Rice plant height regulation gene osmyb44l and application thereof in regulating rice plant height

Abstract

The application discloses a rice plant height regulating gene OsMYB44L and application thereof. The application provides application of a protein OsMYB44L, a DNA molecule coding the protein OsMYB44L or a recombinant vector containing the DNA molecule coding the protein OsMYB44L in regulating plant height. The application knocks out the gene OsMYB44L in wild-type rice to obtain transgenic rice. Compared with the receptor rice, the OsMYB44L gene in the transgenic rice is knocked out, and the plant height is significantly reduced, thereby laying a foundation for cultivating transgenic plants with ideal plant height.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of the rice gene OsMYB44L in regulating rice plant height. Background Technology

[0002] Rice is the staple food for more than half of the world's population, and its yield is directly related to food security. Plant height is an important agronomic trait affecting rice yield potential and population structure, mainly determined by the number of internodes and the division and elongation of internode cells. Due to its internode-specific regulatory characteristics, plant height has also become one of the ideal model traits for studying organ-scale development regulation. In production practice, traditional tall rice varieties are highly dependent on environmental resources, have poor lodging resistance, low light energy utilization efficiency, and significant harvest losses. In contrast, dwarf rice varieties have strong lodging resistance, a significant advantage in resource utilization efficiency, and can effectively reduce grain loss and improve production stability. Therefore, systematically identifying and characterizing genes related to rice plant height regulation and deeply analyzing their molecular mechanisms of action are of significant theoretical and practical value for improving the genetic regulation theory of rice plant height, guiding the design of ideal plant types, and breeding high-yield and stable-yield varieties.

[0003] Genetic improvement of rice plant height helps enhance its lodging resistance, optimize plant canopy structure, improve canopy light utilization efficiency and harvest index, thereby achieving synergistic improvement of lodging resistance and high yield. With the rapid development of gene editing technology, targeted regulation of agronomic traits through site-specific modification of key functional genes has become an important strategy for crop genetic improvement. The OsMYB44L gene belongs to the R2R3-MYB transcription factor subfamily. Previous research on this family of transcription factors has mainly focused on rice secondary metabolism and stress adaptation, but whether they are involved in the regulation of rice plant height has not been systematically reported. This invention utilizes CRISPR / Cas9 gene editing technology to knock out the OsMYB44L gene, finding that it significantly reduces rice plant height, indicating that genetic improvement of rice plant height can be achieved through gene editing. Summary of the Invention

[0004] The inventors discovered that knocking out the OsMYB44L gene in rice plants significantly reduced plant height, thus successfully altering the target plant height. Experiments demonstrated that knocking out the OsMYB44L gene in wild-type rice yields transgenic rice with reduced plant height. Compared to the recipient rice, the knockout of the OsMYB44L gene in transgenic rice resulted in a significantly reduced plant height. Therefore, the OsMYB44L gene is associated with plant height, laying the foundation for cultivating transgenic plants with ideal plant types.

[0005] This invention provides the application of the OsMYB44L gene in regulating rice plant height or in preparing transgenic rice with reduced or increased plant height. The application involves overexpressing or knocking out the OsMYB44L gene in rice, thereby reducing or increasing the plant height of rice accordingly.

[0006] The gene OsMYB44L encodes the amino acid sequence shown in SEQ ID NO.2, or a protein that has the same function by substitution and / or deletion and / or addition of one or more amino acid residues.

[0007] Specifically, the gene OsMYB44L has a nucleotide sequence as shown in SEQ ID No. 1 or a degenerate sequence thereof; or a nucleotide sequence as shown in SEQ ID No. 3 or a degenerate sequence thereof.

[0008] This invention provides a biological material comprising an sgRNA sequence capable of targeted knockout of the OsMYB44L gene, wherein the biological material is any one of (a) to (c):

[0009] (a) Expression box;

[0010] (b) Recombinant vector;

[0011] (c) Recombinant prokaryotic cells;

[0012] The sgRNA is designed for the gene OsMYB44L, specifically with the sequence CGATGGAAGCACGTCAGC or GCCACCGATGGAAGCACG.

[0013] Specifically, the recombinant vector uses plasmid pCas9 as the vector.

[0014] More specifically, the recombinant prokaryotic cells are selected from Agrobacterium as host cells; preferably, the Agrobacterium is EHA105.

[0015] The present invention further provides the application of the aforementioned biomaterials in the preparation of transgenic rice with reduced or increased plant height.

[0016] The present invention also provides a method for preparing transgenic rice with reduced or increased plant height relative to the starting rice, comprising overexpressing or knocking out the rice gene OsMYB44L, thereby reducing or increasing the plant height of the rice accordingly.

[0017] Specifically, the endogenous rice gene OsMYB44L was knocked out using gene editing or homologous recombination techniques.

[0018] More specifically, plant tissues were transfected with the aforementioned biological materials, and plants with the OsMYB44L gene knockout mutant were obtained through screening.

[0019] Specifically, the rice variety mentioned is Nipponbare.

[0020] This invention knocks out the OsMYB44L gene in wild-type rice to obtain transgenic rice. Compared with the recipient rice, the OsMYB44L gene is knocked out in the transgenic rice, resulting in a significantly reduced plant height, laying the foundation for breeding transgenic plants with ideal plant height. This invention also further elucidates the molecular mechanism of plant height regulation and has significant theoretical and practical implications for cultivating high-quality, high-yield crop varieties through genetic engineering. Attached Figure Description

[0021] Figure 1 For pCas 9 Carrier map.

[0022] Figure 2 This section shows the principle and observation results of knocking out the OsMYB44L gene. A shows the sequence alignment of the knockout site coding sequence between wild-type rice Nipponbare and OsMYB44L gene knockout rice; B shows the plant morphology of wild-type rice Nipponbare and OsMYB44L gene knockout rice; and C shows the plant height statistics of wild-type rice Nipponbare and OsMYB44L gene knockout rice. Detailed Implementation

[0023] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0024] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0025] N6 culture medium was purchased from Phyto Technology Laboratories, USA, catalog number C167.

[0026] The rice variety Nipponbare (Oryza sativa) has been published in the literature “Li Z, Wan J, Xia J, et al. Mapping of quantitative trait loci controlling physico-chemical properties of rice grains (Oryza sativa L.). Breeding science, 2003, 53(3): 209-215”, and can be obtained by the public from relevant institutions and Jiangxi Agricultural University.

[0027] Agrobacterium tumefaciens EHA105 has been published in the literature “Hood, Elizabeth E, Gelvin, Stanton B, Melchers, Leo S, Hoekema, Andre. New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Research, 1993, 2(4):208-218”, and can be obtained by the public from relevant institutions and Jiangxi Agricultural University.

[0028] The pCas9 carrier is a commercial carrier, which can be obtained by the public through commercial channels or relevant institutions, or from Jiangxi Agricultural University.

[0029] This invention knocked out the coding genes of 156 transcription factors in Nipponbare using the pCas9 vector and found that knocking out the OsMYB44L gene significantly reduced the plant height of the offspring rice plants. The phenotype of this family was caused by the knockout of the OsMYB44L gene, indicating that the OsMYB44L gene plays an important role in regulating rice plant height.

[0030] Below are examples of the application of the OsMYB44L gene in the cultivation of transgenic plants with reduced plant height.

[0031] I. Construction of the gene knockout vector pCas9-OsMYB44L

[0032] 1. Cloning the nucleotide sequence of the OsMYB44L gene

[0033] Total RNA was extracted from wild-type Nipponbare cells and reverse transcribed into cDNA. Using the cDNA as a template, PCR amplification was performed using OsMYB44L-cds-F and OsMYB44L-cds-R primers. The PCR reaction mixture consisted of 25 μl of 2×KOD buffer, 4 μl of dNTPs, 1 μl each of 10 μM forward and reverse primers, 1 μl of KOD enzyme, 1 μl of template (cDNA), and ultrapure water to a final volume of 50 μl. The reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 10 s, 58℃ annealing for 30 s, 68℃ extension at 1 kb / min, 35 cycles, and a final extension at 68℃ for 5 min. A 570 bp (including the stop codon) full-length OsMYB44L cDNA sequence was obtained (as shown in SEQ ID No. 1), encoding 189 amino acids (as shown in SEQ ID No. 2).

[0034] The primers are as follows:

[0035] OsMYB44L-cds-F:5'-ATGGACATGGAGCTCTCCTCC-3' (SEQ ID No. 4);

[0036] OsMYB44L-cds-R:5'-GTGACCAACTAGCAAAAACCACTC-3' (SEQ ID No. 5).

[0037] 2. Obtaining the OsMYB44L mutant gene

[0038] Using CRISPR / Cas9 technology, the OsMYB44L mutant gene was constructed through knockout vector construction, transgenesis, and confirmation of the knockout site.

[0039] 2.1 Construction of the OsMYB44L gene knockout vector pCas9-OsMYB44L

[0040] The sgRNA sequence of the gene OsMYB44L was obtained by selecting bases 2286-2303 (CGATGGAAGCACGTCAGC, SEQ ID No. 6) and bases 2678-2699 (GCCACCGATGGAAGCACG, SEQ ID No. 7) on the exon sequence of the gene OsMYB44L in SEQ ID No. 3. The adapter sequences AGATGATCCGTGGCA (SEQ ID No. 8) and GTTTAGAGCTATGC (SEQ ID No. 9) of the pCas9 vector were added to the left and right sides of the sgRNA sequence, respectively, to obtain the forward primers pCas9-OsMYB44L-F (F1: AGATGATCCGTGGCACGATGGAAGCACGTCAGCGTTTTAGAGCTATGC, SEQ ID No. 10; F2: AGATGATCCGTGGCACGTGCTTCCATCGGTGGCGTTTTAGAGCTATGC, SEQ ID No. 10). Reverse primers pCas9-OsMYB44L-R (R1: GCATAGCTCTAAAACGCTGACGTGCTTCCATCGTGCCACGGATCATCT, SEQ ID No. 12; R2: GCATAGCTCTAAAACGCCACCGATGGAAGCACGTGCCACGGATCATCT, SEQ ID No. 13) were obtained through reverse complementation. The forward primer pCas9-OsMYB44L-F and the reverse primer pCas9-OsMYB44L-R were annealed on a PCR instrument. The annealing system consisted of 10 μM of each of the forward and reverse primers, diluted to 10 μM with water. The annealing temperature was 95℃ for 10 min, then decreased to 15℃ at 0.1℃ / s and held for 10 min to complete the annealing, yielding the sgRNA fragment sgRNA-OsMYB44L, ready for use.

[0041] The pCas9 vector was digested with the restriction endonuclease AarI, and the linear plasmid was recovered to obtain the large fragment of the vector. The pCas9 vector circular vector map is shown below. Figure 1 As shown. The linear plasmid and the sgRNA-OsMYB44L fragment were in-fusion ligated using Clontech's in-fusion enzyme (www.clontech.com, catalog number: ST0344) to obtain the recombinant plasmid, named pCas9-OsMYB44L.

[0042] 2.2 Obtaining pCas9-OsMYB44L rice

[0043] 2.2.1 Construction of recombinant bacteria

[0044] The recombinant plasmid pCas9-OsMYB44L was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium EHA105 / pCas9-OsMYB44L.

[0045] 2.2.2 Obtaining the OsMYB44L gene knockout mutant in rice

[0046] The EHA105 / pCas9-OsMYB44L was transferred into the callus tissue of mature embryos of rice Nipponbare (Oryza sativa) (hereinafter referred to as recipient rice). The specific steps are as follows:

[0047] (1) Recombinant Agrobacterium EHA105 / pCas9-OsMYB44L was cultured in suspension in liquid LB medium containing 50 μmol / L kanamycin to obtain OD 600nm ≈0.5% bacterial suspension.

[0048] (2) Take mature embryo callus from recipient rice and mix it with the bacterial suspension obtained in step (1). Infect for 30 min, dry the bacterial suspension with filter paper, and place the callus on co-culture medium (solid N6 medium containing 0.03924 mg / L acetylsuccinone) and culture at 24℃ for 3 days.

[0049] (3) The callus obtained in step (2) was inoculated onto solid N6 medium containing 150 mg / L 418 and cultured at 24°C for 16 days.

[0050] (4) Take the healthy callus obtained in step (3) and inoculate it onto solid N6 medium containing 200 mg / L 418. Culture at 24°C and subculture every 15 days.

[0051] (5) Take the healthy callus tissue obtained in step (4) and inoculate it onto differentiation medium (solid N6 medium containing 150 mg / L LG418, 2 mg / L kinetin and 0.05 mg / L naphthaleneacetic acid). Culture it at 24°C for 45 days (at this time, the height of the above-ground part of the plant is about 15 cm). Open the bottle mouth to harden the seedlings for 3 days, and then transfer them to the greenhouse for cultivation. This is the T0 generation plant.

[0052] 2.3 Identification of the OsMYB44L gene knockout mutant

[0053] Genomic DNA was extracted from T0 generation pCas9-OsMYB44l transgenic rice plants as templates, and PCR amplification was performed using OsMYB44l-cas9-F and OsMYB44l-cas9-R primers. The reaction system and amplification procedure were the same as those in step one, “cloning the nucleotide sequence of the OsMYB44l gene”.

[0054] The primers are as follows:

[0055] OsMYB44L-cas9-F: 5'-GCCTCGCCATGGAGAACG-3' (SEQ ID No. 14);

[0056] OsMYB44L-cas9-R: 5'-GGAAGAGCAGATCGTCGATCA-3' (SEQ ID No. 15).

[0057] The primer sequences OsMYB44L-cas9-F and OsMYB44L-cas9-R correspond to positions 2286-2303 bp and 2678-2699 bp (reverse complementary sequences) in SEQ ID NO. 3, respectively. The PCR amplification product is a 414 bp DNA fragment. The amplified DNA fragment sequence is compared with a reference sequence (positions 2286-2303 bp in SEQ ID NO. 3). If an insertion or deletion of bases occurs in the sgRNA sequence (positions 2480-2497 bp or 2475-2492 bp in SEQ ID NO. 3), and the number of inserted or deleted bases is not a multiple of 3, it indicates that a frameshift mutation has occurred in the coding sequence of the OsMYB44L gene in the plant genome, meaning that the OsMYB44L gene has been successfully knocked out, proving that the plant is an OsMYB44L knockout mutant.

[0058] III. Plant height survey of rice knockout mutant with gene OsMYB44L

[0059] The T0 generation of OsMYB44L rice knockout mutant was propagated to obtain the T1 generation plants. The T1 generation OsMYB44L rice knockout mutant was planted in Nanchang, Jiangxi Province. Plant height was measured and photographed, with plant height referring to the vertical distance from the base of the rice plant to the tip of the panicle. The observation results are as follows: Figure 2 As shown, WT represents wild-type rice Nipponbare, and OsMYB44L-crispr-1 and OsMYB44L-crispr-2 represent two OsMYB44L gene knockout mutant rice lines. Figure 2 (A) Figure 2 In section B, the plant type of rice is represented. Figure 2 In the middle, C represents the plant height statistics of rice materials in Nanchang. Compared with wild-type rice, the plant height of the OsMYB44L gene knockout mutants OsMYB44L-crispr-1 and OsMYB44L-crispr-2 was reduced by about 13 cm. Figure 2 (B and C). A t-test showed a significant difference in plant height between the mutant and the wild type. Figure 2 -C), meaning that the height of the rice plant was successfully altered.

Claims

1. The application of the OsMYB44L gene in regulating rice plant height or in preparing transgenic rice with reduced or increased plant height, characterized in that, The application includes overexpressing or knocking out the rice gene OsMYB44L in rice, thereby reducing or increasing the rice plant height accordingly. The gene OsMYB44L encodes an amino acid sequence as shown in SEQ ID NO.2, or a protein that has the same function by substitution and / or deletion and / or addition of one or more amino acid residues.

2. The application according to claim 1, characterized in that, The gene OsMYB44L has a nucleotide sequence as shown in SEQ ID No. 1 or a degenerate sequence thereof; or a nucleotide sequence as shown in SEQ ID No. 3 or a degenerate sequence thereof.

3. A biomaterial comprising an sgRNA sequence capable of targeted knockout of the OsMYB44L gene, characterized in that, The biological material is any one of (a) to (c): (a) Expression box; (b) Recombinant vector; (c) Recombinant prokaryotic cells; The sgRNA is designed for the gene OsMYB44L, specifically with the sequence CGATGGAAGCACGTCAGC or GCCACCGATGGAAGCACG.

4. The biomaterial according to claim 3, characterized in that, The recombinant vector used was plasmid pCas9.

5. The biomaterial according to claim 3, characterized in that, The recombinant prokaryotic cells are selected from Agrobacterium as host cells; preferably, the Agrobacterium is EHA105.

6. The use of the biomaterials according to any one of claims 3 to 5 in the preparation of transgenic rice with reduced or increased plant height.

7. A method for preparing transgenic rice with reduced or increased plant height relative to starter rice, characterized in that, This includes overexpressing or knocking out the rice gene OsMYB44L in rice, which in turn reduces or increases the height of the rice plant.

8. The method according to claim 7, characterized in that, The endogenous gene OsMYB44L in rice was knocked out using gene editing or homologous recombination techniques.

9. The method according to claim 8, characterized in that, Plant tissues were transfected with the biological material described in claim 4, and plants with the OsMYB44L gene knockout mutant were obtained by screening.

10. The method according to claim 8, characterized in that, The rice variety mentioned is Nipponbare.

Images