A primer probe combination for detecting fritillaria thunbergii based on proofman-lmtia technology and application thereof

Abstract

This invention discloses a primer-probe combination for detecting Fritillaria thunbergii using Proofman-LMTIA technology and its application, relating to the field of molecular detection technology. The primer-probe combination includes primers ZBM-F, ZBM-B, and ZBM-LB, and a probe ZBM-Probe; the nucleotide sequences of primers ZBM-F, ZBM-B, and ZBM-LB are shown in SEQ ID NO. 1-3, respectively; the nucleotide sequence of the probe ZBM-Probe is shown in SEQ ID NO. 4. The primer-probe combination designed in this invention can be used for rapid detection of Fritillaria thunbergii using Proofman-LMTIA technology. It can effectively monitor the quality of Fritillaria thunbergii during production, processing, and distribution, and can greatly simplify the detection process, reduce costs, and shorten detection time.

Description

Technical Field

[0001] This invention relates to the field of molecular detection technology, and in particular to a primer-probe combination for detecting Fritillaria thunbergii based on Proofman-LMTIA technology and its application. Background Technology

[0002] Fritillaria thunbergii ( Fritillaria thunbergii Fritillaria thunbergii (Miq.) is a herbaceous plant belonging to the genus Fritillaria in the family Liliaceae. It is mainly distributed in Zhejiang, Jiangsu, and Hunan provinces of China. The bulb is used medicinally and has the effects of clearing heat and moistening the lungs, resolving phlegm and relieving cough, as well as anti-cancer, anti-inflammatory, and antibacterial properties. Fritillaria thunbergii is a traditional Chinese medicine containing abundant alkaloids, polysaccharides, amino acids, coumarins, proteins, and other chemical components.

[0003] The Chinese Pharmacopoeia provides methods for determining the content of major active ingredients, including morphological identification, microscopic identification, thin-layer chromatography, and high-performance liquid chromatography (HPLC). However, all of these methods have limitations in practical applications: morphological identification is highly subjective, microscopic identification requires specialized equipment, thin-layer chromatography relies on expensive standards, and HPLC requires precision instruments and professional operation. Furthermore, because fritillaria bulbs are morphologically similar, and once the raw material is ground into powder or processed into medicine, it is impossible to distinguish and identify them by the naked eye.

[0004] Currently, molecular identification of Fritillaria thunbergii mainly relies on DNA barcoding technology and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. While these DNA barcoding technologies improve the accuracy of identification, they still have many limitations. All of the above molecular identification methods require PCR amplification and sequencing comparison, a process that relies on expensive PCR and sequencing instruments, is complex, and has a long testing cycle. The PCR-RFLP method requires multiple steps, including PCR amplification, enzyme digestion, and gel electrophoresis, which is not only time-consuming but also demands high levels of experimental equipment and operational skills, making it difficult to promote and apply in grassroots testing and market supervision. Therefore, developing a detection technology for Fritillaria thunbergii that does not rely on complex instruments, is simple and rapid to operate, and can accurately identify Fritillaria thunbergii is of significant practical importance for ensuring the quality of Fritillaria thunbergii medicinal materials, maintaining market order, and ensuring medication safety. Summary of the Invention

[0005] The purpose of this invention is to provide a primer-probe combination for detecting Fritillaria thunbergii using Proofman-LMTIA technology and its application, thereby addressing the problems existing in the prior art. The primer-probe combination designed in this invention can be used for rapid detection of Fritillaria thunbergii using Proofman-LMTIA technology, achieving both high sensitivity and high specificity, and has broad application prospects.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a primer-probe combination for detecting Fritillaria thunbergii based on Proofman-LMTIA technology, including primers ZBM-F, ZBM-B, ZBM-LB and probe ZBM-Probe; The nucleotide sequences of primers ZBM-F, ZBM-B, and ZBM-LB are shown in SEQ ID NO. 1-3, respectively; the nucleotide sequence of probe ZBM-Probe is shown in SEQ ID NO. 4.

[0007] Furthermore, the 3' end of the probe ZBM-Probe is labeled with a fluorescent group.

[0008] Furthermore, the fluorescent group is a FAM group.

[0009] The present invention also provides the application of the above-described primer-probe combination in the preparation of products for the detection of components in Fritillaria thunbergii.

[0010] Furthermore, the product is a reagent kit.

[0011] The present invention also provides a product for the detection of components of Fritillaria thunbergii, comprising the above-mentioned primer-probe combination.

[0012] Furthermore, the product is a reagent kit.

[0013] Furthermore, the product also includes 5×Mix premix and DNA polymerase.

[0014] This invention also provides a method for detecting components in Fritillaria thunbergii, comprising the following steps: Genomic DNA was extracted from the sample to be tested; Using the genomic DNA as a template, PCR isothermal amplification was performed using the primer and probe combination described above; The following judgments are made based on the amplification results: If a fluorescence signal can be detected in the fluorescence channel and an exponential amplification curve appears in the amplification result image, it can be determined that the sample contains Fritillaria thunbergii; if no fluorescence signal is detected in the fluorescence channel and no exponential amplification curve appears in the amplification result image, it can be determined that the sample does not contain Fritillaria thunbergii.

[0015] Furthermore, the temperature for the PCR isothermal amplification is 69°C.

[0016] The present invention discloses the following technical effects: This invention develops a rapid detection method for Fritillaria thunbergii using the Proofman-LMTIA technique. The invention designs an LMTIA-specific primer-probe combination for detecting components of Fritillaria thunbergii, which exhibits good specificity and sensitivity, with an absolute sensitivity reaching 100 pg / μL. It also provides rapid detection, enabling the detection of Fritillaria thunbergii components in Fritillaria thunbergii samples under isothermal conditions.

[0017] This invention utilizes carefully designed LMTIA primers and Proofman probes, combined with Proofman-LMTIA technology, to achieve rapid amplification reactions under isothermal conditions. This method eliminates reliance on thermal cyclers, reduces the likelihood of false positives, and balances high sensitivity and specificity, making it promising for broad applications. The method employed in this invention can effectively monitor the quality of Fritillaria thunbergii during its production, processing, and distribution, and also significantly simplifies the detection process, reduces costs, and shortens detection time. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 Melting temperature curve of the target sequence for LMTIA detection in Fritillaria thunbergii; Figure 2 The figure shows the temperature optimization results of the Proofman-LMTIA detection method for Fritillaria thunbergii; where AD represents the amplification curves at 66℃, 67℃, 68℃, and 69℃, respectively. Figure 3 The image shows the specificity test results of the Proofman-LMTIA detection method for Fritillaria thunbergii; where ZBM represents Fritillaria thunbergii, XBM represents Fritillaria thunbergii from Xinjiang, YBM represents Fritillaria yiliensis, and PBM represents Fritillaria pingshen. Figure 4 The graph shows the sensitivity test results of the Proofman-LMTIA detection method for Fritillaria thunbergii. Figure 5 The image shows the detection results of the Proofman-LMTIA method on an actual sample of Fritillaria thunbergii. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] Example 1: Design of primers and probes for LMTIA detection of Fritillaria thunbergii The ITS gene sequence of Fritillaria thunbergii was obtained from the GenBank database of the National Center for Biotechnology Information (NCBI). Subsequently, Oligo 7 software was used to identify a trapezoidal region in the melting temperature (Tm) region of the Fritillaria thunbergii ITS gene (see...). Figure 1 Following the principles of LMTIA primer design, LMTIA primers and Proofman probes were designed, resulting in the following primer set with the specific sequences as follows: ZBM-F: 5'- CCGCCCGACACGTTTTAGAGACCGCGAACCCGTA -3' (SEQ ID NO. 1); ZBM-B: 5'- TGCCCGCCCTGCTTTTCCCCGCAAATCGTGTCCG -3' (SEQ ID NO. 2); ZBM-LB: 5'-GGACCTCGCGTCGTGTC-3' (SEQ ID NO. 3); ZBM-Probe: 5'-GGACCTCGCGTCGTA-FAM-3' (SEQ ID NO. 4).

[0026] Example 2 Temperature optimization of the Proofman-LMTIA reaction system of Fritillaria thunbergii Take 50 mg of Fritillaria thunbergii powder (dried bulb) and extract genomic DNA using a plant genomic DNA extraction kit (Tiangen Biotech Beijing Co., Ltd.). After extraction, the concentration and purity of the genomic DNA were determined using a Nanodrop One (Thermo Fisher Scientific, USA) analyzer. Genomic DNA with an A260 / A280 of 1.6-2.0 can be used for further detection. The extracted genomic DNA was stored at -20 ℃ for later use.

[0027] Proofman-LMTIA reaction system: 5 μL 2×Mix premix (40 mM Tris-HCl, 20 mM KCl, 20 mM (NH4)2SO4, 12 mM MgSO4, 0.2% Triton X-100, 2.4 mM dNTP), 0.5 μL DNA polymerase (2 U / μL, Anhui Global Gene Technology Co., Ltd.), 0.16 μL ZBM-F (100 μM), 0.16 μL ZBM-B (100 μM), 0.04 μL ZBM-LB (100 μM), 0.1 μL ZBM-Probe (10 μM), 2 μL DNA template, and DEPC-treated water to 10 μL.

[0028] DEPC-treated water was used as a negative control, and Fritillaria thunbergii genomic DNA was used as a positive control. Proofman-LMTIA reaction systems were prepared according to the above formulas, and the reaction temperature was optimized. Detection was performed using a Gentier 96E fully automated medical PCR analysis system. The reaction temperatures were set to 66℃, 67℃, 68℃, and 69℃, with 40 cycles. Fluorescence signals were collected every 45 seconds for a total of 40 collections. Each experiment was performed in duplicate. The results were statistically analyzed and observed using the Gentier 96E fully automated medical PCR analysis system software.

[0029] Result determination: If the blue fluorescence channel (FAM) can detect a fluorescence signal and an exponential amplification curve appears in the amplification result image, the sample can be determined to be a positive result, i.e., containing Fritillaria thunbergii components; if the blue fluorescence channel (FAM) cannot detect a fluorescence signal and there is no exponential amplification curve in the amplification result image, the sample can be determined to be a negative result, i.e., not containing Fritillaria thunbergii components.

[0030] The results are as follows Figure 2 As shown, at reaction temperatures of 66℃, 67℃, 68℃, and 69℃, no amplification was observed in the negative DEPC-treated water, while the genomic DNA of *Fritillaria thunbergii* showed significant amplification at all four temperatures. At a reaction temperature of 69℃, no amplification was observed in the DEPC-treated water, but the genomic DNA of *Fritillaria thunbergii* was amplified, demonstrating high stability. The amplification efficiency at 69℃ was higher than that at the other three reaction temperatures. However, while DEPC-treated water amplified at 66℃, 67℃, and 68℃, the amplification of *Fritillaria thunbergii* genomic DNA was very stable and efficient at 69℃. Therefore, 69℃ was selected as the optimal reaction temperature for the Proofman-LMTIA reaction of *Fritillaria thunbergii*.

[0031] Example 3: Specificity test of the Proofman-LMTIA reaction system of Fritillaria thunbergii The specificity of the Proofman-LMTIA reaction system was tested using DEPC-treated water and DNA containing 500 bp ITS from Fritillaria thunbergii, Fritillaria thunbergii, and Fritillaria yiliense as negative controls, and Fritillaria thunbergii ITS DNA as a positive control. The Proofman-LMTIA reaction system was prepared according to the formulation in Example 2. Proofman-LMTIA detection was performed at a reaction temperature of 69℃, with 40 cycles. Fluorescence signals were collected every 30 seconds for a total of 40 collections. Two parallel samples were used in the experiment.

[0032] Result determination: If a fluorescent signal can be detected in the blue fluorescence channel (FAM) and an exponential amplification curve appears in the amplification result image, the sample can be determined to be a positive result, i.e., containing Fritillaria thunbergii components; if no fluorescent signal is detected in the blue fluorescence channel (FAM) and no exponential amplification curve appears in the amplification result image, the sample can be determined to be a negative result, i.e., not containing Fritillaria thunbergii components.

[0033] Specificity test results as follows Figure 3 As shown, observations via the FAM fluorescence channel revealed no amplification in *Fritillaria thunbergii*, *Fritillaria cirrhosa*, *Fritillaria yiliense*, and the DEPC-treated water negative control, while the positive control, *Fritillaria thunbergii*, showed good amplification of genomic DNA. This indicates that the Proofman-LMTIA detection method established in this invention has high specificity for *Fritillaria thunbergii*.

[0034] Example 4: Sensitivity Test of the Proofman-LMTIA Detection Method for Fritillaria thunbergii The extracted genomic DNA from Fritillaria thunbergii was diluted to 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 100 fg / μL, respectively. DEPC-treated water was used as a negative control. The DNA was added to the Proofman-LMTIA reaction system (same as in Example 2) for Proofman-LMTIA detection. Two parallel samples were set for each reaction. The temperature was set at 69℃, and fluorescence signals were collected every 30 seconds for a total of 40 collections to determine the optimal reaction result. The criteria for judging the detection results were the same as in Example 2.

[0035] Sensitivity test results are as follows Figure 4 As shown, 1 ng / μL and 100 pg / μL of Fritillaria thunbergii genomic DNA were well amplified, while 10 pg / μL, 1 pg / μL, 100 fg / μL, and DEPC-treated water showed no amplification. Therefore, the sensitivity of this method is 100 pg / μL of Fritillaria thunbergii genomic DNA, meaning that in the Proofman-LMTIA reaction system established in Example 2 of this invention, Fritillaria thunbergii genomic DNA extracted from the sample at a concentration of 100 pg / μL can be detected, demonstrating high sensitivity.

[0036] Example 5: Detection of actual samples of Fritillaria thunbergii The samples of Fritillaria cirrhosa, Fritillaria thunbergii, Fritillaria sylvestris, Fritillaria yiliensis, and Fritillaria hubeiensis used for testing were provided by the Henan Provincial Institute for Drug and Medical Device Testing.

[0037] Genomic DNA was extracted from the samples to be tested and detected according to the method in Example 2. The reaction was performed using a Gentier 96E fully automated medical PCR analysis system at a temperature of 69°C. Fluorescence signals were collected every 30 seconds for a total of 40 collections, with three replicates for each reaction. The criteria for interpreting the test results were the same as in Example 2.

[0038] Test results as follows Figure 5 As shown, parallel samples (numbered 1-3) of the three Zhejiang Fritillaria samples all showed amplification curves, while samples of Sichuan Fritillaria, Ping Fritillaria, Yili Fritillaria, Hubei Fritillaria and the negative control DEPC-treated water did not produce amplification, indicating that this method can be used for rapid identification and detection of components of Zhejiang Fritillaria.

[0039] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer-probe combination for detecting Fritillaria thunbergii based on Proofman-LMTIA technology, characterized in that, This includes primers ZBM-F, ZBM-B, ZBM-LB, and probe ZBM-Probe; The nucleotide sequences of primers ZBM-F, ZBM-B, and ZBM-LB are shown in SEQ ID NO. 1-3, respectively; the nucleotide sequence of probe ZBM-Probe is shown in SEQ ID NO.

4.

2. The primer-probe combination according to claim 1, characterized in that, The 3' end of the probe ZBM-Probe is labeled with a fluorescent group.

3. The primer-probe combination according to claim 1, characterized in that, The fluorescent group is a FAM group.

4. The use of a primer-probe combination as described in any one of claims 1-3 in the preparation of a product for the detection of components in Fritillaria thunbergii.

5. The application according to claim 4, characterized in that, The product in question is a reagent kit.

6. A product for detecting components in Fritillaria thunbergii, characterized in that, Includes the primer-probe combination as described in any one of claims 1-3.

7. The product according to claim 6, characterized in that, The product in question is a reagent kit.

8. The product according to claim 6, characterized in that, The product also includes 5×Mix premix and DNA polymerase.

9. A method for detecting components in Fritillaria thunbergii, characterized in that, Includes the following steps: Genomic DNA was extracted from the sample to be tested; Using the genomic DNA as a template, PCR isothermal amplification was performed using the primer and probe combination described in any one of claims 1-3; The following judgments are made based on the amplification results: If a fluorescence signal can be detected in the fluorescence channel and an exponential amplification curve appears in the amplification result image, it can be determined that the sample contains Fritillaria thunbergii; if no fluorescence signal is detected in the fluorescence channel and no exponential amplification curve appears in the amplification result image, it can be determined that the sample does not contain Fritillaria thunbergii.

10. The method according to claim 9, characterized in that, The temperature for the isothermal amplification of the PCR was 69°C.

Images