An immune cell for improving anti-tumor efficacy based on autophagy-related gene regulation, a preparation method and use thereof

Abstract

The application discloses an immune cell for improving anti-tumor effect based on autophagy related gene regulation, a preparation method and application thereof, and experiment researches find that FAM134B is highly related to the killing function of the immune cell, overexpression of FAM134B in the immune cell can inhibit the killing function of the immune cell, and reducing or knocking out the expression and / or function of the autophagy related gene FAM134B in the immune cell can significantly enhance the killing function of the immune cell, so that the killing tumor cell effect of the cell is improved, and the treatment effect of the CAR-T cell on the solid tumor is further improved.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to an immune cell that enhances anti-tumor efficacy based on autophagy-related gene regulation, its preparation method, and its uses. Background Technology

[0002] Cancer is one of the most serious diseases threatening human life and health. Due to its destructive power and high complexity, the pathogenesis and treatment of cancer have always been a research hotspot in medicine, life sciences, and biomedical engineering, and these studies have made significant progress in many aspects. Currently, clinical methods for cancer treatment are broadly divided into surgery, radiotherapy, chemotherapy, and targeted therapy. Emerging cancer immunotherapy, selected as the 2013 Science Breakthrough of the Year by Science magazine, has brought revolutionary changes to the field of cancer treatment, shifting the treatment concept from targeting cancer to targeting the immune system. Currently, two types of cancer immunotherapy have achieved significant breakthroughs in clinical trials: the first is immune checkpoint inhibitor therapy, such as anti-PD1 / PD-L1 and anti-CTLA4 antibodies; the second is chimeric antigen receptor (CAR) T-cell therapy. As an important component of immunotherapy, the emergence of CAR-T cell therapy is of great significance and represents a milestone in the fight against malignant tumors. Currently, the manufacturing process of CAR-T cells involves first extracting autologous T cells from the patient, genetically modifying them in vitro, adding CARs that can recognize cancer cells, expanding them in vitro, and then reinfusing them into the patient to kill cancer cells. To date, CAR-T cell therapy has achieved remarkable success in treating hematological malignancies, with the U.S. Food and Drug Administration and the China National Medical Products Administration approving 12 CAR-T cell therapy products. However, CAR-T cell therapy still faces many challenges in treating solid tumors, such as the inhibition of the tumor microenvironment, insufficient CAR-T cell infiltration, and tumor antigen heterogeneity. These issues severely limit its efficacy in treating solid tumors. Therefore, further improving the efficacy of CAR-T cell therapy for solid tumors is of great significance.

[0003] FAM134B (also known as JK-1 or RETREG1) belongs to the 134-sequence-similarity family and was the first endoplasmic reticulum (ER) autophagy receptor discovered. In 2001, FAM134B was first identified as an oncogene in esophageal squamous cell carcinoma (ESCC). More than two decades after its initial discovery, its powerful biological functions have been gradually revealed, most notably its regulation of ER autophagy. This protein has two important domains—the LC3 interaction domain (LIR) and the reticulum homology domain (RHD). The LIR is responsible for binding to autophagosomes when the RHD senses and induces ER membrane bending. Based on this function, FAM134B participates in many processes related to ER phagocytosis, such as hepatic ER phagocytosis, procollagen quality control, ERLAD (ER-associated degradation), reticulomitotic phagocytosis, and preadipocyte differentiation. In recent years, dysfunction of FAM134B has been reported to be associated with many diseases, including neuropathy, viral infections, vascular diseases, inflammation, and cancer. FAM134B-induced neuropathy and viral infection have been shown to be related to its function in regulating autophagy in the ER. In cancer biology, FAM134B exhibits contrasting roles in different cancer types, acting as an oncogene or tumor inhibitor. It is involved in regulating cancer cell cycle, proliferation, apoptosis, and metastasis, and is associated with the PI3K / AKT and WNT / β-catenin signaling pathways. Currently, there are no reports on the role of the autophagy-related gene FAM134B in immune cells. Summary of the Invention

[0004] The purpose of this invention is to address the shortcomings of existing technologies by providing an immune cell, its preparation method, and its uses that enhance anti-tumor efficacy based on autophagy-related gene regulation.

[0005] This invention provides an immune cell that enhances anti-tumor efficacy based on autophagy-related gene regulation. Experimental studies have found that the autophagy-related gene FAM134B is highly correlated with the killing function of immune cells; overexpression of FAM134B in immune cells inhibits the killing function of immune cells; while reducing or knocking out the expression and / or function of the autophagy-related gene FAM134B in the immune cells significantly enhances the killing function of immune cells, thereby significantly improving the cell's effect in killing tumor cells and further improving the efficacy of CAR-T cell therapy for solid tumors.

[0006] The nucleotide sequence of FAM134B described in this invention has a Gene ID of 54463 on the NCBI website.

[0007] This invention is applicable to all types of immune cells and all types of chimeric antigen receptors.

[0008] In some embodiments, an immune cell that enhances anti-tumor efficacy based on autophagy-related gene regulation includes a gene regulation system capable of reducing the expression and / or function of the autophagy-related gene FAM134B within the immune cell, wherein reducing the expression and / or function of the autophagy-related gene FAM134B within the immune cell enhances the effector function of the immune cell.

[0009] The effector function of immune cells described in this invention mainly refers to the killing function of immune cells.

[0010] In some implementations, the expression of endogenous target genes is reduced by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to unmodified or control immune effector cells.

[0011] The gene regulation system of the present invention for reducing the expression and / or function of the phagocytosis-related gene FAM134B in immune cells refers to a system that reduces the expression and / or function of the phagocytosis-related gene FAM134B in immune cells by gene knockout or knockdown through gene editing technology or genetic engineering methods. In some embodiments, the gene regulation system comprises (i) a nucleic acid molecule; (ii) an enzyme protein; or (iii) a nucleic acid molecule and an enzyme protein. In some embodiments, the gene regulation system comprises a nucleic acid molecule selected from siRNA, shRNA, microRNA (miR), microRNA antagonist (antagomiR), or antisense RNA. In some embodiments, the gene regulation system comprises an enzyme protein, and wherein the enzyme protein has been engineered to specifically bind to target sequences in one or more endogenous genes. In some embodiments, the protein is a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease, or a broad-spectrum nuclease. In some embodiments, the gene regulation system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a guide RNA (gRNA) molecule, and the enzyme protein is a Cas protein or a Cas ortholog. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the Cas protein is a wild-type Cas protein containing two enzyme-active domains and capable of inducing double-strand DNA breaks. In some embodiments, the Cas protein is a Cas nickase mutant containing one enzyme-active domain and capable of inducing single-strand DNA breaks. In some embodiments, the Cas protein is an inactivated Cas protein (dCas) that binds to a heterologous protein capable of regulating the expression of an endogenous target gene. In some embodiments, the gene regulation system comprises at least one gRNA molecule targeting FAM134B, the FAM134B-targeting gRNA molecule targeting an exon region of FAM134B.

[0012] In some embodiments, the nucleotide sequence of the gRNA molecule targeting FAM134B is shown in SEQ ID NO.1.

[0013] In some embodiments, the gene regulation system is introduced into the immune cells via transfection, transduction, electroporation, or physical disruption of the cell membrane using a microfluidic device. In some embodiments, the gene regulation system is introduced in the form of a polynucleotide, protein, or ribonucleoprotein (RNP) complex encoding one or more components of the system.

[0014] In some embodiments, the modified immune effector cells further comprise engineered immune receptors displayed on the cell surface. In some embodiments, the engineered immune receptor is a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the engineered immune receptor is an engineered T-cell receptor (TCR). In some embodiments, the engineered immune receptor is capable of specifically binding to antigens expressed on the surface of target cells, wherein the antigen is a tumor-associated antigen.

[0015] In some embodiments, the chimeric antigen receptor of the immune cell includes an antigen-binding domain and a non-antigen-binding domain, the non-antigen-binding domain including the extracellular domain, transmembrane domain and intracellular co-stimulatory domain of CD28 or functional variants thereof, and the signal transduction domain of CD3ζ or functional variants thereof.

[0016] In some implementations, the antigen-binding domain is a CD19 or Her2 binding domain.

[0017] In some embodiments, the immune cells include T cells, B cells, natural killer cells, macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and / or peripheral blood mononuclear cells.

[0018] In some implementations, the immune cells are autologous, allogeneic, or heterologous.

[0019] In some embodiments, the present invention provides a method for preparing immune cells that enhance anti-tumor efficacy based on autophagy-related gene regulation, comprising:

[0020] Immune cells were obtained from the subjects;

[0021] Introducing a gene regulatory system into immune cells, wherein the gene regulatory system is capable of reducing the expression and / or function of the endogenous autophagy-related gene FAM134B; and

[0022] The immune cells were cultured such that the expression and / or function of FAM134B was reduced compared to unmodified immune effector cells.

[0023] In some embodiments, the use of the aforementioned immune cell, which enhances anti-tumor efficacy based on autophagy-related gene regulation, in the preparation of a medicament for the treatment / prevention / diagnosis of cancer or tumors, infections, or autoimmune diseases.

[0024] In some implementations, the cancer or tumor includes one or more of the following: glioblastoma, head and neck cancer, lung cancer, thyroid cancer, bronchial cancer, breast cancer, stomach cancer, liver cancer, pancreatic cancer, colon cancer, colorectal cancer, kidney cancer, bladder cancer, cervical cancer, uterine cancer, ovarian cancer, prostate cancer, skin cancer, melanoma, lymphoma, and leukemia. Attached Figure Description

[0025] Figure 1 This is a flow cytometry analysis result of the CD19-targeting CAR structure transduced by T cells overnight after electroporation;

[0026] Figure 2 This is a comparison of the killing ability of FAM134B-KO-CD19-CAR-T cells and Control-KO-CD19-CAR-T cells after co-culturing for 24 hours; in the figure, the target cells are Raji cells, with a density of 5×10⁻⁶. 4 / hole;

[0027] Figure 3 This is a schematic diagram illustrating the process of establishing a subcutaneous xenograft model;

[0028] Figure 4 This is a graph showing the results of FAM134B-KO-CD19-CAR-T cell and Control-KO-CD19-CAR-T cell therapy for lymphoma.

[0029] Figure 5 This is a flow cytometry analysis result of the CD19-targeting CAR structure transduced by NK cells overnight after electroporation;

[0030] Figure 6 This is a comparison of the killing ability of FAM134B-KO-CD19-CAR-NK cells and Control-KO-CD19-CAR-NK cells after 5 hours of co-culture; in the figure, the target cells are Raji cells, with a density of 5×10⁻⁶. 4 / hole;

[0031] Figure 7 This is a comparison of the killing ability of FAM134B-KO-CD19-CAR-NK cells and Control-KO-CD19-CAR-NK cells after co-culturing for 18 hours; in the figure, the target cells are Raji cells, with a density of 5×10⁻⁶. 4 / hole;

[0032] Figure 8 This is a comparison of the killing ability of FAM134B-KO-CD19-CAR-NK cells and Control-KO-CD19-CAR-NK cells after co-culturing for 24 hours; in the figure, the target cells are Raji cells, with a density of 5×10⁻⁶. 4 / hole;

[0033] Figure 9 This is a flow cytometry analysis result of the Her2-targeting CAR structure transduced by T cells overnight after electroporation;

[0034] Figure 10 This is a comparison of the killing ability of FAM134B-KO-Her2-CAR-T cells and Control-KO-Her2-CAR-T cells after co-culturing for 24 hours; in the figure, the target cells are Skov3 cells with a density of 5×10⁻⁶. 3 / hole;

[0035] Figure 11 This is a flow cytometry analysis result of the CAR structure targeting Her2 transduced by NK cells overnight after electroporation;

[0036] Figure 12 This is a comparison of the killing ability of FAM134B-KO-Her2-CAR-NK cells and Control-KO-Her2-CAR-NK cells after co-culturing for 24 hours; in the figure, the target cells are Skov3 cells with a density of 5×10⁻⁶. 3 / hole;

[0037] Figure 13 This is a flow cytometry analysis result of the CAR structure of CD19-targeting T cells overexpressing FAM134B;

[0038] Figure 14 This is a comparison of the killing ability of FAM134B-OE-CD19-CAR-T cells and Control-OE-CD19-CAR-T cells after 24 hours of co-culture; in the figure, the target cells are Raji cells, with a density of 5×10⁻⁶. 4 / hole;

[0039] Figure 15 This is a flow cytometry analysis result of the CAR structure of CD19-targeting NK cells overexpressing FAM134B;

[0040] Figure 16 This is a comparison of the killing ability of FAM134B-OE-CD19-CAR-NK cells and Control-OE-CD19-CAR-NK cells after 24 hours of co-culture; in the figure, the target cells are Raji cells, with a density of 5×10⁻⁶. 4 / hole. Detailed Implementation

[0041] To make the technical means, creative features, and achieved objectives and effects of this invention easier to understand, the invention is further illustrated below with specific embodiments. However, the following embodiments are only preferred embodiments of this invention and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments described herein without creative effort are all within the protection scope of this invention. In the following embodiments, unless otherwise specified, the operating methods used are conventional operating methods, the equipment used is conventional equipment, and the equipment materials used in each embodiment are the same. In the following embodiments, unless otherwise specified, % refers to volume percentage.

[0042] Example 1: gRNA Design

[0043] 1.1 Construction of gRNA vector

[0044] gRNAs targeting different exon regions of the FAM134B gene were designed and selected. The gRNAs used in this example are as follows:

[0045] AGCTCAGCAGCTCGTCGGCG(SEQ ID NO.1)

[0046] Meanwhile, a non-target gRNA was designed as a control. In this embodiment, a gRNA targeting the luciferase gene was used, as detailed below:

[0047] TGTGCCAGAGTCCTTCGATA (SEQ ID NO. 2).

[0048] Then, a gRNA vector was constructed using the espcas1.1 vector with puro resistance: the espcas1.1 vector was digested with enzymes, ligated with gRNA, transformed, cloned, plasmid extracted, and sequenced to obtain a vector with the correct sequence.

[0049] The gRNA designed in this embodiment can significantly knock down the expression of FAM134B.

[0050] Example 2: Preparation of anti-CD19 CAR-T cells with FAM134B knockout

[0051] 1.1 Construction of chimeric antigen receptor vector

[0052] Using the anti-CD19 single-domain antibody sequence (SEQ ID NO.3), combined with the extracellular hinge region, transmembrane region, and cytoplasmic region of the CD28 molecule (SEQ ID NO.4), and linked to the intracellular domain of CD3ζ (SEQ ID NO.5), a CAR structure targeting CD19 was constructed. The retroviral SFG vector was then digested with enzymes, ligated to the constructed CAR structure, transformed, cloned, plasmid extracted, and sequenced to obtain a retroviral vector with the correct sequence.

[0053] 1.2 Preparation of Retroviruses

[0054] Revived Phoenix-ampho cell lines were cultured for two consecutive passages before being used for virus packaging and transfection. Virus was plated one day before packaging, with a concentration of 1×10⁶ cells / mL. 6 Seed cells in 6-well plates and cultured overnight; the next day, when Phoenix-ampho cells reached approximately 70% confluence, plasmid transfection was performed. The transfection procedure was as follows: Prepare Opti-MEM / DNA mixtures (0.25 mL per well) in 1.5 mL EP tubes: Opti-MEM 125 μL + SFG core plasmid 2.5 μg + P3000 5 μL; and Opti-MEM / Lipo3000 mixture: Opti-MEM 125 μL + Lipo3000 7.5 μL. After mixing, let stand at room temperature for 5 min. Slowly add the Opti-MEM / Lipo3000 mixture to the Opti-MEM / DNA mixture and let stand at room temperature for 20 min. Discard 1 mL of the old culture medium, add the Lipo3000 / DNA mixture dropwise, gently shake in a "X" shape 8 times in each direction, and add 5% of the culture medium. After culturing in a CO2, 37°C, and saturated humidity incubator for 6 hours, replace with 2 mL of fresh, preheated (37°C) whole DMEM medium and continue culturing for another 48 hours. 48 hours after transfection, collect the viral supernatant, filter through a 0.45 μm filter, and store at 4°C (for up to one week) for subsequent infection.

[0055] 2.1 PBMC Separation

[0056] Peripheral blood (30-50 mL) was collected from healthy volunteers (donor) (ethics approval number: NO.2020-003). The peripheral blood was diluted with PBS (PBS:peripheral blood = 1:1). 20 mL of the diluted peripheral blood was slowly added along the wall of a 50 mL centrifuge tube to an equal volume of Ficoll lymphocyte separation medium, allowing the separation medium and peripheral blood to separate into two layers. The mixture was centrifuged at 2200 rpm for 20 min at room temperature, with the acceleration and deceleration rates adjusted to "0". The PBMC layer was transferred to a new 50 mL centrifuge tube, and the acceleration and deceleration rates were adjusted back to "9". The mixture was centrifuged at 1500 rpm for 10 min at room temperature, and the supernatant was discarded. The washing was repeated twice. After the final wash, the PBMCs were resuspended in 40 mL of PBS. Cell viability and density were detected using a cell counter, and the number of PBMCs was calculated.

[0057] 2.2 T cell purification, culture and activation

[0058] Prepare a magnetic bead sorting (MACS) buffer solution containing 0.5% BSA and 2 mM EDTA, per 1 × 10⁻⁶ m³. 7 Add 80 μL MACS and 20 μL CD3 MicroBeads to PBMCs, mix well by pipetting, and incubate at 4°C in the dark for 20 min. After the reaction, add MACS to the cell / Beads mixture to a final volume of 500 μL or 1 mL. Add the mixture to an MS or LS sorting column, collect the eluent in a 15 mL centrifuge tube, and wash the MS / LS sorting column twice with 500 μL MACS. All cells collected in the centrifuge tube are CD3 negative cells. Place the MS or LS sorting column into the mouth of a new 15 mL centrifuge tube, add 1 mL MACS, and use the stopcock provided with the column packaging to slowly but firmly push the liquid to the bottom. Repeat twice. The cells pushed down from the column are the isolated and purified human primary T cells. Count the cells and calculate the yield.

[0059] Prepare a complete T cell culture medium containing cytokines, X-VIVO15 (45 mL X-VIVO15 + 5 mL FBS + 1% P / S + 5 ng / μL IL-7 + 5 ng / μL IL-15). Resuspend the purified primary human T cells in the X-VIVO15 complete culture medium and adjust the density to 1×10⁻⁶ cells / mL. 6 Add CD3 / CD28 dynabeads of equal number of T cells / mL to stimulate the proliferation of human primary T cells. After mixing well, add to a culture flask of appropriate volume and incubate in a 5% CO2, 37°C, saturated humidity incubator.

[0060] 2.3 Preparation of FAM134B knockout T cells by electroporation

[0061] Human primary T cells were stimulated with CD3 / CD28 dynabeads for 48 hours before electroporation. The synthesized target gene gRNA was dissolved in DNase / RNase-Free ddH2O and the concentration was adjusted to 100 pmol / μL. 60 pmol of gRNA (synthesized by GenScript) and 30 pmol of Cas9 protein were mixed and incubated at room temperature for 15 minutes to form the RNP complex. 6–8 × 10⁶ cells were then collected. 6 Centrifuge T cells at 1500 rpm for 5 min, discard the supernatant; add 5 mL of electroporation buffer, centrifuge at 1500 rpm for 5 min, discard the supernatant, and repeat the washing process twice; resuspend the T cells in 120 μL of electroporation buffer, add to the RNP complex, mix well, and then electroporate; after electroporation, transfer the T cells to preheated T cell culture medium at 37℃. Using the CRISPR-Cas9 method, FAM134B knockout T cells (FAM134B KO T cells) and non-FAM134B-targeted luciferase T cells (Control KO T cells) were prepared.

[0062] 2.4KO FAM134B CD19 CAR-T cell preparation

[0063] The virus was packaged using a γ-retrovirus core plasmid containing the CD19 CAR gene; RetroNectin-coated plates were used one day prior to the treatment; T cells that had been electroporated overnight were collected, and a mixture of 1 mL of γ-retrovirus supernatant and 0.5 mL of X-VIVO15 medium containing only FBS and P / S was added, gently pipetting to mix, and then added to the coated plates at a density of 5 × 10⁶ cells per well. 5 Cells were collected; after sealing with a sealing film, the cells were centrifuged at 32℃ and 3000 rpm for 90 min; the sealing film was removed, and the cells were placed in a cell culture incubator for 24 h; the culture medium was replaced with fresh X-VIVO15 complete medium containing IL-7 and IL-15, and the cells were cultured for another 48 h; the CAR positivity rate of CD19 CAR T cells was detected by flow cytometry using IgG to recognize CD19 CAR molecules. The results are as follows: Figure 1 As shown, Control KO CD19-CAR-T cells (Control-KO-CD19-CAR-T cells) and FAM134B KO CD19-CAR-T cells (FAM134B-KO-CD19-CAR-T cells) exhibit similar CAR expression, indicating that Control-KO-CD19-CAR-T cells and FAM134B-KO-CD19-CAR-T cells were successfully prepared. Cells were observed every 2-3 days, and the cell density was adjusted to 1×10⁶ cells by replenishing with X-VIVO15 complete culture medium containing cytokines. 6 / mL.

[0064] 3. In vitro functional evaluation of FAM134B-KO-CD19-CAR-T cells

[0065] 3.1 Validation of in vitro killing function

[0066] After detecting the expression level of CAR on the surface of T cells, the number of effector cells required for different effector-to-target ratios (the ratio of effector cells (E) to target cells (T) (E:T), 2:1, 1:1, 1:2, 1:4, 1:8, 1:16, 1:32) was calculated based on the positive rate. A blank group with no effector cells and only target cells was also set up. After co-culturing effector cells and target cells in a 37℃ cell culture incubator for 5-24 h, 100 μL of D-luciferin substrate (1.5 mg / mL) was added to each well. The chemiluminescence of each well was detected using an ELISA reader, and the killing efficiency of effector cells was calculated as (1 - experimental group / blank group) × 100. Figure 2 The results showed that after co-culturing for 24 h, the killing efficiency of FAM134B-KO-CD19-CAR-T cells as effector cells was higher than that of Control-KO-CD19-CAR-T cells without FAM134B knockout.

[0067] 4. In vivo functional evaluation of FAM134B-KO-CD19-CAR-T cells in mice

[0068] 4.1 Establishment of a subcutaneous xenograft model

[0069] like Figure 3 As shown, the right axillary region of the NSG mouse was disinfected by wiping with a 75% alcohol swab. Using a 1mL syringe, 200μL of PBS resuspended in 1×10⁻⁶ styrene solution was drawn. 6 Raji-luciferase-EGFP tumor cells were injected subcutaneously. Seven days after inoculation, the long and short axes of the tumor in each mouse were measured using calipers. Based on tumor area, mice were randomly divided into two groups: the Control-KO-CD19-CAR-T group and the FAM134B-KO-CD19-CAR-T group, with three mice in each group. The tumor volume was calculated using the formula: Tumor volume (mm²) 3 = Major axis (mm) × Minor axis (mm) × Minor axis (mm) / 2; The two groups of mice were subsequently injected via tail vein with 200 μL of PBS resuspended in 0.8 × 10⁻⁶ mcg. 6 Mice were treated with Control-KO-CD19-CAR-T cells and FAM134B-KO-CD19-CAR-T cells; tumors were observed twice weekly, and the long and short axes of the tumors were measured. Data were collected and tumor volume was calculated. Results are as follows: Figure 4As shown, tumor growth in the FAM134B-KO-CD19-CAR-T group was significantly lower than that in the Control-KO-CD19-CAR-T group, indicating that FAM134B-KO-CD19-CAR-T cells are better able to control tumor growth.

[0070] Example 3: Preparation of CD19-CAR-NK cells with FAM134B knockout

[0071] 1.1 Purification, culture and activation of NK cells

[0072] After obtaining PBMC cells using the same method as in Example 2, a magnetic bead sorting (MACS) buffer containing 0.5% BSA and 2 mM EDTA was prepared, with each 1 × 10 7 Add 80 μL MACS and 20 μL CD56 MicroBeads to PBMCs, mix well by pipetting, and incubate at 4°C in the dark for 20 min. After the reaction, add MACS to the cell / Beads mixture to a final volume of 500 μL or 1 mL. Add the mixture to an MS or LS sorting column, collect the eluent in a 15 mL centrifuge tube, and wash the MS / LS sorting column twice with 500 μL MACS. All cells collected in the centrifuge tube are CD56 negative cells. Place the MS or LS sorting column into the mouth of a new 15 mL centrifuge tube, add 1 mL MACS, and use the stopcock provided with the column packaging to slowly but firmly push the liquid to the bottom. Repeat twice. The cells pushed down from the column are the isolated and purified human primary NK cells. Count the cells and calculate the yield.

[0073] Resuscitate K562-4-1BBL-mIL21 (K562-2+) feeder cells that have been irradiated (100 Gy); prepare RPMI 1640 complete NK cell culture medium containing cytokines (45 mL RPMI 1640 + 5 mL FBS + 1% P / S + 200 IU / mL IL-2), and resuspend K562-2+ feeder cells in RPMI 1640 complete medium; resuspend purified human primary NK cells in RPMI 1640 complete medium and adjust the density to 1 × 10⁻⁶ cells / mL. 6 Add K562-2+ feeder cells at a ratio of 1 cell / mL to stimulate the proliferation of human primary NK cells. After mixing thoroughly, add to a culture flask of appropriate volume and incubate at 37°C with 5% CO2 and saturated humidity.

[0074] 1.2 Preparation of FAM134B knockout NK cells by electroporation

[0075] Human primary NK cells were electroporated 96 h after stimulation with K562-2+ feeder cells. The synthesized target gene gRNA was dissolved in DNase / RNase-Free ddH2O and the concentration was adjusted to 100 pmol / μL. 60 pmol of gRNA (synthesized from GenScript) and 30 pmol of Cas9 protein were mixed and incubated at room temperature for 15 min to form the RNP complex. 6–8 × 10⁶ cells were then used. 6 NK cells were centrifuged at 1500 rpm for 5 min, and the supernatant was discarded. 5 mL of electroporation buffer was added, and the cells were centrifuged at 1500 rpm for 5 min, and the supernatant was discarded. This washing process was repeated twice. NK cells were resuspended in 120 μL of electroporation buffer, added to the RNP complex, mixed thoroughly, and then electroporated. After electroporation, NK cells were transferred to RPMI 1640 complete medium preheated at 37°C containing IL-2 (200 IU / mL). NK cells with FAM134B knockout (FAM134B KO NK cells) and non-knockout NK cells targeting the luciferase gene (Control KO NK cells) were prepared using the CRISPR-Cas9 method.

[0076] Preparation of CD19-CAR-NK cells from 1.3KO FAM134B

[0077] The virus was packaged using the γ-retrovirus core plasmid containing the CD19-CAR gene prepared in Example 2; RetroNectin-coated plates were used one day in advance; NK cells that had been electroporated overnight were taken, and a mixture of 1 mL of γ-retrovirus supernatant and 0.5 mL of RPMI 1640 medium containing only FBS and P / S was added, gently pipetting to mix, and then added to the coated plates, 5 × 10⁶ cells per well. 5 Cells were collected; after sealing with a sealing film, the cells were centrifuged at 32℃ and 3000 rpm for 90 min; the sealing film was removed, and the cells were placed in a cell culture incubator for 24 h; the culture medium was replaced with fresh RPMI 1640 complete medium containing IL-2 (200 IU / mL), and the cells were cultured for another 48 h; the CAR positivity rate of CD19 CAR NK cells was detected by flow cytometry using IgG to recognize the CAR molecule of CD19 scFv. The results are as follows. Figure 5As shown, Control KO CD19-CAR-NK cells (Control-KO-CD19-CAR-NK cells) and FAM134B KO CAR-NK cells (FAM134B-KO-CD19-CAR-NK cells) exhibit similar CAR expression, indicating that Control-KO-CD19-CAR-NK cells and FAM134B-KO-CD19-CAR-NK cells were successfully prepared. Cells were observed every 2–3 days, and the cell density was adjusted to 1 × 10⁶ cells by replenishing with RPMI 1640 complete medium containing IL-2 (200 IU / mL). 6 / mL.

[0078] In vitro functional evaluation of 2FAM134B-KO-CD19-CAR-NK cells

[0079] 2.1 Validation of in vitro killing function

[0080] After detecting the expression level of CAR on the surface of NK cells, the number of effector cells required for different effector-to-target ratios (the ratio of effector cells (E) to target cells (T) (E:T), 2:1, 1:1, 1:2, 1:4, 1:8, 1:16, 1:32) was calculated based on the positive rate. A blank group with no effector cells and only target cells was also set up. After co-culturing effector cells and target cells in a 37℃ cell culture incubator for 5–24 h, 100 μL of D-luciferin substrate (1.5 mg / mL) was added to each well. The chemiluminescence of each well was detected using an ELISA reader, and the killing efficiency of effector cells was calculated as (1 - experimental group / blank group) × 100. Figures 6-8 The results showed that FAM134B-KO-CD19-CAR-NK cells, as effector cells, had a higher killing efficiency than CAR-NK cells without FAM134B knockout.

[0081] Example 4: Preparation of Her2-CAR-T cells with FAM134B knockout

[0082] 1.1 Construction of chimeric antigen receptor vector

[0083] Using the anti-Her2 single-domain antibody sequence (SEQ ID NO.6), combined with the extracellular hinge region, transmembrane region, and cytoplasmic region of the CD28 molecule (SEQ ID NO.4), and linking the intracellular domain of CD3ζ (SEQ ID NO.5), a Her2-targeting CAR structure was constructed. The retroviral SFG vector was then digested with enzymes, ligated to the constructed CAR structure, transformed, cloned, plasmid extracted, and sequenced to obtain a retroviral vector with the correct sequence.

[0084] 2.1 Preparation of Retroviruses

[0085] The revived Phoenix-ampho cell line needs to be cultured for two consecutive generations before it can be used for virus packaging. Plate it one day before transfection, using a 1×10⁶ mcg culture medium. 6 Seed cells in 6-well plates and cultured overnight; on the second day, when Phoenix-ampho cells reached approximately 70% confluence, plasmid transfection was performed. The transfection procedure was as follows: Prepare Opti-MEM / DNA mixtures (0.25 mL per well) in 1.5 mL EP tubes: Opti-MEM 125 μL + SFG core plasmid 2.5 μg + P3000 5 μL; and Opti-MEM / Lipo3000 mixtures: Opti-MEM 125 μL + Lipo3000 7.5 μL. After mixing, let stand at room temperature for 5 min. Slowly add the Opti-MEM / Lipo3000 mixture to the Opti-MEM / DNA mixture and let stand at room temperature for 20 min. Discard 1 mL of the old culture medium, add the Lipo3000 / DNA mixture dropwise, gently shake in a "X" shape 8 times in each direction, and add 5% of the culture medium. After culturing in a CO2, 37°C, and saturated humidity incubator for 6 hours, replace with 2 mL of fresh, preheated (37°C) whole DMEM medium and continue culturing for another 48 hours. 48 hours after transfection, collect the viral supernatant, filter through a 0.45 μm filter, and store at 4°C (for up to one week) for subsequent infection.

[0086] 2.2 Preparation of Her2-CAR-T cells from KO FAM134B

[0087] The virus was packaged using a γ-retrovirus core plasmid with a Her2-CAR structure; the plates were coated with RetroNectin one day in advance; T cells that had been electroporated overnight in Example 2 were taken, and a mixture of 1 mL of γ-retrovirus supernatant and 0.5 mL of X-VIVO15 medium containing only FBS and P / S was added, gently pipetting to mix, and then added to the coated plates at a density of 5 × 10⁶ cells per well. 5 Cells were collected; after sealing with a sealing film, the cells were centrifuged at 32°C and 3000 rpm for 90 min; the sealing film was removed, and the cells were placed in a cell culture incubator for 24 h; the culture medium was replaced with fresh X-VIVO15 complete medium containing IL-7 and IL-15, and the cells were cultured for another 48 h; the CAR positivity rate of CAR T cells was detected by flow cytometry using an antibody that recognizes the HA tag. The results are as follows: Figure 9As shown, Control KO Her2-CAR-T cells (Control-KO-Her2-CAR-T cells) and FAM134B KO CAR-T cells (FAM134B-KO-Her2-CAR-T cells) exhibit similar CAR expression, indicating that Control-KO-Her2-CAR-T cells and FAM134B-KO-Her2-CAR-T cells were successfully prepared. Cells were observed every 2–3 days, and the cell density was adjusted to 1 × 10⁻⁶ cells by replenishing the medium with X-VIVO15 complete culture medium containing cytokines. 6 / mL.

[0088] 3. In vitro functional evaluation of FAM134B-KO-Her2-CAR-T cells

[0089] 3.1 Validation of in vitro killing function

[0090] After detecting the expression level of CAR on the surface of T cells, the number of effector cells required for different effector-to-target ratios (the ratio of effector cells (E) to target cells (T) (E:T), 2:1, 1:1, 1:2, 1:4, 1:8, 1:16, 1:32) was calculated based on the positive rate. A blank group with no effector cells and only target cells was also set up. After co-culturing effector cells and target cells in a 37℃ cell culture incubator for 24 h, 100 μL of D-luciferin substrate (1.5 mg / mL) was added to each well. The chemiluminescence of each well was detected using an ELISA reader, and the killing efficiency of effector cells was calculated as (1 - experimental group / blank group) × 100. Figure 10 The results showed that FAM134B-KO-Her2-CAR-T cells had a higher killing efficiency than Control-KO-Her2-CAR-T cells without FAM134B knockout.

[0091] Example 5: Preparation of Her2-CAR-NK cells with FAM134B knockout

[0092] 1.1 Construction of chimeric antigen receptor vector

[0093] Using the anti-Her2 single-domain antibody sequence (SEQ ID NO.6), combined with the extracellular hinge region, transmembrane region, and cytoplasmic region of the CD28 molecule (SEQ ID NO.4), and linking the intracellular domain of CD3ζ (SEQ ID NO.5), a Her2-targeting CAR structure was constructed. The retroviral SFG vector was then digested with enzymes, ligated to the constructed CAR structure, transformed, cloned, plasmid extracted, and sequenced to obtain a retroviral vector with the correct sequence.

[0094] 2.1 Preparation of Retroviruses

[0095] The revived Phoenix-ampho cell line needs to be cultured for two consecutive generations before it can be used for virus packaging. Plate it one day before transfection, using a 1×10⁶ mcg culture medium. 6 Seed cells in 6-well plates and cultured overnight; on the second day, when Phoenix-ampho cells reached approximately 70% confluence, plasmid transfection was performed. The transfection procedure was as follows: Prepare Opti-MEM / DNA mixtures (0.25 mL per well) in 1.5 mL EP tubes: Opti-MEM 125 μL + SFG core plasmid 2.5 μg + P3000 5 μL; and Opti-MEM / Lipo3000 mixtures: Opti-MEM 125 μL + Lipo3000 7.5 μL. After mixing, let stand at room temperature for 5 min. Slowly add the Opti-MEM / Lipo3000 mixture to the Opti-MEM / DNA mixture and let stand at room temperature for 20 min. Discard 1 mL of the old culture medium, add the Lipo3000 / DNA mixture dropwise, gently shake in a "X" shape 8 times in each direction, and add 5% of the culture medium. After culturing in a CO2, 37°C, and saturated humidity incubator for 6 hours, replace with 2 mL of fresh, preheated (37°C) whole DMEM medium and continue culturing for another 48 hours. 48 hours after transfection, collect the viral supernatant, filter through a 0.45 μm filter, and store at 4°C (for up to one week) for subsequent infection.

[0096] 2.2 Preparation of Her2-CAR-NK cells from KO FAM134B

[0097] The virus was packaged using a γ-retrovirus core plasmid with a Her2-CAR structure; RetroNectin-coated plates were used one day in advance; NK cells that had been electroporated overnight in Example 3 were mixed with 1 mL of γ-retrovirus supernatant and 0.5 mL of RPMI 1640 medium containing only FBS and P / S, gently pipetted to mix, and then added to the coated plates at 5 × 10⁶ wells per well. 5 Cells were collected; after sealing with a sealing film, the cells were centrifuged at 32℃ and 3000 rpm for 90 min; the sealing film was removed, and the cells were placed in a cell culture incubator for 24 h; the culture medium was replaced with fresh RPMI 1640 complete medium containing IL-2 (200 IU / mL), and the cells were cultured for another 48 h; the CAR positivity rate of CAR NK cells was detected by flow cytometry using an antibody that recognizes the HA tag. The results are as follows: Figure 11As shown, Control KO Her2-CAR-NK cells (Control-KO-Her2-CAR-NK cells) and FAM134B KO CAR-NK cells (FAM134B-KO-Her2-CAR-NK cells) exhibit similar CAR expression, indicating that Control-KO-Her2-CAR-NK cells and FAM134B-KO-Her2-CAR-NK cells were successfully prepared. Cells were observed every 2–3 days, and the cell density was adjusted to 1 × 10⁶ cells by replenishing with RPMI 1640 complete medium containing IL-2 (200 IU / mL). 6 / mL.

[0098] 3. In vitro functional evaluation of FAM134B-KO-Her2-CAR-NK cells

[0099] 3.1 Validation of in vitro killing function

[0100] After detecting the expression level of CAR on the surface of NK cells, the number of effector cells required for different effector-to-target ratios (the ratio of effector cells (E) to target cells (T) (E:T), 2:1, 1:1, 1:2, 1:4, 1:8, 1:16, 1:32) was calculated based on the positive rate. A blank group with no effector cells and only target cells was also set up. After co-culturing effector cells and target cells in a 37℃ cell culture incubator for 24 h, 100 μL of D-luciferin substrate (1.5 mg / mL) was added to each well. The chemiluminescence of each well was detected using an ELISA reader, and the killing efficiency of effector cells was calculated as (1 - experimental group / blank group) × 100. Figure 12 The results showed that FAM134B-KO-Her2-CAR-NK cells had a higher killing efficiency than Control-KO-Her2-CAR-NK cells without FAM134B knockout.

[0101] Example 6: Construction of CD19 CAR vector overexpressing FAM134B

[0102] Synthesized P2A-FAM134B gene expression sequence (GenScript Biotechnology), P2A sequence is:

[0103] GGATCTGGAGCAACAAACTTCTCACTACTCAAACAAGCAGGTGACGTGGAGGAGAATC CCGGCCCC(SEQ ID NO.7); The expression sequence of FAM134B is:

[0104]

[0105]

[0106] Using this sequence as a template, the P2A-FAM134B gene fragment was amplified by PCR using the forward primer: AGAATCCCGGCCCCATGGCGAGCCCGGCGCCTCC (SEQ ID NO. 9); and the reverse primer: AATTGGACTAATCCGGATCCTTAATGGCCTCCCAGCAGAT (SEQ ID NO. 10). The existing CD19CAR-P2A gene fragment and the amplified P2A-FAM134B gene fragment were then ligated via homologous recombination to obtain the CD19CAR-P2A-FAM134B gene fragment. The SFG retroviral vector was then digested with enzymes and ligated with the constructed CD19CAR-P2A-FAM134B gene fragment. The fragment was then transformed, clones were selected, plasmids were extracted, and sequencing was performed to obtain a CD19 CAR retroviral vector that correctly overexpressed FAM134B.

[0107] Example 7: Preparation of anti-CD19 CAR-T cells overexpressing FAM134B

[0108] 1. Preparation of CD19 CAR-T cells from OE FAM134B

[0109] The virus was packaged using a γ-retroviral core plasmid containing the CD19 CAR-P2A-FAM134B gene fragment; RetroNectin-coated plates were prepared one day in advance; human primary T cells stimulated with CD3 / CD28 dynabeads for 48 hours were mixed with 1 mL of γ-retroviral supernatant and 0.5 mL of X-VIVO15 medium containing only FBS and P / S, gently pipetted to mix, and then added to the coated plates at 5 × 10⁶ wells per well. 5 Cells were collected; after sealing with a sealing film, the cells were centrifuged at 32℃ and 3000 rpm for 90 min; the sealing film was removed, and the cells were placed in a cell culture incubator for 24 h; the culture medium was replaced with fresh X-VIVO15 complete medium containing IL-7 and IL-15, and the cells were cultured for another 48 h; the CAR positivity rate of CD19 CAR T cells was detected by flow cytometry using IgG to recognize CD19 CAR molecules. The results are as follows: Figure 13As shown, Control OE CD19-CAR-T cells (Control-OE-CD19-CAR-T cells) and FAM134B OE CD19-CAR-T cells (FAM134B-OE-CD19-CAR-T cells) exhibit similar CAR expression, indicating that Control-OE-CD19-CAR-T cells and FAM134B-OE-CD19-CAR-T cells were successfully prepared. Cells were observed every 2-3 days, and the cell density was adjusted to 1×10⁶ cells by replenishing with X-VIVO15 complete culture medium containing cytokines. 6 / mL.

[0110] 2. In vitro functional evaluation of FAM134B-OE-CD19-CAR-T cells

[0111] 2.1 Validation of in vitro killing function

[0112] After detecting the expression level of CAR on the surface of T cells, the number of effector cells required for different effector-to-target ratios (the ratio of effector cells (E) to target cells (T) (E:T), 2:1, 1:1, 1:2, 1:4, 1:8, 1:16, 1:32) was calculated based on the positive rate. A blank group with no effector cells and only target cells was also set up. After co-culturing effector cells and target cells in a 37℃ cell culture incubator for 24 h, 100 μL of D-luciferin substrate (1.5 mg / mL) was added to each well. The chemiluminescence of each well was detected using an ELISA reader, and the killing efficiency of effector cells was calculated as (1 - experimental group / blank group) × 100. Figure 14 The results showed that after co-culturing for 24 h, the killing efficiency of FAM134B-OE-CD19-CAR-T cells, as effector cells, was lower than that of Control-OE-CD19-CAR-T cells without FAM134B knockout.

[0113] Example 8: Preparation of anti-CD19 CAR-NK cells overexpressing FAM134B

[0114] 1. Preparation of CD19 CAR-NK cells from OE FAM134B

[0115] The virus was packaged using the γ-retroviral core plasmid containing the CD19 CAR-P2A-FAM134B gene fragment prepared in Example 6; RetroNectin-coated plates were prepared one day in advance; human primary NK cells stimulated with K562-2+ feeder cells for 96 hours were taken, and a mixture of 1 mL of γ-retroviral supernatant and 0.5 mL of RPMI 1640 medium containing only FBS and P / S was added, gently pipetting to mix, and then added to the coated plates at 5 × 10⁶ wells. 5Cells were collected; after sealing with a sealing film, the cells were centrifuged at 32℃ and 3000 rpm for 90 min; the sealing film was removed, and the cells were placed in a cell culture incubator for 24 h; the culture medium was replaced with fresh RPMI 1640 complete medium containing IL-2 (200 IU / mL), and the cells were cultured for another 48 h; the CAR positivity rate of CD19 CAR NK cells was detected by flow cytometry using IgG-recognized CD19 CAR molecules. The results are as follows: Figure 15 As shown, Control OE CD19-CAR-NK cells (Control-OE-CD19-CAR-NK cells) and FAM134B OE CD19-CAR-NK cells (FAM134B-OE-CD19-CAR-NK cells) exhibit similar CAR expression, indicating that Control-OE-CD19-CAR-NK cells and FAM134B-OE-CD19-CAR-NK cells were successfully prepared. Cells were observed every 2-3 days, and the cell density was adjusted to 1×10⁶ cells by replenishing the medium with RPMI 1640 complete culture medium containing cytokines. 6 / mL.

[0116] 2. In vitro functional evaluation of FAM134B-OE-CD19-CAR-NK cells

[0117] 2.1 Validation of in vitro killing function

[0118] After detecting the expression level of CAR on the surface of NK cells, the number of effector cells required for different effector-to-target ratios (the ratio of effector cells (E) to target cells (T) (E:T), 2:1, 1:1, 1:2, 1:4, 1:8, 1:16, 1:32) was calculated based on the positive rate. A blank group with no effector cells and only target cells was also set up. After co-culturing effector cells and target cells in a 37℃ cell culture incubator for 24 h, 100 μL of D-luciferin substrate (1.5 mg / mL) was added to each well. The chemiluminescence of each well was detected using an ELISA reader, and the killing efficiency of effector cells was calculated as (1 - experimental group / blank group) × 100. Figure 16 The results showed that after co-culturing for 24 h, the killing efficiency of FAM134B-OE-CD19-CAR-NK cells, as effector cells, was lower than that of Control-OE-CD19-CAR-NK cells without FAM134B knockout.

[0119] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An immune cell that enhances anti-tumor efficacy based on autophagy-related gene regulation, characterized in that, The immune cells contain a gene regulatory system capable of reducing the expression and / or function of the phagocytosis-related gene FAM134B within the immune cells, wherein reducing the expression and / or function of the phagocytosis-related gene FAM134B within the immune cells enhances the effector function of the immune cells.

2. The immune cells according to claim 1, characterized in that, The gene regulation system comprises at least one gRNA molecule that targets FAM134B, and the gRNA molecule that targets FAM134B targets the exon region of FAM134B.

3. The immune cells according to claim 2, characterized in that, The nucleotide sequence of the gRNA molecule targeting FAM134B is shown in SEQ ID NO.

1.

4. The immune cells according to claim 1, characterized in that, The gene regulation system is introduced into the immune cells via microfluidic devices through transfection, transduction, electroporation, or physical disruption of the cell membrane.

5. The immune cells according to claim 1, characterized in that, The chimeric antigen receptor of the immune cell includes an antigen-binding domain and a non-antigen-binding domain, wherein the non-antigen-binding domain includes the extracellular domain, transmembrane domain, and intracellular co-stimulatory domain of CD28 or functional variants thereof, and the signal transduction domain of CD3ζ or functional variants thereof.

6. The immune cell according to claim 1, characterized in that, The immune cells include T cells, B cells, natural killer cells, macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and / or peripheral blood mononuclear cells.

7. The immune cells according to any one of claims 1-6, characterized in that, The immune cells are autologous, allogeneic, or heterologous.

8. A method for preparing immune cells based on autophagy-related gene regulation to enhance anti-tumor efficacy as described in any one of claims 1-7, characterized in that, include: Immune cells were obtained from the subjects; Introducing a gene regulatory system into immune cells, wherein the gene regulatory system is capable of reducing the expression and / or function of the endogenous autophagy-related gene FAM134B; and The immune cells were cultured such that the expression and / or function of FAM134B was reduced compared to unmodified immune effector cells.

9. Use of the immune cells according to any one of claims 1-7 that enhance anti-tumor efficacy based on autophagy-related gene regulation in the preparation of a medicament for the treatment / prevention / diagnosis of cancer or tumors, infections or autoimmune diseases.

10. The use according to claim 9, characterized in that, The cancers or tumors mentioned include one or more of the following: glioblastoma, head and neck cancer, lung cancer, thyroid cancer, bronchial cancer, breast cancer, stomach cancer, liver cancer, pancreatic cancer, colon cancer, colorectal cancer, kidney cancer, bladder cancer, cervical cancer, uterine cancer, ovarian cancer, prostate cancer, skin cancer, melanoma, lymphoma, and leukemia.

Images