Buffer AW2, centrifuge at 10000 rpm for 1 min, and discard the filtrate and collection tube.
[0052] (10) Place the spin column back into a new 1.5 mL centrifuge tube.
[0053] (11) Add 100 µL Buffer AE to the Spin column, let stand at room temperature for 1 min, and centrifuge at 8000 rpm for 2 min to obtain the genomic DNA solution.
[0054] (12) Store the extracted genomic DNA at -20 ℃ for later use.
[0055] The above-described method for preparing mealybug template DNA was used to treat *Hibiscus mealybug* (samples 1-14 in Table 1, i.e., mealybug 1-14), *Neopterygii mealybug* (sample 15 in Table 1, i.e., mealybug 15), *Ficus mealybug* (sample 16 in Table 1, i.e., mealybug 16), *Symplocos natans* (sample 17 in Table 1, i.e., mealybug 17), *Neopterygii mealybug* (sample 18 in Table 1, i.e., mealybug 18), *Jackbell's mealybug* (sample 19 in Table 1, i.e., mealybug 19), and *Libyllerygii mealybug*. Scale insects (sample 20 in Table 1, i.e., mealybug 20), Citrus spiny mealybug (sample 21 in Table 1, i.e., mealybug 21), Glandular spiny mealybug (sample 22 in Table 1, i.e., mealybug 22), Long-tailed mealybug (sample 23 in Table 1, i.e., mealybug 23), South Pacific rump mealybug (sample 24 in Table 1, i.e., mealybug 24), Citrus rump mealybug (sample 25 in Table 1, i.e., mealybug 25), Sugarcane cluster mealybug (sample 26 in Table 1, i.e., mealybug 26), Papaya tuft mealybug (sample 27 in Table 1) Genomic DNA was extracted from *Metacarpa spp.* (sample 27), *Metacarpa elegans* (sample 28 in Table 1), *Metacarpa lycoris* (sample 29 in Table 1), and *Metacarpa hibiscus* (sample 30 in Table 1). Genomic DNA solutions were obtained from *Metacarpa hibiscus*, *Metacarpa pygmygdalis*, *Metacarpa spp.*, *Metacarpa spp.*, and *Metacarpa jackbellii*. Genomic DNA solutions for the following mealybugs: Libyllicium lepidocrocum, Citrus spur mealybug, Glandular mealybug, Long-tailed mealybug, Southern Asian mealybug, Citrus spur mealybug, Sugarcane cluster mealybug, Papaya mealybug, Helicopter mealybug, Lycoris radiata mealybug, and Hibiscus mealybug.
[0056] 2) Synthesis of the specific primer set FSCOI for detecting the hibiscus mealybug. The following primers were synthesized by Shanghai Sangon Biotech Co., Ltd.: outer primer pair: FSCOI-F3: AGATGATTAATAACACTTAATGGAA, sequence 1; FSCOI-B3: AAGGAAATCAAAAAAATAATTCTTGA, sequence 2; Inner primer pair: FSCOI-FIP: TACCAGTTAATCCCCCTAAAGTACATCAACTAATTTTTGATCTATTGGAT, sequence 3; FSCOI-BIP: CTTACATGATACATATTTCGTTGTAGCAAAAATAGAAAAAATTACTCCCATAG, sequence 4.
[0057] 3) Visualization of loop-mediated isothermal amplification (LAMP) reaction system The reaction system consisted of 25 μl, including 12.5 µL of 2× Master Mix, 4 µL of FIP (10 µmol / L), 4 µL of BIP (10 µmol / L), 0.5 µL of F3 (10 µmol / L), 0.5 µL of B3 (10 µmol / L), 2 µL of template DNA, and 1.5 µL of sterile double-distilled water (ddH2O).
[0058] 4) Visualized loop-mediated isothermal amplification (LAMP) program The reaction temperature was 60℃ and the reaction time was 30 min.
[0059] Using the prepared mealybug genomic DNA solutions as templates, the reaction was carried out according to the visual loop-mediated isothermal amplification (LAMP) reaction system (3) and the visual loop-mediated isothermal amplification (LAMP) procedure (4). Each mealybug genomic DNA solution was repeated three times.
[0060] 5) Identification of visual loop-mediated isothermal amplification (LAMP) After completing the visualization of loop-mediated isothermal amplification (LAMP) in step 4), the color change of the reaction product can be observed with the naked eye. Another 5µL of the visualization of loop-mediated isothermal amplification (LAMP) product is separated by 2% agarose gel electrophoresis. After ethidium bromide staining, the result is determined by the presence or absence of ladder-like bands in the amplification product using a gel imaging system.
[0061] 6) Results The results are as follows Figure 1 As shown, Figure 1In reaction tube 1, the genomic DNA of *Hibiscus mealybug* showed a clear color change from pink to light yellow, indicating a positive result. Reaction tubes 2-18 contained genomic DNA solutions of *Neoprothodon spp.*, *Ficus microcarpa*, *Pterocarya spp.*, *Pterocarya spp.*, *Jack Bell's mealybug*, *Libyllie's mealybug*, *Citrus spiny mealybug*, *Gnaphalium affineum*, *Longtail mealybug*, *Pterocarya spp.*, *Citrus spiny mealybug*, *Pterocarya spp.*, *Citrus spiny mealybug*, *Pterocarya spp.*, *Pterocarya spp.*, *Pterocarya spp.*, *Pterocarya spp.*, *Pterocarya spp.*, *Pterocarya spp.*, and *Pterocarya spp.*, respectively. The reaction products showed no color change, remaining pink, indicating a negative result.
[0062] As described above, visual loop-mediated isothermal amplification (LAMP) was performed using the outer primer pair FSCOI-F3 / FSCOI-B3 and the inner primer pair FSCOI-FIP / FSCOI-BIP of the primer combination FSCOI. Genomic DNA of *Hibiscus mealybug* was used as the template solution, and *Hibiscus syriacus*, *Hibiscus syriacus*, *Hibiscus syriacus*, *Hibiscus syriacus*, *Hibiscus syriacus*, *Hibiscus syriacus*, *Hibiscus syriacus*, *Hibiscus syriacus*, and *Hibiscus citrus* were used as the target samples. Genomic DNA solutions of 16 other closely related genera and species of mealybugs, including *Gnaphalium brevicornum*, *Gnaphalium long-tailed*, *Gnaphalium lancifolium*, *Gnaphalium citrinum*, *Gnaphalium canescens*, *Gnaphalium pumilense*, *Gnaphalium arachnoideum*, *Gnaphalium lycopersicum*, and *Gnaphalium hibiscus* (the above 17 mealybug species were identified using the mealybug morphological identification criteria in Table 2, as shown in Table 1), and a blank control were used for visualization loop-mediated isothermal amplification (LAMP) using the primer combination FSCOI. In reaction tube 1, *Gnaphalium hibiscus* showed a color reaction in the reaction product (see Appendix). Figure 1 In reaction tube 1), the reaction products showed no color reaction in 16 other closely related genera and species of mealybugs. This indicates that the outer primers of the screened specific amplification composition FSCOI from *Salix hibiscus* are highly specific for FSCOI-F3 / FSCOI-B3 and the inner primers for FSCOI-FIP / FSCOI-BIP.
[0063] As described above, a method for the specific detection of hibiscus mealybug was constructed, as follows: The specific primer composition FS-COI for the hibiscus mealybug is as follows: outer primer pair: FSCOI-F3: AGATGATTAATAACACTTAATGGAA; FSCOI-B3: AAGGAAATCAAAAAAATAATTCTTGA; Inner primer pair: FSCOI-FIP: TACCAGTTAATCCCCCTAAAGTACATCAACTAATTTTTGATCTATTGGAT; FSCOI-BIP: CTTACATGATACATATTTCGTTGTAGCAAAAATAGAAAAAATTACTCCCATAG.
[0064] 5 µL of *Hibiscus mealybug* visualization loop-mediated isothermal amplification (LAMP) product was separated by 2% agarose gel electrophoresis, stained with ethidium bromide, and then imaged using a gel imaging system. The results are as follows: Figure 2 As shown, the amplification products exhibit ladder-like bands.
[0065] Example 2: Visualized loop-mediated isothermal amplification (LAMP) detection results of primer composition FSCOI on different hosts in different countries and regions of the hibiscus mealybug. The genomic DNA solutions extracted from mealybugs 1-14 in Example 1 were tested using the specific detection method for *Hibiscus mealybug* established in Example 1. The results were determined based on the color change of the reaction product. The results are as follows: Figure 3 As shown, reaction tubes 1-14 represent the results of visualized loop-mediated isothermal amplification (LAMP) detection of mealybugs 1-14. The results indicate that the reaction products of mealybugs 1-14 exhibit a clear color change, changing from pink to light yellow, indicating a positive result; the blank control shows no color change and remains pink, indicating a negative result. This demonstrates that the mealybugs mentioned above are all *Hibiscus mealybug*, and that the established method for specifically detecting *Hibiscus mealybug* has good detection efficacy and stability for *Hibiscus mealybug* from host plants in different countries and regions.
[0066] Example 3: Visualized loop-mediated isothermal amplification (LAMP) detection results of different concentrations of hibiscus mealybug DNA using primer composition FSCOI. 1) Preparation of DNA templates of different concentrations of sugarcane mealybug (1) Take 1 µL of the genomic DNA solution of *Metamorphosum hibiscus* extracted from mealybug 1 in Example 1, and then gradually add it according to 10 -1 10 -2 10 -3 10 -4 10 -5 The concentration was diluted to obtain 10 solutions of genomic DNA from the hibiscus mealybug. -1 Diluent, 10g of Hibiscus mealybug genomic DNA solution -2 Diluent, 10g of Hibiscus mealybug genomic DNA solution -3 Diluted 10g of Hibiscus mealybug genomic DNA solution -4 Diluent and genomic DNA solution of *Hibiscus mealybug* 10-5 The diluted solution should be stored at -20 ℃ for later use.
[0067] The specific detection method for *Hibiscus mealybug* established in Example 1 was used to analyze *Hibiscus mealybug* genomic DNA solutions and 10 μL of *Hibiscus mealybug* genomic DNA solutions. -1 Diluent, 10g of Hibiscus mealybug genomic DNA solution -2 Diluent, 10g of Hibiscus mealybug genomic DNA solution -3 Diluted 10g of Hibiscus mealybug genomic DNA solution -4 Diluent and genomic DNA solution of *Hibiscus mealybug* 10 -5 The diluted solution was tested, and the result was determined based on the color change of the reaction product.
[0068] The results are as follows Figure 4 As shown, Figure 4 Reaction tube 1 shows the results of the genomic DNA analysis of the hibiscus mealybug solution, and reaction tube 2 shows 10 μL of the hibiscus mealybug genomic DNA solution. -1 The dilution test results showed that reaction tube 3 contained 10 μL of genomic DNA solution from the cottony mealybug *Hibiscus rosa-sinensis*. -2 The dilution test results showed that reaction tube 4 contained 10 μL of genomic DNA solution from the cottony mealybug *Hibiscus rosa-sinensis*. -3 The dilution test results show that reaction tube 5 contains 10 μL of genomic DNA solution from the cottony mealybug *Hibiscus rosa-sinensis*. -4 The dilution test results showed that reaction tube 6 contained 10 μL of genomic DNA solution from the cottony mealybug *Hibiscus rosa-sinensis*. -5 The diluent test results are shown in reaction tube 8, which is the blank control test result.
[0069] The results show that... Figure 4 As shown, with 10 0 10 -1 10 -2 10 -3 10 -4 10 -5 Using concentrated sugarcane mealybug DNA as a template, visualized loop-mediated isothermal amplification (LAMP) was performed using the primer combination FSCOI. 0 10 -1 10 -2 10 -3 10 -4 All concentrations of *Hibiscus mealybug* genomic DNA showed a color reaction, with the reaction product changing from pink to light yellow, indicating a positive result; dilutions up to 10% also showed a positive result. -5 When the reaction product showed no color change and remained pink, the blank control also showed no color change and was negative. This indicates that the FSCOI visualized loop-mediated isothermal amplification (LAMP) assay, a specific primer combination for the screened hibiscus mealybug, has high sensitivity.
[0070] Example 4: Visualized loop-mediated isothermal amplification (LAMP) detection results of different life stages of the hibiscus mealybug using primer composition FSCOI. 1) Obtaining single eggs, single 1st instar nymphs, single 2nd instar nymphs, single 3rd instar nymphs, and single adult remains of *Hibiscus mealybug*: The hibiscus mealybug reproduces parthenogenetically. By inoculating a single hibiscus mealybug (i.e., mealybug 1) onto a potato and raising it, hibiscus mealybug eggs, 1st instar nymphs, 2nd instar nymphs, 3rd instar nymphs and adults can be obtained.
[0071] 2) Preparation of template DNA from single eggs, single 1st instar nymphs, single 2nd instar nymphs, single 3rd instar nymphs, and single adult remains of *Hibiscus mealybug* Genomic DNA was extracted using the Dneasy Blood and Tissue Nucleic Acid Extraction Kit (centrifuge column type), with slight modifications, including the following steps: 1) Place a single egg, a single first-instar nymph, a single second-instar nymph, a single third-instar nymph, and a single adult remains into a 1.5mL centrifuge tube, add approximately 1mL of pure water, tighten the cap, and shake on a centrifuge for 15 seconds. Remove the mealybugs and place them on sterilized filter paper to absorb excess moisture, then air dry until the mealybugs are fully dry.
[0072] 2) Take a new 1.5mL centrifuge tube and put a single egg, a single first-instar nymph, a single second-instar nymph, a single third-instar nymph, and a single adult remains of the hibiscus mealybug into the tube. Use the tip as a homogenizer to grind them thoroughly.
[0073] 3) Add 180µL of Buffer ATL to the centrifuge tube (while cleaning the tip). Then add 20µL of Proteinase K, gently vortex to mix, and centrifuge.
[0074] 4) Place the centrifuge tubes in a 56℃ constant temperature water bath shaker and shake for 30 minutes. After removing them, centrifuge for 10 seconds.
[0075] 5) Add 200µL of Buffer AL to the centrifuge tube, vortex to mix, centrifuge for 10s, and let stand at 56℃ for 10min.
[0076] 6) Add 200µL of anhydrous ethanol to the centrifuge tube, vortex to mix, and centrifuge for 3 min.
[0077] 7) Transfer the mixture in the centrifuge tube to a 2 mL collection tube containing DNeasy mini, centrifuge at 12000 rpm for 1 min, and discard the collection tube.
[0078] 8) Place the spin column back into the 2mL collection tube, add 500µL Buffer AW1, centrifuge at 8000rpm for 1min, and discard the filtrate and collection tube.
[0079] 9) Place the spin column back into the 2mL collection tube, add 500µL Buffer AW2, centrifuge at 10000rpm for 1min, and discard the filtrate and collection tube.
[0080] 10) Place the spin column back into a new 1.5 mL centrifuge tube.
[0081] 11) Add 100 µL Buffer AE to the Spin column, let stand at room temperature for 1 min, centrifuge at 8000 rpm for 2 min to obtain template DNA solution.
[0082] 12) Store the extracted genomic DNA solutions of a single egg, a single 1st instar nymph, a single 2nd instar nymph, a single 3rd instar nymph, and a single adult remains at -20 ℃ for later use.
[0083] The specific detection method for *Rhizoctonia solani* established in Example 1 was used to perform visual loop-mediated isothermal amplification (LAMP) on genomic DNA solutions of single egg, single first instar nymph, single second instar nymph, single third instar nymph, and single adult remains of *Rhizoctonia solani*. The results were determined based on the color change of the reaction products.
[0084] The results are as follows Figure 5 As shown, Figure 5 In the reaction, reaction tube 1 shows the genomic DNA detection results of a single egg of *S. hibiscus mealybug*, reaction tube 2 shows the genomic DNA detection results of a single first-instar nymph of *S. hibiscus mealybug*, reaction tube 3 shows the genomic DNA detection results of a single second-instar nymph of *S. hibiscus mealybug*, reaction tube 4 shows the genomic DNA detection results of a single third-instar nymph of *S. hibiscus mealybug*, reaction tube 5 shows the genomic DNA detection results of a single adult remains of *S. hibiscus mealybug*, reaction tube 6 shows the genomic DNA detection results of a single adult of *S. hibiscus mealybug*, and reaction tube 7 is a blank control.
[0085] As described above ,Visualized loop-mediated isothermal amplification (LAMP) reactions were performed on DNA templates from single eggs, single 1st instar nymphs, single 2nd instar nymphs, single 3rd instar nymphs, single adult remains, and single adults of the hibiscus mealybug. The reaction products all showed a color change, from pink to light yellow, indicating a positive result; the blank control showed no color change, indicating a negative result. This demonstrates that the selected specific primer composition FSCOI for the hibiscus mealybug can effectively detect single eggs, single 1st instar nymphs, single 2nd instar nymphs, single 3rd instar nymphs, single adult remains, and single adults with high sensitivity.
[0086] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
[0087] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. A primer composition for identifying or assisting in the identification of the hibiscus mealybug, characterized in that, The primer composition consists of an outer primer pair and an inner primer, wherein the outer primer pair is primers FSCOI-F3 and FSCOI-B3, and the inner primer pair is primers FSCOI-FIP and FSCOI-BIP; Wherein, FSCOI-F3 is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No.1, or a DNA molecule of SEQ ID No.1 that has undergone nucleotide substitution and / or deletion and / or addition and has the same function as SEQ ID No.1; The FSCOI-B3 is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No.2, or a DNA molecule with the same function as SEQ ID No.1, but with nucleotide substitution and / or deletion and / or addition. The FSCOI-FIP is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No. 3, or a DNA molecule with the same function as SEQ ID No. 1, which has undergone nucleotide substitution and / or deletion and / or addition. The FSCOI-BIP is a single-stranded DNA molecule with the nucleotide sequence SEQ ID No. 4, or a DNA molecule with nucleotide substitution and / or deletion and / or addition of SEQ ID No. 4 that has the same function as SEQ ID No.
1.
2. The primer composition according to claim 1, characterized in that, The molar ratio of F3 to R3 is 1:1; the molar ratio of FIP to BIP is 1:
1.
3. The use of the primer composition according to claim 1 or 2 in any of the following; E1) Application in assisting in the detection or detection of whether the mealybug to be tested is the hibiscus mealybug; E2) Application in the preparation of products for auxiliary detection or detection of whether the mealybug to be tested is hibiscus mealybug.
4. A reagent or kit for identifying or assisting in the identification of the hibiscus mealybug, characterized in that, The reagent is a loop-mediated isothermal amplification reagent containing the primer composition of claim 1 or 2; the kit is a kit containing the primer composition of claim 1 or 2 or the loop-mediated isothermal amplification reagent of claim 1).
5. The use of the reagent or kit according to claim 4 in any of the following; E1) Application in assisting in the detection or detection of whether the mealybug to be tested is the hibiscus mealybug; E2) Application in the preparation of products for auxiliary detection or detection of whether the mealybug to be tested is hibiscus mealybug.
6. The application as described in claim 3 or 5, characterized in that, The mealybugs to be tested are at least one of the following: Hibiscus mealybug, New pineapple mealybug, Banyan mealybug, Oceanic mealybug, Pineapple mealybug, Jack Bell's mealybug, Liby's mealybug, Citrus spiny mealybug, Glandular spiny mealybug, Long-tailed mealybug, South Pacific mealybug, Citrus spiny mealybug, Sugarcane cluster mealybug, Papaya mealybug, Wax mealybug, Lycoris mealybug, and Hibiscus syriacus mealybug.
7. A method for identifying or assisting in the identification of the hibiscus mealybug, characterized in that, The method includes: Nucleic acid is extracted from the sample to be tested; using the nucleic acid as a template, loop-mediated isothermal amplification is performed on the mealybug to be tested using the primer composition of claim 1 or 2 or the reagent or kit of claim 3, and the color change of the loop-mediated isothermal amplification reaction product is used to determine whether the mealybug to be tested is *Hibiscus mealybug*.
8. The method as described in claim 7, characterized in that, The mealybugs to be tested are at least one of the following: Hibiscus mealybug, New pineapple mealybug, Banyan mealybug, Oceanic mealybug, Pineapple mealybug, Jack Bell's mealybug, Liby's mealybug, Citrus spiny mealybug, Glandular spiny mealybug, Long-tailed mealybug, South Pacific mealybug, Citrus spiny mealybug, Sugarcane cluster mealybug, Papaya mealybug, Wax mealybug, Lycoris mealybug, and Hibiscus syriacus mealybug.
9. The method as described in claim 7 or 8, characterized in that, In the loop-mediated isothermal amplification, the molar ratio of F1 to R1 is 1:1; the molar ratio of FIP to BIP is 1:
1.
10. The method according to any one of claims 7-9, characterized in that, The reaction conditions for the ring-mediated isothermal amplification are a reaction temperature of 60°C and a reaction time of 30 min.