Rhizosphere trichoderma fungi of atractylodes and applications thereof
By screening and isolating highly efficient Trichoderma fungi from the rhizosphere soil of Atractylodes lancea, the problem of isolation and identification in the prevention and control of root rot of Atractylodes lancea was solved, and highly efficient inhibition of Fusarium oxysporum and Fusarium solanum was achieved, thus improving the cultivation effect of Chinese medicinal materials.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INSTITUTE OF CHINESE MATERIA MEDICA CHINA ACADEMY OF CHINESE MEDICAL SCIENCES
- Filing Date
- 2026-04-23
- Publication Date
- 2026-07-24
AI Technical Summary
In the current technology, the methods for controlling root rot of Atractylodes lancea are not yet mature, resulting in low isolation efficiency, difficulty in strain purification, and insufficient identification accuracy, making it difficult to effectively control root rot caused by Fusarium oxysporum and Fusarium solanum.
Six Trichoderma strains, including Trichoderma harzianum, Trichoderma simonii, Trichoderma viride, and Trichoderma chrysotrichum, were screened and isolated from the rhizosphere soil of Atractylodes lancea. Through cultivation and preservation, strains with high antibacterial rates were obtained and applied to the prevention and control of root rot in Chinese medicinal herbs.
These fungi exhibit inhibition rates of over 70% against Fusarium oxysporum and Fusarium solanum, with volatile substances showing inhibition rates of 38% to 59%, providing an effective biological control method and improving the cultivation quality and yield of Chinese medicinal herbs.
Smart Images

Figure CN122445474A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to Trichoderma fungi in the rhizosphere of Atractylodes lancea and their applications. Background Technology
[0002] Atractylodes lancea ( Atractylodes lancea Atractylodes lancea is a perennial herb belonging to the genus Atractylodes of the Asteraceae family. Its rhizome is a commonly used traditional Chinese medicine, with high market demand, primarily cultivated artificially. However, due to multiple factors including seedling sourcing, planting methods, and continuous cropping, Atractylodes lancea is susceptible to severe diseases, particularly caused by Fusarium oxysporum f. sp. (Fo). Fusarium oxysporum ) and Fusarium solani Fs ( Fusarium solani Root rot caused by *Trichoderma* is one of the major soil-borne diseases in Atractylodes lancea cultivation, severely damaging the quality and yield of cultivated Atractylodes lancea products. Trichoderma Trichoderma (spp.) are a well-known class of beneficial microorganisms for plants, exhibiting strong inhibitory effects against Fusarium oxysporum and Fusarium solanum, and showing great potential for the prevention and control of root rot in Atractylodes lancea. Currently, systematic isolation and identification methods for Trichoderma fungi in the rhizosphere of Atractylodes lancea are still immature, leading to problems such as low isolation efficiency, difficulty in strain purification, and insufficient identification accuracy. Based on this, this invention is proposed. Summary of the Invention
[0003] The purpose of this invention is to provide fungi of the Trichoderma genus in the rhizosphere of Atractylodes lancea and their applications.
[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides fungi of the genus *Trichoderma* in the rhizosphere of *Atractylodes lancea*, including *Trichoderma harzianum* (… Trichoderma harzianum TL2107RH10, Trichoderma harzianum ( Trichoderma harzianum TMP2107AR09, Trichoderma harzianum ( Trichoderma harzianum TMP2107RH19, Trichoderma simonii ( Trichoderma koningiopsis TZ2107RHs2, Trichoderma viride ( Trichoderma virens TZ2107R10 and Trichoderma fulvidraco ( Trichoderma aureoviride One or more of TCY2204R2; Trichoderma harzianum ( Trichoderma harzianum TL2107RH10 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is July 5, 2023, and the accession number is CGMCC No. 40721. Trichoderma harzianum ( Trichoderma harzianumTMP2107AR09 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 17, 2022, and the accession number is CGMCC No. 40333. Trichoderma harzianum ( Trichoderma harzianum TMP2107RH19 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 17, 2022, and the accession number is CGMCC No. 40334. Trichoderma simonii ( Trichoderma koningiopsis TZ2107RHs2 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 17, 2022, and the accession number is CGMCC No. 40332. Trichoderma viride ( Trichoderma virens TZ2107R10 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is July 5, 2023, and the accession number is CGMCC No. 40723. Trichoderma fulvidraco ( Trichoderma aureoviride TCY2204R2 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. The deposit date is July 5, 2023, and the accession number is CGMCC No. 40724.
[0005] This invention also provides the application of the aforementioned Trichoderma genus fungi in the rhizosphere of Atractylodes lancea in the prevention and control of root rot in traditional Chinese medicinal materials.
[0006] Preferably, the root rot is caused by Fusarium oxysporum (Fusarium oxysporum). Fusarium oxysporum ) and / or Fusarium solani ( Fusarium solani Caused by ).
[0007] This invention also provides the application of the aforementioned Trichoderma genus fungi in the rhizosphere of Atractylodes lancea in the preparation of products for preventing and treating root rot in traditional Chinese medicinal materials.
[0008] Preferably, the root rot is caused by Fusarium oxysporum (Fusarium oxysporum). Fusarium oxysporum ) and / or Fusarium solani ( Fusarium solani Caused by ).
[0009] This invention also provides a medicament for preventing and treating root rot in Chinese medicinal herbs, comprising Trichoderma fungi in the rhizosphere of Atractylodes lancea and excipients; The Trichoderma genus fungi in the rhizosphere of Atractylodes are the aforementioned Trichoderma genus fungi in the rhizosphere of Atractylodes.
[0010] The present invention also provides a method for preventing and controlling root rot in Chinese medicinal herbs, comprising the following steps: applying Trichoderma fungi or agents to the rhizosphere of Atractylodes lancea in the planting area of Chinese medicinal herbs; The Trichoderma genus fungi in the rhizosphere of Atractylodes are the aforementioned Trichoderma genus fungi in the rhizosphere of Atractylodes; The medicine is the medicine described above.
[0011] The present invention has the following advantages: This invention isolated and screened six Trichoderma strains from the rhizosphere of Atractylodes lancea: Trichoderma harzianum (TL2107RH10, TMP2107AR09, TMP2107RH19), Trichoderma konjac (TZ2107RHs2), Trichoderma viride (TZ2107R10), and Trichoderma chlorophyllin (TCY2204R2). After cultivation on PDA medium, the colony diameter reached 7-8 cm, and the sporulation yield reached 10. 7 ~10 8 cfu / mL. All samples were preserved.
[0012] The fungus Trichoderma harzianum in the rhizosphere of Atractylodes lancea of this invention ( Trichoderma harzianum TL2107RH10, Trichoderma harzianum ( Trichoderma harzianum TMP2107AR09, Trichoderma harzianum ( Trichoderma harzianum TMP2107RH19, Trichoderma simonii ( Trichoderma koningiopsis TZ2107RHs2, Trichoderma viride ( Trichoderma virens TZ2107R10 and Trichoderma fulvidraco ( Trichoderma aureoviride TCY2204R2 against Fusarium oxysporum ( Fusarium oxysporum The inhibition rate of Fo was over 70%, and it was effective against Fusarium solani (the causal agent of solanaceous diseases). Fusarium solani The antibacterial rate of Fs is over 75%.
[0013] Preservation Instructions
[0014] Trichoderma harzianum ( Trichoderma harzianum TL2107RH10 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is July 5, 2023, and the accession number is CGMCC No. 40721. Trichoderma harzianum ( Trichoderma harzianum TMP2107AR09 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 17, 2022, and the accession number is CGMCC No. 40333. Trichoderma harzianum ( Trichoderma harzianumTMP2107RH19 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on October 17, 2022, with accession number CGMCC No. 40334. Trichoderma simonii ( Trichoderma koningiopsis TZ2107RHs2 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 17, 2022, and the accession number is CGMCC No. 40332. Trichoderma viride ( Trichoderma virens TZ2107R10 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is July 5, 2023, and the accession number is CGMCC No. 40723. Trichoderma fulvidraco ( Trichoderma aureoviride TCY2204R2 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. The deposit date is July 5, 2023, and the accession number is CGMCC No. 40724. Attached Figure Description
[0015] Figure 1 A method for isolating Trichoderma fungi from the rhizosphere of Atractylodes lancea; Figure 2 Morphological characteristics of Trichoderma fungi in the rhizosphere of Atractylodes lancea; Figure 3 Microstructure of Trichoderma fungi in the rhizosphere of Atractylodes lancea (1 represents hyphae, 2 represents conidiophores, 3 represents conidia, and 4 represents pedicels). Figure 4 Phylogenetic results for 6 rhizosphere Trichoderma fungi in Atractylodes lancea; Figure 5 The process of the confrontation experiment; Figure 6 The results of a confrontation experiment between six rhizosphere Trichoderma fungi and Fusarium oxysporum. Figure 7 The results of a confrontation experiment between six rhizosphere Trichoderma fungi of Atractylodes lancea and Fusarium solanum causal agent; Figure 8 The inhibition rate of six Trichoderma rhizosphere fungi in Atractylodes lancea against Fusarium oxysporum was determined. Figure 9 The inhibition rate of six Trichoderma rhizosphere fungi in Atractylodes lancea against Fusarium solani was determined. Figure 10The inhibition rates of volatiles from six Atractylodes rhizosphere Trichoderma species against Fusarium oxysporum and Fusarium solanum are shown in Figure A (inhibition morphology diagram; inhibition rate result diagram). Detailed Implementation
[0016] The following detailed description of the solutions provided by the present invention, in conjunction with the embodiments, should not be construed as limiting the scope of protection of the present invention.
[0017] The potato glucose agar medium (PDA) described in this embodiment of the invention uses water as a solvent and includes the following components at the following concentrations: potato extract powder 4.0 g / L, glucose 20.0 g / L, and agar powder 15.0 g / L; pH is 5.8±0.2.
[0018] The Bengal Red Agar (RBA) culture medium described in this embodiment of the invention uses water as a solvent and comprises the following components at the following concentrations: peptone 5.0 g / L, potassium dihydrogen phosphate 1.0 g / L, magnesium sulfate 0.5 g / L, glucose 10.0 g / L, Bengal Red 0.003 g / L, chloramphenicol 0.1 g / L, agar powder 20.0 g / L, and pH 5.8 ± 0.2.
[0019] Example 1
[0020] Screening of Trichoderma fungi in the rhizosphere of Atractylodes lancea
[0021] (1) Sample source
[0022] Rhizomes of wild Atractylodes lancea from Liaoyang City, Liaoning Province; fibrous roots of cultivated Atractylodes lancea from Zhalatun City, Hulunbuir City, Inner Mongolia Autonomous Region; rhizomes of cultivated Atractylodes lancea from Zhalatun City, Hulunbuir City, Inner Mongolia Autonomous Region; fibrous roots of wild Atractylodes lancea from Zhenjiang City, Jiangsu Province; and fibrous roots of wild Atractylodes lancea from Chengde City, Hebei Province, along with rhizosphere soil, were collected to obtain samples to be separated.
[0023] (2) Separation and purification
[0024] Take 1g of the sample to be separated and place it in an Erlenmeyer flask containing 100mL of sterile water. Shake at 200rpm and 25℃ for 2h to allow the rhizosphere microorganisms of Atractylodes lancea to be fully released.
[0025] Dilute the shaken suspension 10 times with sterile water, take 200 μL and spread it on a Bengal Red Agar (RBA) plate. Incubate in the dark at 28°C and observe the mycelial growth daily.
[0026] Once suspected Trichoderma mycelia appear (48h), immediately pick a single colony and transfer it to a potato dextrose agar (PDA) plate for purification. Continuously subculture on PDA plates until a pure strain is obtained. Inoculate the pure strain into PDA slant agar or glycerol tubes and store at -80℃ for later use.
[0027] Specific separation methods are as follows: Figure 1 As shown.
[0028] (3) Genus identification
[0029] Morphological identification: Observe the colony morphology of the pure strain, and observe the structure of hyphae, conidiophores and conidia under a microscope.
[0030] Molecular biological identification: Genomic DNA was extracted from the purified strain and amplified by PCR using ITS1 primers. The amplified products were sequenced, and the obtained sequences were compared with BLAST in the NCBI database to construct a phylogenetic tree and determine the species classification. The ITS1 primer pairs are shown in SEQ ID NO.1~2, where SEQ ID NO.1 is the upstream primer: CTTGGTCATTTAGAGGAAGTAA, and SEQ ID NO.2 is the downstream primer: GCTGCGTTCTTCATCC.
[0031] Six strains of *Trichoderma* fungi from the rhizosphere of *Atractylodes lancea* were isolated and screened. The colony morphology of the six strains is as follows: Figure 2 As shown, the microscopic results are as follows Figure 3 As shown.
[0032] Six strains of Trichoderma were cultured in PDA medium at 28°C in the dark for 5 days. The colony diameter reached 7-8 cm, and the spore production reached 10. 7 ~10 8 cfu / mL.
[0033] The phylogenetic tree constructed after sequencing and alignment of the amplified products is as follows: Figure 4 As shown.
[0034] Six fungi, including three Trichoderma harzianum strains, were identified through morphological and molecular biological analysis and named Trichoderma harzianum. Trichoderma harzianum TL2107RH10 (Th2), Trichoderma harzianum ( Trichoderma harzianum TMP2107AR09(Th3), Trichoderma harzianum ( Trichoderma harzianum TMP2107RH19(Th4); One strain of *Trichoderma syn.* was named *Trichoderma syn.* Trichoderma koningiopsis TZ2107RHs2(Th5); One strain of *Trichoderma viride* was named *Trichoderma viride*. Trichoderma virens TZ2107R10(Tv); One strain of *Trichoderma fulvidraco* was named *Trichoderma fulvidraco*. Trichoderma aureoviride )TCY2204R2(Tci).
[0035] Trichoderma harzianum ( Trichoderma harzianumThe amplification product of TL2107RH10 is as shown in SEQ ID NO.3, SEQ ID NO.3: CGAGCTAcACTCCCAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTTGTATACCCCCTCGCGGGTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTGCCTCTGGCGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATACAAA。
[0036] Trichoderma harzianum ( Trichoderma harzianumThe amplification product of TMP2107AR09 is as shown in SEQ ID NO.4, SEQ ID NO.4: TCACTCCAGACCCATGTGACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTGCCTTGGCGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCATAAGGCCGGGAG。
[0037] Trichoderma harzianum ( Trichoderma harzianumThe amplification product of TMP2107RH19 is as shown in SEQ ID NO.5, SEQ ID NO.5: ACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTTGTATACCCCCTCGCGGGTTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTGCCTCTTGGCGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAACGGGGGAAGAAAACC。
[0038] Trichoderma pseudokoningii Trichoderma koningiopsisThe amplification product of TZ2107RHs2 is as shown in SEQ ID NO.6, SEQ ID NO.6: CTCCAACCCATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGGGGGGAAG。
[0039] Trichoderma viride ( Trichoderma virensThe amplification product of TZ2107R10 is as shown in SEQ ID NO.7, SEQ ID NO.7: CCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTACTATCTGAGCCATCTCGGCGCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATACAAA。
[0040] Trichoderma aureoviride ( Trichoderma aureovirideThe amplification product of TCY2204R2 is shown in SEQ ID NO.8, SEQ ID NO.8:
[0041] The sources of different Trichoderma fungi are shown in Table 1.
[0042] Table 1. Sources of Trichoderma fungi
[0043] Example 2
[0044] Confrontation experiment between Trichoderma fungi and pathogens in the rhizosphere of Atractylodes lancea.
[0045] Take the above-mentioned 6 Trichoderma strains and respectively according to Figure 5 The aforementioned experimental procedure involves a confrontation experiment. The pathogen used in the confrontation experiment is *Fusarium oxysporum* (…). Fusarium oxysporum Fo and Fusarium solani ( Fusarium solani )Fs.
[0046] Antibacterial rate = (D1-D2) / D1×100%.
[0047] The colony morphology and microscopic observation results of six Trichoderma strains confronting Fusarium oxysporum are as follows:Figure 6 As shown in the figure. The colony morphology and microscopic observation results of the confrontation between six Trichoderma strains and Fusarium solani Fs are as follows. Figure 7 As shown.
[0048] The inhibition rates of 6 Trichoderma strains against Fusarium oxysporum Fo. are as follows: [[ID= As shown; the inhibition rates of 6 Trichoderma strains against Fusarium solani Fs are as follows: As shown.
[0049] Figures 8 - 9 As shown, the inhibition rates of the six Trichoderma strains against Fusarium oxysporum Fo were all above 70%, and the inhibition rates against Fusarium solani Fs were above 75%.
[0050] Example 3
[0051] The inhibitory rate of volatiles from *Trichoderma* fungi in the rhizosphere of *Atractylodes lancea* against pathogens.
[0052] The inhibitory effects of volatile metabolites of TL2107RH10, TMP2107AR09, TMP2107RH19, TZ2107R10, TZ2107RHs2 and TCY2204R2 on the growth of Fo and Fs were evaluated using the cross-culture method. Mycelial pellets of TL2107RH10, TMP2107AR09, TMP2107RH19, TZ2107R10, TZ2107RHs2, and TCY2204R2 were cultured on PDA plates for 7 days. Fo or Fs mycelial pellets were then placed in the center of new PDA plates. The TL2107RH10, TMP2107AR09, TMP2107RH19, TZ2107R10, TZ2107RHs2, and TCY2204R2 plates were sealed together with the freshly inoculated Fo or Fs plates. A separate freshly inoculated Fo or Fs plate was sealed together with a blank PDA plate as a blank control. After 3 days of culture, the colony diameter was measured using the cross-sectional method. The inhibition rate was calculated. The inhibition rate is shown in the figure. Figure 10 As shown.
[0053] Figure 10 It can be seen that the six selected Trichoderma strains have antibacterial effects against the two Fusarium species, and the effects are quite good, which helps to prevent diseases in medicinal materials in a green way.
[0054] As can be seen from the above embodiments, this invention screened out 6 Trichoderma strains from the rhizosphere soil of Atractylodes lancea, namely Trichoderma harzianum ( Trichoderma harzianum TL2107RH10, Trichoderma harzianum ( Trichoderma harzianum TMP2107AR09, Trichoderma harzianum ( Trichoderma harzianum TMP2107RH19; Trichoderma syn. Trichoderma koningiopsis TZ2107RHs2; Trichoderma viride ( Trichoderma virensTZ2107R10; Trichoderma fulvidraco ( Trichoderma aureoviride TCY2204R2. The six Trichoderma strains of this invention are effective against Fusarium oxysporum (…). Fusarium oxysporum ) and Fusarium solani ( Fusarium solani The antibacterial rates of both were above 70% and 75%, and their volatile substances showed antibacterial activity against Fusarium oxysporum (Fusarium oxysporum). Fusarium oxysporum ) and Fusarium solani ( Fusarium solani The antibacterial rate was over 38% and 59%. This provides a basis for the prevention and control of root rot in Chinese medicinal herbs and is of great significance for the green cultivation and biological control of diseases in Chinese medicinal herbs.
[0055] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A fungus of the genus *Trichoderma* in the rhizosphere of *Atractylodes lancea*, characterized by: Including Trichoderma harzianum ( Trichoderma harzianum TL2107RH10, Trichoderma harzianum ( Trichoderma harzianum TMP2107AR09, Trichoderma harzianum ( Trichoderma harzianum TMP2107RH19, Trichoderma simonii ( Trichoderma koningiopsis TZ2107RHs2, Trichoderma viride ( Trichoderma virens TZ2107R10 and Trichoderma fulvidraco ( Trichoderma aureoviride One or more of TCY2204R2; Trichoderma harzianum ( Trichoderma harzianum TL2107RH10 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is July 5, 2023, and the accession number is CGMCC No. 40721. Trichoderma harzianum ( Trichoderma harzianum TMP2107AR09 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 17, 2022, and the accession number is CGMCC No. 40333. Trichoderma harzianum ( Trichoderma harzianum TMP2107RH19 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 17, 2022, and the accession number is CGMCC No. 40334. Trichoderma simonii ( Trichoderma koningiopsis TZ2107RHs2 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 17, 2022, and the accession number is CGMCC No. 40332. Trichoderma viride ( Trichoderma virens TZ2107R10 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is July 5, 2023, and the accession number is CGMCC No. 40723. Trichoderma fulvidraco ( Trichoderma aureoviride TCY2204R2 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. The deposit date is July 5, 2023, and the accession number is CGMCC No. 40724.
2. The application of the Trichoderma genus fungi in the rhizosphere of Atractylodes lancea as described in claim 1 in the prevention and control of root rot in traditional Chinese medicinal materials.
3. The application according to claim 2, characterized in that, The root rot is caused by Fusarium oxysporum (… Fusarium oxysporum ) and / or Fusarium solani ( Fusarium solani Caused by ).
4. The application of the *Trichoderma* fungus in the rhizosphere of *Atractylodes lancea* as described in claim 1 in the preparation of products for preventing and treating root rot in traditional Chinese medicinal materials.
5. The application according to claim 4, characterized in that, The root rot is caused by Fusarium oxysporum (… Fusarium oxysporum ) and / or Fusarium solani ( Fusarium solani Caused by ).
6. A medicament for preventing and treating root rot in Chinese medicinal herbs, characterized in that, Including Trichoderma fungi in the rhizosphere of Atractylodes lancea and excipients; The Trichoderma genus fungus in the rhizosphere of Atractylodes is the Trichoderma genus fungus described in claim 1.
7. A method for preventing and controlling root rot in Chinese medicinal herbs, characterized in that, The steps include: applying Trichoderma fungi or pesticides to the rhizosphere of Atractylodes lancea in the planting area of Chinese medicinal herbs; The Trichoderma genus fungus in the rhizosphere of Atractylodes is the Trichoderma genus fungus in the rhizosphere of Atractylodes as described in claim 1; The pharmaceutical agent is the pharmaceutical agent according to claim 6.