SNP molecular markers associated with spinach mottle leaf phenotype and uses thereof

By developing SNP molecular markers and KASP primer combinations related to mottled spinach leaves, the problem of screening for recessive gene mutations in mottled leaves in spinach breeding was solved, enabling efficient and accurate breeding processes to be accelerated.

CN122357773APending Publication Date: 2026-07-10ZHONGYUAN RES CENT +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610666838.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-14
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

The lack of effective molecular markers in existing technologies for screening and eliminating recessive gene mutations in spinach mottled leaves has led to a slow breeding process.

Method used

We developed SNP molecular markers associated with the mottled leaf phenotype of spinach and their KASP primer combinations to screen and eliminate spinach varieties containing recessive gene mutations in mottled leaves. We then used the KASP primer combinations for PCR amplification and determined the genotype by fluorescence detection.

Benefits of technology

This technology enables high-throughput and accurate screening of spinach mottled leaf genes, significantly shortening the breeding cycle and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

This invention relates to the field of molecular genetics, disclosing SNP molecular markers associated with the mottled leaf phenotype of spinach and their applications. The SNP molecular markers contain a nucleotide sequence with a G / A polymorphism at position 158522852 bp on spinach chromosome 3; spinach plants with the G base have normal leaves, while those with the A base exhibit mottled chlorotic leaves. This invention utilizes segregating population analysis (BSA) to discover SNPs associated with the mottled leaf phenotype of spinach and develops a KASP primer combination for detecting the molecular markers for assisted breeding. The three KASP primers provided by this invention can detect the mottled leaf phenotype of spinach at the seedling stage, with high throughput and high accuracy. The co-dominant KASP markers provided by this invention facilitate the screening of spinach varieties containing the mottled leaf gene, significantly accelerating the breeding process of spinach varieties containing the potential mottled leaf gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, and more specifically, to SNP molecular markers associated with the mottled leaf phenotype of spinach and their applications. Background Technology

[0002] spinach( Spinacia oleracea L. (2n = 2x = 12) belongs to the genus Spinach of the subfamily Chenopodiaceae in the family Amaranthaceae. It originated in Iran and is an annual or biennial herbaceous plant whose main product is its green leaves. Due to its wide adaptability, good storage properties, long supply period, diverse cultivation methods, and relatively comprehensive nutrition, it is widely cultivated around the world.

[0003] Spinach is rich in nutrients and health-promoting compounds such as vitamins and minerals, and is considered one of the healthiest vegetables in the human diet, with the vast majority of nutrients concentrated in the leaves. Plants primarily perform photosynthesis in their leaves, where chloroplasts convert solar energy into chemical energy essential for plant development. As a leaf-eating vegetable, the quality of spinach leaves determines its yield. Mutations in genes related to spinach leaf color can lead to symptoms such as mottling, chlorosis, slow plant growth, and smaller leaves, severely impacting spinach quality and yield. Leaf color mutations are mostly due to recessive gene mutations related to chloroplast development or metabolism and changes in chlorophyll content, affecting photosynthesis, hormone physiology, morphogenesis, and yield. In severe cases, plants with such recessive gene mutations may not survive.

[0004] Currently, no molecular markers related to mottled spinach leaves have been developed, which hinders the screening and elimination of recessive mutant genes in mottled spinach leaves. Summary of the Invention

[0005] The purpose of this invention is to provide SNP molecular markers associated with the mottled leaf phenotype of spinach and their applications.

[0006] The present invention also developed a KASP primer combination for detecting the molecular markers, which is used to screen and eliminate varieties containing recessive gene mutations in mottled leaves, thereby shortening the breeding cycle.

[0007] To achieve the objective of this invention, in a first aspect, this invention provides an SNP molecular marker associated with the mottled leaf phenotype of spinach, wherein the SNP molecular marker contains a nucleotide sequence with a polymorphism of G / A at position 158522852bp on chromosome 3 of spinach; wherein, spinach plants with the base G have normal leaves, and spinach plants with the base A exhibit mottled chlorosis.

[0008] The location information of this marker was determined based on the spinach whole genome sequence published by Cai et al. (2021), at http: / / spinachbase.org / ftp / genome / Monoe-Viroflay / .

[0009] Furthermore, the genotype of the site with the polymorphism is GG or GA, corresponding to spinach with normal leaves; the genotype of the site with the polymorphism is AA, corresponding to spinach with mottled leaves.

[0010] Secondly, the present invention provides primer combinations for amplifying the molecular marker, including forward primer 1, forward primer 2 and universal reverse primer, the sequences of which are shown in SEQ ID NO:1-3 respectively.

[0011] Furthermore, the primer combination is a KASP primer combination, wherein the 5' end of the forward primer 1 is connected to a tag sequence corresponding to the first fluorescent label; the 5' end of the forward primer 2 is connected to a tag sequence corresponding to the second fluorescent label, and the first fluorescent label and the second fluorescent label are different.

[0012] Preferably, the nucleotide sequence of the forward primer 1 with the tag sequence is shown in SEQ ID NO:4; and the nucleotide sequence of the forward primer 2 with the tag sequence is shown in SEQ ID NO:5.

[0013] Thirdly, the present invention provides detection reagents or kits containing the primer combinations described above.

[0014] Fourthly, the present invention provides a method for identifying the phenotype and / or genotyping of mottled leaves in spinach, comprising the following steps: (1) Provide a DNA sample of the spinach to be tested; (2) The DNA sample was amplified by PCR using the primer combination; (3) Determine the mottled leaf phenotype and / or mottled leaf genotype of the spinach to be tested based on the amplification results of step (2).

[0015] Preferably, the PCR reaction conditions are as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 61-55℃ for 60 seconds (decreasing by 0.6℃ per cycle), 10 cycles; 94℃ for 20 seconds, 55℃ for 60 seconds, 26 cycles.

[0016] Furthermore, when a primer combination with a fluorescent tag is used in step (2), step (3) makes a judgment by detecting the fluorescent signal; The criteria for determination are as follows: if only the first fluorescent marker signal corresponding to allele G is detected, the genotype is determined to be GG, corresponding to spinach with normal leaves; if only the second fluorescent marker signal corresponding to allele A is detected, the genotype is determined to be AA, corresponding to spinach with mottled leaves; if both the first and second fluorescent marker signals are detected simultaneously, the genotype is determined to be GA, corresponding to spinach with normal leaves.

[0017] Fifthly, the present invention provides any of the following applications of the molecular marker, the primer combination, or the detection reagent or kit: 1) Used for identification or auxiliary identification of spinach mottled leaf genes; preferably used for identifying spinach mottled leaf gene characteristics during the seedling stage; 2) Used for early prediction of spinach mottled leaf phenotype; 3) Used in molecular breeding of spinach; 4) Used for spinach germplasm improvement; 5) Used for screening recessive genes in spinach mottled leaves; 6) Used for genotyping of mottled spinach leaves.

[0018] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention utilizes segregating population analysis (BSA) to discover SNPs associated with the mottled leaf phenotype in spinach and employs a developed KASP primer combination for detecting these molecular markers in assisted breeding. The three KASP primers provided in this invention can detect the mottled leaf phenotype in spinach at the seedling stage, offering high throughput and accuracy. The co-dominant KASP markers provided by this invention facilitate the screening of spinach varieties containing the mottled leaf gene, significantly accelerating the breeding process for spinach varieties with potential mottled leaf genes. Attached Figure Description

[0019] Figure 1 This is the localization result of the SNP related to the mottled leaf gene in Example 1 of the present invention; where the left side is the p-value - log 10 (P), the right side shows the SNP density, and the bottom shows the chromosome name.

[0020] Figure 2 This is the result of Spomac labeling detection of 400 spinach samples in Example 2 of the present invention. Detailed Implementation

[0021] The present invention adopts the following technical solution: This invention provides the development and application of SNP molecular markers related to mottled leaves of spinach, and further develops a KASP primer combination for detecting the molecular markers, which is used to screen and eliminate varieties containing recessive gene mutations in mottled leaves, thus shortening the breeding cycle.

[0022] This invention provides a molecular marker associated with mottled spinach leaves, with the following site location information:

[0023] The marker Spmoc in this invention is located on chromosome 3 of spinach at a physical location of 158522852 bp. The base at the SNP site is G / A. Spinach plants with the base G have normal leaves, while spinach plants with the base A show mottled chlorosis on their leaves.

[0024] Preferably, the location information of the marker is determined based on the whole genome sequence of spinach, at http: / / spinachbase.org / ftp / genome / Monoe-Viroflay / .

[0025] The present invention also provides a primer combination for amplifying the molecular marker; Preferably, it includes a first primer, a second primer, and a third primer; The nucleotide sequence of the first primer is shown in SEQ ID NO:1 (5'-AGTTGTACAACTACAAATGTTCTAACAC-3'); The nucleotide sequence of the second primer is shown in SEQ ID NO:2 (5'-CAGTTGTACAACTACAAATGTTCTAACAT-3'); The nucleotide sequence of the third primer is shown in SEQ ID NO:3 (5'-AATTTTGGTTGAATTGTGTGAAATCACTAAAATG-3').

[0026] The present invention also provides a KASP primer combination, comprising a first primer (forward primer 1), a second primer (forward primer 2), and a third primer (universal reverse primer). The first primer is the 5' end of the first primer above with the tag sequence A corresponding to the A fluorescence added; The second primer is the 5' end of the second primer above with the tag sequence B corresponding to B fluorescence added; The third primer is the third primer described above; The A fluorescence and B fluorescence are different. If only the universal tag A fluorescence is detected, it indicates the GG genotype, which corresponds to spinach with normal leaves; if only the universal tag B fluorescence is detected, it indicates the AA genotype, which corresponds to spinach with mottled leaves; if both universal tags A and B fluorescence are detected, it indicates the GA genotype, which corresponds to spinach with the recessive gene for mottled leaves but normal leaves.

[0027] According to the KASP primer combination, the nucleotide sequence of the first primer is as shown in SEQ ID NO:4 (5'- GAAGGT GACCAAGTTCATGCT AGTTGTACAACTACAAATGTTCTAACAC-3'; where GAAGGTGACCAAGTTCATGCT As shown in the general label A); The nucleotide sequence of the second primer is as shown in SEQ ID NO:5 (5'- GAAGGTCGGAGTCAACGGATT CAGTTGTACAACTACAAATGTTCTAACAT-3'; where GAAGGTCGGAGTCAACGGATT As shown in the general label B).

[0028] The present invention also provides products containing the primer combination, wherein the products are detection reagents or kits.

[0029] The present invention also provides a method for identifying the mottled leaf phenotype and / or mottled leaf genotype of spinach, using spinach DNA to be tested as a template, and using the primer combination to determine the mottled leaf phenotype and / or mottled leaf genotype of spinach based on the primer amplification results; Preferably, the determination is based on the fluorescence detection results.

[0030] The method includes the following steps: (1) Extract DNA from the spinach to be tested; (2) Dilute the DNA in step (1) to 20 ng / µL, and add specific KASP Primer mix and universal KASP Master mix to it for PCR amplification; PCR products are analyzed by fluorescence detection at below 40℃; The aforementioned specific KASP Primer mix contains the primer combination described above; Preferably, the above-mentioned universal KASP Master mix contains the following components: universal TRET cassette fluorescent primers, ROX internal control dye, KlearTaq DNA polymerase, dNTPs, and MgCl2.

[0031] According to the method for spinach mottled leaf phenotype and / or mottled leaf genotyping, the PCR reaction system is as follows: each 10 μl reaction system includes 4.86 μl template DNA, 5 μl KASP Master mix and 0.14 μl KASP Primer mix (Table 1).

[0032] The KASP genotyping method provided by this invention has high throughput and is simple to operate. It only requires adding a specific KASP Primer mix and a universal KASP Master mix to a PCR microplate containing a DNA sample for PCR amplification. The final results can be analyzed using a fluorescence detector.

[0033] The KASP Primer mix contains three specific primers: forward primers 1 and 2, each bearing universal tags A and B, and a reverse primer.

[0034] Table 1 PCR reaction system

[0035] The KASP Master mix contains universal FRET cassette fluorescent primers, ROX internal control dye, KlearTaq DNA polymerase, dNTPs, and MgCl2, pre-prepared in an optimized buffer. Fluorescent reporter A is FAM, and fluorescent reporter B is HEX. The KASP Master mix was purchased from LGC Ltd., UK, catalog number KBS-1016-002.

[0036] PCR reaction conditions are shown in Table 2: Table 2 PCR reaction conditions

[0037] Preferably, if the genotyping results are unsatisfactory after fluorescence detection, a PCR reaction as shown in Table 3 can be performed again: Table 3 PCR reaction conditions

[0038] Fluorescence detection and analysis can be performed again after the second PCR reaction.

[0039] This invention also provides the use of the primer combination or the product in any one or more of the following: (1) Application in identifying or assisting in the identification of spinach mottled leaf genes; Preferably, it is used for identifying the genetic characteristics of mottled leaves in spinach seedlings; (2) Application in early prediction of spinach mottled leaf phenotype; (3) Application in molecular breeding of spinach; (4) Application in spinach germplasm improvement; (5) Application in screening recessive genes for mottled spinach leaves; (6) Application in the genotyping of mottled spinach leaves.

[0040] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0041] Example 1: Development of KASP molecular markers related to the spinach mottled leaf gene 1. Investigation of spinach leaf phenotypes Four hundred spinach inbred lines of “SP234” (see She, H., Liu, Z., Xu, Z., Zhang, H., Wu, J., Cheng, F., Wang, X. and Qian, W. (2024), Pan-genome analysis of 13 Spinacia accessions reveals structural variations associated with sexchromosome evolution and domestication traits in spinach. Plant Biotechnol.J, 22: 3102-3117. https: / / doi.org / 10.1111 / pbi.14433) were planted at the experimental base of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. Leaf phenotypes were investigated 50 days after sowing.

[0042] 2. DNA extraction and BSA resequencing Twenty-five days after sowing, young leaves were collected for DNA extraction. The quality of the DNA was tested using 1.0% agarose gel electrophoresis and an ND-1000 spectrophotometer. The DNA was then sent to Benagene for BSA resequencing using the Illumina platform on a pooled sample of two extreme traits of the spinach material. 234,694 high-quality SNPs were obtained for gene mapping.

[0043] 3. Detection of related SNPs and development of KASP tags Based on BSA sequencing data from two pooled samples of extreme traits, allele frequency differences were assessed using the Euclidean Distance (ED) algorithm. Allele frequency matrices for both pools were extracted using VCFtools v0.1.16. The original ED values ​​were power-law transformed to suppress background noise and enhance association signals. Based on the empirical cumulative distribution function of ED values, the 99th percentile was selected as the significance threshold. Genomic regions with multiple consecutive SNP loci and an average ED higher than the significance threshold were defined as initial localization intervals. The SNP ultimately found to be closely linked to the spinach mottled leaf gene was located at 158522852 bp in SOVchr3.Figure 1 The primers were designed as KASP primers. These primers consist of forward primer 1, forward primer 2, and a reverse primer. The two forward primers have G / A allelic variants at their ends, and the reverse primer sequence is chosen to ensure the amplified fragment is between 60-120 bp. The 5' ends of the forward primers are linked with fluorescent tag sequences: forward primer 1 has a FAM fluorescent tag sequence 5'-GAAGGTGACCAAGTTCATGCT-3' linked to its 5' end, and forward primer 2 has a HEX fluorescent tag sequence 5'-GAAGGTCGGAGTCAACGGATT-3' linked to its 5' end.

[0044] The primer sequences are as follows:

[0045] The primer sequences mentioned above were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0046] Example 2: Validation of Spmoc tags The specific method is as follows: 1. Material phenotyping and genomic DNA extraction The phenotypes of leaves from 400 spinach samples were recorded. Simultaneously, whole-genome DNA was extracted using the CTAB method.

[0047] 2. Dilute DNA The DNA concentration used in this experiment was 20 ng / µl.

[0048] 3. Preparation of KASP Primer mix Take 12 μl (100 μM) of the forward primer and 30 μl (100 μM) of the reverse primer, and add sterile ultrapure water to make up to 100 μl.

[0049] 4. PCR amplification reaction system and reaction conditions The PCR amplification reaction system is shown in Table 1. A blank control (NTC) without template DNA was also included in the experiment, with one blank control per plate.

[0050] The PCR reaction conditions are shown in Table 2. If the genotyping results are unsatisfactory after fluorescence detection, the PCR reaction shown in Table 3 can be repeated.

[0051] Fluorescence detection and analysis can be performed again after the second PCR reaction.

[0052] 5. Fluorescence scanning of PCR amplification products PCR amplification products were scanned using an Applied Biosystems QuantStudio 6 Flex scanner. Genotyping was achieved based on the different excitation and emission wavelengths of the two fluorescence sources (FAM and HEX). The genotypes aggregated on the vertical axis represent the alleles linked to the FAM fluorescent tag sequence, i.e., GG; the genotypes aggregated in the middle represent both alleles, i.e., GA; the genotypes aggregated on the horizontal axis represent the alleles linked to the HEX fluorescent tag sequence, i.e., AA; the black samples shown in the lower left corner represent NTC (…). Figure 2 ).

[0053] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. SNP molecular markers associated with the mottled leaf phenotype of spinach, characterized in that, The SNP molecular marker contains a nucleotide sequence with a polymorphism of G / A at position 158522852 bp on chromosome 3 of spinach; among them, spinach plants with the base G have normal leaves, while spinach plants with the base A show mottled chlorosis on their leaves.

2. The molecular marker according to claim 1, characterized in that, The genotype of the site with the polymorphism is GG or GA, corresponding to spinach with normal leaves; the genotype of the site with the polymorphism is AA, corresponding to spinach with mottled leaves.

3. A primer combination for amplifying the molecular marker of claim 1 or 2, characterized in that, It includes forward primer 1, forward primer 2 and universal reverse primer, with sequences shown in SEQ ID NO:1-3, respectively.

4. The primer combination according to claim 3, characterized in that, The primer combination is a KASP primer combination, wherein the 5' end of the forward primer 1 is connected to a tag sequence corresponding to the first fluorescent label; the 5' end of the forward primer 2 is connected to a tag sequence corresponding to the second fluorescent label, and the first fluorescent label and the second fluorescent label are different.

5. The primer combination according to claim 4, characterized in that, The nucleotide sequence of the forward primer 1 with the tag sequence is shown in SEQ ID NO:4; the nucleotide sequence of the forward primer 2 with the tag sequence is shown in SEQ ID NO:

5.

6. A detection reagent or kit containing the primer combination according to any one of claims 3-5.

7. A method for identifying the phenotype and / or genotyping of mottled leaves in spinach, characterized in that, Includes the following steps: (1) Provide a DNA sample of the spinach to be tested; (2) The DNA sample is amplified by PCR using the primer combination according to any one of claims 3-5; (3) Determine the mottled leaf phenotype and / or mottled leaf genotype of the spinach to be tested based on the amplification results of step (2).

8. The method according to claim 7, characterized in that, The PCR reaction conditions were as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 61-55℃ for 60 seconds (decreasing by 0.6℃ per cycle), 10 cycles; 94℃ for 20 seconds, 55℃ for 60 seconds, 26 cycles.

9. The method according to claim 7 or 8, characterized in that, When the primer combination of claim 4 or 5 is used in step (2), step (3) is determined by detecting the fluorescence signal; The criteria for determination are as follows: if only the first fluorescent marker signal corresponding to allele G is detected, the genotype is determined to be GG, corresponding to spinach with normal leaves; if only the second fluorescent marker signal corresponding to allele A is detected, the genotype is determined to be AA, corresponding to spinach with mottled leaves. If both the first and second fluorescent marker signals are detected simultaneously, the genotype is determined to be GA, corresponding to spinach with normal leaves.

10. Any of the following applications of the molecular marker of claim 1 or 2, the primer combination of any one of claims 3-5, or the detection reagent or kit of claim 6: 1) Used for identification or auxiliary identification of spinach mottled leaf genes; preferably used for identifying spinach mottled leaf gene characteristics during the seedling stage; 2) Used for early prediction of spinach mottled leaf phenotype; 3) Used in molecular breeding of spinach; 4) Used for spinach germplasm improvement; 5) Used for screening recessive genes in spinach mottled leaves; 6) Used for genotyping of mottled spinach leaves.