A fungus of the order of the moniliellales and its use

Abstract

The present application belongs to the technical field of pest control, and particularly relates to a kind of fungi of the order of Mucorales in the class of Sordariomycetes and its application. The fungi is preserved in China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 42531. The fungi can be used for screening hazelnut disease-resistant lines or controlling hazelnut black spot disease. The present application proves by tests that eight kinds of pesticides, including penthiopyrad, mancozeb, difenconazole, pyraclostrobin, thiram, tridemorph, kresoxim-methyl and thiophanate-methyl, all have inhibitory effects on the fungi, which provides a new direction for controlling hazelnut black spot disease.

Description

Technical Field

[0001] This invention belongs to the field of pest and disease control technology, specifically relating to a species of fungus belonging to the genus *Bacillus* of the order *Bacillus* (*Bacillus*). Cladosporium sp.) fungi and their applications. Background Technology

[0002] Hazelnuts are an important economic forest nut tree species in northern my country. Hazelnuts contain a variety of bioactive substances and have outstanding nutritional properties, making them valuable for development in the food and pharmaceutical fields. The dry weight of hazelnuts contains 50% to 60% fat and approximately 20% protein. The oil in hazelnuts is mainly composed of unsaturated fatty acids, accounting for up to 80%, which is very beneficial for maintaining cardiovascular health.

[0003] Hazelnut trees are susceptible to various biological stresses during their growth period. Major diseases include powdery mildew and sooty mold, while pests include hazelnut weevils, barn beetles, and scale insects. Hazelnut powdery mildew, a highly damaging foliar disease, is characterized by a short incubation period, rapid onset, rapid spread, and strong pathogenicity. The pathogens of powdery mildew not only damage hazelnut leaves but can also harm branches and fruit buds. Disease monitoring data shows that the frequency and severity of hazelnut diseases in Northeast China are on the rise, and the types of pathogens are becoming increasingly complex. Hazelnut leaf spot is caused by fungi of the genus *Phyllostachys*. Hazelnut leaf spot primarily damages the plant's photosynthetic organs, exhibiting a clear disease expansion pattern. In the early stages of infection, brown necrotic spots appear on the leaf surface. If not controlled in time, infected hazelnuts develop characteristic black necrotic spots, inhibiting normal growth and development, ultimately leading to premature fruit senescence and drop. Twig blight is a significant vascular disease of woody plants, disrupting plant community stability and causing severe economic and ecological losses. Twig blight is one of the most common diseases affecting hazelnut trees; when infected, branches gradually wither, the xylem turns brown, and ulcerative lesions appear. Hazelnut rust initially manifests as yellowish-brown dotted lesions on the leaf surface, which expand into typical dark brown rust-like symptoms as the disease progresses.

[0004] In recent years, with changes in the hazelnut growing environment, new diseases have emerged in hazelnut orchards, causing losses to the value of hazelnuts. Researchers have discovered a new disease in hazelnut plantations—hazelnut male inflorescence black spot. Hazelnut male inflorescence black spot is mainly caused by a fungus. After infecting the male inflorescence, black spots form on the inflorescence. These spots enlarge as the disease progresses, causing the inflorescence to wither and affecting normal pollination and fruit set of hazelnuts.

[0005] However, since hazelnut male inflorescence black spot disease is a newly discovered disease and its pathogen is not yet clearly identified, research on its control methods is currently insufficient. This results in a lack of effective control measures in actual production, causing significant harm to the growth and development of hazelnuts.

[0006] Therefore, isolating and identifying the pathogen of this disease, and then using it to screen for disease-resistant strains and effective control agents, has become an urgent technical problem to be solved. Summary of the Invention

[0007] Based on the above technical problems, the present invention provides a deuteromycete belonging to the genus *Bacillus* of the order *Bacillus* (…). Cladosporium (sp.) fungus, which can be used to screen for agents to control hazelnut black spot disease and develop disease-resistant hazelnut strains, providing a sound scientific basis for efficient hazelnut cultivation and disease control.

[0008] The specific technical solution provided by this invention is as follows: In a first aspect, this invention provides a deuteromycete belonging to the genus *Bacillus* of the order *Bacillus*. Cladosporium The fungus (sp.) is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 42531.

[0009] In a second aspect, the present invention provides a method for culturing fungi of the genus *Bacillus* in the order *Bacillus* of the class *Deuteromycetes*, which involves culturing using a fungal culture medium.

[0010] In a preferred embodiment of the present invention, the fungal culture medium is PDA culture medium.

[0011] In a preferred embodiment of the present invention, the culture is carried out at a constant temperature of 26~28℃ for 5~7 days.

[0012] In a third aspect, the present invention provides the application of the aforementioned fungi, belonging to the genus *Bacillus* of the order *Bacillus* in the screening of disease-resistant hazelnut strains.

[0013] The screening process can be carried out according to conventional methods in the field, such as inoculating different hazelnut strains with fungi of the genus *Bacillus* in the order *Bacillus* of the order *Bacillus*, cultivating them, and screening for disease-resistant strains based on the occurrence of hazelnut diseases.

[0014] In a fourth aspect, the present invention provides the application of the aforementioned fungi of the genus *Bacillus* in the order *Bacillus* of the order *Bacillus* in screening agents for the prevention and control of hazelnut black spot disease.

[0015] As a preferred embodiment of the present invention, the selected agent for controlling hazelnut black spot disease is one or a combination of several of the following: pyraclostrobin, mancozeb, difenoconazole, pyraclostrobin, thiram, triadimefon, azoxystrobin, and thiophanate-methyl.

[0016] More preferably, the agent is one or a combination of several of the following: 20% pyraclostrobin suspension concentrate, 80% mancozeb wettable powder, 10% difenoconazole water-dispersible granules, 25% pyraclostrobin suspension concentrate, 80% thiram water-dispersible granules, 15% triadimefon wettable powder, 25% azoxystrobin suspension concentrate, and 70% thiophanate-methyl wettable powder.

[0017] More preferably, the effective inhibitory concentrations (ICPs) of 20% pyraclostrobin suspension concentrate and 80% mancozeb wettable powder are both 30-50 mg / L, the effective ICP of 10% difenoconazole water-dispersible granules is 20-30 mg / L, the effective ICPs of 25% pyraclostrobin suspension concentrate and 25% azoxystrobin suspension concentrate are both 5-15 mg / L, the effective ICP of 80% thiram water-dispersible granules is 25-40 mg / L, the effective ICP of 15% triadimefon wettable powder is 10-30 mg / L, and the effective ICP of 70% thiophanate-methyl wettable powder is 15-25 mg / L.

[0018] The present invention also provides a method for screening agents for controlling hazelnut black spot disease using the aforementioned fungi of the order Cladosporales of the class Deuteromycetes, comprising the following steps: contacting the agent to be tested with the aforementioned fungi of the order Cladosporales of the class Deuteromycetes on a culture medium, measuring the growth inhibition rate of the fungi of the order Cladosporales of the class Deuteromycetes after culture, and screening effective agents according to the level of inhibition rate.

[0019] In a preferred embodiment of the present invention, the culture is carried out in PDA medium at a constant temperature of 26-28°C for 5-7 days.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention isolates a pathogen causing a new hazelnut disease—a fungus belonging to the genus *Bacillus* of the order *Bacillus* in the class Deuteromycetes. CladosporiumUsing isolated and preserved pathogens of male inflorescence black spot disease as targets, the indoor antibacterial effects of eight tested agents (pyraclostrobin, thiophanate-methyl, triadimefon, azoxystrobin, mancozeb, thiram, pyraclostrobin, and difenoconazole) were determined. The results showed that the eight agents exhibited different antibacterial effects against the pathogen. Pyraclostrobin, difenoconazole, and azoxystrobin all showed good indoor antibacterial effects, with inhibition rates exceeding 80% at all concentrations. Specifically, difenoconazole achieved an inhibition rate of 82.35% at the lowest concentration and 90.00% at the highest concentration; pyraclostrobin achieved an inhibition rate of 83.13% at the lowest concentration and 91.57% at the highest concentration; and azoxystrobin achieved an inhibition rate of 83.53% at the lowest concentration and up to 92.55% at the highest concentration. Based on this, the present invention screened out fungicide varieties with good control effects and suitable application concentrations, providing a sound scientific theoretical basis for the efficient planting and disease control of hazelnut trees, and has important guiding significance for the development of the hazelnut industry. Pyraclostrobin and azoxystrobin both belong to the methoxyacrylate class of fungicides. Pyraclostrobin has an extremely broad fungicidal spectrum, capable of controlling both lower and higher fungal diseases. It can control a variety of pathogenic fungi such as oomycetes, ascomycetes, basidiomycetes, and deuteromycetes, and has excellent control effects against common crop fungal diseases such as downy mildew, blight, powdery mildew, rust, rice blast, sheath blight, anthracnose, leaf spot, and Fusarium head blight. It is suitable for various grains, fruits, vegetables, fruit trees, and cash crops. Azoxystrobin has a broad and balanced fungicidal spectrum, effective against most higher fungal diseases caused by ascomycetes, basidiomycetes, and deuteromycetes. It is particularly effective against powdery mildew, rust, anthracnose, early blight, leaf spot, and vine blight. It is suitable for vegetables, fruit trees, flowers, and field crops. Its efficacy against some lower fungal diseases is weaker. It is commonly used for the mainstream control of powdery mildew and foliar fungal diseases in crops. Difenoconazole is a triazole sterol inhibitor fungicide specifically targeting higher fungal diseases, primarily controlling diseases caused by ascomycetes, basidiomycetes, and deuteromycetes. It is highly effective against powdery mildew, rust, black spot, anthracnose, leaf spot, sheath blight, smut, and vine blight. It is widely used in grain and oil crops, melons, vegetables, and fruit trees. It is ineffective against downy mildew and blight caused by oomycetes.

[0021] Information on the preservation of biological materials: Deuteromycetes, Species of the order Bryophyllodes, genus Bacillus ( Cladosporium sp.) fungi, Latin name is Cladosporium The fungus sp., classified as a Deuteromycete belonging to the order Bryophyllodes and genus Bacillus, was deposited on March 19, 2026, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42531. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0022] Figure 1This is a pathogenicity experiment of the pathogen causing black spot disease in hazelnut male inflorescences; a) the condition of male inflorescences 2 days after inoculation, b) the condition of male inflorescences 5 days after inoculation, c) the condition of male inflorescences without inoculation, and d) the disease incidence in male inflorescences in the field.

[0023] Figure 2 These are the morphological characteristics of the hazelnut male inflorescence black spot fungus: a) Front view of the colony on a PDA, b) Back view of the colony on a PDA, c) Conidia, d) Mycelium.

[0024] Figure 3 This is a sequence comparison of the pathogenic strain of hazelnut male inflorescence black spot disease.

[0025] Figure 4 The results show the antibacterial effects of different concentrations of pyrimethanil on pathogens.

[0026] Figure 5 This describes the antibacterial effects of different concentrations of mancozeb on pathogens.

[0027] Figure 6 This describes the antibacterial effects of different concentrations of difenoconazole on pathogenic bacteria.

[0028] Figure 7 The results show the antibacterial effects of different concentrations of pyraclostrobin on pathogens.

[0029] Figure 8 The results show the antibacterial effects of different concentrations of thiram against pathogenic bacteria.

[0030] Figure 9 The results show the antibacterial effects of different concentrations of methyl thiophanate on pathogens.

[0031] Figure 10 The results show the antibacterial effects of different concentrations of triadimefon on pathogens.

[0032] Figure 11 The results show the antibacterial effects of different concentrations of azoxystrobin on pathogens. Detailed Implementation

[0033] The present application will be further described below with reference to the embodiments, but the embodiments do not constitute a limitation on the present invention.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0035] Unless otherwise specified, all materials and reagents used in the following examples were obtained commercially.

[0036] Example 1 Isolation and identification of hazelnut black spot pathogen 1. Field disease occurrence survey and disease collection Diseased male inflorescences with typical symptoms were collected from the large-fruited hazelnut demonstration garden of Liaodong University in Dandong City, Liaoning Province, and stored at 4℃ for later use as disease samples.

[0037] 2. Isolation and purification of pathogens Select male inflorescence samples with typical symptoms of black spot disease, disinfect the surface with 75% ethanol, rinse thoroughly with sterile water, and blot dry with sterile filter paper. Use an inoculation loop to scrape an appropriate amount of pathogen from the sample and inoculate it onto a PDA agar plate, incubating at 26°C for 7 days. After colonies have grown, use sterile tools to pick hyphae from the colony edges for strain purification. This purification process needs to be repeated 2 to 3 times until a pure culture strain is obtained.

[0038] 3. Pathogenicity detection of pathogens Normal hazelnut male inflorescences were surface-sterilized with 75% ethanol, rinsed with sterile water, dried, and placed in moistened petri dishes (the petri dishes should be lined with filter paper and have two toothpicks placed inside for support and isolation). Floating bacterial powder from the cultured pathogen agar plates was brushed onto the healthy hazelnut male inflorescences, mixed with an appropriate amount of sterile water, and sprayed onto them. A total of 7 groups of experimental pathogens were used, with 2 groups of sterile culture media serving as control (CK). All were incubated at 26℃ in a constant temperature environment. Disease progression was recorded promptly upon the appearance of symptoms.

[0039] 4. Identification of pathogens 4.1 Morphological identification The purified black spot virus was inoculated onto PDA plates and placed in a 26°C incubator for 7 days. During the incubation period, colony morphology, color, and other characteristics were observed and recorded, as well as the morphology of the pathogen colonies and the color of the front and back of the colonies. Hyphae, sporulation, and spore morphology were observed under a regular optical microscope.

[0040] 4.2 Molecular biological identification The isolated strain was inoculated onto PDA plates and incubated at 28 °C for 7 days. Mycelia were then collected, and genomic DNA was extracted using a fungal DNA extraction kit for PCR amplification. The selected PCR primer sequences were: ITS1: 5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO.1; ITS4-R: 5'-TCCTCCGCTTATTGATATGC-3', SEQ ID NO.2.

[0041] PCR amplification was performed using the Taq Plus DNA polymerase kit (product number B600090) from Sangon Biotech Co., Ltd., prepared according to the systems shown in Tables 1-2, for the amplification of fungal-specific gene fragments to meet subsequent sequencing requirements.

[0042] The PCR reaction system consisted of 12.5 μL of PCR premix (excluding primers and template) and 25 μL of complete PCR reaction system. The specific components, concentrations, and volumes are shown in Tables 1 and 2. Table 1. 12.5 μL PCR premix system Table 2. Complete PCR reaction system (25 μL) (for fungal amplification and sequencing) The PCR program settings are shown in Table 3: Table 3 PCR Procedure Place the prepared 25 μL complete PCR reaction system into a PCR instrument and amplify according to the preset amplification program (the amplification program can be adjusted according to the actual optimization situation); after the amplification is completed, perform agarose gel electrophoresis to detect the PCR product, verify the amplification effect, and ensure that the target fragment is obtained.

[0043] The validated PCR products were sent to a professional sequencing institution for sequencing. The primers used for sequencing were the same as those used for PCR amplification. After sequencing, the obtained gene sequences were spliced, proofread, and redundant sequences were removed to obtain the target gene sequence of the fungal strain.

[0044] The obtained fungal target gene sequence was submitted to the NCBI (National Center for Biotechnology Information) database. The BLAST tool was used to perform sequence homology comparison to determine the species classification information of the isolated fungal strain and complete the molecular biological identification.

[0045] 5. Results and Analysis 5.1 Pathogenicity testing Inoculating healthy hazelnut male inflorescences with the pathogen showed that ( Figure 1 The pathogenicity of strains inoculated on healthy hazelnut male inflorescences was similar, with no significant difference. On the fifth day after inoculation, typical lesion symptoms were observed, covering more than 70% of the plant surface; these symptoms were completely consistent with those occurring naturally in the field. Control leaves, however, showed no abnormal symptoms. Strains isolated again from the diseased sites exhibited colony and spore morphology consistent with the initial tested strains.

[0046] 5.2 Pathogen Identification 5.2.1 Morphological identification The tested pathogen was cultured on PDA medium for 7 days. The hyphae penetrated the substrate, producing an olive-green mold layer that was flat and occasionally had dotted protrusions. Figure 2(a). The color of the colony rings on the back changes from white, grayish-green, to yellow from the inside out. Figure 2 (b) Under a regular optical microscope, abundant mycelium and conidia can be observed. After 7 days of culture, a large number of conidia are produced, including unicellular and dicellular conidia, but no multicellular conidia. The conidia are mostly elliptical, cylindrical, or lemon-shaped. Figure 2 (c)

[0047] 5.2.2 Molecular biological identification DNA was extracted from the tested pathogenic strain and sent to a biotechnology company for sequencing. The sequence of the strain is shown in SEQ ID NO.3. CCTGCGGAGGGATCATTACAAGTGACCCCGGTCTAACCACCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTC TTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT CATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCATCGCGGTCCGCCGCGTGCCTCAAATCGACCGGC TGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACCGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC Phylogenetic analysis was performed by comparing the obtained gene sequences of the target strain with those in the EzTaxon database. Through sequence alignment, the *Hazelnut male inflorescence black spot* strain was found to be related to several *Cladosporium* species (…). Cladosporium The gene sequence similarity of sp. reached 100% ( Figure 3 Meanwhile, combining its morphological characteristics on PDA culture medium, culture characteristics, and characteristics observed under a regular optical microscope, with... Cladosporium. The strains are largely consistent; therefore, the pathogenic strain of black spot disease in hazelnut male inflorescences has been preliminarily identified as *Bacillus*, a deuteromycete belonging to the order Phyllostachyales. Cladosporium sp.) fungi.

[0048] Example 2 Inhibitory effects of different chemical agents on hazelnut pathogens 1. Test reagents Eight commonly used chemical agents were used as test subjects, specifically categorized as follows: 20% pyraclostrobin suspension, 80% mancozeb wettable powder, 10% difenoconazole water-dispersible granules, 25% pyraclostrobin suspension, 80% thiram water-dispersible granules, 15% triadimefon wettable powder, 25% azoxystrobin suspension, and 70% thiophanate-methyl wettable powder. For relevant information on the test agents, please refer to Table 4.

[0049] Table 4 Information on test reagents 2. Screening of test reagent concentrations After several rounds of screening experiments, we identified the suitable agents and concentrations. The weighed agents were poured into potato dextrose agar (PDA) medium, shaken well, and then poured into equal volumes into petri dishes to create plates with different concentration gradients, which were then labeled. Taking 20% ​​pyraclostrobin suspension as an example, the specific preparation steps are as follows:

[0050] To prepare 100 ml of a 30 mg / L culture medium containing 20% ​​pyrimethanil suspension: Based on the formula: Mass of pure active ingredient = Target active ingredient concentration × Preparation system volume, the required mass of pure pyrimethanil active ingredient is calculated as m = 30 mg / L × 0.1 L = 3 mg. Then, based on the 20% mass fraction of the pyrimethanil suspension, the required volume of 20% pyrimethanil suspension is calculated as V = 3 mg ÷ 20% = 15 μL. Take 99.985 mL of sterilized blank culture medium and precisely add 15 μL of 20% pyrimethanil suspension using a micropipette to obtain the target concentration of pyrimethanil-containing culture medium. Similarly, calculate the required reagent weights for other concentrations and prepare other reagents with different concentration gradients using this method.

[0051] 3. Measurement Method Preparation of drug-containing plates: Accurately pipette different volumes of the drug stock solution according to the required drug concentration and add them separately to sterilized and cooled PDA medium. Shake thoroughly to ensure the drug is evenly distributed in the medium. Pour the drug-containing medium into sterile petri dishes and allow it to solidify before use. Simultaneously, prepare drug-free PDA plates as a control.

[0052] Inoculation with pathogens: In a clean bench, use a 5mm diameter punch to create mycelial discs on the cultured pathogen agar plate, ensuring the discs are uniform in size and taken from the active growth area at the edge of the colony. Use tweezers to inoculate the mycelial discs into the center of the drug-containing plate and the control plate, with three replicates for each treatment. Observe and record the growth of the pathogens regularly. When the hyphae on the control plate are close to completely covering the petri dish, measure the colony diameter with a ruler. When measuring, use the cross-sectional method to measure the diameter in two perpendicular directions, and take the average as the colony diameter.

[0053] Data recording and calculation: Record the diameter of colonies on plates under different treatments and calculate the mycelial growth inhibition rate. The calculation formula is: Inhibition rate (%) = (Control group diameter - Treatment group diameter) / Control group diameter × 100%.

[0054] 4. Results and Analysis 4.1. The effect of different drug concentrations on the tested pathogenic strains During the drug screening process, this invention identified the most suitable chemical agent concentration for the hazelnut male inflorescence black spot pathogen, and the specific concentration can be found in Table 5.

[0055] Table 5 Screening Concentrations of Chemical Bactericides 4.2 Effects of different concentrations of the test reagent on the colony diameter growth of pathogenic strains This experiment used the pathogen of hazelnut male inflorescence black spot disease as the research object, and determined the indoor antibacterial activity of eight chemical fungicides at different concentrations. A cross-sectional measurement method was used to measure the two diameters of the colonies and calculate the inhibition rate. The results showed that all eight agents had a certain degree of antibacterial effect. The agents difenoconazole, pyraclostrobin, and azoxystrobin showed strong antibacterial activity against the pathogen of hazelnut male inflorescence black spot disease, with inhibition rates exceeding 80% at all concentrations. Specifically, difenoconazole (30 mg / L), pyraclostrobin (15 mg / L), and azoxystrobin (15 mg / L) showed inhibition rates exceeding 90%. The agents mancozeb, thiram, and thiophanate-methyl showed relatively good antibacterial performance, with inhibition rates around 75%. Finally, the agents pyraclostrobin and triadimefon showed less significant inhibitory effects compared to the other agents, but at high concentrations, the inhibition rates still reached over 50%.

[0056] Table 6. Analysis of variance of mean diameter and inhibition rate of tested bacterial strains Note: Data are the average of three replicates; different lowercase letters after the data in the same column indicate significant differences between treatments (P<0.05). Different concentrations of pyraclostrobin showed significant differences in their inhibitory effects on the pathogen of hazelnut male inflorescence black spot disease. The overall inhibitory effect did not meet expectations, resulting in uneven colony growth. Experimental data indicated that the inhibitory effect on the pathogen of hazelnut male inflorescence black spot disease increased with increasing concentration, reaching its peak at 50 mg / L with an inhibition rate of 58.63%. The results are shown in Table 6. Figure 4 .

[0057] Different concentrations of mancozeb showed significantly different inhibitory effects on the pathogen of hazelnut male inflorescence black spot, and exhibited a certain degree of antibacterial effect. The antibacterial effect increased with increasing concentration, reaching a maximum inhibition rate of 79.02% at a concentration of 50 mg / L. The results are shown in Table 6. Figure 5 .

[0058] Different concentrations of difenoconazole showed significant differences in their inhibitory effects on the pathogen causing black spot disease in hazelnut male inflorescences, with difenoconazole exhibiting extremely strong inhibitory efficacy. Even at the lowest concentration, its inhibition rate was as high as 82.35%; the inhibitory effect was best at a concentration of 25 mg / L, with uniform and regular colony growth and an inhibition rate of 87.65%; and when the concentration of difenoconazole reached 30 mg / L, the inhibition rate could reach 90.00%. The results are shown in Table 6. Figure 6 .

[0059] Different concentrations of pyraclostrobin showed significant differences in their inhibitory effects on the pathogen of hazelnut male inflorescence black spot disease. Pyraclostrobin exhibited a particularly prominent inhibitory effect on the pathogen. With increasing concentration, the antibacterial efficacy significantly increased, and the mycelial growth morphology in the culture medium became more regular. The optimal inhibitory effect (91.57%) was achieved at a concentration of 15 mg / L. Even at the lowest concentration, the inhibition rate reached 83.13%. The results are shown in Table 6. Figure 7 .

[0060] Different concentrations of thiram showed significantly different inhibitory effects on the pathogen of black spot disease in hazelnut male inflorescences, with thiram exhibiting relatively weak antibacterial activity. Compared to pyrimethanil, thiram demonstrated a more pronounced inhibitory effect on this pathogen. At a concentration of 40 mg / L, it showed the best inhibition rate of colony growth, reaching 76.47%. The results are shown in Table 6. Figure 8 .

[0061] Different concentrations of methyl thiophanate showed significantly different inhibitory effects on the pathogen of black spot disease in hazelnut male inflorescences. As the concentration of the chemical agent methyl thiophanate gradually increased, significant inhibition of colony growth was observed. In the culture medium, the colonies exhibited an orderly growth pattern, especially at a concentration of 25 mg / L, where the growth inhibition rate reached 73.53%. The results are shown in Table 6. Figure 9.

[0062] The inhibitory effects of different concentrations of triadimefon on the pathogen of hazelnut male inflorescence black spot disease varied significantly. Specifically, the toxicity of the chemical agent triadimefon against the pathogen was relatively low, and its overall inhibitory effect did not reach the ideal level. Within the tested concentration range, the inhibitory effect on the pathogen was most significant at a triadimefon concentration of 30 mg / L, with a corresponding inhibition rate of 60.20%. The results are shown in Table 6. Figure 10 .

[0063] Different concentrations of azoxystrobin showed significant differences in their inhibitory effects on the pathogen of hazelnut male inflorescence black spot. Specifically, azoxystrobin performed excellently in inhibiting the pathogen, even at low concentrations. At a concentration of 5 mg / L, the inhibition rate against the pathogen reached 83.53%; at the highest tested concentration of 15 mg / L, the inhibition rate further increased to 92.55%. The results are shown in Table 6. Figure 11 .

[0064] Finally, it should be noted that the above are only some preferred embodiments of the present invention and should not be construed as limiting the scope of protection of the present invention. Any non-essential improvements and adjustments made by those skilled in the art based on the above content of the present invention shall fall within the scope of protection of the present invention.

Claims

1. A type of deuteromycete belonging to the genus *Bacillus* of the order *Bacillus* (*Bacillus*). Cladosporium sp.) fungi, characterized by, It is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 42531.

2. A method for culturing fungi of the genus *Bacillus* in the order *Bacillus* of the order *Bacillus* as described in claim 1, characterized in that, The fungus was inoculated into PDA medium and cultured at a constant temperature of 26-28°C.

3. The cultivation method according to claim 2, characterized in that, The incubation period is 5 to 7 days.

4. The application of the fungus of the genus *Bacillus* in the order *Branchiales* of the class *Deuteromycetes* as described in claim 1 in screening disease-resistant hazelnut strains.

5. The use of the fungus of the genus *Bacillus* in the order *Branchiales* of the class *Deuteromycetes* as described in claim 1 in screening agents for the prevention and control of hazelnut black spot disease.

6. The application according to claim 5, characterized in that, The selected agents for controlling hazelnut black spot disease are one or a combination of several of the following: pyraclostrobin, mancozeb, difenoconazole, pyraclostrobin, thiram, triadimefon, azoxystrobin, and thiophanate-methyl.

7. The application according to claim 6, characterized in that, The agent is one or a combination of several of the following: 20% pyraclostrobin suspension concentrate, 80% mancozeb wettable powder, 10% difenoconazole water-dispersible granules, 25% pyraclostrobin suspension concentrate, 80% thiram water-dispersible granules, 15% triadimefon wettable powder, 25% azoxystrobin suspension concentrate, and 70% thiophanate-methyl wettable powder.

8. A method for screening agents to control hazelnut black spot disease using fungi of the genus *Bacillus* in the order *Bacillus* of the class *Deuteromycetes* as described in claim 1, characterized in that, Includes the following steps: The test agent was contacted with the fungus of the genus *Bacillus* in the order *Bacillus* of the order *Bacillus* of the order *Bacillus* on a culture medium. After cultivation, the growth inhibition rate of the fungus was measured, and effective agents were screened based on the level of inhibition.

9. The method according to claim 8, characterized in that, The culture was carried out in PDA medium at a constant temperature of 26–28°C for 5–7 days.

Images