A high-flux kasp molecular marker significantly related to the height of upland cotton plant and application

By developing high-throughput KASP molecular markers associated with upland cotton plant height, and using KASP primers for PCR amplification and fluorescence signal detection, the problem of low efficiency in improving cotton plant height traits in traditional breeding methods has been solved, achieving high efficiency and accuracy in cotton breeding and promoting the breeding of cotton varieties for mechanized harvesting.

CN122382231APending Publication Date: 2026-07-14INST OF COTTON RES CHINESE ACAD OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610444803.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-07
Publication Date
2026-07-14

AI Technical Summary

Technical Problem

Traditional breeding methods for improving cotton plant height are inefficient and time-consuming, and desirable traits are easily lost. Furthermore, existing molecular marker-assisted selection technology is not widely or effectively applied in cotton breeding.

Method used

We developed high-throughput KASP molecular markers that are significantly associated with upland cotton plant height, and used KASP primers for PCR amplification and fluorescence signal detection to achieve high-throughput and accurate genotyping of cotton plant height traits.

Benefits of technology

It has accelerated the cotton breeding process, improved breeding efficiency and accuracy, and facilitated the selection of cotton varieties for mechanized harvesting.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122382231A_ABST
    Figure CN122382231A_ABST
Patent Text Reader

Abstract

The application discloses a high-throughput KASP molecular marker significantly related to plant height of Gossypium hirsutum and application, and belongs to the technical field of cotton molecular breeding. The KASP marker is successfully developed based on cotton plant type related genes and resequencing data of germplasm resources. Through genotyping and phenotype correlation analysis in 246 natural Gossypium hirsutum populations, four KASP markers (PH-TK1-PH-TK4) significantly related to plant height in three environments are screened. The regulation effect and aggregation effect of the markers on plant height are verified in a separation population. Experiments prove that the KASP marker can be used for high-throughput and accurate genotyping of plant height in early cotton breeding, and provides an effective tool for molecular marker assisted selection of cotton ideal plant type, and helps to accelerate the breeding process of cotton varieties suitable for mechanical harvesting.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cotton molecular breeding technology, and in particular to a high-throughput KASP molecular marker and its application that is significantly associated with the plant height of upland cotton. Background Technology

[0002] Cotton is an important global economic crop and a source of natural fiber. Its plant structure directly affects its adaptability to mechanical harvesting, fiber quality, and yield. Upland cotton (Gossypium hirsutum L.), as a tetraploid cultivar, is characterized by high yield, early maturity, excellent fiber quality, and wide adaptability. It has become the most widely planted cotton variety in the world and is crucial to ensuring the global cotton supply.

[0003] With rising labor costs, cotton production is transitioning from manual harvesting to mechanized harvesting. Plant architecture, especially plant height, is a key factor determining suitability for mechanized harvesting, and also significantly impacts early maturity, yield, and quality. Plant architecture traits such as plant height, height of the first fruiting node, position of the first fruiting node, and number of fruiting branches are quantitative traits, controlled by multiple genes and environmental interactions, resulting in a complex genetic background. A reasonable plant architecture can optimize canopy ventilation and light penetration, improve light energy utilization efficiency, and coordinate vegetative and reproductive growth, thereby increasing yield through increased boll number, boll weight, and lint percentage. Among various plant architecture traits, plant height is the most direct and highly heritable indicator: excessively tall plants tend to lead to dense canopy cover, poor ventilation, and increased risk of lodging and pests / diseases; excessively short plants limit biomass accumulation and effective boll-forming space, thus restricting yield potential.

[0004] Traditional breeding methods for improving plant height are inefficient, time-consuming, and prone to loss of desirable traits in hybrid offspring. Marker-assisted selection (MAS) offers an effective solution to this problem. MAS utilizes molecular markers closely linked to the target trait to directly select genotypes in early generations, significantly improving breeding efficiency and accuracy. Single nucleotide polymorphisms (SNPs), as third-generation molecular markers, are abundant, widely distributed, have high detection throughput, and are suitable for automated analysis, and have been widely used in crop genetic research.

[0005] Kompetitive allele-specific PCR (KASP) is a fluorescence-based SNP genotyping technique. This technique involves designing two allele-specific forward primers and one universal reverse primer for the target SNP locus. Genotype is determined by detecting the fluorescence signal after PCR amplification. KASP technology offers advantages such as high sensitivity, high specificity, low cost, and high throughput, and has been widely used in important crops such as wheat, maize, and rice.

[0006] In recent years, with the development of cotton genomics, a large number of candidate genes related to plant type have been identified, but their allelic variation effects and breeding value are still unclear. Summary of the Invention

[0007] The purpose of this invention is to provide a high-throughput KASP molecular marker and its application that is significantly associated with plant height in upland cotton, in order to solve the problems existing in the prior art. The KASP marker of this invention can be used for high-throughput and accurate genotyping of plant height traits in the early stage of cotton breeding, providing an effective tool for molecular marker-assisted selection of ideal cotton plant type, and helping to accelerate the breeding process of cotton varieties suitable for mechanized harvesting.

[0008] To achieve the above objectives, the present invention provides the following solution: This invention provides a high-throughput KASP molecular marker that is significantly associated with upland cotton plant height, including at least one of PH-TK1, PH-TK2, PH-TK3 and PH-TK4; The PH-TK1 is located at position 90582149 on chromosome A05 of upland cotton. The mutated base is G or A. The GG genotype results in lower plant height. The PH-TK2 is located at position 2181993 on chromosome A05 of upland cotton, with the mutant base being G or A. The GG genotype results in lower plant height. The PH-TK3 is located at position 90678640 on chromosome A05 of upland cotton. The mutant base is T or C. The TT genotype results in lower plant height. The PH-TK4 is located at position 2018493 on chromosome A05 of upland cotton. The mutant base is T or C. The CC genotype results in lower plant height. The reference genome is the genome of the upland cotton TM-1 standard line.

[0009] The present invention also provides KASP primers for specifically detecting the KASP molecular marker, wherein the KASP primers for detecting PH-TK1 consist of forward primer 1 with nucleotide sequence as shown in SEQ ID NO.1, forward primer 2 with nucleotide sequence as shown in SEQ ID NO.2, and reverse universal primer with nucleotide sequence as shown in SEQ ID NO.3; The KASP primers for detecting PH-TK2 consist of forward primer 1 with the nucleotide sequence shown in SEQ ID NO.4, forward primer 2 with the nucleotide sequence shown in SEQ ID NO.5, and reverse universal primer with the nucleotide sequence shown in SEQ ID NO.6. The KASP primers for detecting PH-TK3 consist of forward primer 1 with the nucleotide sequence shown in SEQ ID NO.7, forward primer 2 with the nucleotide sequence shown in SEQ ID NO.8, and reverse universal primer with the nucleotide sequence shown in SEQ ID NO.9. The KASP primers for detecting PH-TK4 consist of forward primer 1 with the nucleotide sequence shown in SEQ ID NO.10, forward primer 2 with the nucleotide sequence shown in SEQ ID NO.11, and reverse universal primer with the nucleotide sequence shown in SEQ ID NO.12.

[0010] The present invention also provides reagents or kits containing the KASP primers.

[0011] This invention also provides the use of the KASP primers or the reagents or kits described herein in any of the following: (1) To identify or assist in identifying the height of upland cotton plants; (2) Prepare products for identification or auxiliary identification of upland cotton plant height; (3) Select upland cotton germplasm with low or high plant height; (4) Prepare products of upland cotton germplasm with low or high plant height.

[0012] This invention also provides a method for determining the height of upland cotton plants, comprising the following steps: Using the genome of the sample to be tested as a template, the template is amplified by PCR using the KASP primers described above, and the fluorescence signal is read and judged according to the type of fluorescence signal; When the FAM signal is detected, the height of the sample plant to be tested is determined to be low; when the HEX signal is detected, the height of the sample plant to be tested is determined to be high.

[0013] This invention also provides a method for selecting upland cotton plants of different heights, comprising the following steps: Using the genome of the sample to be tested as a template, the template was amplified by PCR using the KASP primers described above, and the fluorescence signal was read. Samples to be tested that showed the FAM signal were selected for further cultivation.

[0014] This invention also provides a method for selecting tall upland cotton plants, comprising the following steps: Using the genome of the sample to be tested as a template, the template was amplified by PCR using the KASP primers described above, the fluorescence signal was read, and the sample to be tested that showed the HEX signal was selected for cultivation.

[0015] Optionally, the PCR amplification reaction system is as follows: 1 μL DNA template, 1 μL 2×KASP Master Mix, 0.04 μL KASP primer, and ddH2O to a final volume of 3 μL; The KASP primers are a mixture of forward primer 1, forward primer 2 and reverse universal primer in a volume ratio of 1:1:1.

[0016] Optionally, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃~55℃ annealing and extension for 60 s, 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, 22 cycles.

[0017] The present invention discloses the following technical effects: This invention successfully developed corresponding KASP markers based on cotton plant type-related genes and germplasm resource resequencing data. Through genotyping and phenotypic association analysis of 246 natural upland cotton accessions, four KASP markers (PH-TK1~PH-TK4) significantly correlated with plant height under three environmental conditions were screened. The regulatory and aggregation effects of these markers on plant height were further verified in segregating populations. Experiments demonstrate that the KASP markers of this invention can be used for high-throughput and accurate genotyping of plant height traits in the early stages of cotton breeding, providing an effective tool for marker-assisted selection of ideal cotton plant types and helping to accelerate the breeding process of cotton varieties suitable for mechanized harvesting. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a schematic diagram of KASP marker genotyping in a natural population; A: PH-TK1; B: PH-TK2; C: PH-TK3; D: PH-TK4; Blue dots represent FAM fluorescent signal sites, red dots represent HEX fluorescent signal sites, black dots represent blank controls, and pink dots represent unsuccessful genotyping. Figure 2 The phenotypic distribution of plant height trait in 246 upland cotton varieties under three different environments; Figure 3Comparison of plant height among individual plants with different allelic variations of PH-TK1, PH-TK2, PH-TK3 and PH-TK4 in the F2 population of Jimian 169 × Heishanmian 1; Figure 4 Evaluation of the aggregation effect of four KASP markers in the F2 population of Jimian 169 × Heishanmian 1; A: PH-TK1; B: PH-TK2; C: PH-TK3; D: PH-TK4. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] Example 1: KASP Tag Development (1) 162 genes related to cotton plant type traits reported in the past ten years were collected from the Web of Science website (https: / / www.webofscience.com / ) and the NCBI Pumped website (https: / / pubmed.ncbi.nlm.nih.gov / ) (Table 1). The physical location of these candidate genes was determined using the genome of the TM-1 standard line assembled by Nanjing Agricultural University (https: / / yanglab.hzau.edu.cn / CottonMD / download.1) as a reference genome.

[0026] (2) The SNP mutation sites within the upstream 2000 bp and coding region of the above 162 genes were obtained through the CottonMD website (https: / / yanglab.hzau.edu.cn / CottonMD / ). SNPs were found in the regions of 132 genes. One SNP was selected from each gene for the development of KASP markers. The selection order was: non-synonymous mutation > promoter region mutation > synonymous mutation > intron region mutation.

[0027] (3) Initial KASP primer design was performed on the selected SNP sites using the SNPway website (http: / / www.snpway.com / ).

[0028] (4) Use e-PCR genome simulation amplification technology to screen primers for specificity. Take any one of the original KASP primers and the universal back primer as a set of primers, and select the primer set that can be simulated to amplify only at one position in the reference genome as candidate KASP primers.

[0029] (5) The candidate KASP markers were initially verified using 46 upland cotton germplasms with high genetic diversity, and markers that could be stably and clearly genotyped were selected.

[0030] (6) If a certain SNP site is not suitable for developing KASP markers or cannot be effectively genotyped, the next SNP of the gene should be selected in sequence for development.

[0031] (7) After the above process, a total of 78 KASP markers for genes related to plant height were obtained for subsequent analysis.

[0032] Example 2: Validation of KASP markers in a population of 246 samples (1) To verify the correlation between 78 KASP markers and plant height, genotyping was performed on 246 widely representative upland cotton germplasm resources (Table 2), and their plant height phenotypes were identified for three consecutive years (2020-2022). This population included 54 varieties from the Yellow River cotton region, 31 varieties from the Yangtze River cotton region, 53 varieties from the Northwest inland cotton region, 45 varieties from the northern extra-early maturing cotton region, 28 local varieties, and 35 foreign varieties.

[0033] (2) The field trial was conducted at the Dongchang Experimental Station of the Cotton Research Institute, Chinese Academy of Agricultural Sciences, Anyang, Henan Province (36.05°N, 114.21°E), and was carried out for three consecutive years (2020, 2021, and 2022). The experimental plot had moderate fertility. Sowing was carried out in late April, with sequential arrangement and two replicates. The row length was 5 m, the row spacing was 0.8 m, and the plant spacing was 0.25 m. Field management was carried out according to local standards.

[0034] (3) In early October each year, select plants with normal growth status from a row for phenotypic survey and measure the height of 10 plants consecutively. Use a ruler to measure the vertical height from the cotyledon node to the top of the main stem.

[0035] (4) Genotyping of 246 upland cotton varieties was performed using 78 KASP markers associated with plant height. Figure 1 Genomic DNA was extracted using a modified CTAB method. After measuring the quality and concentration with a microplate reader, the concentration was uniformly adjusted to 20 ng / μL. PCR amplification was performed using a Hydrocycler 2 water bath thermal cycler.

[0036] Prepare a 3 μL KASP reaction system: 1 μL 20 ng / μL DNA template, 1 μL 2×KASP Master Mix, 0.04 μL 100 μmol / L KASP primers (a mixture of the three primers dissolved in a 1:1:1 volume ratio), and add ddH2O to a final volume of 3 μL; The amplification program was as follows: pre-denaturation at 94℃ for 15 min. The first amplification reaction consisted of denaturation at 94℃ for 20 s, followed by annealing and extension at 61℃–55℃ for 60 s, for 10 cycles. The second amplification reaction consisted of denaturation at 94℃ for 20 s, followed by annealing and extension at 55℃ for 60 s, for 22 cycles. The amplified 384-well plates were then placed in a Pherastar fluorescence scanner to read the fluorescence signals. The FAM and HEX signals of each material were determined using Kraken™ data analysis software to further determine the sample genotype.

[0037] (5) Association analysis was performed between the obtained genotype data and plant height phenotypic data from three environments (three consecutive cotton growing seasons from 2020 to 2022). The results showed that four KASP markers (PH-TK1, PH-TK2, PH-TK3, and PH-TK4) were significantly associated with plant height in all three environments (Table 1). The average plant height difference among different alleles of PH-TK1 was 4.96 cm, that of PH-TK2 was 7.23 cm, that of PH-TK3 was 4.55 cm, and that of PH-TK4 was 7.23 cm. Figure 2 ).

[0038] The four KASP marker detection sites mentioned above are SNP1 (PH-TK1), SNP2 (PH-TK2), SNP3 (PH-TK3), and SNP4 (PH-TK4).

[0039] SNP1 is located on chromosome A05 of upland cotton. GhWRKY70 The gene (90583705~90584788 bp of A05 staining, based on the upland cotton TM-1 genome assembled by Nanjing Agricultural University) has an allelic variant at 1556 bp upstream of the promoter (5'→3'), which is a G / A variant and the corresponding KASP marker is PH-TK1. SNP2 is located on chromosome A05 of upland cotton. GhACS7 The gene (2183774~2185291 bp of A05 staining, based on the upland cotton TM-1 genome assembled by Nanjing Agricultural University) has an allelic variant at 1781 bp upstream of the promoter (5'→3'), which is a G / A variant and the corresponding KASP name is PH-TK2. SNP3 is located on chromosome A05 of upland cotton. GhCYP714 The allelic variant (5'→3') is located 493 bp upstream of the promoter of the gene (90679133~90682020 bp on chromosome A05, based on the upland cotton TM-1 genome assembled by Nanjing Agricultural University). The corresponding KASP marker is named PH-TK3. SNP4 is located on chromosome A05 of upland cotton. GhPFN2 The gene (2019753~2020336 bp of A05 staining, based on the upland cotton TM-1 genome assembled by Nanjing Agricultural University) has an allelic variant at 1260 bp upstream of the promoter (5'→3'), which is a C / T variant and corresponds to the KASP marker PH-TK4.

[0040] The PH-TK1 labeled primer set consists of 3 primers: Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCT AGAAATAAAATCAAACATACCTCCCG-3' (SEQ ID NO. 1); Forward primer 2: 5'- GAAGGTCGGAGTCAACGGATT AGAAATAAAATCAAACATACCTCCCA-3' (SEQ ID NO. 2); Reverse universal primer: 5'-ACAAAAGGTTCTTGGATATTCGGC-3' (SEQ ID NO.3).

[0041] The PH-TK2 labeled primer set consists of 3 primers: Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCT TTGTTTTCTCATGTAGTTTAATGATCAG-3' (SEQ ID NO.4); Forward primer 2: 5'- GAAGGTCGGAGTCAACGGATT TTGTTTTCTCATGTAGTTTAATGATCAA-3' (SEQ ID NO. 5); Reverse universal primer: 5'-AAGTGTTAAGAGTCAACTCAGGCA-3' (SEQ ID NO.6).

[0042] The PH-TK3 labeled primer set consists of 3 primers: Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCT TGATTCCACATTATCCTTATCCTTTTCT-3' (SEQ ID NO. 7); Forward primer 2: 5'- GAAGGTCGGAGTCAACGGATT TGATTCCACATTATCCTTATCCTTTTCC-3' (SEQ ID NO. 8); Reverse universal primer: 5'-TCCAACTAAAAAGGCTAAAAATCAAGA-3' (SEQ ID NO.9).

[0043] The PH-TK4 labeled primer set consists of 3 primers: Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCT ACTAACAGACTATTTGAATTGTGAACC-3' (SEQ ID NO. 10); Forward primer 2: 5'- GAAGGTCGGAGTCAACGGATT ACTAACAGACTATTTGAATTGTGAACT-3' (SEQ ID NO. 11); Reverse universal primer: 5'-GTGTCAGGCACTATTCTCTTAAATTGT-3' (SEQ ID NO.12).

[0044] In the primers mentioned above, the single-underlined sequence is the FAM fluorescent tag adapter, and the double-underlined sequence is the HEX fluorescent tag adapter.

[0045] When the PH-TK1 marker detects the FAM signal, it indicates that the SNP1 allelic variant is G, corresponding to a genotype with lower plant height; when the HEX signal is detected, it indicates that the SNP1 allelic variant is A, corresponding to a genotype with higher plant height.

[0046] When the PH-TK2 marker detects the FAM signal, it indicates that the SNP2 allelic variant is G, corresponding to a genotype with lower plant height. When the HEX signal is detected, it indicates that the SNP2 allelic variant is A, corresponding to a genotype with higher plant height.

[0047] When the PH-TK3 marker detects the FAM signal, it indicates that the SNP3 allelic variant is T, corresponding to a genotype with lower plant height; when the HEX signal is detected, it indicates that the SNP3 allelic variant is C, corresponding to a genotype with higher plant height.

[0048] When the PH-TK4 marker detects the FAM signal, it indicates that the SNP4 allelic variant is C, corresponding to a genotype with lower plant height; when the HEX signal is detected, it indicates that the SNP4 allelic variant is T, corresponding to a genotype with higher plant height.

[0049] Table 1. TK markers significantly associated with plant height under different environmental conditions. Note: and Represents respectively in P <0.05 and P <0.01 level is significant.

[0050] Example 3: Validation and application of four KASP markers in a segregated population (1) To verify the marker effect in a genetic context, an F2 segregating population of 366 individual plants was constructed using upland cotton varieties Jimian 169 (average plant height 94.3 cm) and Heishanmian 1 (average plant height 62.2 cm) as parents. All four KASP marker loci were polymorphic between the two parents.

[0051] (2) In 2021, 366 F2 single plants were planted at the Dongchang Experimental Station of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences in Anyang, Henan Province (36.05°N, 114.21°E), and the planting method was the same as in Specific Example 2.

[0052] (3) Genotyping of the F2 population was performed using PH-TK1, PH-TK2, PH-TK3 and PH-TK4 markers. The cotton DNA extraction and KASP reaction procedures were the same as in Example 2.

[0053] (4) The time and method for identifying the plant height phenotype of F2 individual plants were the same as those in Example 2.

[0054] (5) The phenotypic distribution frequency of plant height in the F2 population conformed to a normal distribution. At the PH-TK1 locus, a total of 71 homozygous AA genotype plants and 85 homozygous GG genotype plants were detected. Compared with the homozygous AA genotype, the plant height of the homozygous GG genotype decreased by 9.28 cm in the F2 generation (P<0.05), and compared with the recipient parent Jimian 169, the plant height of the homozygous GG genotype decreased by 10.44 cm in the F2 generation (P<0.05). At the PH-TK2 locus, a total of 68 homozygous AA genotype plants and 87 homozygous GG genotype plants were detected. Compared with the homozygous AA genotype, the plant height of the homozygous GG genotype decreased by 6.78 cm in the F2 generation (P<0.05), and compared with the recipient parent Jimian 169, the plant height of the homozygous GG genotype decreased by 10.27 cm in the F2 generation (P<0.05). At the PH-TK3 locus, 73 plants with the homozygous CC genotype and 90 plants with the homozygous TT genotype were detected. Compared with the homozygous CC genotype, the plant height of the homozygous TT genotype decreased by 8.51 cm in the F2 generation (P<0.05). Compared with the recipient parent, Jimian 169, the plant height of the homozygous TT genotype decreased by 10.25 cm in the F2 generation (P<0.05). At the PH-TK4 locus, 78 plants with the homozygous CC genotype and 89 plants with the homozygous TT genotype were detected. Compared with the homozygous TT genotype, the plant height of the homozygous CC genotype decreased by 4.6 cm in the F2 generation (P<0.05). Compared with the recipient parent, Jimian 169, the plant height of the homozygous CC genotype decreased by 9.4 cm in the F2 generation (P<0.05). Figures 3-4 ).

[0055] Table 2. Names and origins of 246 upland cotton varieties The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A high-throughput KASP molecular marker significantly associated with upland cotton plant height, characterized in that, Including at least one of PH-TK1, PH-TK2, PH-TK3 and PH-TK4; The PH-TK1 is located at position 90582149 on chromosome A05 of upland cotton. The mutated base is G or A. The GG genotype results in lower plant height. The PH-TK2 is located at position 2181993 on chromosome A05 of upland cotton, with the mutant base being G or A. The GG genotype results in lower plant height. The PH-TK3 is located at position 90678640 on chromosome A05 of upland cotton. The mutant base is T or C. The TT genotype results in lower plant height. The PH-TK4 is located at position 2018493 on chromosome A05 of upland cotton. The mutant base is T or C. The CC genotype results in lower plant height. The reference genome is the genome of the upland cotton TM-1 standard line.

2. The KASP primers for specific detection of the KASP molecular marker described in claim 1, characterized in that, The KASP primers for detecting PH-TK1 consist of forward primer 1 with the nucleotide sequence shown in SEQ ID NO.1, forward primer 2 with the nucleotide sequence shown in SEQ ID NO.2, and reverse universal primer with the nucleotide sequence shown in SEQ ID NO.

3. The KASP primers for detecting PH-TK2 consist of forward primer 1 with the nucleotide sequence shown in SEQ ID NO.4, forward primer 2 with the nucleotide sequence shown in SEQ ID NO.5, and reverse universal primer with the nucleotide sequence shown in SEQ ID NO.

6. The KASP primers for detecting PH-TK3 consist of forward primer 1 with the nucleotide sequence shown in SEQ ID NO.7, forward primer 2 with the nucleotide sequence shown in SEQ ID NO.8, and reverse universal primer with the nucleotide sequence shown in SEQ ID NO.

9. The KASP primers for detecting PH-TK4 consist of forward primer 1 with the nucleotide sequence shown in SEQ ID NO.10, forward primer 2 with the nucleotide sequence shown in SEQ ID NO.11, and reverse universal primer with the nucleotide sequence shown in SEQ ID NO.

12.

3. A reagent or kit containing the KASP primers of claim 2.

4. The use of the KASP primer as described in claim 2 or the reagent or kit as described in claim 3 in any of the following: (1) To identify or assist in identifying the height of upland cotton plants; (2) Prepare products for identification or auxiliary identification of upland cotton plant height; (3) Select upland cotton germplasm with low or high plant height; (4) Prepare products of upland cotton germplasm with low or high plant height.

5. A method for determining the height of upland cotton plants, characterized in that, Includes the following steps: Using the genome of the sample to be tested as a template, PCR amplification of the template is performed using the KASP primers described in claim 2, and the fluorescence signal is read and determined according to the type of fluorescence signal; When the FAM signal is detected, the height of the sample plant to be tested is determined to be low; when the HEX signal is detected, the height of the sample plant to be tested is determined to be high.

6. A method for selecting upland cotton plants of varying heights, characterized in that, Includes the following steps: Using the genome of the sample to be tested as a template, PCR amplification of the template was performed using the KASP primers described in claim 2, and the fluorescence signal was read. Samples to be tested that showed the FAM signal were selected for cultivation.

7. A method for selecting tall upland cotton plants, characterized in that, Includes the following steps: Using the genome of the sample to be tested as a template, PCR amplification of the template was performed using the KASP primers described in claim 2, the fluorescence signal was read, and the sample to be tested that showed the HEX signal was selected for cultivation.

8. The method according to any one of claims 5-7, characterized in that, The PCR amplification reaction system was as follows: 1 μL DNA template, 1 μL 2×KASP Master Mix, 0.04 μL KASP primers, and ddH2O to a final volume of 3 μL. The KASP primers are a mixture of forward primer 1, forward primer 2 and reverse universal primer in a volume ratio of 1:1:

1.

9. The method according to any one of claims 5-7, characterized in that, The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃~55℃ annealing and extension for 60 s, 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, 22 cycles.