A cortinarius mycorrhizal fungus tu55 and application thereof

Abstract

The application discloses the field of microbial technology, and relates to a gomphidiaceae mycorrhizal fungus Tu55 and application thereof. The gomphidiaceae mycorrhizal fungus Tu55 is isolated from a root part of a Dendrobium lindleyi adult plant. Phylogenetic research shows that the Tu55 strain has the closest genetic relationship with the published gomphidiaceae fungi, and is a gomphidiaceae fungus. The Tu55 strain can significantly promote the growth of root length, plant height and biomass accumulation of Dendrobium unicum seedlings. HPLC determination results show that the Tu55 strain can significantly promote the accumulation of sorbic acid content in the Dendrobium unicum seedlings, and the content is about 1228 times that of the non-symbiotic Dendrobium unicum seedlings. The application can be used for Dendrobium unicum conservation and seedling cultivation, and provides a new way for the development of a plant-derived natural preservative, sorbic acid.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a mycorrhizal fungus Tu55 of the Mycorrhizal Fungi family and its applications. Background Technology

[0002] Orchids are typical mycorrhizal symbiotic plants, their symbiotic relationship with fungi lasting throughout their entire life cycle, especially during seed germination and seedling stages where they exhibit absolute dependence. Dendrobium is one of the largest genera in the Orchidaceae family, and also one of the largest genera of angiosperms, with some species possessing extremely high medicinal and ornamental value. Due to habitat destruction and over-harvesting, wild Dendrobium species are now among the endangered plant species.

[0003] Dendrobium unicum is mainly distributed in Vietnam, Laos and Myanmar. It grows epiphytically on rocks and shrubs at altitudes of 800-1550 meters. Because its lip is inverted like a rhinoceros horn and has deep orange-red reticulations, and its flowering period can last for more than a month, it has become an important parent for the breeding of Dendrobium unicum and has high breeding and ornamental value.

[0004] Similar to other orchids, the life cycle of Dendrobium is inseparable from mycorrhizal fungi. Amplicon analysis shows that Dendrobium mycorrhizal fungi are mainly concentrated in the families Tulasnellaceae, Ceratobasidiaceae, and Sebacinaceae within the class Agaricomycetes (Han et al., 2016), among which Tulasnellaceae fungi are the most culturable and studied group. Researchers have isolated different types of Tulasnellaceae fungi from the roots of Dendrobium (Nontachaiyapoom et al., 2010; Zi et al., 2014; Shao et al., 2020; Leng Chunyan et al., 2026).

[0005] Research on the promoting effect of mycorrhizal fungi on Dendrobium seedlings has mainly focused on growth-promoting experiments on medicinal Dendrobium officinale and Dendrobium huoshanense seedlings (Yang et al., 2023; He et al., 2025; Wu et al., 2025; Zhang et al., 2025). Due to the high recognition specificity between mycorrhizal fungi from different sources and Dendrobium seedlings, the symbiotic mycorrhizalization growth-promoting technology system for Dendrobium seedlings is not yet perfect, and there are few reports on the rapid and effective acquisition of Dendrobium nobile mycorrhizalized seedlings through co-culture.

[0006] Sorbic acid is an internationally recognized safe food preservative. As a natural guardian of food preservation, sorbic acid has the characteristics of high safety, naturalness, and high efficiency. It is widely used in food, cosmetics, and medicine. Plant-derived natural preservative sorbic acid has broad development and application prospects. Summary of the Invention

[0007] The purpose of this invention is to address the existing technical problems by proposing a mycorrhizal fungus Tu55 of the Mycorrhizaeaceae family and its applications.

[0008] The present invention achieves the above objectives through the following technical solutions: As a first aspect of the present invention, a mycorrhizal fungus Tu55Tulasnella sp. of the family Mycorrhizalaceae is provided. The Tu55 strain was deposited at the China General Microbiological Culture Collection Center on April 23, 2026, with the accession number CGMCC No. 42763.

[0009] As a further optimization of the present invention, the Tu55 strain was isolated from the roots of mature Dendrobium lindleyi plants.

[0010] As a second aspect of the invention, a fungal block is also provided, containing the *Tu55* fungus of the *Colletotrichum* family as described in any one of the preceding claims.

[0011] As a third aspect of the invention, the use of the mycorrhizal fungus Tu55 of the Mycorrhizal Fungi family as described in any one of the above claims, or the mycorrhizal block as described above, in any one of the following (1)-(2): (1) Promotes the growth of Dendrobium nobile seedlings; (2) Increase the sorbic acid content of Dendrobium nobile seedlings.

[0012] As a further optimization of the present invention, promoting the growth of Dendrobium nobile seedlings means promoting the increase of root length, plant height or biomass of Dendrobium nobile seedlings.

[0013] As a fourth aspect of the present invention, a method for promoting the growth of Dendrobium nobile seedlings and increasing the sorbic acid content of Dendrobium nobile seedlings is also provided, comprising the following steps: (1) Transfer sterile Dendrobium nobile seedlings to a symbiotic culture medium; (2) The mycorrhizal fungus Tu55 of the family of mycorrhizal fungi as described above or the mycorrhizal block as described above is inoculated into the symbiotic culture medium and symbiotically cultured with Dendrobium nobile seedlings. After symbiotic culture, the Tu55 strain colonizes in the root cells of Dendrobium nobile seedlings and forms symbiotic mycorrhizae to promote the growth of Dendrobium nobile seedlings and increase the sorbic acid content of Dendrobium nobile seedlings.

[0014] As a further optimization of the present invention, the symbiotic culture medium is OMA medium, which consists of 3 g / L oats, 10 g / L sucrose, 6.5 g / L agar and 0.1 g / L activated carbon, with a pH of 5.8.

[0015] As a further optimization of the present invention, the culture conditions are as follows: the light cycle is 16 h of light and 8 h of darkness, the light intensity is 1500-2000 lx, and the culture temperature is 25.0±2.0 ℃.

[0016] As a further optimization of the present invention, the symbiotic culture period is 90 days.

[0017] The beneficial effects of this invention are as follows: This invention isolated a mycorrhizal fungus Tu55 from the roots of an adult Dendrobium nobile plant. Phylogenetic analysis of the conserved mitochondrial sequence showed that strain Tu55 is most closely related to published fungi of the family ... This invention uses aseptic seedlings of *Dendrobium nobile* as material and conducts a co-culture mycorrhizalization experiment with the mycorrhizal fungus Tu55 (Orchidaceae). The results show that *Dendrobium nobile* seedlings co-cultured for 30 days can establish a symbiosis with strain Tu55. Through specific staining and tissue sectioning of orchidaceae mycorrhizal fungi, it was observed that strain Tu55 colonizes the root cells of *Dendrobium nobile* seedlings in the form of hyphal clusters, which is a typical symbiotic model of orchidaceae mycorrhizae. After 90 days of co-culture, strain Tu55 can significantly promote the growth of root length, plant height and biomass accumulation of *Dendrobium nobile* seedlings (p<0.001), and significantly increase the sorbic acid content of mycorrhizalized *Dendrobium nobile* seedlings. Compared with the content in non-symbiotic seedlings, the content in mycorrhizalized seedlings can be significantly increased by about 1228 times. In summary, this invention yielded a potential new strain of the Mycotomycetes family, which can be used for the conservation and seedling cultivation of Dendrobium nobile, and also provides a new approach for the development of sorbic acid, a plant-derived natural preservative. Attached Figure Description

[0018] Figure 1 The figures show the colony and hyphal morphology of the Tu55 strain provided by this invention after 7 days of culture on PDA medium. In the figures, a shows the colony morphology on the front side; b shows the colony morphology on the back side; and c shows the hyphal microstructure. In c, A indicates the septum at the right-angle branch. Figure 2 The phylogenetic tree of some fungi in the mitochondrial family based on rDNA-mitochondrial sequence provided by this invention has the values ​​at the branch points as the support rates obtained by 1000 repeated evaluations using the Bootstrap method. Figure 3The Tu55 strain provided by this invention colonizes in the roots of Dendrobium nobile seedlings to form mycelial clusters; in the figure, P shows the intracellular colonized mycelial clusters. Figure 4 The symbiotic culture of the 90-day Tu55 strain provided by this invention promotes the growth of Dendrobium nobile seedlings; Figure 5 The retention time quality control chart for positive and negative ion internal standards provided by this invention. Detailed Implementation

[0019] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0020] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques known to those skilled in the art, and the reagents or materials described are all from commercial sources unless otherwise specified.

[0021] Example 1: Isolation and Identification of Mycorrhizal Fungi 1.1. Strains Isolation Fungi were isolated from the roots of mature Dendrobium lindleyi plants grown in greenhouses using the tissue section method.

[0022] The specific method is as follows: Collect healthy, plump Dendrobium root segments, wash away any attached substances with running water, and blot dry with absorbent paper. Prepare freehand sections and observe fungal colonization under a microscope. If fungal colonization is observed, transfer the sections to a clean bench and perform surface disinfection on the root segments near the sections: immerse in 75% ethanol for 30 seconds, rinse twice with sterile water, disinfect with 1% NaClO solution for 3 minutes, rinse five times with sterile water, and blot dry with sterile filter paper. Use a sterile blade to cut the root segments into thin slices approximately 0.5 mm thick, lay them flat on PDA medium, and incubate in the dark at 25 ℃. When hyphae emerge from the root slices, pick the edge hyphae and transfer them to PDA medium for purification. Inoculate the purified hyphae onto PDA slant tubes and incubate in the dark at 25 ℃ for 7-10 days. Store the PDA slant tubes with colonies at 4 ℃.

[0023] 1.2 Molecular identification of strains The isolated strain was re-inoculated onto PDA medium lined with cellophane and cultured for 10 days. A small amount of mycelium was scraped off with a sterile pipette tip, and DNA was extracted using the CTAB method for PCR amplification.

[0024] The amplification primers were designed as follows: Upstream primer (SEQ ID NO.1) ML5: 5'-CTCGGCAAATTATCCTCATAAG-3'; Downstream primer (SEQ ID NO.2) ML6: 5'-CAGTAGAAGCTGCATAGGGTC-3'.

[0025] The PCR amplification reaction system consisted of 2.0 μL template, 4.0 μL 10×Ex Taq Buffer, 3.0 μL dNTPMixture, 0.4 μL each of primers (10 μmol / L), 0.3 μL TaKaRa Ex Taq, and ddH2O to a final volume of 40 μL.

[0026] PCR amplification program: 94 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 40 s, 56 ℃ annealing for 40 s, 72 ℃ extension for 1 min, 35 cycles; 72 ℃ extension for 10 min.

[0027] After electrophoresis, the PCR products were sent to Beijing Boyoushun Biotechnology Co., Ltd. for bidirectional sequencing. The sequences were then assembled and compared in the NCBI database. Sequences with high similarity were selected for molecular identification, and a phylogenetic tree was constructed using the maximum likelihood (ML) method.

[0028] 1.3 Results A mycorrhizal fungus was isolated from the root of Dendrobium nobile and named Tu55. Figure 1 The image shows the colony and hyphal morphology of strain Tu55 after 7 days of inoculation on PAD medium. It can be seen that the colonies are pale yellow with radial edges, and the hyphae grow downwards. After 15 days of culture, the colonies have filled a 9 cm culture dish. Under an optical microscope, the hyphae are colorless and transparent, with septa at the right-angle branching points. No fruiting bodies or spore structures were observed.

[0029] The ML5 / ML6 primers amplified a conserved mitochondrial sequence, NCBI accession number PX984624.1, as shown below: TCTCGGCAAATTATCCTCATAAGTTAGACGATATGAAGAACCACTGAAACTATATAGGCTATGCCCTTATAGTATAAAGTGGTGGCACAGAATCGGAGGCCCCGACTGTTTACTTAAAACACAGCTTTCTGCGACGAATAATATCTTTGTATAGAAAGCGAATTTTGCCCAATGCCATTAATATAAGGTCGATAAGCGCTTAGCGTAATTATTGGCTGAAGTTCTGGTCAATGGCGGTCTTATCTATGAGGATCCTAAGGTAGCAAAATTAATTGTCCATTAAATGTGGTCCTGACTGAATAAAGTAACGATGGTCTCGCTGTCTCTACAAGTATCTCAGTGAAATTGAATTAGCCGTGCAGATGCGGTTTAACTTCGGGTAGACGGGAAGACCCTATGCACTTTCTACTGA (SEQ ID NO.3); NCBI comparison results showed that the fungus with the highest similarity to strain Tu55 was *Tulasnella calospora* strain Pvi-BRBG-1 (PP963828.1), a culturable root-forming fungus of the genus *Paphiopedilum villosum*. Figure 2 The results of the phylogenetic analysis of conserved mitochondrial sequences are shown. The Tu55 strain clusters with published fungi of the Mucocephalaceae family, which is a Mucocephalaceae family. However, this strain is not closely related to common culturable species of the Mucocephalaceae family and is a potential new strain.

[0030] Example 2: Co-culture and growth of fungi and Dendrobium seedlings 2.1 Obtaining tissue culture seedlings from seed germination *Dendrobium unicum* plants were cultivated in the research greenhouse of the Beijing Botanical Garden. They were self-pollinated at the initial flowering stage. The capsules were collected when mature but not yet dehiscent for use in the non-symbiotic germination of seeds to form sterile seedlings. Specifically, After wiping the surface of mature, unopened Dendrobium capsules with 75% ethanol, they were transferred to a clean bench and treated with a 1% NaClO solution for 3 min. The capsules were then rinsed five times with sterile water, dried with filter paper, and the seeds were extracted by cutting open the capsules with a sterile scalpel. The seeds were then evenly sown on 1 / 2 MS agar plates (1 / 2 MS + 10 g / L sucrose + 6.5 g / L agar + 0.1 g / L activated carbon, pH=5.8). Sterile tissue culture seedlings were obtained after 3 months of seed germination.

[0031] 2.2 Seedling Symbiotic Culture Dendrobium nobile tissue culture seedlings were transferred to tissue culture flasks containing OMA medium (OMA: 3 g / L oats + 10 g / L sucrose + 6.5 g / L agar + 0.1 g / L activated carbon, pH=5.8). A 0.5 cm diameter piece of Tu55 strain was inoculated in the center of the medium for symbiotic culture. The culture conditions were: a photoperiod of 16 h / 8 h (light / dark), a light intensity of 1500-2000 lx, and a temperature of 25.0±2.0 ℃. This was designated as the OMA treatment group, abbreviated as Du-Tu55. An OMA control group and an MS control group were also set up, as detailed below: OMA control group, abbreviated as Du-ck: Dendrobium seedlings were transferred only into OMA medium; MS control group: MS + 10 g / L sucrose + 6.5 g / L agar + 0.1 g / L activated carbon, pH=5.8.

[0032] Each treatment group was repeated 5 times.

[0033] 2.3 Observation of root colonization of strain Tu55 When the Dendrobium seedlings in the OMA treatment group were co-cultured for 30 days, plant samples were randomly selected every day. The colonization of fungi in the seedling roots was observed under an optical microscope by tissue sectioning and safranin staining (Warcup JH. Symbiotic germination of some Australianterrestrial orchids[J]. New Phytologist, 1973, 72(9): 387-392).

[0034] 2.4 Effects of Tu55 strain on the growth of Dendrobium seedlings After 30 days of co-culturing tissue culture seedlings of Dendrobium nobile with strain Tu55, 10 seedlings from each of the treatment group and the control group were randomly selected, and their fresh weight, dry weight, root length and plant height were measured.

[0035] 2.5 Results After co-culturing Dendrobium nobile seedlings with strain Tu55 for 30 days on OMA medium, stable intracellular colonization hyphae clusters were observed in the roots of the co-cultured Dendrobium nobile seedlings under an optical microscope, indicating that strain Tu55 had stably colonized the root cells of Dendrobium nobile seedlings. Figure 3 ), forming symbiotic mycorrhizae.

[0036] After 90 days of co-culture, compared with independently cultured Dendrobium nobile seedlings, strain Tu55 significantly promoted the growth of co-cultured Dendrobium nobile seedlings, with the most significant effects on root length and plant height, increasing them by 3.805 times and 2.265 times, respectively (p<0.001). Fresh weight and dry weight increased by approximately 1.5 times, but all differences were statistically significant. The results are as follows: Figure 4 As shown in Table 1.

[0037] Table 1. Growth-promoting effect of strain Tu55 on Dendrobium nobile seedlings. Note: * indicates that the results of symbiotic culture are significantly different from those of non-symbiotic culture at the p<0.001 level.

[0038] Example 3 Detection of metabolites in Dendrobium-fungus symbiont The relative content of sorbic acid (C6H8O2) in Dendrobium nobile seedlings was determined by LC-MS; the specific steps are as follows: 3.1 Preparation of the test sample solution Seedlings of *Dendrobium nobile* cultured alone (Du-ck) and co-cultured (Du-Tu55) for 90 days were used as test samples. The samples were freeze-dried and then ground (45 Hz, 60 s). 25 mg (±1 mg) of the sample was accurately weighed and added to a 2 mL centrifuge tube. 1000 μL of extraction buffer (methanol:water = 3:1, volume ratio, including internal standard) was added. After vortexing for 30 s, homogenization was performed at 40 Hz for 4 min, followed by sonication in an ice-water bath for 5 min. The homogenization and sonication were repeated 3 times. After incubation at 4 ℃ overnight, the mixture was centrifuged at 12000 rpm for 15 min at 4 ℃. The supernatant was filtered through a 0.22 μm filter and injected into a 2 mL volume.

[0039] 3.2 Chromatographic conditions Metabolites in *Dendrobium nobile* seedlings were separated by chromatographic separation using an EXION LC System (SCIEX) ultra-high performance liquid chromatograph with a UPLC Kinetex C18 column (2.1 mm × 100 mm, 2.6 μm). Phase A of the liquid chromatography was an aqueous solution containing 0.01% acetic acid, and phase B was 50% acetonitrile / isopropanol. The column oven temperature was 25 °C, the autosampler temperature was 4 °C, the injection volume was 2 μL, and the flow rate was 0.3 mL / min.

[0040] 3.3 Mass Spectrometry Conditions Mass spectrometry analysis was performed using a SCIEX 6500 QQQ triple quadrupole mass spectrometer equipped with an IonDrive Turbo V ESI ion source in multiple reaction monitoring (MRM) mode.

[0041] The ion source parameters are as follows: IonSpray Voltage: 5500 V / -4500 V, Curtain Gas: 35 psi, Temperature: 400 ℃, Ion Source Gas: 50 psi. Electrospray ionization (ESI) was selected in MRM positive and negative modes to acquire mass spectrometry data. During the detection process, the instrument stability and signal normality were monitored in real time by detecting and analyzing the internal standard response and the stability of the sample's response in the internal standard.

[0042] Figure 5 The image shows the retention time quality control chart of the internal standard in the sample. The sample and retention time are both within ±10 s of the expected retention time, indicating that the instrument data acquisition stability is very good. When an exogenous substance is used as an internal standard and its concentration is the same as that of the sample internal standard, the smaller the difference in the response of the internal standard (relative standard deviation RSD ≤ 20%), the more stable the system and the higher the data quality. The data in Table 2 shows that the quality of the test data is very high.

[0043] Table 2. Stability of Internal Standard Response in Samples 3.4 Results As shown in Table 3, compared with the independently cultured Dendrobium nobile seedlings (Du-ck), the sorbic acid content in the Dendrobium nobile-mucinous mycorrhizal symbiont (Du-Tu55) was significantly increased by 1228.18 times (p<0.001). The mucinous mycorrhizal fungus Tu55, which was isolated and identified from the roots of Dendrobium nobile, can significantly promote the synthesis of sorbic acid in the Dendrobium nobile-mucinous mycorrhizal symbiont.

[0044] Table 3. Relative content of sorbic acid in Dendrobium nobile seedlings before and after symbiosis The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A mycorrhizal fungus Tu55 of the Mycorrhizaeaceae family, characterized in that, The Tu55 strain was deposited at the China General Microbiological Culture Collection Center on April 23, 2026, with accession number CGMCC No. 42763.

2. The mycorrhizal fungus Tu55 of the Cotyledonaceae family according to claim 1, characterized in that, The Tu55 strain was isolated from the roots of mature Dendrobium lindleyi plants.

3. A type of fungal colony, characterized in that, Contains Tu55, a fungus of the Cotyledonaceae family as described in any one of claims 1-2.

4. The use of the mycorrhizal fungus Tu55 of the Mycorrhizaeaceae family as described in any one of claims 1-2 or the mycorrhizal block as described in claim 3 in any one of (1)-(2) below, characterized in that, (1) Promotes the growth of Dendrobium nobile seedlings; (2) Increase the sorbic acid content of Dendrobium nobile seedlings.

5. The application according to claim 4, characterized in that, The promotion of Dendrobium nobile seedling growth refers to the promotion of the increase of root length, plant height or biomass of Dendrobium nobile seedlings.

6. A method for promoting the growth of Dendrobium nobile seedlings and increasing the sorbic acid content of Dendrobium nobile seedlings, characterized in that, Includes the following steps: (1) Transfer sterile Dendrobium nobile seedlings to a symbiotic culture medium; (2) The mycorrhizal fungus Tu55 of the Mycorrhizal Fungi family as described in any one of claims 1-2 or the mycorrhizal block as described in claim 2 is inoculated into a symbiotic culture medium and symbiotically cultured with Dendrobium nobile seedlings. After symbiotic culture, the Tu55 strain colonizes in the root cells of Dendrobium nobile seedlings and forms symbiotic mycorrhizae to promote the growth of Dendrobium nobile seedlings and increase the sorbic acid content of Dendrobium nobile seedlings.

7. The method according to claim 6, characterized in that, The symbiotic culture medium is OMA medium, which consists of 3 g / L oats, 10 g / L sucrose, 6.5 g / L agar and 0.1 g / L activated carbon, with a pH of 5.

8.

8. The method according to claim 6, characterized in that, The culture conditions were as follows: a light cycle of 16 h light and 8 h darkness, a light intensity of 1500-2000 lx, and a culture temperature of 25.0 ± 2.0 ℃.

9. The method according to claim 6, characterized in that, The symbiotic culture period is 90 days.

Images