Clostridium autoethanogenum mutant strain with alcohol-aldehyde dehydrogenase knocked out and application thereof in reducing reverse absorption of ethanol product in one-carbon gas fermentation process

By knocking out the alcohol-aldehyde dehydrogenase gene in Clostridium ethanolae through gene editing, the reverse absorption of ethanol is blocked, which solves the problem of decreased ethanol concentration during Clostridium ethanolae fermentation and improves ethanol yield and production efficiency.

CN122445679APending Publication Date: 2026-07-24BEIJING SHOUGANG LANZATECH TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING SHOUGANG LANZATECH TECH CO LTD
Filing Date
2026-06-10
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

During Clostridium ethanolans fermentation, the ethanol concentration in the storage tank continuously decreases, resulting in a loss of ethanol production. Existing methods cannot completely solve this problem and increase production costs.

Method used

By knocking out the alcohol-aldehyde dehydrogenase gene on the chromosome of Clostridium ethanolae using gene editing technology, the reverse ethanol absorption pathway is blocked, and a Clostridium ethanolae mutant strain is constructed to reduce ethanol loss during fermentation and storage.

Benefits of technology

It significantly improved ethanol yield, reduced carbon source loss, and enhanced production economic efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122445679A_ABST
    Figure CN122445679A_ABST
Patent Text Reader

Abstract

The embodiment of the present application discloses a Clostridium ethanoligenes mutant with alcohol-aldehyde dehydrogenase knocked out and application thereof in reducing reverse absorption of ethanol product in one-carbon gas fermentation process, and belongs to the technical field of biotechnology. In the process of producing ethanol and microbial protein by Clostridium ethanoligenes using one-carbon gas fermentation, the reverse absorption phenomenon of product ethanol, the alcohol-aldehyde dehydrogenase (Adh, Alcohol dehydrogenase) on the chromosome of Clostridium ethanoligenes is knocked out by gene editing means, so as to reduce or completely block the reverse absorption pathway of ethanol, reduce the loss of ethanol in the fermentation process and in the wort storage tank, and help to improve the ethanol yield, reduce the waste of carbon source and improve the enterprise income.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to an ethanol Clostridium mutant strain with aldehyde dehydrogenase knocked out and its application in reducing the reverse absorption of ethanol products during one-carbon gas fermentation. Background Technology

[0002] Clostridium autoethanogenum has been successfully applied to commercial-scale production, utilizing purified steel industry tail gas, ferroalloy tail gas, or syngas containing carbon monoxide, carbon dioxide, and hydrogen as a single carbon source. The main products include ethanol, isopropanol, acetone, and microbial protein. Common fermentation processes for producing ethanol and microbial protein using Clostridium autoethanogenum typically employ a continuous fermentation model. By controlling the inflow of nutrient-rich culture medium and the outflow of mash containing bacterial protein and fermentation products, overall liquid level balance and stable cell and metabolite concentrations are maintained. Ethanol concentrations are typically between 30-50 g / L, and biomass is typically between 15-20 g / L. Finally, ethanol and microbial protein are separated and extracted from the continuously discharged mash. Depending on production intensity, when mash output exceeds the distillation unit's capacity, excess mash is received in a temporary storage tank, serving as a buffer for overall liquid balance.

[0003] Long-term observations have revealed that the ethanol concentration in mash storage tanks continuously decreases with prolonged storage time, leading to a loss of ethanol production. Although methods such as high-temperature sterilization of bacteria or low-temperature treatment of the mash can reduce ethanol loss in storage tanks to some extent, they cannot completely solve the problem of declining ethanol concentration, and are accompanied by a significant increase in production costs. Summary of the Invention

[0004] The applicant explored the root cause of the decrease in ethanol concentration at the genetic level of Clostridium ethanolans, fully analyzed its physiological activity mechanism, and then used gene editing to completely block the relevant metabolic processes at the genetic level. This can fundamentally solve the problem of decreased ethanol concentration in mash storage tanks, reduce unnecessary losses in ethanol production, and improve production efficiency.

[0005] Therefore, embodiments of the present invention provide an ethanol Clostridium mutant strain and its application.

[0006] To achieve the above objectives, the embodiments of the present invention provide the following technical solutions:

[0007] According to a first aspect of the present invention, the present invention provides a method for constructing a Clostridium ethanolica mutant strain, using wild-type Clostridium ethanolica as the starting strain, and knocking out the gene encoding an alcohol-aldehyde dehydrogenase that has stronger catalytic activity in the reaction from ethanol to acetaldehyde.

[0008] Furthermore, the wild-type Clostridium ethanolae is C. autoethanogenum DSM 10061.

[0009] Further, the aldol dehydrogenase encoding genes are: CAETHG_0410, CAETHG_0555, CAETHG_1078, CAETHG_1500, CAETHG_1813, CAE THG_1841, CAETHG_2445, CAETHG_3279, CAETHG_3604, CAETHG_3954, CAETHG_3747, CAETHG_3748.

[0010] According to a second aspect of the present invention, the present invention provides a Clostridium ethanolae mutant strain, which is constructed by the method described in any of the preceding claims.

[0011] According to a third aspect of the present invention, the present invention provides the application of the Clostridium ethanolivirus mutant strain described above in reducing the reverse absorption of ethanol products during carbon-1 gas fermentation.

[0012] According to a fourth aspect of the present invention, the present invention provides a method for reducing the reverse absorption of ethanol products in a carbon-1 gas fermentation process. The ethanol Clostridium mutant strain described above is cultured in YTF medium to the exponential phase, inoculated and transferred to a reactor containing the medium, and continuously anaerobic fermentation is carried out using CO-containing tail gas from the iron and steel industry as the raw material gas.

[0013] Furthermore, the YTF culture medium is composed of: 10 g / L yeast extract, 10 g / L peptone (16 g / L), 10 g / L fructose (10 g / L), 1 g / L cysteine, and pH 5.5-6.0.

[0014] The culture medium consists of: yeast extract 1-5 g / L, ammonium sulfate 1-10 g / L, magnesium sulfate 1-5 g / L, potassium dihydrogen phosphate 1-2 g / L, L-cysteine ​​0.5-1 g / L, ferrous sulfate 5-10 mg / L, manganese sulfate 5-10 mg / L, folic acid 1-2.0 mg / L, pyridoxine hydrochloride 5-10 mg / L, riboflavin 1-5 mg / L, biotin 1-2 mg / L, thiamine 1-5 mg / L, niacin 1-5 mg / L, calcium pantothenate 1-5 mg / L, vitamin B12 0.1-0.5 mg / L, para-aminobenzoic acid 1-5 mg / L, and lipoic acid 1-5 mg / L.

[0015] Furthermore, the volumetric composition of the exhaust gas from the steel industry is: 40-50% CO, 20-30% N2, and 20-30% CO2.

[0016] Furthermore, the conditions for the anaerobic fermentation culture are: inoculum size 10%-25%, 30-37℃, pH 5.0-6.0.

[0017] The embodiments of the present invention have the following advantages:

[0018] This invention addresses the problem of reverse ethanol absorption during the fermentation of ethanol and microbial protein by Clostridium ethanolii using carbon gas. By using gene editing technology to knock out the Alcohol Dehydrogenase (Adh) gene on the Clostridium ethanolii chromosome, the reverse ethanol absorption pathway is weakened or completely blocked, reducing ethanol loss during fermentation and mash storage, thereby increasing ethanol yield, reducing carbon source loss, and increasing economic benefits. Attached Figure Description

[0019] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other embodiments based on the provided drawings without creative effort.

[0020] Figure 1 The experimental flowchart provided for this invention;

[0021] Figure 2 The effect of initial addition of different concentrations of ethanol on the reverse absorption of ethanol by wild-type Clostridium ethanolii strain DSM 10061, which is provided for the present invention;

[0022] Figure 3 A comparison of reverse ethanol absorption between the mutant strain M1 provided by this invention and the wild-type strain DSM 10061 at initial ethanol concentrations of (a) 20 g / L and (b) 30 g / L;

[0023] Figure 4 The fermentation curves of the mutant strain M1 and the wild-type strain DSM 10061 in a 3 L reactor using tail gas from the steel industry are shown. Detailed Implementation

[0024] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1: Growth test of wild-type Clostridium ethanolans using ethanol as the sole carbon source

[0026] Wild-type Clostridium autoethanogenum DSM 10061 (derived from DSMZ) was placed in an anaerobic incubator and cultured anaerobically to the exponential phase using YTF medium (10 g / L yeast extract, 16 g / L peptone, 10 g / L fructose, 1 g / L cysteine, pH 5.5). OD... 600 =0.6, and transferred at a 10% inoculum to fresh fructose-free YT medium (10 g / L yeast extract, 16 g / L peptone, 1 g / L cysteine, pH 5.5). Ethanol was added to each group at the same time as inoculation, with final ethanol concentrations of 0 g / L, 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, 70 g / L, and 80 g / L, respectively. A control group was prepared with fructose added at a final concentration of 10 g / L. All groups were anaerobically cultured at 37℃ for 72-144 h, and cell growth and changes in ethanol concentration were observed.

[0027] The results showed that in YTF medium without fructose, no significant cell growth was observed regardless of whether ethanol was added, nor was there any decrease in ethanol concentration. However, in the control group with 10 g / L fructose, the cells grew normally. This indicates that Clostridium ethanolans cannot use ethanol as the sole carbon source for growth.

[0028] Example 2: Whole-cell catalytic reverse absorption test of ethanol by wild-type Clostridium ethanolii

[0029] Wild-type *C. autoethanogenum* DSM 10061 was cultured in YTF medium in an anaerobic incubator to the exponential phase. After centrifugation, the supernatant was discarded, and the cells were collected. The cells were washed at least three times with PBS buffer (pH 6.0) and finally resuspended to prepare OD. 600 The concentrated bacterial suspension with a concentration of 10 was divided into groups, and ethanol was added to each group. The final ethanol concentrations were 0 g / L, 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, 70 g / L, and 80 g / L. The groups were then anaerobic cultured at 37℃ for 72 h to observe the changes in ethanol concentration.

[0030] The results showed that no decrease in ethanol concentration was observed in any group after culture. This indicates that cells pre-cultured in YTF medium without ethanol do not have the ability to reverse absorb ethanol. It is speculated that enzymes related to reverse ethanol absorption behavior need to be expressed in large quantities under certain ethanol induction conditions to enable cells to acquire the ability to reverse absorb ethanol.

[0031] Example 3: Test on reverse ethanol uptake during fructose growth of wild-type Clostridium ethanolii

[0032] Wild-type Clostridium autoethanogenum DSM 10061 was cultured in an anaerobic incubator using YTF medium to the exponential phase, OD... 600 =0.6, and transferred to fresh YTF medium at a 10% inoculum. At the same time as inoculation, ethanol was added to each group at final concentrations of 0 g / L, 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, 70 g / L, and 80 g / L, respectively. The cells were cultured at 37℃ for 72 h to observe cell growth and changes in ethanol concentration.

[0033] The results are as follows Figure 2 As shown, when the initial ethanol concentration exceeded 20 g / L, the ethanol concentration decreased by approximately 0.3-1.5 g / L after 72 h of cultivation, indicating that ethanol concentrations exceeding 20 g / L activate the reverse ethanol uptake behavior of Clostridium ethanolii.

[0034] Example 4: Construction of a chromosome knockout aldehyde dehydrogenase mutant strain of wild-type Clostridium ethanolae

[0035] According to annotations from databases such as KEGG and NCBI, wild-type Clostridium autoethanogenum The DSM10061 chromosome contains 12 genes that may be related to the synthesis or reverse absorption of ethanol: CAETHG_0410 (encoding iron-containing alcohol dehydrogenase), CAETHG_0555 (encoding iron-containing alcohol dehydrogenase), CAETHG_1078 (encoding iron-containing alcohol dehydrogenase), CAETHG_1500 (encoding iron-containing alcohol dehydrogenase), CAETHG_1813 (encoding iron-containing alcohol dehydrogenase), CAETHG_1841 (encoding iron-containing alcohol dehydrogenase), CAETHG_2445 (encoding iron-containing alcohol dehydrogenase), CAETHG_3279 (encoding iron-containing alcohol dehydrogenase), CAETHG_3604 (encoding iron-containing alcohol dehydrogenase), CAETHG_3954 (encoding iron-containing alcohol dehydrogenase), CAETHG_3747 (encoding aldehyde-coagulant A / ethanol bifunctional dehydrogenase), and CAETHG_3748 (encoding aldehyde-coagulant A / ethanol bifunctional dehydrogenase). This study used the CRISPR / Cas9 gene editing system to knock out one or more of the target genes mentioned above, which can construct Clostridium ethanolica mutant strains with partial or complete inactivation of alcohol-aldehyde dehydrogenase function.

[0036] This embodiment uses the knockout of adjacent CAETHG_3747 and CAETHG_3748 on chromosomal DNA as an example to illustrate the method of constructing mutant strains.

[0037] Using a gene-editing vector carrying constitutive CRISPR / Cas9 that is stably inherited in Clostridium ethanolae, a 20 nt sgRNA sequence (5'-AACAAGTGGATGAAATTTTC (SEQ ID No. 1)-3') was obtained via DNA sequence synthesis and ligated upstream of a gRNA scaffold (5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID No. 2)-3'). This fusion fragment was generated by the Clostridium ethanolae lactose-inducible promoter P. bgaL Induced expression.

[0038] The upstream homologous arm of 1000 bp was amplified by PCR using primers CAETHG_3747-F (5'-TACTCAAGAACAAGTGGATGAAATTTTTAG (SEQ ID No. 3)-3') and CAETHG_3747-R (5'-tgtatctggtCCTAACCAGTTTATCAGTTTTTGCA (SEQ ID No. 4)-3'); the downstream homologous arm of 1000 bp was amplified by PCR using primers CAETHG_3748-F (5'-actggttaggACCAGATACAATTATAGCAGTTGGTGGT (SEQ ID No. 5)-3') and CAETHG_3748-R (5'-CTTCTCCACAGTTGCCTTTGGTGTA (SEQ ID No. 6)-3'); and the downstream homologous arm of 1000 bp was amplified by PCR using primers CAETHG_3747-F and CAETHG_3748-R. PCR yielded a complete homologous arm sequence of 2000 bp.

[0039] Using E. coli CA434 as a DNA donor, the above-mentioned tool vector was transformed into Clostridium ethanolica cells via conjugation transfer. Guide RNA expression was induced using lactose at a final concentration of 40 mM. The DNA length changes at the CAETHG_3747 and CAETHG_3748 gene sites on the chromosome were identified by PCR using primers ID-3747-F (5'-AAAAATTAGGAAAGAGGTGTCGCTA (SEQ ID No. 7)-3') and ID-3748-R (5'-GCTTTTCTTTGCATAGGATCAAGAT (SEQ ID No. 8)-3'). The PCR amplification product of the wild-type strain was 5614 bp in length, while the PCR amplification product of the mutant strain was 2314 bp in length. The mutant strain was named C. autoethanogenum M1.

[0040] P bgaL The promoter's nucleotide sequence is (5'-3'):

[0041]

[0042] Example 5: A test of reverse ethanol uptake during fructose growth using an ethanol mutant strain with aldehyde dehydrogenase knocked out.

[0043] The mutant strain C. autoethanogenum M1 was cultured in YTF medium in an anaerobic incubator until the exponential phase. It was then transferred to fresh YTF medium at a 10% inoculum. At the same time as inoculation, ethanol was added to each group at final concentrations of 0 g / L, 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, 40 g / L, 50 g / L, 60 g / L, 70 g / L, and 80 g / L, respectively. The cells were anaerobically cultured at 37℃ for 120 h to observe cell growth and changes in ethanol concentration.

[0044] See results Figure 3 After 120 h of culture, no decrease in ethanol concentration was observed in the mutant group. Conversely, the wild-type strain exhibited significant reverse ethanol uptake activity at ethanol concentrations of 20 g / L and 30 g / L. This indicates that the reverse ethanol uptake behavior of Clostridium ethanolans mutants with knocked-out aldehyde dehydrogenase was significantly weakened or completely blocked.

[0045] Example 6: Performance Comparison of Ethanol Production from Steel Industry Waste Gas in a 3 L Fermenter

[0046] The mutant strain *C. autoethanogenum* M1 and the wild-type strain *C. autoethanogenum* DSM 10061 were cultured separately in YTF medium to the exponential phase. They were then transferred at a 10% inoculum to a 3 L reactor (medium composition: yeast extract 5.0 g / L, ammonium sulfate 10.0 g / L, magnesium sulfate 5.0 g / L, potassium dihydrogen phosphate 2.0 g / L, L-cysteine ​​1.0 g / L, ferrous sulfate 10.0 mg / L, manganese sulfate 10.0 mg / L, folic acid 2.0 mg / L, pyridoxine hydrochloride 10.0 mg / L, riboflavin 5.0 mg / L, biotin 2.0 mg / L, thiamine 5.0 mg / L, niacin 5.0 mg / L, calcium pantothenate 5.0 mg / L, vitamin B12 0.1 mg / L, para-aminobenzoic acid 5.0 mg / L, lipoic acid 5.0 mg / L), using 50% iron and steel industry exhaust gas. CO, 30% N2 and 20% CO2) were used as feed gases, and continuous fermentation was carried out at 37°C and pH 5.0. The inflow rate of fresh nutrient solution increased with the increase of cell growth rate and product synthesis rate, and the concentration of ethanol product was detected periodically.

[0047] The results show that ( Figure 4In the early stage of fermentation, the growth and metabolic trends of mutant strain M1 and wild-type strain DSM 10061 were similar. When the ethanol concentration accumulated to about 20 g / L (about 18 days), the biomass of M1 increased slightly compared with DSM 10061, and the ethanol production of M1 was significantly higher than that of DSM 10061, by about 10%.

[0048] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for constructing an ethanol-producing Clostridium mutant strain, characterized in that, Using wild-type Clostridium ethanolii as the starting strain, the gene encoding aldehyde dehydrogenase, which has stronger catalytic activity in the reaction from ethanol to acetaldehyde, was knocked out.

2. The method for constructing the Clostridium ethanolae mutant strain according to claim 1, characterized in that, The wild-type Clostridium ethanolae was identified as C. autoethanogenum DSM 10061.

3. The method for constructing the Clostridium ethanolae mutant strain according to claim 1, characterized in that, The aldol dehydrogenase encoding genes are: CAETHG_0410, CAETHG_0555, CAETHG_1078, CAETHG_1500, CAETHG_1813, CAETH G_1841, CAETHG_2445, CAETHG_3279, CAETHG_3604, CAETHG_3954, CAETHG_3747, CAETHG_3748.

4. A Clostridium ethanolae mutant strain, characterized in that, It is constructed by the method as described in any one of claims 1-3.

5. The application of the Clostridium ethanolica mutant strain according to claim 4 in reducing the reverse absorption of ethanol products during carbon-1 gas fermentation.

6. A method for reducing the reverse absorption of ethanol products during carbon-1 gaseous fermentation, characterized in that, The Clostridium ethanolica mutant strain described in claim 4 was cultured in YTF medium to the exponential phase, then inoculated and transferred to a reactor containing the medium, and continuously anaerobic fermented using CO-containing tail gas from the iron and steel industry as the raw material gas.

7. The method according to claim 6, characterized in that, The YTF culture medium consists of: 10 g / L yeast extract, 10 g / L peptone (16 g / L), 10 g / L fructose (10 g / L), and 1 g / L cysteine, with a pH of 5.5-6.

0. The culture medium consists of: yeast extract 1-5 g / L, ammonium sulfate 1-10 g / L, magnesium sulfate 1-5 g / L, potassium dihydrogen phosphate 1-2 g / L, L-cysteine ​​0.5-1 g / L, ferrous sulfate 5-10 mg / L, manganese sulfate 5-10 mg / L, folic acid 1-2.0 mg / L, pyridoxine hydrochloride 5-10 mg / L, riboflavin 1-5 mg / L, biotin 1-2 mg / L, thiamine 1-5 mg / L, niacin 1-5 mg / L, calcium pantothenate 1-5 mg / L, vitamin B12 0.1-0.5 mg / L, para-aminobenzoic acid 1-5 mg / L, and lipoic acid 1-5 mg / L.

8. The method according to claim 6, characterized in that, The volumetric composition of the exhaust gas from the steel industry is: 40-50% CO, 20-30% N2, and 20-30% CO2.

9. The method according to claim 6, characterized in that, The conditions for the anaerobic fermentation culture are: inoculum size 10%-25%, 30-37℃, pH 5.0-6.0.