Specific gene target for detecting burkholderia pseudomallei and application thereof

CN122503522APending Publication Date: 2026-08-04HAINAN MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610622473.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-08
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

[0004]TTS1基因簇属于伯克霍尔德菌属内常见的功能性基因区域,在属内多个近缘菌种中具有一定程度的保守性和同源性,仅依赖该靶标难以在基因层面实现对B.pseudomallei与其他近缘伯克霍尔德菌的精准区分,存在潜在交叉扩增风险

Benefits of technology

[0012] (1) It has high detection sensitivity, with the lowest detection limit reaching the fg level, which is significantly better than conventional PCR methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122503522A_ABST
    Figure CN122503522A_ABST
Patent Text Reader

Abstract

The application discloses a specific gene target for detecting burkholderia pseudomallei and application, and relates to the field of pathogenic microorganism molecular detection technology.The technical solution points are as follows: the application provides a specific gene target for detecting burkholderia pseudomallei, and the gene sequence of the specific gene target is shown in SEQ ID NO.1.A corresponding LAMP detection system is constructed based on the specific gene target.Both the specific gene target and the LAMP detection system are suitable for laboratory fluorescence detection platforms, on-site rapid detection platforms, integrated reagent kits or POCT detection systems.The application can significantly improve the species specificity and accuracy of burkholderia pseudomallei molecular detection, and reduce the risk of misjudgment.Meanwhile, the application lays a foundation for constructing a rapid detection system with high sensitivity and high specificity, and helps to meet the application requirements of early clinical diagnosis, public health monitoring and on-site rapid screening.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular detection technology for pathogenic microorganisms, and more specifically, to a specific gene target for detecting Burkholderia melioides and its application. Background Technology

[0002] Burkholderia melioidis is the causative agent of melioidosis, which can cause severe sepsis and multiple organ dysfunction with a high mortality rate. This bacterium is widespread in the environment, and its clinical symptoms lack specificity; therefore, early, rapid, and accurate detection is crucial for disease control.

[0003] Existing techniques often select conserved sequences from the TTS1 (Type III Secretion System 1) gene cluster as amplification targets, design LAMP primer sets, and rapidly amplify the target sequences under isothermal conditions. Results can be interpreted through colorimetric reactions or fluorescence signals. Related studies have shown that this method can complete detection in a relatively short time, offering advantages such as faster reaction speed and simpler operation compared to traditional PCR methods, and also exhibiting a certain level of detection sensitivity for some clinical isolates.

[0004] The TTS1 gene cluster is a common functional gene region within the Burkholderia genus, exhibiting a degree of conservation and homology among several closely related species. Relying solely on this target makes it difficult to accurately distinguish *B. pseudomallei* from other closely related *B.* species at the gene level, posing a potential risk of cross-amplification. Existing TTS1-LAMP methods often select targets based on single or a small number of known functional genes, without combining large-scale whole-genome data for systematic screening and validation. This makes it difficult to guarantee the stability and universality of the target across strains from different sources and regions. In clinical or environmental samples, multiple closely related microorganisms often coexist. Relying solely on the TTS1 target for detection is susceptible to interference from background bacterial DNA, affecting the accuracy of the results and hindering high-confidence species-level identification. Summary of the Invention

[0005] The purpose of this invention is to provide a specific gene target for detecting Burkholderia melioides and its application, which can significantly improve the species specificity and accuracy of molecular detection of Burkholderia melioides and reduce the risk of misdiagnosis; at the same time, it lays the foundation for building a rapid detection system with high sensitivity and high specificity, which helps to meet the application needs of early clinical diagnosis, public health monitoring and rapid on-site screening.

[0006] The above-mentioned technical objective of the present invention is achieved through the following technical solution: a specific gene target for detecting Burkholderia melioides, the sequence of which is shown in SEQ ID NO.1.

[0007] The present invention further provides the application of the above-mentioned specific gene target for detecting Burkholderia melioides, wherein the specific gene target is adapted to laboratory fluorescence detection platforms, on-site rapid detection platforms, integrated kits or POCT detection systems.

[0008] The present invention further provides a LAMP detection system containing the above-mentioned specific gene targets, wherein the LAMP detection system comprises 10 μL of 2× fluorescent LAMP / RT-LAMP master mixture, 2 μL of premix, 7.2 μL of nuclease-free aqueous solution and 0.8 μL of DNA template.

[0009] The present invention is further configured such that the premixed solution is prepared from the following components: 4 μL LF, 4 μL LB, 16 μL FIP, 16 μL BIP, 2 μL F3, 2 μL B3, and 56 μL ddH2O.

[0010] The present invention further provides applications of the above-mentioned LAMP detection system, which is adapted to laboratory fluorescence detection platforms, on-site rapid detection platforms, integrated reagent kits, or POCT detection systems.

[0011] In summary, the present invention has the following beneficial effects:

[0012] (1) It has high detection sensitivity, with the lowest detection limit reaching the fg level, which is significantly better than conventional PCR methods.

[0013] This invention constructs a LAMP detection system targeting a Burkholderia melioides gene sequence obtained through comparative genomics analysis. Systematic evaluation of the detection sensitivity shows that when using the representative Chinese strain of Burkholderia melioides, HNBP001, as a template, the limit of detection (LOD) of this invention's LAMP detection system reaches 1 pg / μL-100 fg / μL. Under the same template gradient conditions, conventional PCR methods have a LOD of 100-10 pg / μL. The comparison results show that the detection sensitivity of this invention's LAMP method is approximately 100 times that of PCR. Therefore, this invention's detection system is significantly superior to conventional PCR in terms of sensitivity, enabling reliable detection of extremely low concentrations of Burkholderia melioides, meeting the practical needs for trace pathogen detection in clinical and environmental samples.

[0014] (2) It has high detection specificity and has been verified by multiple standard strains to have no cross-reactivity.

[0015] The detection target used in this invention was obtained through big data bioinformatics analysis and is highly conserved in the genome of *Burkholderia melioides*, but absent or with very low homology in other closely related *Burkholderia* species and common clinical pathogens. In the DNA samples of 13 different standard strains tested, only the *Burkholderia melioides* standard strain showed typical positive amplification characteristics (color change and specific amplification band) in the LAMP reaction; no amplification signal was observed in the other non-target strains, and all test results were negative. Specificity verification experiments were performed on 76 DNA samples from different sources. Of the 76 tested samples, reaction tubes containing *Burkholderia melioides* DNA showed system color changes (20 strains), while 2 false positives were observed in the other 56 samples, including the blank control. The calculated positive predictive value was approximately 91%, and the negative predictive value was 100%. Therefore, the LAMP detection system constructed in this invention has good species specificity and can effectively distinguish *Burkholderia melioides* from its closely related species and other common pathogens.

[0016] (3) Fast detection speed / intuitive result interpretation, amplification and interpretation can be completed within 30 minutes.

[0017] This invention employs loop-mediated isothermal amplification (LAMP), eliminating the need for complex temperature cycling. Amplification is completed within 30 minutes at an isothermal temperature of 65°C, and results can be directly interpreted through colorimetric changes or real-time fluorescence signals. Compared to traditional bacterial culture methods (which typically require several days) and conventional PCR methods (which require longer reaction and post-processing times), this invention significantly shortens the detection cycle, making it more suitable for rapid diagnosis and on-site emergency testing.

[0018] (4) The one-pot closed reaction system is easy to operate and has a low risk of pollution.

[0019] The detection process of this invention is completed in a single closed reaction system, without the need for opening the lid or transferring the product, which reduces the complexity of operation and the risk of aerosol contamination of the amplified product. It also requires less technical expertise from operators and is easy to promote and apply in primary healthcare institutions and on-site testing conditions.

[0020] (5) The results are intuitive and visual, with low equipment dependence.

[0021] This invention constructs a colorimetric LAMP detection system, allowing for direct visual interpretation of detection results through color changes in the reaction system; it can also be combined with real-time fluorescence for quantitative analysis. This technical approach eliminates the need for large, sophisticated instruments, facilitating rapid screening for Burkholderia melioides in resource-constrained areas.

[0022] (6) Economic effects

[0023] By enabling rapid, early, and highly sensitive detection of Burkholderia melioides, this invention can effectively reduce the incidence of severe illness and hospitalization time caused by diagnostic delays, thereby lowering overall medical expenses. Furthermore, due to the simplicity of the instruments and the low cost of the reagents required for the detection system, its cost per test is significantly lower than that of conventional molecular detection methods such as PCR, facilitating large-scale application in primary healthcare institutions and public health screenings.

[0024] (7) Social benefits

[0025] Meredema poses a high risk of prevalence in tropical and subtropical regions, continuing to threaten public health. Existing detection methods are insufficient in sensitivity, timeliness, and accessibility, limiting early detection and control of the disease. The LAMP detection technology provided by this invention enables rapid and accurate detection of Burkholderia melioides without complex equipment, helping to improve pathogen detection capabilities in grassroots and resource-scarce areas and narrowing diagnostic gaps between different regions. Furthermore, this technology is applicable to monitoring in various scenarios, including the environment, water sources, and food, and is of great significance for reducing the risk of melioidosis transmission and enhancing biosafety control capabilities. Attached Figure Description

[0026] Figure 1 This is a schematic diagram of the gene presence / deletion distribution of Burkholderia melioides and related strains obtained based on comparative genomics analysis in this invention;

[0027] Figure 2 This is the result of the optimal specific gene target screening experiment in this invention;

[0028] Figure 3 This is the result of the LAMP system specificity verification in Application Example 1 of this invention;

[0029] Figure 4 This is the result of the specificity verification of the standard strain in Application Example 2 of this invention;

[0030] Figure 5 This is the result of the lowest detection limit determination experiment of the LAMP and PCR detection systems in Application Example 3 of this invention;

[0031] Figure 6 This is a flowchart of the specific target screening process in this invention. Detailed Implementation

[0032] The following is in conjunction with the appendix Figure 1-6 The present invention will be described in further detail below.

[0033] Example 1: Screening steps for specific gene targets of Burkholderia melioides

[0034] 1. The whole genome sequence of Burkholderia melioides HNBP001, a representative strain of Burkholderia melioides in China, was used as the reference sequence;

[0035] This study integrated and analyzed the genomic data of 10,522 strains, including Burkholderia melioides, Burkholderia melioides, other Burkholderia species and non-Burkholderia species. These included 112 Burkholderia melioides strains, 144 Burkholderia melioides strains, 5,489 non-Burkholderia species, 1,349 closely related Burkholderia species, and 3,428 Burkholderia melioides genomes from the NCBI database.

[0036] 2. Using the pan-genomics analysis tools Roary and Scoary, positive screening (coverage ≥90%, similarity ≥90%) and negative screening (coverage ≤60%, similarity ≤80%) were performed to progressively eliminate non-specific genes, ultimately obtaining 5 highly conserved specific gene sequences that are found only in Burkholderia melioides (see...). Figure 1 );

[0037] 3. BLAST alignment analysis was used to locate and number the corresponding gene loci of the specific detection target in the genome of the Burkholderia melioides standard strain HNBP001, in order to clarify its gene origin and sequence characteristics, providing a basis for subsequent primer design and detection system construction. The gene sequence characteristics are as follows (see Table 1):

[0038]

[0039] Table 1. Gene sequence characteristics

[0040] 4. Primers were designed based on the five specific gene fragments obtained. Primers were designed using PrimerExplorer 5.0 (http: / / primerexplorer.jp / e / ). During the design process, it was found that sequences BPSS0135 and BPSS0137 lacked circular primers, which would affect the amplification efficiency of the final system. Therefore, three sets of primers were designed based on the specific gene fragments BPSL1059, BPSS0448, and BPSS0489. A qPCR / PCR system was established to amplify DNA fragments from eight bacteria, including Burkholderia melioides. The amplification curves (qPCR) and the agarose gel electrophoresis band characteristics of the qPCR / PCR amplification products were compared and observed (see...). Figure 2 Based on the reaction results, BPSS0489 was selected as the optimal specific target for constructing the detection system.

[0041] The BPSS0489 gene exhibits good conservation in Burkholderia melioides strains from different sources, while no homologous sequences were detected in Burkholderia melioides and other closely related bacteria, enabling precise species-level differentiation.

[0042] The gene sequence of the specific gene target BPSS0489 is shown below:

[0043] SEQ ID NO.1:

[0044] ATGATCACTTCTACGATGCGCCGTGATACGGCGTTCAGACTCGTCAAGGCGTCGCCTTCGGCGGTCTATGCCGCCTTCGTGGCGTCGGAGGCCGTGGCACAATGGCTACCGCCGGAAGGTGCAATGATGGAGATCCAAGTCTTCGAGCCGCGCGTCGGCGGGCGGTTCCAAATGACGCTCATCTTCGCTTCGGCCCCCGGCAAGTCAACAGCCAATACGGACGTCGTGGTCGGGC GCTTCGTCGAACTGGTGCCGCAGCAACGCATCGTCCAGGCGTTCGAGTTCGATTCGCCTGATCCGGTATTCGCCGGGGCGATGACGATGCGTTGGGAGTTGGAGGCGGCAGCGGGCGGTACGGCCGTCACGGTCGTTGCAGAGAACGTGCCGCCTGGCATCTCGCAGACAGACCATGAGACGGGCATGAATTCGTCGCTTACCCAGCTTGCCGCCTACGTCGAATCGCACGACTGA

[0045] Example 2: Construction of a LAMP detection system for detecting specific gene targets of Burkholderia melioides.

[0046] Based on the specific gene target BPSS0489 mentioned above, this invention constructs a loop-mediated isothermal amplification (LAMP) detection system, as shown in Table 2:

[0047]

[0048] Table 2 LAMP detection system based on the specific gene target BPSS0489

[0049] The premixed solution is composed of the following components:

[0050]

[0051] Table 3 Premixed Liquid Components

[0052] The specific gene targets and the LAMP detection system built upon them are compatible with a variety of detection platforms, including but not limited to: laboratory fluorescence detection platforms, on-site rapid detection platforms, integrated reagent kits, or POCT detection systems.

[0053] Example 3: Detection method for Burkholderia melioides based on the detection system described in Example 2

[0054] 1. Extract DNA from the sample to be tested (using a DNA extraction kit or boiling method) as an amplification template;

[0055] 2. Mix the template DNA with the prepared LAMP reaction system;

[0056] 3. Perform isothermal amplification reactions under constant temperature conditions (using qPCR or a PCR instrument);

[0057] 4. Judge the detection results based on the color change or fluorescence signal curve of the reaction system.

[0058] The LAMP reaction is performed under isothermal conditions (such as a PCR instrument or qPCR instrument), with a reaction temperature of 65°C and a reaction time of 30 minutes. The amplification results can be interpreted by colorimetric reaction (positive reaction system is yellow) or fluorescence signal (positive reaction fluorescence signal exceeds the threshold).

[0059] Application Example 1: Specificity Validation Experiment of LAMP Detection System

[0060] DNA samples from 76 strains of bacteria from different sources (obtained by DNA extraction using a kit) were selected, including nucleic acid samples from 20 Burkholderia melioides standard strains. The LAMP detection system constructed in this invention was used for amplification and verification. Simultaneously, DNA from the Burkholderia melioides standard strains was used as a positive control, and double-distilled water (ddH2O) was used as a negative control.

[0061] The detection system was placed in a qPCR instrument, the reaction temperature was 65℃, and the reaction time was 30 minutes.

[0062] The experimental results showed that among the 76 tested samples, reaction tubes containing Burkholderia melioides DNA all showed system color changes (20 samples), while 2 false positives were found in the other 56 samples, including the blank control (see...). Figure 3 The calculated positive predictive value is approximately 91%, and the negative predictive value is 100%.

[0063] Application Example 2: Specificity Verification Experiment of Standard Strains

[0064] Thirteen standard bacterial strains, including *Burkholderia melioides*, from different species were selected. Genomic DNA was extracted from these strains and used as the detection targets. The selected BPSS0489 gene was used as the detection target. LAMP colorimetric assay and PCR amplification were employed to detect the DNA of these standard strains. *Burkholderia melioides* standard strain DNA was used as a positive control, and double-distilled water (ddH2O) was used as a negative control.

[0065] The detection system was placed in a qPCR instrument, the reaction temperature was 65℃, and the reaction time was 30 minutes.

[0066] Experimental results showed that in the LAMP colorimetric assay, only the reaction system containing Burkholderia melioides DNA showed a significant color change, exhibiting typical positive reaction characteristics (system color change / fluorescence signal curve exceeding the threshold). The remaining standard strain samples and negative controls all showed negative reaction characteristics (see...). Figure 4 In the PCR amplification verification, only Burkholderia melioides samples obtained specific amplification bands, while no amplification products were found in the other standard strains.

[0067] Application Example 3: Determination of the Limit of Detection (LOD) of the LAMP Detection System and Comparison with Conventional PCR

[0068] To evaluate the sensitivity of the LAMP detection system constructed in this invention and to compare it with conventional PCR detection methods, the genomic DNA of Burkholderia melioides standard strain (obtained by the DNA extraction method of the kit) was used as the detection target to conduct a limit of detection experiment.

[0069] First, the genomic DNA of the Burkholderia melioides standard strain was quantified using a spectrophotometer and its concentration was adjusted to 100 ng / μL (original concentration). Subsequently, the DNA samples were serially diluted 10-fold using sterile double-distilled water (ddH2O) to obtain concentration gradients of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, and 1 fg / μL. A template-free control was included as a negative control (tubes 1–9).

[0070] The LAMP detection system constructed in this invention and conventional PCR methods were used to detect the above-mentioned DNA gradient samples, with the BPSS0489 gene as the detection target. LAMP amplification results were analyzed by colorimetric interpretation, and PCR amplification results were interpreted by endpoint electrophoresis.

[0071] Experimental results show that in DNA concentration gradient samples, the LAMP detection system can still obtain stable and interpretable amplification signals under low template concentration conditions, with a detection limit as low as 1 pg / μL-100 fg / μL. The detection sensitivity is approximately 100 times that of PCR (the detection limit is 100-10 pg / μL) (see...). Figure 5 ).

[0072] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A specific gene target for detecting Burkholderia melioides, characterized in that: The sequence of the specific gene target is shown in SEQ ID NO.

1.

2. The application of the method for detecting specific gene targets of Burkholderia melioides according to claim 1, characterized in that: The specific gene target is compatible with laboratory fluorescence detection platforms, on-site rapid detection platforms, integrated reagent kits, or POCT detection systems.

3. A LAMP detection system comprising the specific gene target as described in claim 1, characterized in that: The LAMP detection system includes 10 μL of 2× fluorescent LAMP / RT-LAMP master mixture, 2 μL of premix, 7.2 μL of nuclease-free aqueous solution, and 0.8 μL of DNA template.

4. The LAMP detection system according to claim 3, characterized in that: The premixed solution is prepared from the following components: 4ul LF, 4ul LB, 16ul FIP, 16ul BIP, 2ul F3, 2ul B3, and 56ul ddH2O.

5. The application of the LAMP detection system according to claim 3 or 4, characterized in that: The LAMP detection system is compatible with laboratory fluorescence detection platforms, on-site rapid detection platforms, integrated reagent kits, or POCT detection systems.