Ascl9 protein and its coding gene for regulating oat plant height

Abstract

The present application relates to the technical field of plant genetic engineering, and particularly relates to an AsSCL9 protein capable of regulating oat plant height and a coding gene thereof. As SCL9 The present application clones the AsSCL9 gene for the first time As SCL9 , and it is found that overexpression of the AsSCL9 gene can increase the plant height of oat by transforming oat plants through construction of an overexpression vector. Therefore, the present application provides a new molecular tool for regulating the plant height of oat, realizes directional improvement of the plant height of oat through precise gene regulation, provides effective technical support for solving the breeding predicament of oat and promoting high-quality development of the industry, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to an AsSCL9 protein that can regulate oat plant height and its encoding gene. Background Technology

[0002] oat( Avena sativa Oats (L.) belong to the genus *Avena* of the Poaceae family. They are annual dual-purpose crops for both food and forage, and a core cultivated forage variety with significant promotional value. This crop exhibits strong ecological adaptability, possessing outstanding resistance to drought, cold, salinity, and poor soil conditions, enabling it to grow normally in cold, infertile marginal lands. Furthermore, oats have excellent production performance, with stable and high forage yields, rich in nutrients such as crude protein and digestible fiber, and are highly palatable and readily utilized in feed. Given the current scarcity of high-quality forage resources, planting forage-grade oats can effectively alleviate the supply-demand imbalance of forage, playing an irreplaceable role in stabilizing feed supply and promoting the quality improvement, efficiency enhancement, and sustainable development of regional forage agriculture.

[0003] Plant height is a key agronomical trait determining the biomass accumulation of oat plants and has a highly significant positive correlation with forage yield. It has long been considered a primary target trait for high-yield genetic improvement of forage oats. Identifying and precisely defining key functional genes regulating oat plant height can provide important gene targets and theoretical support for molecular design breeding of forage oats. Furthermore, by developing and utilizing superior genetic resources, it is possible to effectively overcome the yield limitations of existing varieties, significantly improve the supply of high-quality forage, alleviate the shortage of high-quality forage in the livestock industry from the source, and reduce the production pressure caused by the substitution of feed grains.

[0004] However, current research on oat plant height-related genes is severely insufficient, making it difficult to achieve targeted improvement of oat plant height through precise gene regulation. Therefore, there is an urgent need to discover new key genes regulating oat plant height and establish corresponding methods for improving plant height. Summary of the Invention

[0005] To address the aforementioned technical challenges, in a first aspect, the present invention provides the AsSCL9 protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0006] SEQ ID NO.2: MVMDAALHDWRAPLPIGSKHLPIYPQIAAAATDGFTTEELESLLFLPSDGVDAAGFLNASALLLHSPSASADTASPPRDDASVYSSVAAGPGAGHAHPDDSEDIVLGYISRMLMAEDIDEKFEHYPAHAALLAAEKPFLEILADQPPNSGASTVDSPDGGSSVANSCNSLSSCTCNAPSTVLDAVQSPPALEFPTAEFLQPAQPYRDLSPDSWVVEAGGAWPYDAAEFYQLQTNPLPDALLSQSSSFASSSNGSSSVAFSEGFESFLSTAGVVPDAGFSDFVLQSQQHAAQFSRGVEEASRFLPQESKLVIDLDSLPSVPSLQSGIKAEKFVEVKTEKADAEVAATHRGKKHFYGDDLDAEEGRCSKHSSPVMDADHLIREMMDKVLLCNGETCSKGVKELREALQHDVATHSGGAHGKGSGHGKGRGKKQPKKEVVDLETLLVHCAQSVASDDRRSATDLLKQIRQHSSASGDGDQRLAHSFANGLEARLSGNGSQIYKLHTISRFACTDVLKAYQLYLAASPFKKISHYFANQTIMNAVEKAKKVHIVDYGIYYGFQWPCLIQRLANRPGGPPELRITGIDTPQPGFRPAERIEETGRHLSDYAQTFNIPFKFHGIASQFEAVQVEDLHIEKDEVLIVNCMFRFKTLMDESVVAESPRNMVLNTIRKMNPHVFIHGITSGSYNAPFFVSRFREALFHYSALFDMLEANIPRDNEQRLLIESALFSREAVNVISCEGMERMERPETYKQWQSRNQRAGFKQLPLDQNIMKRAREKVKCYHKNFIIDKDNRWLLQGWKGRILFALSTWTPNHRSS In a second aspect, the present invention provides the coding gene of the AsSCL9 protein.

[0007] Preferably, the nucleotide sequence of the gene is as shown in SEQ ID NO.1.

[0008] SEQ ID NO.1: Thirdly, the present invention provides biological materials containing the AsSCL9 protein or its encoding gene.

[0009] In some embodiments, the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, or engineered bacteria.

[0010] Fourthly, the present invention provides oats containing the AsSCL9 protein or its encoding gene.

[0011] The oats described in this invention do not limit the structural composition and complete genomic information of the whole plant. Therefore, the AsSCL9 protein or its encoding gene and the target trait (plant height) are applicable to numerous oat plant populations or individual plants. However, these plant populations or individual plants, apart from the aforementioned defined genes or encoded proteins, do not share the same or highly similar genetic background. Therefore, the oats or their propagation materials of this invention will not possess consistency and stability in major traits. Consequently, the protected subject matter of the oats of this invention does not fall within the scope of plant varieties.

[0012] Fifthly, the present invention provides the application of the AsSCL9 protein, the gene, or the biological material in regulating the growth of oat plants.

[0013] In a sixth aspect, the present invention provides the application of the AsSCL9 protein, the gene, or the biological material in oat breeding or oat germplasm resource improvement.

[0014] Preferably, the purpose of oat breeding or oat germplasm resource improvement is to obtain oat plants with higher plant height or higher yield.

[0015] Preferably, oat plant height is increased by enhancing the activity or expression level of the AsSCL9 protein or its encoding gene.

[0016] Preferably, oat plant height is reduced by decreasing the activity or expression level of the AsSCL9 protein or its encoding gene.

[0017] Preferably, overexpression of the gene encoding the AsSCL9 protein increases oat plant height.

[0018] In some implementations, the overexpression method is selected from one or more combinations of (1)-(5): (1) By introducing a plasmid containing the gene; (2) By increasing the copy number of the genes described on the chromosome; (3) By altering the promoter sequence of the genes described on the chromosome; (4) By operatively linking a strong promoter to the gene; (5) By introducing enhancers.

[0019] Preferably, the oats are feed oats.

[0020] In some implementations, the activity or expression level of the AsSCL9 protein or its encoding gene is increased or decreased through genetic engineering or hybridization techniques.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows: The invention first cloned and obtained AsSCL9 Genes were found to be overexpressed in oat plants after being transformed with an overexpression vector. AsSCL9 Genes can increase oat plant height. Therefore, this invention provides a new molecular tool for regulating oat plant height, achieving targeted improvement of oat plant height through precise gene regulation. This provides effective technical support for solving oat breeding dilemmas and promoting high-quality development of the industry, and has broad application prospects. Attached Figure Description

[0022] Figure 1 It is the subcellular localization of the AsSCL9 protein in feed oats.

[0023] Figure 2 It is feed oats AsSCL9 Tissue-specific expression analysis of genes.

[0024] Figure 3 yes AsSCL9 Phenotypic comparison between overexpression oat lines and wild-type oat lines. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0026] In the embodiments provided in this specification, unless specific techniques or conditions are specified, the techniques or conditions described in the literature in this field, or the product instructions, shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0027] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art may conduct corresponding experiments under the guidance of the operating manuals accompanying various commercially available kits or entrust them to specialized companies, such as gene sequencing, plasmid sequencing, and primer synthesis.

[0028] Example 1: Feed Oats AsSCL9 Gene cloning and protein sequence analysis Total RNA was extracted from oat leaves using the M5 SuperPure Total RNA Extraction Reagent kit (Beijing Polymer Biotechnology Co., Ltd.). Following the instructions of the HiScript IV 1st Strand cDNA Synthesis Kit (Nanjing Novizan Biotechnology Co., Ltd.), the extracted total RNA was reverse transcribed to obtain cDNA. Using the cDNA as a template, PCR amplification was performed using primer pairs SEQ ID No. 3 and SEQ ID No. 4 to obtain feed oats. AsSCL9 Genes were amplified, then subjected to agarose gel electrophoresis. The amplified products were recovered and sequenced. AsSCL9 The nucleotide sequence is shown in SEQ ID NO.1.

[0029] SEQ ID No.3 (SCL9-CDS-F):ATGGTCATGGACGCCGCG SEQ ID No.4 (SCL9-CDS-R): CTAGGAAGATCGGTGATTCGG The PCR amplification reaction system and procedure are shown in Table 1 and Table 2, respectively.

[0030] Table 1

[0031] Table 2

[0032] AsSCL9 The protein sequence encoded by the gene is shown in SEQ ID NO.2. The basic physicochemical properties of the AsSCL9 protein were predicted using Protparam from the Expasy website (http: / / web.expasy.org / protparam / ). The molecular formula of the AsSCL9 protein is C2. 3965 H6146 N 1106 O 1215 S 28 Encoding 815 amino acids, this protein has a molecular weight of approximately 89.65 kDa, an aliphatic index of 77.04, a theoretical isoelectric point (pI) of 5.72, an instability coefficient of 49.58, and a GRAVY (Grandaverage of Hydropathicity) value of -0.352, classifying it as a hydrophilic protein. Prediction of conserved domains using the SMART database revealed a GRAS conserved domain between amino acids 439 and 809, indicating that this protein belongs to the GRAS transcription factor family.

[0033] Example 2 Subcellular localization of AsSCL9 protein in feed oats Amplification using the subcellular localization primer pairs shown in SEQ ID No. 5 and SEQ ID No. 6 AsSCL9 Gene. The PCR amplification reaction system and procedure were the same as in Example 1. After the target fragment was recovered and purified, it was amplified using a homologous recombination cloning kit (Nanjing Novizan Biotechnology Co., Ltd.). AsSCL9 Connected to and BamHI The plant expression vector pCAMBIA1300-GFP, after double enzyme digestion, was added and sequenced for verification. The correctly sequenced pCAMBIA1300-GFP was then used for further analysis. XbaI GFP was transfected into Agrobacterium GV3101 (p19) competent cells and injected into 4-week-old leaves of Nicotiana benthamiana carrying nuclear localized red fluorescent protein (NSL-mCherry). After culturing in the dark for 48 hours, sections were prepared and fluorescence signals were observed under a laser confocal microscope.

[0034] Microscopic observation revealed that in the control group (wild type, CK), the GFP fluorescent signal was widely distributed throughout the cell; while in the experimental group (AsSCL9), the superposition of the GFP green fluorescent signal and the mCherry red fluorescent signal showed a yellow signal in the cell nucleus, indicating that the AsSCL9 protein is located in the cell nucleus. AsSCL9- ).

[0035] SEQ ID No. 5 (GFP-F): GAGCTCGGTACCCGGGGATCCATGGTCATGGACGCCGCG SEQ ID No. 6 (GFP-R): GCCCTTGCTCACCATGTCGACGGAAGATCGGTGATTCG Example 3: Feed OatsFigure 1 Tissue-specific gene expression analysis To explore AsSCL9 The tissue expression pattern of the gene in feed oats was detected using qRT-PCR technology. AsSCL9 The relative expression levels of genes in different tissues of feed oats were determined through the following steps: Different tissues were collected from forage oats at the seedling stage (above-ground parts and roots), jointing stage (roots, stems, leaves, and nodes), booting stage (roots, stems, leaves, nodes, and ears), and heading stage (roots, stems, leaves, nodes, and ears). RNA was extracted from these tissues using the M5 SuperPure Total RNA Extraction Reagent kit. RNA quality was assessed by agarose gel electrophoresis. cDNA was synthesized using the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit (Nanjing Novizan Biotechnology Co., Ltd.), and diluted 4-fold as a template. The cDNA synthesis reaction conditions are shown in Table 3.

[0036] Table 3

[0037] according to AsSCL9 Gene sequence information was used to design quantitative fluorescent primer pairs using NCBI's Primer-Blast. AsSCL9 -qPCR-F (shown in SEQ ID No. 7) and AsSCL9 -qRT-R (shown in SEQ ID No. 8). Using cDNA from different tissues at different stages of oat production as templates, qRT-PCR amplification was performed using 2×HQ SYBR qPCR Mix reagent and an ABI Q7 real-time PCR instrument. -ΔΔCt Method calculation AsSCL9 The relative expression levels of the gene in different tissues at different growth stages of oats. The qRT-PCR reaction system is shown in Table 4.

[0038] SEQ ID No.7: CGTACAAGCAATGGCAGTCG SEQ ID No.8: TGATTCGGCGTCCATGTTGA Table 4

[0039] The results showed that AsSCL9 It is expressed in the roots, stems, leaves, nodes, and spikes at all four stages. AsSCL9The gene expression level was lowest in roots at all growth stages, and highest in stems and nodes during the jointing stage; furthermore, its expression level was second highest in panicles during the booting and heading stages. These results indicate that... AsSCL9 Throughout the development of forage oats, the gene is highly expressed mainly in the stem, node, and spike tissues, which is consistent with the predicted function of this gene in regulating plant height development. AsSCL9 ).

[0040] Example 4 Figure 2 Obtaining transgenic oats through overexpression Use restriction endonucleases AsSCL9 and HindIII The plant overexpression vector pUBI-FLAG (from Weimi Biotechnology Co., Ltd.) was double-digested with enzymes, and simultaneously amplified using primer pairs SEQ ID No. 9 and SEQ ID No. 10. BamHI Genes, to obtain those containing vector arms AsSCL9 The CDS region of the gene was analyzed using the One-Step ZTOPO-Blunt Zero-Background Rapid Cloning Kit (Beijing Zhuangmeng International Biotechnology Co., Ltd.). Vector and fragment recombination was performed, and the recombinant product was transformed into DH5α competent E. coli cells. Sequencing confirmed the overexpression of the gene. AsSCL9 The transgenic vector pUBI-FLAG- AsSCL9 .

[0041] SEQ ID No.9 (pUBI-FLAG-F): GTTACTTCTGCAGAAGCTTATGGTCATGGACGCCGCG SEQ ID No.10 (pUBI-FLAG-R): CTTTGTAGTCCATGGATCCGGAAGATCGGTGATTCGG The constructed overexpression vector pUBI-FLAG- AsSCL9 Agrobacterium EHA105 competent cells were transformed, and positive clones were selected and cultured to 50 mL. These cells were then used to infect oat callus tissue. Regenerated plants were obtained through callus induction and regeneration. Gene expression levels in the transgenic oat lines were identified using the same quantitative fluorescence system and method as in Example 3; 2 -ΔΔCT Method calculation AsSCL9 Gene expression levels in different transgenic plants.

[0042] The results are shown in Table 5, numbered as follows: AsSCL9 -3 and AsSCL9 -9 overexpression in oat strains AsSCL9 The expression levels were the highest, being 8.08 times and 5.07 times higher than those in the control group (wild type, CK), respectively.

[0043] Table 5

[0044] Example 5 Overexpression AsSCL9 Phenotypic analysis of genetically modified oats During the milk ripening stage of oats, the investigation in Example 4 was conducted. AsSCL9 Plant height of overexpressing oat lines. Results as follows: AsSCL9 As shown in Table 6, Figure 3 The plant height of the overexpressing oat lines was significantly higher than that of the control group (wild type, CK). p <0.05), representing increases of 11.3% and 12.5% ​​respectively compared to the control group. These results indicate... AsSCL9 AsSCL9 Overexpression of this substance can significantly promote the increase of plant height in feed oats, and it is a positive regulator of plant height in feed oats.

[0045] Table 6

[0046] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An AsSCL9 protein, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

2.

2. The gene encoding the AsSCL9 protein of claim 1.

3. The gene according to claim 2, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

4. A biomaterial, characterized in that, It contains the AsSCL9 protein as described in claim 1 or the gene as described in claim 2 or 3.

5. The biomaterial according to claim 4, characterized in that, The biological material is recombinant DNA, expression cassette, plasmid vector, or engineered bacteria.

6. An oat variety, characterized in that, It contains the AsSCL9 protein as described in claim 1 or the gene as described in claim 2 or 3.

7. The application of the AsSCL9 protein of claim 1, the gene of claim 2 or 3, or the biomaterial of claim 4 or 5 in regulating the growth rate of oat plants.

8. The application of the AsSCL9 protein of claim 1, the gene of claim 2 or 3, or the biological material of claim 4 or 5 in oat breeding or oat germplasm resource improvement.

9. The application according to claim 7 or 8, characterized in that, Oat plant height can be increased by enhancing the activity or expression of the AsSCL9 protein or its encoding gene.

10. The application according to claim 9, characterized in that, The activity or expression level of the AsSCL9 protein or its encoding gene can be increased through genetic engineering techniques.

Images