Method for increasing seed germination rate under stress

By knocking out or downregulating the Arabidopsis HDP4 gene and regulating the stability of ABI5, the problem of low seed germination rate under adverse conditions was solved, and the seed germination rate and germination speed were significantly improved.

CN122445690APending Publication Date: 2026-07-24CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Filing Date
2025-01-23
Publication Date
2026-07-24

Smart Images

  • Figure HDA0005255449900000011
    Figure HDA0005255449900000011
  • Figure HDA0005255449900000012
    Figure HDA0005255449900000012
  • Figure HDA0005255449900000021
    Figure HDA0005255449900000021
Patent Text Reader

Abstract

The application discloses application of HDP4 gene in regulating seed germination under adversity stress. The HDP4 gene can be used for regulating seed germination rate under adversity stress, and a HDP4 gene knockout strain shows a phenotype of fast seed germination in a high-salt and drought environment. The application can be used for solving the problem of low seed germination rate in the high-salt and drought environment, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology and relates to the application of the Harbinger transposon-derived protein 4 gene HDP4 as a target in improving the seed germination rate of plants under adverse conditions. Background Technology

[0002] Seed germination refers to the series of physiological and morphological changes that begin when a seed absorbs water and undergoes swelling under suitable conditions. In agricultural production, seed germination rates are easily affected by external environmental conditions, including high salinity and drought. Although inhibiting seed germination under abiotic stress is a protective mechanism for plants themselves, in actual production, this inhibition leads to a decrease in seedling emergence rate, ultimately affecting crop yield and quality. Therefore, identifying key genes controlling seed germination under abiotic stress and elucidating their mechanisms of action is of great significance for improving seed germination rates.

[0003] For example, patent document CN104911159A reports the expression of a plant stress-resistance-related protein TaWPK under the induction of abscisic acid, drought, high salt and salicylic acid. Overexpression of the TaWPK gene in Arabidopsis thaliana can improve seed germination rate and germination speed. Summary of the Invention

[0004] In our research on seed germination, we screened a gene that affects the germination rate and germination percentage of Arabidopsis seeds under abiotic stress. This gene was identified as HDP4 (Harbinger transposon-derived protein 4, AT3G19120), whose coding sequence is SEQ ID NO:1 (NCBI accession number NM_112799), encoding a Harbinger transposon-derived protein HDP4 (NCBI accession number NP_566626, amino acid sequence SEQ ID NO:2). Experiments confirmed that HDP4 protein mainly regulates seed germination under abiotic stress (drought, high salinity) by modulating the stability of the abscisic acid (ABA) core transcription factor ABI5. Knocking out HDP4 can improve the germination rate and germination percentage of seeds under abiotic stress. Based on this, the present invention provides the following technical solution.

[0005] This invention mainly provides the application of Harbinger transposon-derived protein 4 (HDP4) as a target to improve the germination rate of plant seeds under adverse conditions.

[0006] The aforementioned abiotic stresses especially refer to abiotic stress conditions in high-salt and / or arid environments.

[0007] In one embodiment, the HDP4 mentioned above is Arabidopsis-derived HDP4, namely AT3G19120 (NCBI accession number NP_566626, amino acid sequence as shown in SEQ ID NO:2) or its homologous protein, wherein the amino acid sequence of the homologous protein has more than 60%, preferably more than 65%, preferably more than 70%, preferably more than 75%, more preferably more than 80% homology (identity) with AT3G19120, and has the function of regulating the stability of the abscisic acid (ABA) core transcription factor ABI5.

[0008] The protein HDP4 mainly regulates seed germination under abiotic stress by modulating the stability of the abscisic acid (ABA) core transcription factor ABI5.

[0009] Preferably, the above-mentioned plants are crops that express HDP4, and the crops are selected from the group consisting of: soybeans, rapeseed, tomatoes, seed-propagated vegetables, cruciferous plants (such as tobacco, Arabidopsis thaliana), etc.

[0010] In one specific embodiment, the plant is Arabidopsis thaliana, and HDP4 is the Arabidopsis-derived HDP4, namely AT3G19120 (NCBI accession number NP_566626); the nucleotide sequence of its encoding gene HDP4 is SEQ ID NO:1, NCBI accession number NM_112799. This HDP4 can be represented as AtHDP4, and the encoding gene is represented as AtHDP4.

[0011] The preferred application method is to improve the germination rate and / or germination speed of plant seeds under abiotic stress by targeting the HDP4 gene, including the following steps: downregulating, inactivating, weakening or knocking out the expression of the HDP4 gene in the chromosomes of wild-type plants.

[0012] The above-mentioned methods for improving the germination rate and / or germination rate of plant seeds under abiotic stress can be implemented in the following ways:

[0013] (1) Knock out the HDP4 gene in the chromosomes of wild-type plants;

[0014] (2) Down-regulate the expression level of the HDP4 gene in wild-type plants;

[0015] (3) Replace the HDP4 gene in the chromosomes of wild-type plants with a mutant of the HDP4 gene that has lost its coding function or whose expression is downregulated; and / or

[0016] (4) Block, inhibit or interfere with the expression of the HDP4 gene in wild-type plants.

[0017] Furthermore, the above method (2) can be selected from the following group:

[0018] (2-1) Mutations in the promoter region and / or coding region of the HDP4 gene lead to downregulation of the expression level of the HDP4 gene;

[0019] (2-2) Mutations in the upstream regulators of the HDP4 gene lead to downregulation of HDP4 gene expression; or

[0020] (2-3) Introduce HDP4 interacting proteins into wild-type plants to alter the function of HDP4 proteins.

[0021] In one specific implementation, the mutation in the coding region described in the above method (2-1) is a frameshift mutation, which leads to the inactivation or loss of function of HDP4.

[0022] In one embodiment, the HDP4 mutant described in method (3) above can be hdp4-1 or hdp4-2 as described in the examples. Both mutants hdp4-1 and hdp4-2 are T-DNA insertion lines, and the insertion site is the exon region of the HDP4 gene. Semi-quantitative detection confirmed that they are mutants that inactivate protein function.

[0023] Optionally, the above methods (1), (2), (3) and / or (4) are implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation.

[0024] While it is theoretically possible to improve seed germination tolerance by overexpressing exogenous mutant forms of the HDP4 gene, such as hdp4-1 or hdp4-2, the steps of downregulating, inactivating, weakening or knocking out HDP4 expression in wild-type plants are preferably implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation, considering that overexpression of exogenous genes often leads to abnormal plant physiological homeostasis.

[0025] In one implementation, the gene editing technology described above may be selected from the group consisting of: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0026] This invention newly discovers that the HDP4 gene negatively regulates seed germination in plants under adverse conditions. Experiments have confirmed that knocking out the HDP4 gene can promote seed germination in crops under adverse conditions such as drought. Improving seed germination in crops under abiotic stress through the genetic methods of this invention can be used to solve the problem of low seed germination rates in high-salt and drought environments. It is highly efficient, stable, and economical, and has promising prospects for widespread application. Attached Figure Description

[0027] Figure 1 The identification of HDP4 gene mutants hdp4-1 and hdp4-2 is shown.

[0028] Figure 2 Germination morphology of hdp4-1 and hdp4-2 mutant seeds on ABA, NaCl and mannitol media is shown.

[0029] Figure 3 Germination morphology of seeds overexpressing the HDP4 gene is shown on ABA and NaCl media.

[0030] Figure 4 The germination phenology of rice seeds overexpressing the AtHDP4 gene was shown on ABA medium. Detailed Implementation

[0031] The N-terminus (amino acids 1-98) of the Arabidopsis-derived protein HDP4 has two unique α-helical structures. By comparing the amino acid sequences and combining the presence of two α-helices at the N-terminus, we found that HDP4 homologous proteins exist in crops such as soybean, rapeseed, and tomato.

[0032] Based on the function of the Arabidopsis thaliana AtHDP4 gene in negatively regulating seed germination stress tolerance, it is reasonable to expect that the germination rate and / or germination speed of seeds in wild-type crops containing HDP4 homologous proteins may be improved under abiotic stress after the HDP4 gene is knocked out or its expression is suppressed.

[0033] As used in this article, the term "wild-type (WT)" refers to the original plant with a normal phenotype and expressing the normal HDP4 gene. Correspondingly, the terms "plant mutant," "plant mutant strain," "transgenic plant," and "genetically engineered plant" in this article have the same meaning, all referring to plants that have been genetically engineered to have seed germination tolerance after the HDP4 gene has been knocked out or suppressed, whether they are wild-type plants or original plants with a normal phenotype.

[0034] The aforementioned abiotic stresses specifically refer to high-salt and arid environmental conditions. In the examples, a high-salt environment is created using soil containing a high concentration of sodium chloride (NaCl); an arid environment is created using water-deficient soil or soil containing a certain concentration of abscisic acid (ABA). Abscisic acid, also known as natural abscisic acid, is a plant hormone that inhibits growth, named for its ability to induce leaf abscission; it is likely widely distributed in higher plants. Besides inducing leaf abscission, ABA has other functions, such as inducing seed dormancy, promoting tuber formation in potatoes, and inhibiting cell elongation. Natural abscisic acid, along with auxins, ethylene, gibberellins, and cytokinins, is considered one of the five major plant hormones.

[0035] In some implementations, the term "(seed germination rate / germination rate) improvement" or "enhancement" may mean an improvement of at least 10% compared to a reference level (such as normal plants), for example, an improvement of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any improvement between 10% and 100%, or an improvement of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.

[0036] In this document, for the sake of simplicity, the names of a protein, such as HDP4, and its encoding gene (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they represent different substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, when describing the function or category of a Harbinger transposon-derived protein (NCBI accession number NP_566626), HDP4 refers to the protein; when described as a gene, it refers to the gene encoding that protein (NCBI accession number NM_112799).

[0037] There are various techniques for inactivating, attenuating, and / or preventing the expression of genes such as HDP4 in plants. These techniques can be used individually or in combination. For example, one inactivation method is to mutate the HDP4 encoding gene, causing an alteration in the amino acid sequence of the polypeptide and / or termination of translation.

[0038] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0039] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the invention.

[0040] Example

[0041] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0042] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0043] The molecular biology experiments in this embodiment, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were both performed according to Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments if necessary.

[0044] PCR amplification experiments are performed according to the plasmid or DNA template and the reaction conditions or kit instructions provided by the supplier. Adjustments can be made through simple experiments if necessary.

[0045] The primer synthesis and gene sequencing in this embodiment were commissioned to Sangon Biotech (Shanghai) Co., Ltd. and BGI Genomics.

[0046] Molecular biology methods, including the construction of CRISPR-Cas9 system plasmids with HDP4 gene knockout and gene editing technology, and transgenic plant construction methods are carried out using techniques commonly used in this field.

[0047] Example 1: Screening and cloning of the HDP4 gene

[0048] Eleven Harbinger transposon-derived proteins exist in Arabidopsis thaliana. Through structural prediction and evolutionary analysis of these proteins, we discovered that the previously unreported biological function of the HDP4 (AT3G19120) gene is highly expressed in seeds. The HDP4 protein contains two exposed hydrophobic α-helical structures at its N-terminus, a structure first observed in terrestrial bryophytes. Observation of the subcellular localization of HDP4 protein in seeds revealed that only HDP4 among the Harbinger transposon-derived proteins can form intracellular aggregates upon water exposure. Furthermore, the aggregation of HDP4 protein with the two hydrophobic α-helical structures deleted upon water exposure was significantly reduced. Therefore, we hypothesize that this protein is related to the evolution of plants from aquatic to terrestrial environments and participates in controlling seed germination in terrestrial settings. Based on the importance of HDP4 protein in controlling seed germination, we conducted an in-depth study on the mechanism of action of HDP4 (AT3G19120) protein in controlling seed germination.

[0049] The following examples focus on the relationship between the gene HDP4 (AT3G19120) and seed germination.

[0050] Example 2: Identification of hdp4 mutants

[0051] Two HDP4 gene T-DNA mutants, hdp4-1 (SALK_027245) and hdp4-2 (SALK_132948), were obtained from the Arabidopsis Seed Resource Center (ABRC). Genomic DNA was extracted from the wild-type (Columbia, Col-0) and the two mutants using the SDS method. Primers were designed as follows:

[0052] hdp4-1-LP: 5'-CCGTACTTGCAACCGTAAATG-3',

[0053] hdp4-1-RP: 5'-TAAATGGTTGCAACTTGTTGG-3'.

[0054] hdp4-2-LP: 5'-ACTCTCAACCTCTCCGGAGAG-3',

[0055] hdp4-2-RP: 5'-AATCCAATAGCTTCCACCACC-3'.

[0056] T-DNA insertion identification was performed on the two mutants, such as... Figure 1 Both mutants shown have T-DNA insertions in the coding region of the HDP4 gene.

[0057] Wild-type, hdp4-1, and hdp4-2 mutant seedlings were ground with liquid nitrogen and total RNA was extracted using the Eastep Total RNA Super Extraction kit (Promega). The total RNA was then reverse transcribed into cDNA using the HiScript II 1st strand cDNA Synthesis + gDNA wiper kit (Vazyme). Primers HDP4-RT-F (5'-ATGGAAGAAGCTTTCATGGC-3') and HDP4-RT-R (5'-CCTCGAGGAGAGTCTCTGGT-3') were designed based on the sequence in SEQ NO.1 to amplify the cDNA by PCR. The amplified products were subjected to agarose gel electrophoresis. The results showed that the mRNA level of the HDP4 gene was significantly decreased in both mutants.

[0058] Example 3: HDP4 gene mutation promotes seed germination under abiotic stress conditions

[0059] Wild-type, hdp4-1, and hdp4-2 plants were grown at 22°C, 50% relative humidity, and a light intensity of 120 μmol / m². -2 s -1Seeds were cultured in the same batch under long-day conditions (16 hours light / 8 hours darkness). After full maturity, the seeds were harvested and dried in a 28°C oven for one week, then sealed and stored at 4°C. Wild-type, mutant hdp4-1, and hdp4-2 seeds were disinfected with 15% sodium hypochlorite for 10 minutes and washed three times with sterile distilled water. The seeds were then sown on MS medium (8% agar, sucrose-free) with or without 1 μM ABA, 180 mM NaCl, and 300 mM mannitol, and incubated at 4°C for 3 days. The plates were then placed at 22°C under a light intensity of 100 μmol / m². -2 s -1 Seeds were cultured in a long-day (16 hours light / 8 hours dark) incubator, with germination defined as the emergence of the radicle from the seed coat. Germination rate was recorded after three days of culture, and the proportion of cotyledons turning green was recorded after seven days. The results showed that the seed germination rate and cotyledon greening rate of the two hdp4 mutants on MS medium were consistent with the wild type, while the seed germination rate and cotyledon greening rate on ABA, NaCl, and mannitol plates were significantly higher than those of the wild type.

[0060] Based on the sequences of SEQ ID NO:1 and HDP4 gene promoter SEQ ID NO:3, the following primers were designed:

[0061] gHDP4-EcoRI-F:

[0062] 5'-TATGACCATGATTAC GAATTC CAGTGATGCCAAACTCGGAC-3', and

[0063] gHDP4-XbaI-R:

[0064] 5'-TGGTACTAGTGTCGAC TCTAGA CCTCGAGGAGAGTCTCTGGT-3'.

[0065] The HDP4 gene promoter and CDS sequence were amplified using wild-type genomic DNA as a template. After verifying the size of the amplified product by agarose gel electrophoresis, the target fragment was recovered and loaded into the plant expression vector pCambia1300-eGFP via homologous recombination. Single clones were selected, and plasmids were extracted. Plasmids with correct sequencing were transformed into Agrobacterium GV3101 competent cells. Single clones of Agrobacterium were selected and cultured overnight at 200 rpm (28℃) in 4 mL of LB broth containing antibiotic resistance (50 mg / L kanamycin + 40 mg / L rifampin). 1 mL of the bacterial culture was transferred to 100 mL of LB broth containing antibiotic resistance and cultured at 200 rpm until OD200. 600=1.5, centrifuge to collect bacterial cells, and resuspend the cells in 100 mL of Arabidopsis thaliana infection solution (MS + 4% sucrose + 0.05% Silwet L-77). After being placed at room temperature in the dark for 3 hours, infect the inflorescences of the mutant hdp4-1. After infection, the plants are kept moist and in the dark for 24 hours before being transferred to normal growth conditions. After the seeds of the infected plants are fully mature, the harvested seeds are disinfected with 15% sodium hypochlorite for 15 minutes, washed three times with sterile distilled water, resuspended in 0.1% agarose, and spread evenly on MS culture plates (25 mg / L hygromycin + 100 mg / L termethin). After being placed at 4°C for 3 days, they are transferred to an incubator for cultivation. Plants that grow normally on the culture medium are transgenic positive plants containing resistance. Positive seedlings are transplanted into the substrate to continue growing. After 2 weeks, total protein is extracted from the plants, and the expression level of HDP4 protein is detected using GFP antibody. Individual plants expressing the protein are selected for seed collection. After sterilization, T2 generation transgenic seeds were sown on MS medium containing hygromycin. If the ratio of normally growing to growth-inhibited plants was 3:1, it was considered a single copy. These plants were then transplanted into the substrate to continue growing and were then harvested. After sterilization, T3 generation seeds were sown on MS medium containing hygromycin. If all plants grew normally, they were considered homozygous supplementary lines of hdp4-1.

[0066] Seeds from the same batch of harvested wild-type, hdp4-1 mutant, and two independent hdp4-1 mutant replacement lines were collected, sterilized, and then sown on MS plates (8% agar, sucrose-free) with or without 180 mM NaCl, and incubated at 4°C for 3 days. Culture conditions and statistical methods were the same as above. Figure 2 As shown in the figure. The results showed that the germination rate of seeds from the hdp4-1 mutant replacement line on NaCl was not significantly different from that of the wild type, indicating that loss of function of the HDP4 gene can promote seed germination under adverse conditions.

[0067] Example 4: HDP4 gene overexpression inhibits seed germination under stress conditions

[0068] Based on the sequence of SEQ ID NO:1, the following amplification primers were designed:

[0069] HDP4-F:

[0070] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAAGAAGCTTTCATG GC-3', and

[0071] HDP4-R:

[0072] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCCTCCCTCGAGGAGAGTCTCTGG T-3'.

[0073] Using the above wild-type transcript as a template, the CDS sequence of the HDP4 gene was amplified by PCR. The amplified product fragment size was determined by agarose gel electrophoresis. After recovering the amplified fragment, the HDP4 gene CDS sequence (SEQ ID NO:1) was loaded into pDONAR207 (Invitrogen) via BP reaction. Clones with correct fragment sequencing were then loaded into the plant expression vector pEarleyGate101 via LR reaction to construct pEarleyGate101-HDP4. Single clones were selected to extract plasmids. The plasmids of clones with correct sequencing were transformed into Agrobacterium GV3101 (Arabidopsis thaliana transformation) and Agrobacterium tumefaciens EHA105 (rice transformation) competent cells.

[0074] (1) Germination of Arabidopsis seeds overexpressing HDP4 is sensitive to ABA and NaCl.

[0075] Using wild-type Arabidopsis thaliana as the recipient material, the pEarleyGate101-HDP4 plasmid was transformed into Arabidopsis thaliana. Transformation and identification of the Arabidopsis thaliana were performed as described above. Seeds from the same harvest of wild-type Arabidopsis thaliana and the HDP4 gene overexpression line were collected, sterilized, and sown on MS plates (8% agar, sucrose-free) with or without 0.5 μM ABA or 180 mM NaCl, and incubated at 4°C for 3 days. Culture conditions and statistical methods were the same as described above. Figure 3 As shown in the figure. The results showed that the germination rate of seeds overexpressing the HDP4 gene was significantly lower than that of wild-type seeds under ABA and NaCl treatments, indicating that HDP4 can inhibit seed germination under abiotic stress.

[0076] (2) Heterologous overexpression of the Arabidopsis HDP4 (AtHDP4) gene increases the sensitivity of rice seeds to ABA during germination.

[0077] Since the homologous protein of HDP4 is absent in rice, the AtHDP4 gene was heterologously overexpressed in the rice variety ZH11. The resulting T1 generation transgenic plants were observed for fluorescence signals in their roots using a laser confocal microscope. The HDP4 protein showed significant aggregation within the plant. Lines exhibiting this aggregation were selected and planted in the transgenic experimental field at the Shanghai Songjiang Experimental Base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences. The harvested T2 generation seeds were screened with the herbicide Basta. Seedlings with a root-to-non-root segregation ratio of 3:1 were identified as single-copy lines. These single-copy lines were planted at the Sanya Experimental Base of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, Hainan Province. After individual seed harvesting, homozygous lines were obtained through Basta screening. Seeds from the same batch of wild-type ZH11 and AtHDP4 gene overexpression lines were disinfected with 30% sodium hypochlorite for 20 minutes, washed three times with sterile distilled water, and each material was divided into two portions and transferred to separate petri dishes containing sterile water or 5 μM ABA solution. Cultured at 28℃ under short-day conditions (14 hours light / 10 hours darkness) for 5 days, and count the number of seeds that have developed radicles. Figure 4 As shown in the figure. The results showed that the germination rate of rice seeds overexpressing the AtHDP4 gene was lower than that of wild-type ZH11, indicating that heterologous overexpression of the AtHDP4 gene can inhibit the germination of rice seeds under ABA treatment.

[0078] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of Harbinger transposon-derived protein 4 (HDP4) as a target in improving the germination rate of plant seeds under stress conditions.

2. The application as described in claim 1, characterized in that, The HDP4 is Arabidopsis-derived HDP4, namely AT3G19120 (NCBI accession number NP_566626, amino acid sequence as shown in SEQ ID NO:2), or a homologous protein from other crops. The amino acid sequence of the homologous protein is more than 60% similar to that of AT3G19120 and has the function of regulating the stability of the abscisic acid (ABA) core transcription factor ABI5.

3. The application as described in claim 1, characterized in that, The plant is a crop that expresses HDP4, and the crop is selected from the group consisting of: soybean, rapeseed, tomato, seed-propagated vegetables, cruciferous plants such as tobacco, and Arabidopsis thaliana.

4. The application as described in claim 3, characterized in that, The plant in question is Arabidopsis thaliana, and HDP4 is the Arabidopsis-derived HDP4, namely AT3G19120. The nucleotide sequence of the encoding gene HDP4 is SEQ ID NO:1, and the NCBI accession number is NM_112799.

5. The application as described in claim 1, which is a method for improving the germination rate and / or germination speed of plant seeds under abiotic stress by targeting the HDP4 gene, characterized in that, Includes the following steps: It can downregulate, inactivate, weaken, or knock out the HDP4 gene expression in the chromosomes of wild-type plants.

6. The application as described in claim 5, characterized in that, Improving the germination rate and / or germination rate of plant seeds under abiotic stress can be achieved through the following methods: (1) Knock out the HDP4 gene in the chromosomes of wild-type plants; (2) Down-regulate the expression level of the HDP4 gene in wild-type plants; (3) Replace the HDP4 gene in the chromosomes of wild-type plants with a mutant HDP4 gene that has lost its coding function or whose expression level is downregulated; and / or (4) Block, inhibit or interfere with the expression of the HDP4 gene in the chromosomes of wild-type plants.

7. The application as described in claim 6, characterized in that, Method (2) is selected from the following group: (2-1) Mutations in the promoter region and / or coding region of the HDP4 gene lead to downregulation of HDP4 gene expression level; (2-2) Mutations in the upstream regulatory factors of the HDP4 gene lead to downregulation of HDP4 gene expression; or (2-3) Introduce HDP4 interacting proteins into wild-type plants to alter the function of HDP4 proteins.

8. The application as described in claim 7, characterized in that, The mutation in the coding region described in method (2-1) is a frameshift mutation, which leads to the inactivation or loss of function of HDP4.

9. The application as described in claim 6, characterized in that, The methods (1), (2), (3) and / or (4) are implemented through gene editing technology, antisense nucleic acid, and transcriptional regulation.

10. The application as described in claim 8, characterized in that, The gene editing technologies are selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.