Method for expressing and purifying a ferritin in bacillus subtilis

By screening expression elements and modifying chassis strains in Bacillus subtilis WB600 and optimizing induction conditions, efficient secretory expression and purification of ferritin were achieved, solving the safety and long production cycle problems of existing technologies and promoting the application of ferritin in the food industry.

CN122445680APending Publication Date: 2026-07-24TIANJIN UNIV OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TIANJIN UNIV OF SCI & TECH
Filing Date
2026-05-06
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

In existing technologies, heterologous expression systems for ferritin have problems such as safety risks, long production cycles, and high costs, which limit their application in the food and health product fields. Furthermore, expression systems based on Escherichia coli and Pichia pastoris have problems with pathogenicity and excessively long fermentation cycles.

Method used

Using food-grade Bacillus subtilis strain WB600 as the host, we achieved efficient secretory expression of ferritin from Litopenaeus japonicus and H-2 type soybean ferritin through expression element screening, chassis strain modification, and optimization of induction conditions. Specific measures included promoter screening, signal peptide screening, dltD gene knockout, and csaA molecular chaperone gene overexpression, followed by protein purification.

Benefits of technology

This study achieved efficient secretory expression and purification of ferritin, improved the protein expression and purification yield, ensured the typical structure and functional properties of the protein, and promoted the industrial application of ferritin in the food industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122445680A_ABST
    Figure CN122445680A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and discloses a ferritin expression and purification method in bacillus subtilis, wherein the food safety level strain bacillus subtilis WB600 is used as a host, and the synergistic regulation of expression element (promoter, signal peptide) screening, bottom strain (dltD gene knockout, csaA molecular chaperone gene overexpression) modification and induction condition (induction time, temperature, IPTG concentration) optimization is used to successfully realize the high-efficiency secretory expression of Japanese capsule prawn ferritin (MjFer) and H-2 type soybean ferritin (H-2). The transmission electron microscope and dynamic light scattering analysis prove that the two proteins both retain the typical cage structure of ferritin, and the iron oxidation precipitation and reduction release experiment proves that the two proteins retain the basic iron oxidation precipitation and reduction release characteristics of ferritin, which is helpful for the large-scale production of ferritin in the food industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular to the study of a method for expressing and purifying ferritin in Bacillus subtilis and its physicochemical properties. Background Technology

[0002] Ferritin is a class of iron storage and detoxification proteins widely found in animals, plants, and microorganisms. It can store large amounts of highly soluble, non-toxic, and bioavailable iron, and also plays a role in regulating the body's iron metabolism balance. Currently, the heterologous expression system for ferritin production still faces many unresolved issues. First, a core requirement for heterologous ferritin expression in genetic engineering is screening suitable, safe, food-grade host bacteria. Although *E. coli* has been commonly used as an expression host in previous laboratory studies, it is not an ideal food-grade strain. Its potential pathogenicity and metabolic byproducts limit the application and transformation of ferritin in food, health products, and other fields. Second, some commonly used heterologous expression systems suffer from excessively long ferritin production cycles. For example, the Pichia pastoris expression system, with its long fermentation cycle, not only increases energy consumption and costs but may also reduce production efficiency, affecting the feasibility of large-scale production. Therefore, selecting generally recognized as safe (GRAS) host bacteria for heterologous ferritin expression is of great significance.

[0003] There are already reports on recombinant expression of ferritin. For example, Zhang et al. expressed bovine ferritin in *E. coli* BL21 using the vector pET30a; Lee et al. expressed and purified human H-ferritin and L-ferritin from *Pichia pastoris* strain GS115. However, the fermentation cycle of the *Pichia pastoris* expression system is relatively long, which increases production energy consumption and cost, reduces production efficiency, and is not conducive to large-scale production. *Bacillus subtilis* (… Bacillus subtilis Bacillus subtilis is a food-grade bacterial strain with excellent characteristics such as a clear genetic background, rapid growth rate, and no endotoxin secretion. Coupled with its mature gene manipulation system and strong extracellular secretion capacity, it has been widely used in the industrial production of various chemical products and recombinant functional proteins. Currently, gene manipulation techniques and efficient expression systems for it have been developed by various parties, and it is used as a powerful chassis cell to produce a variety of heterologous proteins. Meanwhile, Bacillus subtilis has a clear genetic background and a relatively mature set of gene manipulation methods, allowing for corresponding metabolic modifications through the application of various gene editing systems and synthetic biology tools. B. subtilis Common strategies for expressing heterologous proteins include screening and optimizing expression elements such as promoters, ribosome binding sites, signal peptides, and codons, as well as overexpressing chaperone proteins to enhance protein folding and secretion.

[0004] The purpose of this invention is to achieve heterologous expression of Marsupenaeus japonicus ferritin (MjFer) and Soybean seed H-2 subunit ferritin (H-2) in the food-grade safe strain Bacillus subtilis. This was achieved by selecting three promoters, with the optimal promoter P... grac Based on the expression vector, ten signal peptides, encompassing both natural and artificially optimized signal peptides, were further screened. CRISPR-Cas9 gene editing technology was used to overexpress the chaperone protein-related gene csaA, and the effect of dltD gene knockout on protein expression was investigated. Simultaneously, the induction expression conditions of the recombinant strain were systematically optimized, and the microstructure and physicochemical properties of the two recombinant proteins were analyzed using transmission electron microscopy, dynamic light scattering, and oxidative precipitation and reductive release experiments. The aim is to utilize Bacillus subtilis for the expression and purification of ferritin, thereby promoting the industrial application of ferritin in the food industry.

[0005] A search revealed no patent publications related to this invention's patent application. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for expressing and purifying ferritin in Bacillus subtilis and its application.

[0007] The technical solution adopted by this invention to solve its technical problem is: A method for expressing and purifying ferritin in Bacillus subtilis, using food-grade Bacillus subtilis strain WB600 as the host, achieves efficient secretory expression of Penaeus japonicus ferritin MjFer and H-2 type soybean ferritin H-2 through synergistic regulation of expression element screening, chassis strain modification, and induction condition optimization; the expression element screening includes promoter screening and signal peptide screening; the chassis strain modification includes dltD gene knockout and csaA molecular chaperone gene overexpression; and the induction condition optimization includes optimization of induction time, induction temperature, and IPTG concentration.

[0008] Furthermore, the promoter selection employs an induced promoter P. grac ; Alternatively, the signal peptide screening is performed using the ybdN signal peptide, and the purification yields of 6His-MjFer and 6His-rH-2 expression guided by the ybdN signal peptide are 6.75 mg / L and 4.42 mg / L, respectively.

[0009] Furthermore, the csaA molecular chaperone gene overexpression is achieved by replacing the natural promoter of the csaA gene with the strong promoter Pc2up. Overexpression of the csaA gene increases the purification yield of 6His-MjFer expression by 42% and 6His-rH-2 expression by 24%. Alternatively, the dltD gene knockout is performed using CRISPR-Cas9 gene editing technology to knock out the dltD gene. Knocking out the dltD gene increases the expression and purification yield of 6His-MjFer by 10% and 6His-rH-2 by 40%.

[0010] Furthermore, in the optimization of the induction conditions, the induction conditions for 6His-MjFer are: IPTG concentration of 0.5 mmol / L, induction time of 24 h, and induction temperature of 30℃; the induction conditions for 6His-rH-2 are: IPTG concentration of 1.5 mmol / L, induction time of 24 h, and induction temperature of 30℃.

[0011] Furthermore, the method also includes a protein purification step, wherein the protein purification step uses NiSepHarose. TM 6. Affinity chromatography purification was performed using a gravity chromatography column filled with Fast Flow packing material.

[0012] Furthermore, the method specifically includes the following steps: (1) Promoter screening: Recombinant expression vectors containing different promoters were constructed, and the transcription level was detected by qPCR to screen for promoter P. grac ; (2) Signal peptide screening: at promoter P grac Based on this, recombinant expression vectors containing different signal peptides were constructed, and the signal peptide ybdN was screened out by Western blotting and protein quantification analysis. (3) Chassis strain modification: CRISPR-Cas9 gene editing technology was used to construct csaA overexpression strains and dltD knockout chassis strains; (4) Construction of recombinant strains: The selected strains containing promoter P grac The expression vector for the signal peptide ybdN was transformed into the modified chassis strain; (5) Induced expression: Induced expression is performed under induction conditions; (6) Protein purification: The target protein was purified by affinity chromatography.

[0013] Furthermore, the induction conditions for 6His-MjFer in step (5) are an IPTG concentration of 0.5 mmol / L, an induction time of 24 h, and an induction temperature of 30 °C; the optimal conditions for 6His-rH-2 in step (5) are an IPTG concentration of 1.5 mmol / L, an induction time of 24 h, and an induction temperature of 30 °C. A method for analyzing the physicochemical properties of ferritin obtained by the expression and purification method described above, the method comprising transmission electron microscopy (TEM) observation, dynamic light scattering (DLS) analysis, iron oxidation precipitation experiment, and reduction release experiment.

[0014] Furthermore, the transmission electron microscopy (TEM) observation showed that both recombinant 6His-MjFer and 6His-rH-2 exhibited typical cage-like structures with diameters of 12-17.5 nm. Alternatively, the dynamic light scattering DLS analysis showed that the hydration diameter of 6His-MjFer was 17.36 nm and the hydration diameter of 6His-rH-2 was 17.51 ​​nm. Alternatively, the iron oxide precipitation experiment was performed by detecting Fe at 300 nm using a UV spectrophotometer. 2+ The ferrite-bridging compound formed by oxidation, and the reduction-release experiment, were measured at 562 nm using a UV spectrophotometer [Fe(ferrozine)3]. 2+ The content reflects the Fe 3+ The restoration and release.

[0015] Furthermore, the recombinant ferritin is recombinant 6His-MjFer or recombinant 6His-rH-2, with the recombinant 6His-MjFer expression purification yield being 12.35 mg / L and the recombinant 6His-rH-2 expression purification yield being 7.01 mg / L.

[0016] The advantages and positive effects of this invention are as follows: 1. The method of this invention uses food-grade Bacillus subtilis WB600 as the host. Through the synergistic regulation of expression element (promoter, signal peptide) screening, chassis strain (dltD gene knockout, csaA molecular chaperone gene overexpression) modification and induction conditions (induction time, temperature, IPTG concentration) optimization, it has successfully achieved efficient secretory expression of ferritin (MjFer) from Litopenaeus japonicus and H-2 type soybean ferritin (H-2). The protein expression and purification yields have been increased to 12.35 mg / L and 7.01 mg / L, respectively.

[0017] 2. This invention identifies P through promoter screening. grac As the optimal promoter, compared to the constitutive promoter P 43 and P veg,Inducible promoter P grac The target protein is not expressed before reaching the logarithmic growth phase, which puts less stress on the growth of Bacillus subtilis cells. In contrast, the constitutive promoter is expressed during cell growth, which puts stress on the cells and affects their growth.

[0018] 3. This invention identified ybdN (SP6) as the optimal signal peptide through signal peptide screening. The purification yields of 6His-MjFer and 6His-rH-2 expression guided by this signal peptide were 6.75 mg / L and 4.42 mg / L, respectively, which were significantly higher than other signal peptides, effectively improving the extracellular secretion efficiency of the target protein.

[0019] 4. This invention, through chassis strain modification, overexpression of the chaperone protein gene csaA can promote the correct folding and secretion of proteins, increasing the expression and purification yield of 6His-MjFer by 42% and 6His-rH-2 by 24%; knocking out the cell wall-related gene dltD can affect the binding of cationic folding factors to the cell wall surface, increasing the expression and purification yield of 6His-MjFer by 10% and 6His-rH-2 by 40%.

[0020] 5. Through optimization of induction conditions, this invention determined that the optimal induction conditions for 6His-MjFer were 0.5 mmol / L IPTG concentration, 24 h induction time, and 30 °C, and the optimal induction conditions for 6His-rH-2 were 1.5 mmol / L IPTG concentration, 24 h induction time, and 30 °C. Under the optimal conditions, the protein expression and purification yield reached the highest level.

[0021] 6. This invention confirms through transmission electron microscopy and dynamic light scattering analysis that both recombinant 6His-MjFer and 6His-rH-2 exhibit typical cage-like structures with diameters of approximately 12 nm to 17.5 nm, possessing the core structural characteristics of ferritin. Oxidation precipitation and reduction release experiments confirm that recombinant 6His-MjFer and 6His-rH-2 maintain the oxidation precipitation and reduction release properties of MjFer and H-2, possessing the typical iron ion storage and release functions of ferritin.

[0022] 7. The recombinant ferritin prepared by the method of this invention has broad development potential and application prospects in the food additive, health product, and biopharmaceutical industries. At the same time, this method also provides a new way for the development and utilization of ferritin, and has important research significance and application prospects for improving the utilization of ferritin and developing new ferritin products.

[0023] 8. The method of this invention achieves efficient secretory expression of MjFer and H-2 in Bacillus subtilis through expression element screening, chassis strain modification, and induction condition optimization. The structure and physicochemical properties of these two proteins are analyzed, providing key technical support and theoretical basis for the large-scale co-synthesis of two ferritins in this bacterium. This invention is applicable to the expression and purification of ferritins in Bacillus subtilis, specifically involving the heterologous expression, purification, and structural and physicochemical property analysis of Litopenaeus japonicus ferritin (MjFer) and H-2 type soybean ferritin (H-2) in Bacillus subtilis.

[0024] 9. This invention belongs to the field of biotechnology and discloses a method for expressing and purifying ferritin in Bacillus subtilis. The method uses food-grade Bacillus subtilis strain WB600 as the host. Through the synergistic regulation of expression element (promoter, signal peptide) screening, chassis strain (dltD gene knockout, csaA molecular chaperone gene overexpression) modification, and optimization of induction conditions (induction time, temperature, IPTG concentration), the efficient secretory expression of Japanese tiger prawn ferritin (MjFer) and H-2 type soybean ferritin (H-2) has been successfully achieved. Transmission electron microscopy and dynamic light scattering analysis confirmed that both proteins retain the typical cage structure of ferritin. Iron oxidation precipitation and reduction release experiments confirmed that both proteins retain the basic iron oxidation precipitation and reduction release characteristics of ferritin, which is conducive to the large-scale production of ferritin in the food industry. Attached Figure Description

[0025] Figure 1 This is a schematic diagram of plasmid construction in this invention; wherein, a: schematic diagram of pHK01-P-SP-6His-MjFer plasmid construction; b: schematic diagram of pHK01-P-SP-6His-rH-2 plasmid construction; Figure 2 This is a diagram showing the transcriptional level of the promoter-mediated gene transcription in this invention; where a: promoter-mediated transcriptional level of the MjFer gene (1-4: strains) B subtilis WB600, pHK01-MjFer, pHK01-P43-MjFer and pHK01-Pveg-MjFer); b: promoter pair rH-2 gene transcription level (1-4: strains B subtilis WB600, pHK01-rH-2, pHK01-P43-rH-2 and pHK01-Pveg--rH-2); Figure 3This is a diagram illustrating the identification of the exocrine expression of 6His-MjFer and 6His-rH-2 based on Western blotting in this invention; wherein, ab: identification of the exocrine expression of 6His-MjFer based on Western blotting, cd: identification of the exocrine expression of 6His-MjFer based on Western blotting. Graphs showing the identification of 6His-rH-2 exocrine expression by blotting; (Note: M: Marker; N: Negative control; 1-20: strains 6-pHK01-SP1-6His-MjFer, 6-pHK01-SP3-6His-MjFer, 6-pHK01-SP8-6His-MjFer, 6-pHK01-SP6-6His-MjFer, 6-pHK01-SP5-6His-MjFer, 6-pHK01-SP2-6His-MjFer, 6-pHK01-SP7-6His-MjFer, 6-pHK01-SP4-6His-MjFer, 6-pHK01-SP9-6His-MjFer) s-MjFer, 6-pHK01-SP10-6His-MjFer, 6-pHK01-SP10-6His-rH-2, 6-pHK01-SP3-6His-rH-2, 6-pHK01-SP1-6His-rH-2, 6-pHK01-SP4-6His-rH-2, 6-pHK0 1-SP6-6His-rH-2, 6-pHK01-SP5-6His-rH-2, 6-pHK01-SP7-6His-rH-2, 6-pHK01-SP2-6His-rH-2, 6-pHK01-SP9-6His-rH-2 and 6-pHK01-SP8-6His-rH-2); Figure 4This is a graph showing the effect of the signal peptide on the expression and purification yield of 6His-MjFer and 6His-rH-2 in this invention; where 1-20: strains 6-pHK01-SP1-6His-MjFer, 6-pHK01-SP2-6His-MjFer, 6-pHK01-SP3-6His-MjFer, 6-pHK01-SP4-6His-MjFer, 6-pHK01-SP5-6His-MjFer, 6-pHK01-SP6-6His-MjFer, 6-pHK01-SP7-6His-MjFer, 6-pHK01-SP8-6His-MjFer, 6-pHK01-SP9-6His- MjFer, 6-pHK01-SP10-6His-MjFer, 6-pHK01-SP1-6His-rH-2, 6-pHK01-SP2-6His-rH-2, 6-pHK01-SP3-6His-rH-2, 6-pHK01-SP4-6His-rH-2, 6-pHK01 -SP5-6His-rH-2, 6-pHK01-SP6-6His-rH-2, 6-pHK01-SP7-6His-rH-2, 6-pHK01-SP8-6His-rH-2, 6-pHK01-SP9-6His-rH-2 and 6-pHK01-SP10-6His-rH-2; Figure 5 This is a schematic diagram of the CRISPR-Cas9 gene editing technology in this invention; Figure 6 This is a graph showing the influence of Western blotting on the identification of exocrine expression and the yield of expression purification in this invention; where a: identification of exocrine expression of 6His-MjFer based on Western blotting; b: identification based on Western blotting... blotting was used to identify the exocrine expression of 6His-rH-2; c: the effect of csaA gene overexpression on the purification yield of 6His-MjFer; d: the effect of csaA gene overexpression on the purification yield of 6His-rH-2; (Note: M: Marker; N: negative control; Pa: control strain 6-pHK01-SP6-6His-MjFer; Pb: control strain 6-pHK01-SP6-6His-rH-2; 1-6: strains 6csaA-pHK01-SP4-6His-MjFer, 6-pHK01-SP2-6His-MjFer, 6-pHK01-SP10-6His-MjFe, 6-pHK01-SP1-6His-rH-2, 6-pHK01-SP5-6His-rH-2 and 6-pHK01-SP6-6His-rH-2). Figure 7This is a graph showing the effect of Western blotting on the identification of exocrine expression and the purification yield of 6His-MjFer; where a: identification of exocrine expression of 6His-MjFer based on Western blotting; b: identification of exocrine expression of 6His-rH-2 based on Western blotting; c: effect of csaA gene overexpression on the purification yield of 6His-MjFer; d: effect of csaA gene overexpression on the purification yield of 6His-rH-2; (Note: M: Marker; N: Negative control; Pa: Control strain 6-pHK01-SP6-6His-MjFer; Pb: Control strain 6-pHK01-SP6-6His-rH-2) ;1-6: strains 6dltd-pHK01-SP4-6His-MjFer, 6dltd-pHK01-SP2-6His-MjFer, 6dltd-pHK01-SP10-6His- MjFe, 6dltd-pHK01-SP1-6His-rH-2, 6dltd-pHK01-SP5-6His-rH-2 and 6dltd-pHK01-SP6-6His-rH-2); Figure 8 This diagram illustrates the effects of exocrine expression identification and purification yield on the results of this invention. Specifically, a: identification of 6His-MjFer exocrine expression based on Western blotting; b: identification of 6His-rH-2 exocrine expression based on Western blotting; c: effect of IPTG concentration on 6His-MjFer expression purification yield; d: effect of IPTG concentration on 6His-rH-2 expression purification yield. (Note: M: Marker; N: Negative control; 1-5: IPTG concentrations of 0.5 mmol / L, 1.0 mmol / L, 1.5 mmol / L, 2.0 mmol / L, and 2.5 mmol / L). Figure 9 This diagram illustrates the effects of different induction times on the expression and purification yield of 6His-MjFer in this invention. Specifically, a: Identification of 6His-MjFer exocrine expression based on Western blotting; b: Identification of 6His-rH-2 exocrine expression based on Western blotting; c: Effect of different induction times on the expression and purification yield of 6His-MjFer; d: Effect of different induction times on the expression and purification yield of 6His-rH-2. (Note: M: Marker; N: Negative control; 1-5: 16 h, 20 h, 24 h, 28 h, and 32 h). Figure 10The figures show the effects of different induction temperatures on the expression and purification yield of 6His-MjFer in this invention. Specifically, a: Identification of 6His-MjFer exocrine expression based on Western blotting; b: Identification of 6His-rH-2 exocrine expression based on Western blotting; c: Effect of different induction temperatures on the expression and purification yield of 6His-MjFer; d: Effect of different induction temperatures on the expression and purification yield of 6His-rH-2. (Note: M: Marker; N: Negative control; 1-3: 20℃, 25℃, and 30℃). Figure 11 These are TEM images and dynamic light scattering intensity maps in this invention; where a: TEM image of 6His-MjFer; b: TEM image of 6His-rH-2; c: dynamic light scattering intensity of 6His-MjFer; d: dynamic light scattering intensity of 6His-rH-2. Figure 12 These are the kinetic curves and rate diagrams in this invention; where a: iron oxidation kinetic curves of 6His-MjFer and 6His-rH-2; b: oxidation deposition rate diagrams of 6His-MjFer and 6His-rH-2. Figure 13 These are the kinetic curves and rate diagrams in this invention; where a: reduction-release kinetic curves of 6His-MjFer and 6His-rH-2; b: reduction-release rate diagrams of 6His-MjFer and 6His-rH-2. Figure 14 This diagram illustrates the overall strategy for the expression and purification of ferritin in Bacillus subtilis in this invention. Detailed Implementation

[0026] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0027] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.

[0028] A method for expressing and purifying ferritin in Bacillus subtilis, using food-grade Bacillus subtilis strain WB600 as the host, achieves efficient secretory expression of Penaeus japonicus ferritin MjFer and H-2 type soybean ferritin H-2 through synergistic regulation of expression element screening, chassis strain modification, and induction condition optimization; the expression element screening includes promoter screening and signal peptide screening; the chassis strain modification includes dltD gene knockout and csaA molecular chaperone gene overexpression; and the induction condition optimization includes optimization of induction time, induction temperature, and IPTG concentration.

[0029] Furthermore, the promoter selection employs an induced promoter P. grac ; Alternatively, the signal peptide screening is performed using the ybdN signal peptide, and the purification yields of 6His-MjFer and 6His-rH-2 expression guided by the ybdN signal peptide are 6.75 mg / L and 4.42 mg / L, respectively.

[0030] Furthermore, the csaA molecular chaperone gene overexpression is achieved by replacing the natural promoter of the csaA gene with the strong promoter Pc2up. Overexpression of the csaA gene increases the purification yield of 6His-MjFer expression by 42% and 6His-rH-2 expression by 24%. Alternatively, the dltD gene knockout is performed using CRISPR-Cas9 gene editing technology to knock out the dltD gene. Knocking out the dltD gene increases the expression and purification yield of 6His-MjFer by 10% and 6His-rH-2 by 40%.

[0031] Furthermore, in the optimization of the induction conditions, the induction conditions for 6His-MjFer are: IPTG concentration of 0.5 mmol / L, induction time of 24 h, and induction temperature of 30℃; the induction conditions for 6His-rH-2 are: IPTG concentration of 1.5 mmol / L, induction time of 24 h, and induction temperature of 30℃.

[0032] Furthermore, the method also includes a protein purification step, wherein the protein purification step uses NiSepHarose. TM 6. Affinity chromatography purification was performed using a gravity chromatography column filled with Fast Flow packing material.

[0033] Furthermore, the method specifically includes the following steps: (1) Promoter screening: Recombinant expression vectors containing different promoters were constructed, and the transcription level was detected by qPCR to screen for promoter P. grac ; (2) Signal peptide screening: at promoter P gracBased on this, recombinant expression vectors containing different signal peptides were constructed, and the signal peptide ybdN was screened out by Western blotting and protein quantification analysis. (3) Chassis strain modification: CRISPR-Cas9 gene editing technology was used to construct csaA overexpression strains and dltD knockout chassis strains; (4) Construction of recombinant strains: The selected strains containing promoter P grac The expression vector for the signal peptide ybdN was transformed into the modified chassis strain; (5) Induced expression: Induced expression is performed under induction conditions; (6) Protein purification: The target protein was purified by affinity chromatography.

[0034] Furthermore, the induction conditions for 6His-MjFer in step (5) are an IPTG concentration of 0.5 mmol / L, an induction time of 24 h, and an induction temperature of 30 °C; the optimal conditions for 6His-rH-2 in step (5) are an IPTG concentration of 1.5 mmol / L, an induction time of 24 h, and an induction temperature of 30 °C. A method for analyzing the physicochemical properties of ferritin obtained by the expression and purification method described above, the method comprising transmission electron microscopy (TEM) observation, dynamic light scattering (DLS) analysis, iron oxidation precipitation experiment, and reduction release experiment.

[0035] Furthermore, the transmission electron microscopy (TEM) observation showed that both recombinant 6His-MjFer and 6His-rH-2 exhibited typical cage-like structures with diameters of 12-17.5 nm. Alternatively, the dynamic light scattering DLS analysis showed that the hydration diameter of 6His-MjFer was 17.36 nm and the hydration diameter of 6His-rH-2 was 17.51 ​​nm. Alternatively, the iron oxide precipitation experiment was performed by detecting Fe at 300 nm using a UV spectrophotometer. 2+ The ferrite-bridging compound formed by oxidation, and the reduction-release experiment, were measured at 562 nm using a UV spectrophotometer [Fe(ferrozine)3]. 2+ The content reflects the Fe 3+ The restoration and release.

[0036] Furthermore, the recombinant ferritin is recombinant 6His-MjFer or recombinant 6His-rH-2, with the recombinant 6His-MjFer expression purification yield being 12.35 mg / L and the recombinant 6His-rH-2 expression purification yield being 7.01 mg / L.

[0037] The H-2 type soybean ferritin involved in this invention is identified as NM_001251572.2 and NP_001238501.2 in NCBI, and the PDB number for Japanese shrimp ferritin is... https: / / doi.org / 10.2210 / pdb6LRX / pdb.

[0038] Specifically, the relevant preparation and testing methods are as follows: A method for the expression, purification, and physicochemical properties of ferritin in Bacillus subtilis (see research strategy) Figure 14 The steps are as follows: The central objective of this invention is to achieve recombinant expression of full-length MjFer and H-2 proteins by inserting a 6×His tag at the N-terminus of the target protein. For example... Figure 1 As shown in (a) and 1(b), using pHK01 as the plasmid backbone (pHK01 plasmid is a derivative vector of the well-known plasmid PHT01, obtained by replacing the chloramphenicol resistance gene in PHT01 with the kanamycin resistance gene, and the remaining functional elements and multiple cloning sites are the same as PHT01, as disclosed in Chinese Patent Publication CN121538139A), an expression cassette was constructed with the promoter (P)-signal peptide (SP)-6His tag target protein coding sequence as the core, and the promoter and signal peptide elements in the expression cassette were screened and optimized to improve the expression and secretion efficiency of the target protein in the recipient bacteria.

[0039] The strains and plasmids involved in this invention are shown in Tables 1 and 2.

[0040] The instruments used in the experiments of this invention are detailed in Table 3.

[0041] The primer sequences, promoters, and signal peptide sequences involved in this invention are shown in Tables 4 and 5.

[0042] The culture media used in this invention were prepared as follows: (1) TB medium (g / L): 23.6 g yeast extract, 11.8 g tryptone, 4 mL glycerol, 9.40 g K2HPO4, 2.20 g KH2PO4; (2) LB medium (1L): 5 g yeast extract, 5 g NaCl and 10 g tryptone. Solid culture medium 15% agar powder; (3) Sp medium (1L): 8.34 g K2HPO4, 6 g KH2PO4, 2 g (NH4)2SO4, 0.2 g MgSO4·7H2O and 1 g sodium citrate; (4) SpI medium (1L): SP medium, 50 g casein hydrolysate, 500 g glucose and 100 g yeast extract; (5) SpII medium (1L): SpI medium, 106.2 g MgCl2·6H2O and 14.7 g CaCl2. All culture media were sterilized under high temperature and high pressure at 121℃ for 20 min after preparation; water was used as the solvent.

[0043] The preparation method of the solutions used in the experiment of this invention is as follows: (1) Mannose solution: Weigh 0.02 g of mannose and dissolve it in 100 mL of distilled water; (2) Kanamycin (Kan): Weigh 100 mg of kanamycin powder, add about 8 mL of ddH2O, and vortex thoroughly until completely dissolved. Make up to a total volume of 10.0 mL and mix well. (3) IPTG solution: Weigh 2.383 g IPTG powder, add about 8 mL ddH2O, vortex thoroughly until completely dissolved, bring to a total volume of 10.0 mL, mix well, and filter sterilize using a 0.22 μm sterile filter membrane; (4) His binding solution (pH 7.5, containing Tris-HCl and NaCl): Weigh 6.05 g Tris and 8.7 g NaCl respectively, dissolve in distilled water, mix thoroughly, add hydrochloric acid to adjust pH to 7.5, bring to a volume of 1 L, sterilize by membrane filtration, and store at room temperature; (5) His elution buffer: Add 500 mmol / L imidazole to the His binding solution; (6) TBST: Measure 100 mL 10×Tris Buffer and 5 mL 10% Tween-20 respectively, mix thoroughly, bring to a volume of 1 L with water, and store at room temperature. All of the above solutions were sterilized by filtration.

[0044] The reagents used in this invention are as follows: DNA product purification kit and plasmid extraction kit were purchased from Tiangen Biotech (Beijing) Co., Ltd.; Quick Cut enzyme, Prime STAR® Max DNA polymerase, 10× Loading Buffer and DNA Maker were provided by BioRa Biotechnology (Beijing) Co., Ltd. (TaKaRa); T4 DNA ligase was purchased from New England Biolabs (USA); Green Taq Mix polymerase was from Nanjing Novizan Biotechnology Co., Ltd.; PrimeScript™ RT-PCR kit; SYBR Premix Ex Taq kit.

[0045] The experimental steps for shake-flask fermentation in this invention are as follows: The bacterial strain was streaked onto an LB agar plate containing 10 mg / mL Kan-resistant material and incubated overnight at 37°C; 4 mL of LB agar containing 10 mg / mL Kan-resistant material was added to a sterilized test tube, a single colony was picked, and the mixture was incubated overnight at 37°C and 200 rpm on a shaker; 50 mL of pre-sterilized LB agar was transferred to a 250 mL Erlenmeyer flask, and 2% of the bacterial culture was inoculated into the Erlenmeyer flask. 30 μL of 100 mg / 10 mL Kan solution was added, and the mixture was incubated at 37°C and 200 rpm for 3-4 h. When the OD600 was measured to be 0.8-1.2, IPTG at a final concentration of 1.0 M was added for low-temperature induction.

[0046] The Western blotting technique required for several parts of the experiment in this invention is as follows: Take 1 mL of fermentation broth, centrifuge at 10000 r / min for 3 min, and collect the supernatant. Take 20 μL of the prepared sample, add 5 μL of 5×SDS sample buffer and mix well, then heat at 100℃ for 5 min; add 20 μL of sample processing solution to each well of a 12% SDS-PAGE, connect the power supply, stabilize the voltage at 150 V, and electrophoresis for 60 min; cut a PVDF membrane the same size as the gel, and soak it in ice-cold methanol for 30 s before use to activate the PVDF membrane; pour the pre-cooled transfer solution into the transfer tank to make a transfer sandwich, and transfer the membrane at a constant current of 250 mA for 60 min under ice bath conditions; remove the transferred membrane, place the PVDF membrane in 10% skim milk, and block it at room temperature for 1 h to block specific binding sites. After blocking, excess milk blocking solution was rinsed off with 1×TBST buffer, and primary antibody was added with 10% skim milk according to the ratio, and incubated overnight at 4°C. After primary antibody incubation, excess milk blocking solution was rinsed off with 1×TBST buffer, and secondary antibody was added with 10% skim milk according to the ratio, and incubated at room temperature for 1 h. After secondary antibody incubation, excess milk blocking solution was rinsed off with 1×TBST buffer, and chemiluminescence imaging was performed.

[0047] The purification steps used in this invention are as follows: the fermentation broth was centrifuged at 10,000 r / min for 10 min to remove the bacterial cells and collect the supernatant. The supernatant was then filtered through a membrane and loaded onto a Ni SepHarose packing material. TM 6. The column was incubated in a Fast Flow-filled gravity chromatography column at 4°C on a shaker for 24 h. The flow-through was drained and sampled. The column was then washed with His-tagged washing buffer to remove contaminating proteins. An equal volume of His-tagged elution buffer was added to elute the target protein. Subsequent regeneration and storage of the column were strictly performed according to the kit instructions. The flow-through and elution buffers were analyzed by SDS-PAGE electrophoresis to determine the purity of the target protein.

[0048] In this invention, the Lowry method was used for quantitative analysis of proteins. 40 μL of sample was mixed with 360 μL of deionized water, and 400 μL of composite working solution (CTC stock solution: 0.8 mol / L NaOH:10% SDS:H2O = 1:1:1:1, volume ratio) was added. After standing for 10 min, 200 μL of diluted Folin-Ciocalteu reagent was added, and the reaction was carried out for 30 min at room temperature in the dark. The A value was then measured using a spectrophotometer. 750 The standard curve was established using a gradient of bovine serum albumin (BSA) solutions (0-50 μg). Linear regression was performed using the least squares method, yielding the following regression equation: Y = 0.0045x + 0.0715 (R²). 2 =0.9983).

[0049] The specific steps are as follows: Step 1: Promoter Screening (1) Amplify the target fragment Based on homologous recombination cloning technology, a homologous arm-directed design strategy was used to achieve directed recombination of DNA fragments. The specific procedure is as follows: The nucleotide sequence at the end of the linearized vector (20 bp) was selected for amplifying the homologous arm of the target gene, and this sequence was added to the forward and reverse 5' ends of the target gene fragment, respectively. PCR amplification was performed using pre-designed primers containing homologous arms. After the amplification reaction was completed, the target gene DNA fragment with homologous arms was successfully obtained.

[0050] (2) Linearization of the carrier Using pHK01 plasmid as the starting vector, the vector was subjected to double digestion with two fast digestion enzymes, Quick Cut1 and Quick Cut2 (ddH2O). The digestion reaction was set at 37℃ and the reaction time was controlled at 30 min.

[0051] (3) Agarose gel electrophoresis Weigh agarose, add 1×TAE buffer (0.8%-1.0% by mass), and heat in a microwave oven for 3-5 minutes until completely dissolved. Add nucleic acid dye, shake to mix, and pour into a gel plate. Let stand at room temperature for 25 minutes until the gel solidifies. Carefully remove the comb from the gel plate to obtain the gel plate. Transfer the sample to be verified to the well of the gel plate using a pipette. Set the electrophoresis time to 25 minutes and start the electrophoresis apparatus. After the electrophoresis reaction is complete, observe the electrophoresis results using a gel imager.

[0052] (4) Agarose gel recovery and purification After the PCR amplification reaction, the target gene fragment obtained and the vector plasmid after enzyme digestion need to be purified by agarose gel extraction. The specific operation procedure should be followed according to the instructions of the corresponding nucleic acid recovery kit. After recovery, the purified target gene fragment and enzyme digestion vector are finally obtained.

[0053] (5) Homologous recombination The target gene fragment and enzyme digestion vector obtained in the above process are ligated for homologous recombination using a one-step cloning ligation method.

[0054] (6) Chemical transformation of Escherichia coli Add 10 μL of the ligation system (the system obtained in step 1 (5)) to the competent E. coli cells, mix thoroughly, and incubate on ice for 30 min; place the above EP tube in a 42℃ metal bath, react for 90 s, and immediately place it in ice for 5 min; add 900 μL of LB liquid, and incubate at 37℃ and 200 rpm for 45 min; after the incubation, centrifuge the EP tube at 8,000 rpm for 3 min, discard 900 μL of supernatant, resuspend the remaining bacterial solution and spread it evenly on an LB plate containing 10 mg / mL of Kan resistance; incubate overnight at 37℃.

[0055] (7) Extraction and validation of recombinant plasmids In this experiment, the plasmid extraction process was strictly performed according to the instructions of the plasmid miniprep kit from Tiangen Biotech (Beijing) Co., Ltd. The specific procedure can be found in the instructions. The extracted recombinant plasmids were sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing.

[0056] The results are as follows: To screen promoters suitable for efficient expression of the MjFer and H-2 genes in Bacillus subtilis, three types of promoters with different characteristics were selected for comparison and verification, namely the commonly used strong constitutive promoter P of Bacillus subtilis. 43 Constitutive promoter P veg And the inducible promoter P inherent in the vector skeleton grac(The intrinsic promoter of the pHK01 plasmid). The expression intensity of the promoter was verified by detecting the transcriptional levels of MjFer and H-2 using qPCR. Real-time quantitative PCR (qPCR) verification is shown in Table 8, and the qPCR reaction procedure is shown in Table 9. Figure 2 As shown in (ab), the inductive promoter P grac Transcriptional levels were highest for both MjFer and rH-2. For MjFer, the differences in transcriptional levels driven by the three promoters were relatively small; for H-2, P... grac The transcriptional level of P43 is approximately 3 times that of P43. veg 30 times that of the other two constitutive promoters. Compared to the other two constitutive promoters, the inducible promoter does not express the target protein before reaching the logarithmic growth phase, thus exerting less growth stress on Bacillus subtilis cells. In contrast, the constitutive promoter expresses the protein during cell growth, causing growth stress and affecting cell growth. Therefore, this experiment chose the inducible promoter P. grac .

[0057] Step 2: Screening of signal peptides This step is basically the same as step one, involving amplification of the target fragment, vector linearization, agarose gel electrophoresis, agarose gel recovery and purification, homologous recombination methods, verification of the ligation product, extraction of the recombinant plasmid, and verification of the recombinant plasmid. However, the vector linearization step differs from the double enzyme digestion in step one; instead, a single enzyme digestion is performed, as follows: using the pHK01 plasmid as the starting vector, a single enzyme digestion reaction is performed on the vector according to Quick Cut. The digestion reaction is set at 37℃, and the reaction time is controlled at 30 min.

[0058] To improve the extracellular secretion efficiency of MjFer and H-2, this invention conducted targeted signal peptide screening experiments. Ten signal peptides were used for screening (bglS, dacB, pel, sacB, sacC, ybdN, yddT, yjcN, yncM, and yoaW). The screening used the extracellular protein expression and purification yield as the core evaluation indicator, and the optimal promoter P, verified by the above promoter screening, was selected. grac, Ten signal peptides were fused with two target protein genes to construct recombinant expression plasmids. This invention constructed 20 signal peptide expression vectors, and the 20 successfully constructed recombinant expression plasmids were transformed into... B. subtilisRecombinant strains 6-pHK01-SP1-6His-MjFer, 6-pHK01-SP2-6His-MjFer, 6-pHK01-SP3-6His-MjFer, 6-pHK01-SP4-6His-MjFer, 6-pHK01-SP5-6His-MjFer, 6-pHK01-SP6-6His-MjFer, 6-pHK01-SP7-6His-MjFer, 6-pHK01-SP8-6His-MjFer, 6-pHK01-SP9-6His-MjFer, and 6-pHK01-SP10- were obtained from WB600. 6His-MjFer and 6-pHK01-SP1-6His-rH-2, 6-pHK01-SP2-6His-rH-2, 6-pHK01-SP3-6His-rH-2, 6-pHK01-SP4-6His-rH-2, 6-pHK01-SP5-6His -rH-2, 6-pHK01-SP6-6His-rH-2, 6-pHK01-SP7-6His-rH-2, 6-pHK01-SP8-6His-rH-2, 6-pHK01-SP9-6His-rH-2, and 6-pHK01-SP10-6His-rH-2.

[0059] wild type B. subtilis Using strain WB600 as the control, the strains obtained above were used as the experimental group for shake-flask fermentation experiments. After the shake-flask fermentation, Western blotting was used to verify the specific expression of 6His-MjFer and 6His-rH-2, respectively. Figure 3 As shown in (ab), nine recombinant 6His-MjFer expression strains all exhibited specific bands at around 19.0 kDa, while the remaining strain did not show a corresponding band. The underlying reason is presumably the extremely poor molecular compatibility between the signal peptide and MjFer; this type of signal peptide cannot bind to the secretory system of Bacillus subtilis, or it may misfold after fusion with MjFer and be degraded by intracellular proteases. Figure 3 As shown in (cd), all seven recombinant 6His-rH-2 expression strains showed specific bands at around 28.0 kDa. No corresponding bands were detected in three strains. This may be due to severe misfolding of the target protein after fusion and complete degradation by intracellular proteases, or a complete mismatch between the signal peptide and the secretion pathway of Bacillus subtilis, which led to the complete obstruction of rH-2 secretion and transport.

[0060] Protein concentration was determined using the Lowry method to calculate the protein expression and purification yield. Different signal peptides exhibit varying guided expression efficiencies. For example... Figure 4As shown in (a), for strains 6-pHK01-SP1-6His-MjFer to 6-pHK01-SP10-6His-MjFer, the highest purification yield of 6His-MjFer expression was observed in strain 6-pHK01-SP6-6His-MjFer (6.75 mg / L), followed by strains 6-pHK01-SP4-6His-MjFer and 6-pHK01-SP10-6His-MjFer. Figure 4 As shown in (b), among strains 6-pHK01-SP1-6His-rH-2 to 6-pHK01-SP10-6His-rH-2, the purification yield of 6His-rH-2 from strain 6-pHK01-SP6-6His-rH-2 was the highest, reaching 4.42 mg / L, followed by 6-pHK01-SP5-6His-rH-2 and 6-pHK01-SP1-6His-rH-2.

[0061] Step 3: Modification of chassis strains (1) Preparation of N2O First, the amino acid sequence of the target gene was determined in NCBI. The predicted N20 sequence was obtained by inputting the corresponding amino acid sequence of the target gene into the website (http: / / chopchop.cbu.uib.no / ). Sequences with relatively high scores were selected as the N20 sequences. Specific primers N20-F and N20-R were designed based on the obtained N20 sequences. The N20 reaction system consisted of 10 μL of 5×Buffer (DNA annealing buffer), 10 μL of the upstream primer (N20-F), 10 μL of the downstream primer (N20-R), and 20 μL of ddH2O. The reaction system was placed in a 95℃ metal bath for annealing for 2 min, the metal bath was turned off, and the reaction was allowed to proceed for 50 min, finally obtaining the N20 fragment (sequence: ACCGGCGTGATCAGACAGTGGGG).

[0062] (2) Connect N20 Chromosomal gene knockout or overexpression was achieved using a CRISPR-Cas9 system based on the pJOE8999 plasmid. The target gene was analyzed using the CHOPCHOP website, and a high-resolution N20 sequence was screened and identified. This N20 sequence was cloned into the pJOE8999 plasmid, and then a homologous template was cloned to repair DNA double-strand breaks.

[0063] (3) Preparation of the target gene UP and DOWN fragments Approximately 1000 bp upstream and downstream of the gene to be knocked out were selected as the homologous arms UP and DOWN, respectively. Primers for the target fragment were designed, resulting in primers UP-F, UP-R, DOWN-F, and DOWN-R. The genome of Bacillus subtilis WB600 was used as a template for amplification, yielding the UP and DOWN target fragments containing the homologous sequences.

[0064] (4) Homologous recombination of UP, DOWN fragments and plasmids The obtained upstream and downstream fragments UP and DOWN are ligated into the vectors with corresponding N20 segments using homologous recombination. The plasmid for integrating the genome ligates the UP and DOWN segments from the corresponding knockout gene and the integrated gene fragment into the vectors with corresponding N20 segments. For details on the vector digestion and homologous recombination methods, please refer to step two. This process yields the correct integration plasmid lytH-pJOE8999-N20-UPDN.

[0065] (5) Promoter and target fragment amplification See step one for details.

[0066] (6) Homologous recombination of promoter, target fragment and plasmid Using lytH-pJOE8999-N20-UPDN (obtained from step three (4)) as the starting vector, the obtained promoter and target gene fragment are linked to the vector by homologous recombination. For details of the vector enzyme digestion method and homologous recombination method, please refer to step two and step one, so as to obtain the correct overexpression vector and integration plasmid.

[0067] (7) Modification of the chassis strain The CRISPR-Cas9 system used in this invention is a single plasmid system (pJOE8999), which is modified by knockout and overexpression of pJOE8999. csaA is B. subtilis An essential gene that promotes proper protein folding and secretion. Overexpression of the csaA gene (Gene ID: 937362, protein accession number NP_391732.1) can lead to... Figure 5 As shown in (b). dltD (Gene ID: 939631) is a cell membrane surface metal ion-related gene that can affect the binding of cation folding factors to the cell wall surface. We knocked out the dltD gene, as shown in [the image]. Figure 5 As shown in (c).

[0068] The results are as follows: csaA is B. subtilisA crucial gene that promotes proper protein folding and secretion. This invention first overexpresses the csaA gene by replacing its natural promoter with the strong promoter Pc2up (sequence: TGAGAATTCCTAACAACTAAATCACGACTATATACCTATACTATTTATTATCATCAATTTGTCGAAAAGGGTAGACAAACTATCGTTTAACATGTTATACTATAATAG), obtaining strain 6csaA. The 6csaA strain was then transformed with plasmids pHK01-SP4-6His-MjFe, pHK01-SP6-6His-MjFer, pHK01-SP10-6His-MjFer, pHK01-SP1-6His-rH-2, pHK01-SP5-6His-rH-2, and pHK01-SP6-6His-rH-2. (Step 1 (6) obtained) strains 6csaA-pHK01-SP4-6His-MjFe, 6csaA-pHK01-SP6-6His-MjFer, 6csaA-pHK01-SP10-6His-MjFer, 6csaA-pHK01-SP1-6His-rH-2, 6csaA-pHK01-SP5-6His-rH-2 and 6csaA-pHK01-SP6-6His-rH-2. Overexpressing strain 6csaA and strains 6-pHK01-SP6-6His-MjFer and 6-pHK01-SP6-6His-rH-2 were used as controls, and the strains that were successfully transformed were used as the experimental group for shake-flask fermentation experiments. After the shake-flask reaction, Western blotting was used to verify the specific expression of 6His-MjFer and 6His-rH-2, respectively. Figure 6 As shown in (a), specific bands of the target protein were detected in all three recombinant 6His-MjFer expression strains near the 19.0 kDa position; Figure 6 As shown in (b), all three recombinant 6His-rH-2 expressing strains exhibited specific bands at approximately 28.0 kDa; based on this, it is inferred that the csaA gene did not affect the expression of either strain. Figure 6 As shown in (c), compared to the control strain, strain 6csaA-pHK01-SP6-6His-MjFer achieved the highest protein expression and purification yield of 10.04 mg / L, representing an increase of 42%. Figure 6As shown in (d), compared with the control strain 6-pHK01-SP6-6His-rH-2, the protein expression and purification yield of strain 6csaA-pHK01-SP6-6His-rH-2 reached the highest 5.35 mg / L, an increase of approximately 24%. Furthermore, overexpression of the csaA gene significantly increased the yield of MjFer, suggesting that the csaA gene can promote the correct folding and secretion of these two proteins, with this promoting effect being particularly pronounced on 6His-MjFer.

[0069] dltD is a cell membrane surface metal ion-related gene that can affect the binding of cation folding factors to the cell wall surface. Knockout of dltD yielded strain 6dltD. Strains 6dltD-pHK01-SP4-6His-MjFe, pHK01-SP6-6His-MjFer, pHK01-SP10-6His-MjFer, pHK01-SP1-6His-rH-2, pHK01-SP5-6His-rH-2, and pHK01-SP6-6His-rH-2 were obtained by transforming plasmids pHK01-SP4-6His-MjFe, 6dltD-pHK01-SP6-6His-MjFer, 6dltD-pHK01-SP10-6His-MjFer, 6dltD-pHK01-SP1-6His-rH-2, 6dltD-pHK01-SP5-6His-rH-2, and 6dltD-pHK01-SP6-6His-rH-2 into the 6dltD strain. The knockout strain 6dltD, as well as the strains 6-pHK01-SP6-6His-MjFer and 6-pHK01-SP6-6His-rH-2, were used as control groups. The successfully transformed strains were used as the experimental group for shake-flask fermentation experiments. After the shake-flask fermentation, Western blotting was used to verify the specific expression of 6His-MjFer and 6His-rH-2. Figure 7 As shown in (a), specific bands of the target protein were detected in all three recombinant 6His-MjFer expression strains near the 19.0 kDa position; Figure 7 As shown in (b), all three recombinant 6His-rH-2 expression strains exhibited specific bands at approximately 28.0 kDa. Figure 7 As shown in (c), compared to the control strain 6-pHK01-SP6-6His-MjFer, strain 6dltD-pHK01-SP6-6His-MjFer exhibited the highest protein expression and purification yield, reaching a maximum of 7.67 mg / L, representing a 10% increase. Figure 7As shown in (d), compared with the control strain 6-pHK01-SP6-6His-rH-2, the protein expression and purification yield of strain 6dltD-pHK01-SP1-6His-rH-2 reached the highest level of 6.70 mg / L, which is 40% higher. In addition, knocking out the dltD gene has a more significant effect on increasing rH-2 production. Based on this, it is speculated that dltD is a cell membrane surface metal ion-related gene, which can affect the binding of cation folding factors to the cell wall surface, thereby improving the protein expression and purification yield.

[0070] Step 4: Construction of recombinant Bacillus subtilis strains (1) Preparation and chemical transformation of Bacillus subtilis competent cells Will B. subtilis WB600 was streaked in three zones on LB agar plates and incubated overnight at 37°C. Single colonies from the plates were picked and cultured in shake-tube incubation at 37°C and 200 rpm overnight. 2.5 mL of SPI medium and 100 μL of the culture from the single colony picks were then cultured in shake-tube incubation at 37°C and 200 rpm until the OD600 reached approximately 1.1. 2 mL of SPII medium and 200 μL of the liquid from the previous step were then cultured in shake-tube incubation at 37°C and 100 rpm for 1.5 h. 20 μL of 10 mM EGTA was added, and the plates were incubated at 37°C and 100 rpm for 10 min. 2-3 μL of plasmids (all plasmids mentioned above) were added, and the plates were incubated at 37°C and 100 rpm for 1 h. The rotation speed was then increased to 200 rpm, and the plates were incubated for another 1.5 h. 100 μL of the liquid from the previous step was plated onto LB agar plates with the appropriate antibiotic resistance and incubated overnight at 37°C.

[0071] (2) Validation of recombinant Bacillus subtilis strains The recombinant strain was validated using colony PCR, as detailed in step one.

[0072] (3) CRISPR-Cas9 gene editing Constructing plasmids. Construct plasmids according to the method described in step three; Chemical transformation. Chemically transform the plasmids into Bacillus subtilis (obtained in step three (7)); Colony verification. Verify the transformants by colony PCR, see step one for details; Plasmid elimination. Perform plasmid elimination on the verified transformants. The specific steps are: transfer the colonies twice into test tubes containing LB, and the culture conditions are: 42℃, 200 rpm. The culture time is 12 h. Then streak the above bacterial solution on LB plates. Finally, select suitable single colonies and culture them on LB plates and LB plates containing 10 mg / mL Kan resistance. No growth occurs on the plates containing the corresponding resistant LB, and the colonies on the LB plates are plasmid eliminated. Colony verification again. Verify the plasmid-eliminated colonies again by colony PCR, and preserve the verified strains.

[0073] Step 5: Bacillus subtilis RNA extraction and MjFer and rH-2 transcription level detection (1) RNA extraction from Bacillus subtilis The strain obtained in step four was streaked onto LB agar plates and incubated overnight at 37°C. In a sterilized test tube, 4 mL of LB was added, and a single colony was picked and incubated overnight at 37°C and 200 rpm on a shaker. 50 mL of pre-sterilized LB was transferred to a 250 mL Erlenmeyer flask, and the bacterial culture was inoculated at a 2% inoculum. The culture was incubated at 37°C, and the OD600 was measured to be between 0.6 and 0.8. 2 mL of fermentation broth was taken. The culture was centrifuged at 5,000 × g for 5 min in a 2 mL EP tube at 4°C, and the supernatant was discarded. 100 μL of 15 mg / mL lysozyme solution (dissolved in TE buffer) was added, and the mixture was shaken for 30 s. The culture was incubated at 30°C for 10 min, with shaking every 2 min during this period. Add 350 μL of Buffer BRK (β-mercaptoethanol needs to be added before use, final concentration 2% (v / v)); weigh 25-40 mg of glass powder into a 2 mL EP tube, shake for 5 min, then centrifuge at 13,000×g for 5 min; transfer 400 μL of supernatant to a 1.5 mL EP tube, add an equal volume of 70% ethanol and mix well; transfer the mixture to a centrifuge column, centrifuge for 1 min at 10,000×g, and discard the filtrate in the collection tube; add 300 μL of Buffer I, centrifuge at 10,000×g for 1 min, and discard the filtrate; add 500 μL of Buffer II, centrifuge at 10,000×g for 1 min, and discard the filtrate (Buffer II needs to be diluted with anhydrous ethanol at a 1:4 volume ratio before use); centrifuge the empty column at 12,000×g for 2 min to remove residual filtrate; place the bound column into a new 1.5 mL EP tube. Add 50 mL of DEPC Water to an EP tube, let stand for 2 min, centrifuge at 12,000×g for 1 min to obtain the RNA solution.

[0074] (2) Detection of Bacillus subtilis RNA transcription level The reaction system for removing genomic DNA is shown in Table 6. PCR reaction procedure: 42℃ for 2 min.

[0075] The reverse transcription reaction system is shown in Table 7. PCR reaction procedure: 37℃ for 15 min, 85℃ for 5 s.

[0076] The gene expression levels of the promoters of MjFer and rH-2 were measured, among which, hbsU (Gene ID:11239944) is used as an internal reference gene. Bacillus subtilis WB600 was used as the control strain. Real-time quantitative PCR (qPCR) validation is shown in Table 8, and the qPCR reaction procedure is shown in Table 9.

[0077] Step Six: Optimization of Induced Conditions After successfully constructing the recombinant strains 6csaA-pHK01-SP6-6His-MjFer and 6dltD-pHK01-SP6-6His-rH-2, the controlled variable method was adopted, that is, only one influencing factor was changed each time while keeping other conditions constant. The effects of three key parameters, namely IPTG concentration, induction time and induction temperature, on ferritin expression were systematically investigated to achieve scientific optimization of the induction system and provide a reliable basis for subsequent scale-up culture.

[0078] (1) Optimization of IPTG concentration IPTG, a classic inducer of the lactose operon, releases inhibition by binding to repressor proteins, initiating the transcription and expression of ferritin genes. Excessive IPTG concentration can lead to increased metabolic burden and contaminating proteins in the strain, while insufficient concentration fails to adequately activate the expression system. To screen for the optimal IPTG induction concentration suitable for the target protein in this invention, five gradient concentrations were set up: 0.5 mmol / L, 1.0 mmol / L, 1.5 mmol / L, 2.0 mmol / L, and 2.5 mmol / L. Strains 6csaA and 6dltD were used as control groups, while the constructed strains 6csaA-pHK01-SP6-6His-MjFer and 6dltD-pHK01-SP6-6His-rH-2 were used as experimental groups for shake-flask fermentation at 37℃ and 200 r / min for 3-4 h. 600 At temperatures ranging from 0.8 to 1.2, different concentrations of IPTG were added to the system for induction, and all experimental groups maintained the same induction temperature and induction time (induction temperature was 30℃, induction time was 24h) to eliminate interference from irrelevant variables.

[0079] After the shake-flask reaction, Western blotting was used to verify the specific expression of 6His-MjFer and 6His-rH-2, respectively. Figure 8 As shown in (a), strain 6csaA-pHK01-SP6-6His-MjFer exhibited specific bands at approximately 19.0 kDa at different IPTG concentrations; Figure 8 As shown in (b), strain 6dltD-pHK01-SP6-6His-rH-2 at different IPTG concentrations all exhibited specific bands around 28.0 kDa; Figure 8(c) The results showed that the purification yield of 6His-MjFer expression exhibited a significant concentration effect with IPTG concentration, reaching its highest level under 0.5 mmol / L IPTG induction, with an extracellular protein purification yield of 11.35 mg / L. The extracellular protein content decreased with increasing IPTG concentration. However, the trend of 6His-rH-2 expression purification yield under various IPTG concentration gradients differed from that of 6His-MjFer. Figure 8 As shown in (d), the highest expression was achieved when induced by 1.5 mmol / L IPTG, and the extracellular protein expression purification yield reached 7.49 mg / L.

[0080] (2) Optimization of induction time The induction time is directly related to the growth cycle of the strain and the efficiency of protein synthesis and accumulation. If the induction time is too short, the ferritin will not reach the maximum expression level. If it is too long, the yield may decrease due to nutrient depletion, cell aging or target protein degradation. The optimal IPTG concentration in step six (1) was selected and the induction temperature was kept constant at 30℃. Five time gradients were set: 16 h, 20 h, 24 h, 28 h and 32 h. 6-pHK01-SP6-6His-MjFer and 6-pHK01-SP6-6His-rH-2 were used as control groups. The constructed strains 6csaA-pHK01-SP6-6His-MjFer and 6dltD-pHK01-SP6-6His-rH-2 were used as experimental groups for shake-flask fermentation. The strains were cultured at 37℃ and 200 r / min for 3-4 h and then the optimal concentration of IPTG was added. The fermentation was continued for 24 h on a constant temperature shaker. Three parallel samples were set at each time point.

[0081] After shake-flask fermentation, Western blotting was used to verify the specific expression of MjFer and rH-2, such as... Figure 9 As shown in (a), strains 6csaA-pHK01-SP6-6His-MjFer, induced at different times, all exhibited specific bands at approximately 19.0 kDa; Figure 9 As shown in (b), strains of 6dltD-pHK01-SP6-6His-rH-2 with different induction times all showed specific bands at around 28.0 kDa; Figure 9 (c) The results showed that the purification yield of 6His-MjFer expression reached its peak at 12.49 mg / L at 24 h, and decreased slightly after 24 h, but not significantly. The bacteria maintained certain metabolic and expression activities even after 24 h. Figure 9(d) The results showed that the protein expression purification yield of 6His-rH-2 reached its highest value of 7.14 mg / L at 28 h, but the protein expression purification yield at 24 h was not much different from that at 28 h, and the overall value tended to be stable. This indicates that 6His-rH-2 had completed most of the protein synthesis and extracellular accumulation at 24 h, and the subsequent 4 h of induction only achieved a small increase in expression. The cells could still maintain a stable expression and secretion state after 24 h, which also reflects that the synthesis and secretion cycle of rH-2 is slightly longer than that of 6His-MjFer, but it can reach an expression level close to the highest value at 24 h.

[0082] (3) Optimization of induction temperature Temperature has a crucial impact on the synthesis and folding of ferritin by affecting the cell metabolic rate, enzyme activity, and gene expression efficiency. Excessively high temperatures may lead to excessively rapid cell growth and protein misfolding, while excessively low temperatures may inhibit metabolic processes and prolong the fermentation cycle. Based on the optimized IPTG concentration of 1.5 mmol / L and fermentation time (obtained in step six (2), 24 h), three temperature gradients were set: 20℃, 25℃, and 30℃. The experimental procedures were as follows: 6-pHK01-SP6-6His-MjFer and 6-pHK01-SP6-6His-rH-2 were used as control groups, and the constructed strains 6csaA-pHK01-SP6-6His-MjFer and 6dltD-pHK01-SP6-6His-rH-2 were used as experimental groups for shake-flask fermentation. The cells were cultured in shakers at 37℃ and 200 r / min for 3-4 h. After the cells grew to the appropriate induction period, the optimal IPTG induction concentration corresponding to each target protein was added to the fermentation system. Then, the fermentation broth was placed in shakers at different temperatures and inducing fermentation at a constant temperature for 24 h according to the selected optimal induction time. Three parallel samples were set up for all experimental groups to ensure the reliability and repeatability of the experimental results.

[0083] After shake-flask fermentation, the specific expression of 6His-MjFer and 6His-rH-2 was verified using Western blotting. Figure 10 As shown in (a), strain 6csaA-pHK01-SP6-6His-MjFer at different induction temperatures all exhibited specific bands at approximately 19.0 kDa; Figure 10 As shown in (b), strain 6dltD-pHK01-SP6-6His-rH-2 at different induction temperatures all exhibited specific bands at approximately 28.0 kDa. Figure 10(cd) The results showed that the purification yields of 6His-MjFer and 6His-rH-2 were highest at 30℃, with protein purification yields of 12.35 mg / L and 7.01 mg / L, respectively. Furthermore, the purification yields decreased with decreasing temperature. Low temperature weakens the transport function of the bacterial secretion system, delaying the extracellular secretion process of the target protein. Small amounts of synthesized protein tend to remain intracellularly for a short period. Although no obvious misfolding was observed, it still reduced the extracellular accumulation to some extent. Ultimately, this resulted in a gradual decrease in the extracellular purification yields of both target proteins with decreasing temperature.

[0084] Step 7: Protein Structure and Physicochemical Properties Analysis (1) Transmission electron microscopy (TEM) observation The morphological characteristics of 6His-MjFer and 6His-rH-2 were analyzed using a Talos G2 200X transmission electron microscope (TEM) at an accelerating voltage of 80 kV. After sample dilution, Tris-HCl buffer (20 mM, pH 7.0) was prepared and deposited onto a carbon-coated copper grid. The grid was negatively stained with 2% (w / v) uranium acetate for 5 min, and then allowed to stand at room temperature for 5 min. Excess stain was then gently blotted off with sterile filter paper, and the copper grid was allowed to air dry in a laminar flow hood to complete the staining process and for imaging.

[0085] Microscopic morphology observation of 6His-MjFer and 6His-rH-2 using TEM revealed that both exhibited a typical cage-like structure with a diameter of approximately 12 nm. Figure 11 As shown in (ab), this morphological feature is also a hallmark structural characteristic of ferritin family proteins, directly reflecting that 6His-MjFer and 6His-rH-2 possess the core structural features of ferritin. In this experiment, uranyl acetate was used to perform negative staining on the samples, resulting in a distinct black core region in the images. This black core region actually corresponds to the internal cavity of the cage-like structure of ferritin, while the surrounding bright ring is the protein shell of ferritin. Therefore, the black core appears in the images of 6His-MjFer and 6His-rH-2 samples.

[0086] (2) Dynamic light scattering (DLS) analysis Dynamic light scattering experiments were conducted using a size distribution analyzer to analyze the particle size of 6His-MjFer and 6His-rH-2. DLS technology was used to quantitatively determine the hydrated diameter (DH) of 6His-MjFer and 6His-rH-2 protein particles in aqueous solution, thereby analyzing the actual particle size and dispersion state of the two proteins in a natural aqueous environment. The relevant particle size distribution results are shown below. Figure 11As shown in (cd), the diameter of 6His-MjFer is 17.36 nm, and the diameter of 6His-rH-2 is 17.51 ​​nm. It can be seen that the particle size detection results of DLS are consistent with the morphology analysis results of TEM, both confirming that MjFer and rH-2 are nanoscale cage-like particles with similar particle sizes. This result further verifies from the perspective of solution phase particle size that 6His-MjFer and 6His-rH-2 possess the typical spherical structure and nanoscale size distribution properties of ferritin.

[0087] (3) Oxidative precipitation and reductive release experiments of ferritin Fe in ferritin was determined using a UV spectrophotometer. 2+ The rapid oxidation kinetics were determined. 1 mL of ferritin solution (0.5 μM, pH 7.4) was added to a 4 mL quartz cuvette, along with 5 μL of FeSO4 solution and 550 μL of Tris-HCl buffer (pH 7.5, 20 mM). Fe was detected at 300 nm. 2+ Ferrite bridging compounds formed by oxidation. Data acquisition intervals were 0.1 s, total time 100 s, experimental temperature 25℃. The ferrite bridge exhibits UV absorption at 300 nm. The kinetic equation was obtained by fitting data using Origin 2024 software; the fitted equation is a third-order polynomial: Y = A0 + A1t + A2t 2 +A3t 3 (Where: t is the reaction time (s), Y is the concentration of the ferrite bridge at time t, A0 is the initial concentration of the ferrite bridge; A1 is the initial reaction rate; A2 is the coefficient of the reaction acceleration term; A3 is the coefficient of the reaction curvature change term; R) 2 (This is the coefficient of determination.) The reductive kinetics of ferritin were determined using a UV spectrophotometer. A certain amount of FeSO4 solution (4 μL, 100 mM) was added to 1 mL of ferritin solution (0.5 μM, pH 7.4) and allowed to stand in the dark for 30 min. 1 mL of the above mixture was then injected into a 4 mL cuvette, followed by 550 μL of Tris-HCl buffer (pH 7.5, 20 mM), 100 μL of phenoxyazine (1 mM), and finally 15 μL of ascorbic acid (300 μM). [Fe(ferrozine)3] was measured at 562 nm. 2+ The content of Fe reflects the content of Fe. 3+ The reduction and release of Fe(II) was observed. Data acquisition intervals were 0.5 s, with a total time of 1200 s and an experimental temperature of 25℃. The product formed by Fe(II) and Ferrozine is [Fe(ferrozine)3]. 2+There is ultraviolet absorption at 562 nm. The kinetic equation can be obtained by fitting the data using Origin 2024 software. The fitted equation is a third-order polynomial: Y = A0 + A1t + A2t 2 +A3t 3 (Where: t is the reaction time (s), Y is the concentration of the ferrite bridge at time t, A0 is the initial background value; A1 is the initial reduction release rate; A2 is the coefficient of the reaction acceleration term; A3 is the coefficient of the reaction curvature change term; R) 2 (This is the coefficient of determination.) Iron oxide precipitation refers to the catalytic oxidation of Fe by an oxidant (oxygen molecules or hydrogen peroxide) in the system. 2+ Oxidation to form Fe 3+ The process by which ferritin enriches and stores iron oxide mineralization nuclei within the protein lumen, ultimately forming these mineralization nuclei. Figure 12 (a) Visually demonstrates the catalytic effects of 6His-MjFer and 6His-rH-2 on Fe. 2+ The time-dependent dynamic changes in oxidation clearly reflect the effects of the two proteins on Fe at different reaction times. 2+ The oxidation process and trend of Fe. 12(b) then discusses the Fe of both. 2+ The oxidation rate was quantitatively calculated and directly compared. The oxidation precipitation rate of 6His-MjFer was significantly higher than that of 6His-rH-2, demonstrating stronger ferrous oxidation catalytic efficiency and iron ion storage capacity. Both proteins exhibited typical ferritin ferrous oxidation precipitation characteristics.

[0088] The release of iron from ferritin refers to the reduction-induced release of Fe. 3+ Reduced to Fe 2+ and the generated Fe 2+ Iron is released from within the ferritin cage to the outside. The time-dynamic curve of iron release obtained in this experiment is shown below. Figure 13 As shown in (a), the curve can intuitively reflect the dynamic change trend of iron ion release from 6His-MjFer and 6His-rH-2 under the action of ascorbic acid with reaction time, clearly demonstrating the overall process, release potential and reaction steady-state characteristics of iron release from the two proteins. Figure 13 (b) Quantitative calculations and direct comparisons were made of the reduction and release rates of the two proteins. The reduction and release rate of 6His-MjFer was slightly higher than that of 6His-rH-2. This may be due to slight differences in the iron core stability and lumen iron ion release efficiency of the two recombinant ferritins. Both proteins exhibit typical ferritin reduction and release characteristics.

[0089] Table 1. Strains used in this experiment

[0090] Table 2. Plasmids used in this experiment

[0091] Table 3. Instruments used in this experiment

[0092] Table 4 Primers designed in this experiment

[0093] Table 5. Screening promoter and signal peptide sequences of this invention

[0094] Table 6 Genomic DNA Removal Reaction System

[0095] Table 7 Reverse transcription reaction system

[0096] Table 8 qPCR reaction system

[0097] Table 9 qPCR reaction procedure

[0098] 1. The host strain used in this invention is Bacillus subtilis WB600. Compared with the host strain Escherichia coli used in CN202210920629.2, Bacillus subtilis WB600 is a generally recognized safe (GRAS) strain, while Escherichia coli is a non-food grade strain that may pose a risk of pathogenicity. This invention fundamentally solves the safety problem of ferritin in the fields of food and health products, which is a core advantage that the Escherichia coli system cannot match.

[0099] 2. This invention adopts a secretory expression strategy, in which the protein is directly secreted into the culture medium. High-purity protein can be obtained by centrifugation and one-step Ni affinity chromatography. In CN202210920629.2, E. coli is expressed intracellularly, which requires cell disruption, centrifugation to remove fragments, multi-step chromatographic purification, and refolding. The steps of this invention are simpler, the cycle is shorter, and the loss is lower.

[0100] 3. This invention is the first to achieve efficient secretory expression of ferritin in Bacillus subtilis, filling a technological gap in this field.

[0101] 4. This invention establishes a systematic expression element screening strategy (promoter + signal peptide combination optimization).

[0102] 5. This invention innovatively adopts a dual modification strategy for chassis strains (csaA overexpression + dltD knockout synergistic regulation), which is more efficient.

[0103] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. A method for expressing and purifying ferritin in Bacillus subtilis, characterized in that: The method uses food-grade Bacillus subtilis strain WB600 as the host and achieves efficient secretory expression of Penaeus japonicus ferritin (MjFer) and H-2 type soybean ferritin (H-2) through synergistic regulation of expression element screening, chassis strain modification, and induction condition optimization. The expression element screening includes promoter screening and signal peptide screening; the chassis strain modification includes dltD gene knockout and csaA molecular chaperone gene overexpression; and the induction condition optimization includes optimization of induction time, induction temperature, and IPTG concentration.

2. The expression and purification method according to claim 1, characterized in that: The promoter selection process uses the inducible promoter P. grac ; Alternatively, the signal peptide screening is performed using the ybdN signal peptide, and the purification yields of 6His-MjFer and 6His-rH-2 expression guided by the ybdN signal peptide are 6.75 mg / L and 4.42 mg / L, respectively.

3. The expression and purification method according to claim 1, characterized in that: The csaA molecular chaperone gene overexpression was achieved by replacing the natural promoter of the csaA gene with the strong promoter Pc2up. Overexpression of the csaA gene increased the purification yield of 6His-MjFer by 42% and 6His-rH-2 by 24%. Alternatively, the dltD gene knockout is performed using CRISPR-Cas9 gene editing technology to knock out the dltD gene. Knocking out the dltD gene increases the expression and purification yield of 6His-MjFer by 10% and 6His-rH-2 by 40%.

4. The expression and purification method according to claim 1, characterized in that: In the optimization of induction conditions, the induction conditions for 6His-MjFer are: IPTG concentration of 0.5 mmol / L, induction time of 24 h, and induction temperature of 30℃; the induction conditions for 6His-rH-2 are: IPTG concentration of 1.5 mmol / L, induction time of 24 h, and induction temperature of 30℃.

5. The expression and purification method according to claim 1, characterized in that: The method further includes a protein purification step, which uses Ni SepHarose. TM 6. Affinity chromatography purification was performed using a gravity chromatography column filled with Fast Flow packing material.

6. The expression and purification method according to any one of claims 1 to 5, characterized in that: The method specifically includes the following steps: (1) Promoter screening: Recombinant expression vectors containing different promoters were constructed, and the transcription level was detected by qPCR to screen for promoter P. grac ; (2) Signal peptide screening: at promoter P grac Based on this, recombinant expression vectors containing different signal peptides were constructed, and the signal peptide ybdN was screened out by Western blotting and protein quantification analysis. (3) Chassis strain modification: CRISPR-Cas9 gene editing technology was used to construct csaA overexpression strains and dltD knockout chassis strains; (4) Construction of recombinant strains: The selected strains containing promoter P grac The expression vector for the signal peptide ybdN was transformed into the modified chassis strain; (5) Induced expression: Induced expression is performed under induction conditions; (6) Protein purification: The target protein was purified by affinity chromatography.

7. The expression and purification method according to claim 6, characterized in that: The induction conditions for 6His-MjFer in step (5) are IPTG concentration of 0.5 mmol / L, induction time of 24 h, and induction temperature of 30℃; the optimal conditions for 6His-rH-2 in step (5) are IPTG concentration of 1.5 mmol / L, induction time of 28 h, and induction temperature of 30℃.

8. A method for analyzing the physicochemical properties of ferritin obtained by the expression and purification method according to any one of claims 1 to 6, characterized in that: The method includes transmission electron microscopy (TEM) observation, dynamic light scattering (DLS) analysis, iron oxide precipitation experiment, and reduction release experiment.

9. The physicochemical property analysis method according to claim 8, characterized in that: The transmission electron microscopy (TEM) observations showed that both recombinant 6His-MjFer and 6His-rH-2 exhibited typical cage-like structures with diameters of 12-17.5 nm. Alternatively, the dynamic light scattering DLS analysis showed that the hydration diameter of 6His-MjFer was 17.36 nm and the hydration diameter of 6His-rH-2 was 17.51 ​​nm. Alternatively, the iron oxide precipitation experiment was performed by detecting Fe at 300 nm using a UV spectrophotometer. 2+ The ferrite-bridging compound formed by oxidation, and the reduction-release experiment, were measured at 562 nm using a UV spectrophotometer [Fe(ferrozine)3]. 2+ The content reflects the Fe 3+ The restoration and release.

10. The physicochemical property analysis method according to claim 8 or 9, characterized in that: The recombinant ferritin was either recombinant 6His-MjFer or recombinant 6His-rH-2. The purification yield of recombinant 6His-MjFer was 12.35 mg / L, and the purification yield of recombinant 6His-rH-2 was 7.01 mg / L.

Citation Information

Patent Citations

  • Preparation method of ferritin

    CN115948308A

  • High-yield hyaluronic acid bacillus subtilis strain for expressing hyaluronic acid synthase gene, construction method and application

    CN121538139A