A primer probe composition, kit and detection method for specifically detecting blattella germanica
By designing specific primers and probes targeting the COI gene of the German cockroach mitochondria and combining them with real-time quantitative PCR technology, the problem of misjudgment or missed detection caused by damaged or incomplete samples during port quarantine has been solved, enabling rapid and accurate detection of German cockroaches.
Patent Information
- Application Number
- CN202610390837.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-27
- Publication Date
- 2026-07-10
Smart Images

Figure CN122357732A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology detection, and specifically relates to a primer-probe composition, kit, and detection method for the specific detection of German cockroaches. Background Technology
[0002] In the context of globalized trade, the problem of biological invasion is becoming increasingly serious. Cross-border cargo flows, transportation vehicles, and various containers can all become important carriers for the spread of alien species. Among them, cockroaches (also known as roaches) have become one of the key imported disease vectors that customs quarantine needs to focus on preventing due to their strong environmental adaptability, high concealment, and high reproductive rate. German cockroaches are one of the most important indoor hygiene pests in the world, capable of mechanically transmitting various pathogens and causing allergic diseases. With the development of international trade, the risk of their cross-border spread through cargo and containers has increased dramatically. Port quarantine is the first line of defense against their introduction. However, cockroach samples intercepted at ports are often fragments, larvae, or damaged individuals, making traditional morphological identification methods extremely difficult and prone to misjudgment or missed detection.
[0003] DNA barcoding technology has provided a new approach for species identification, with COI-based identification becoming a standard method. Real-time quantitative PCR (qPCR) technology, with its advantages of high specificity, high sensitivity, rapid speed, quantification, and closed-tube operation to prevent contamination, has been widely used for pathogen detection and species identification. Currently, a TaqMan qPCR rapid detection method for the German cockroach has not been systematically reported. Developing a rapid molecular detection method with high specificity and sensitivity, suitable for complex samples at ports of entry, is urgently needed and of significant value for improving national biosecurity monitoring capabilities. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a primer and probe composition, a kit and a detection method for the specific detection of German cockroaches, and in particular, to provide a TaqMan real-time fluorescence quantitative PCR detection method for German cockroaches with high specificity, high sensitivity, speed and accuracy, as well as dedicated primers, probes and kits.
[0005] This invention provides a primer and probe composition for the specific detection of the German cockroach, the composition comprising a primer pair and a TaqMan probe; wherein the upstream primer of the primer pair is Bg-F: 5'-TCATTAATTGGAGATGATCA-3', as shown in SEQ ID NO. 1; the downstream primer is Bg-R: 5'-GGTACTAATCAATTTCCAAATC-3', as shown in SEQ ID NO. 2; and the TaqMan probe sequence is: 5'-FAM-TTATTGTAACGGCTCACGCTTTTGTT-BHQ1-3', as shown in SEQ ID NO. 3.
[0006] The primers and probes described are specific primers and probes targeting a unique conserved region of the COI gene in the mitochondria of the German cockroach, and have been verified to have no cross-reactivity with other common cockroach species.
[0007] The present invention provides a kit for the specific detection of German cockroaches, the kit comprising the primer and probe composition.
[0008] The kit also includes qPCR reaction premix, positive control, and negative control.
[0009] The positive control is a plasmid or genomic DNA containing the target fragment of the German cockroach COI; the negative control includes sterile ultrapure water. The target fragment of the German cockroach COI is the fragment amplified by the primers.
[0010] This invention provides a non-diagnostic method for detecting German cockroaches, comprising: using the genomic DNA of the sample to be tested as a template, and performing a real-time quantitative PCR reaction using the primer and probe composition.
[0011] Further steps include sample DNA extraction, TaqMan qPCR amplification using the aforementioned primers and probes, and interpretation of the results based on the amplification curve and Ct value.
[0012] Furthermore, based on the fluorescence signal growth curve and Ct value, it is determined whether the sample contains German cockroaches (Ct value ≤ 35 indicates the presence of German cockroaches).
[0013] Furthermore, standard solutions with concentration gradients from 100 ng / μL to 0.1 fg / μL were prepared, and real-time quantitative PCR reactions were performed to measure the corresponding Ct values. A standard curve was established with the logarithm of the concentration as the x-axis and the measured Ct values as the y-axis. The quantitative detection of the test samples was achieved through the standard curve.
[0014] The real-time quantitative PCR reaction system includes: 10 μL of 2×qPCR premix, 1 μL each of 10 μmol / L Bg-F and Bg-R primers, 1 μL of 4 μmol / L probe, 2 μL of DNA template, and sterile water to a final volume of 25 μL.
[0015] The reaction procedure for the real-time quantitative PCR is as follows: pre-denaturation at 95℃ for 30 seconds; then 40 cycles of denaturation at 95℃ for 15 seconds, annealing and extension at 60℃ for 45 seconds, with fluorescence signals collected at the 60℃ stage.
[0016] The samples to be tested are insect remains, larvae, molted skins, egg cases, or environmental swab samples.
[0017] The present invention provides a primer and probe composition for the specific detection of German cockroaches, or any of the kits for the specific detection of German cockroaches, for use in products for the identification of German cockroaches in port quarantine, health and epidemic prevention or pest monitoring.
[0018] This invention designs and screens specific primers and TaqMan probes based on the specific sequence of the mitochondrial COI gene of the German cockroach. The detection method exhibits extremely high specificity, showing no cross-reactivity with closely related species such as the American cockroach and the two-banded cockroach; it also boasts high sensitivity, with a detection limit of 1 fg / μL; and good repeatability, with intra- and inter-group coefficients of variation both less than 3%. This invention is particularly suitable for rapid and accurate molecular identification of German cockroach samples in port and warehouse settings where accurate morphological identification is impossible due to sample damage, juvenile status, or morphological similarity. The method is simple to operate, rapid (approximately 1.5 hours), and uses closed-tube contamination prevention, providing a powerful technical tool for port biosafety monitoring, invasive alien species control, and public health.
[0019] Beneficial effects
[0020] (1) Primers and probes were designed for the unique site of the COI gene of German cockroach and showed no cross-reaction with nearly ten common cockroaches at ports, including American cockroach, Australian cockroach, double-banded cockroach, and Surinamese cane cockroach.
[0021] (2) The detection limit can reach 1 fg / μL, which can effectively detect trace amounts of degraded DNA samples (such as single insect legs and antennae fragments).
[0022] (3) The entire testing process can be completed within 2 hours and does not require post-PCR processing. It is easy to operate and suitable for batch sample screening.
[0023] (4) It is particularly suitable for rapid species identification of cockroach samples that are incomplete in shape and difficult to identify in scenarios such as ports and warehouses, which significantly improves quarantine efficiency and accuracy.
[0024] (5) The method has high repeatability, small coefficients of variation within and between groups, and stable and reliable results. Attached Figure Description
[0025] Figure 1 This is a sequence comparison diagram of multiple species in the amplification regions of the specific primers and probes in Example 1; LC793874.1: *Berberis longissima*; MG882134.1: *Berberis squareis*; NC_012901.1: *Berberis davidianus*; KX388345.1: *Berberis Scottii*; NC_080268.1: *Berberis surae*; NC_016956.1: *Berberis thunbergii*; NC_030003.1: *Berberis lateralis*; NC_034842.1: *Berberis faceta*;
[0026] Figure 2 The specific detection experiment in Example 3 included the following background species: two-banded cockroach, American cockroach, Madagascar cockroach, Surinamese cane cockroach, Kumamoto rimosa cockroach, Celatoblatta sp., a species of cockroach, and a species of giant cockroach.
[0027] Figure 3 The results of the German cockroach qPCR serial dilution assay in Example 4 are as follows: 1. 100 ng / μL; 2. 10 ng / μL; 3. 1 ng / μL; 4. 100 pg / μL; 5. 10 pg / μL; 6. 1 pg / μL; 7. 100 fg / μL; 8. 10 fg / μL; 9. 1 fg / μL; 10. 0.1 fg / μL.
[0028] Figure 4 This is the standard curve for real-time fluorescence quantitative PCR amplification of German cockroaches in Example 4. Detailed Implementation
[0029] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.
[0030] Example 1
[0031] Design and synthesis of specific primers and probes
[0032] (1) Download the full-length COI gene sequence of German cockroach and its closely related species (such as square-spotted giant cockroach and American cockroach) from the NCBI GenBank database.
[0033] (2) Use MEGA software to perform multiple sequence alignment to identify nucleotide variation regions unique to the German cockroach. Figure 1 ).
[0034] (3) In this specific region, candidate primers and TaqMan probes were designed using Primer Premier 5.0 software. The 5' end of the probe was labeled with a FAM fluorescent reporter group, and the 3' end was labeled with a BHQ1 quencher group.
[0035] (4) Using the NCBI Primer-BLAST tool, a nucleotide database was used to screen for a set of primers and probes with the lowest homology to other species and theoretically the best specificity. Their sequences are as follows:
[0036] Bg-F: 5'-TCATTAATTGGAGATGATCA-3'; as shown in SEQ ID NO: 1;
[0037] Bg-R: 5'-GGTACTAATCAATTTCCAAATC-3'; as shown in SEQ ID NO: 2;
[0038] Bg-P: 5'-(FAM)TTATTGTAACGGCTCACGCTTTTGTT(BHQ1)-3', as shown in SEQ ID NO: 3.
[0039] (5) The above primers and probes were synthesized by Genewiz Biotechnology Co., Ltd. and purified by PAGE.
[0040] Example 2
[0041] Components of a reagent kit for detecting German cockroaches
[0042] This kit contains the following components:
[0043] ① qPCR reaction premix (2×, containing HotStart Taq DNA polymerase, dNTPs, Mg) 2+ (such as buffer solutions).
[0044] ② Primer-probe mixture: A mixed solution containing the Bg-F and Bg-R primers (10 μmol / L) and the Bg-P probe (4 μmol / L) described in Example 1.
[0045] ③ Positive control: German cockroach COI target fragment (amplified by Bg-F / Bg-R).
[0046] ④ Negative control: sterile ultrapure water.
[0047] ⑤ Instruction manual.
[0048] Example 3
[0049] Specific detection experiment
[0050] (1) Sample preparation: Genomic DNA was extracted from nine cockroach species, including German cockroach (Blattella germanica), double-banded cockroach (Blattella bisignata), American cockroach (Periplaneta americana), Madagascar humming cockroach (Gromphadorhinaportentosa), Surinamese cane cockroach (Pycnoscelus surinamensis), Kumamoto marginal cockroach (Margattea nimbata), and three unidentified cockroach species intercepted at ports (Celatoblatta sp., Deropeltis sp., Blaberus sp.), and the concentration was uniformly adjusted to 10 ng / μL.
[0051] (2) qPCR reaction: Prepare the following 25 μL system: 10 μL 2× qPCR premix, 3 μL primer-probe mixture, 2 μL DNA template, and 5 μL sterile water. Reaction program: 95℃ for 30 seconds; then 40 cycles (95℃ for 15 seconds, 60℃ for 45 seconds, and collect fluorescence signal at 60℃).
[0052] (3) such as Figure 2 As shown, only the German cockroach DNA template exhibited a typical "S"-shaped fluorescence growth curve, with a Ct value of 10. The other nine non-target cockroaches and the negative control (NTC) did not show specific amplification (Ct value > 40 or undetectable), indicating that the primers and probes of this invention possess excellent species-level specificity.
[0053] Example 4
[0054] Sensitivity and Standard Curve Establishment and Stability Testing
[0055] (1) The positive control in Example 2 was serially diluted 10-fold to obtain a standard solution of 100 ng / μL ~ 0.1 fg / μL. Figure 3 ).
[0056] (2) Three replicates were set for each concentration, and the reaction system and procedure of Example 3 were used for detection.
[0057] (3) Plot a standard curve with the logarithm of concentration on the x-axis and the average value of Ct on the y-axis. Figure 4 The curve equation is: y = -3.5357x + 32.0357, the amplification efficiency is 91.79%, and the correlation coefficient R0 is [missing value]. 2= 0.9952. Stable detection was still possible at a concentration of 1 fg / μL (Ct value approximately 32), and the limit of detection (LOD) of the method was determined to be 1 fg / μL.
[0058] (4) The coefficient of variation (CV) of the repeated tests in (1) was calculated. The highest CV of the repeated tests within the group (n=3) was 2.53%, the lowest was 0.26%, and the average CV was 1.49%, all of which were lower than the generally accepted threshold (3%) (Table 1). This shows that the established qPCR method has good reproducibility and high operational stability, and is suitable for quantitative and qualitative analysis of different batches of experiments.
[0059] Table 1 Stability Test Results
[0060]
[0061] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications to the technical solutions described in the foregoing embodiments, or equivalent substitutions for some or all of the technical features, do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A primer and probe composition for the specific detection of the German cockroach, characterized in that, The composition comprises a primer pair and a TaqMan probe; wherein the upstream primer in the primer pair is Bg-F: 5'-TCATTAATTGGAGATGATCA-3', as shown in SEQ ID NO. 1; and the downstream primer is Bg-R: 5'-GGTACTAATCAATTTCCAAATC-3', as shown in SEQ ID NO. 2; The TaqMan probe sequence is: 5'-FAM-TTATTGTAACGGCTCACGCTTTTGTT-BHQ1-3', as shown in SEQ ID NO.
3.
2. A kit for the specific detection of German cockroaches, characterized in that, The kit comprises the primer and probe composition of claim 1.
3. The reagent kit according to claim 2, characterized in that, The kit also includes qPCR reaction premix, positive control, and negative control.
4. The reagent kit according to claim 3, characterized in that, The positive control is a plasmid or genomic DNA containing the target fragment of the German cockroach COI; the negative control includes sterile ultrapure water.
5. A method for detecting the German cockroach, comprising: Using the genomic DNA of the sample to be tested as a template, a real-time quantitative PCR reaction was performed using the primer and probe composition described in claim 1.
6. The method according to claim 5, characterized in that, Based on the fluorescence signal growth curve and Ct value, determine whether the sample contains German cockroaches.
7. The method according to claim 5, characterized in that, Prepare standard solutions with concentration gradients from 100 ng / μL to 0.1 fg / μL, and perform real-time quantitative PCR reactions to measure the corresponding Ct values. Establish a standard curve by plotting the logarithm of the concentration on the x-axis and the measured Ct values on the y-axis. Quantitative detection of the test samples can be achieved through the standard curve.
8. The method according to claim 5, characterized in that, The real-time quantitative PCR reaction system includes 10 μL of 2×qPCR premix, 1 μL each of 10 μmol / L Bg-F and Bg-R primers, 1 μL of 4 μmol / L probe, 2 μL of DNA template, and sterile water to a final volume of 25 μL.
9. The method according to claim 1, characterized in that, The reaction procedure for the real-time quantitative PCR is as follows: pre-denaturation at 95℃ for 30 seconds; then 40 cycles of denaturation at 95℃ for 15 seconds, annealing and extension at 60℃ for 45 seconds, with fluorescence signals collected at the 60℃ stage.
10. The use of the primer and probe composition for the specific detection of German cockroaches as described in claim 1, or the kit for the specific detection of German cockroaches as described in any one of claims 2-4, in products used for the identification of German cockroaches in port quarantine, sanitary and epidemic prevention, or pest monitoring.