Ureaplasma-based bacteriostatic preparation and application thereof
Patent Information
- Application Number
- CN202610703480.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-21
- Publication Date
- 2026-08-18
AI Technical Summary
目前对拟态弧菌拮抗菌的研究较少,仅有从9株非致病菌中筛选出两株具有拮抗效果的产碱杆菌
[0012] The beneficial effects of this invention are as follows: This invention selects the mucus on the skin surface of yellow catfish suffering from Vibrio mimicry disease as a sample for screening antagonistic bacteria. To screen for skin probiotics capable of antagonizing Vibrio mimicry in yellow catfish, during the peak season for Vibrio mimicry, skin flora from yellow catfish experiencing outbreaks of the disease are collected, isolated, cultured, and subjected to antibacterial effect experiments. The antagonistic bacteria with the best antibacterial effect are screened, followed by a series of probiotic characteristic analyses, including related enzyme activity, hemolysis, and safety. Through the above method, this invention screens for Bacillus urealyticum (… Paenibacillus urinalisY6N9 exhibits significant antagonistic effects against various pathogens in aquaculture, including Vibrio mimicus, Edwardsiella tarda, Streptococcus dolphinii, Aeromonas hydrophila, and Aeromonas vesiculosus. Ureaplasma urealyticum Y6N9 secretes proteases and is sensitive to commonly used antibiotics such as florfenicol and doxycycline. It does not cause hemolysis in yellow catfish or rabbit blood, is non-pathogenic to yellow catfish, and has good safety profile. It can be used as a probiotic for disease control in yellow catfish farming and shows promising application prospects.
Smart Images

Figure CN122587927A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial application technology, specifically relating to a Bacillus urealyticum and an antibacterial preparation based on Bacillus urealyticum, and their applications. Background Technology
[0002] Currently, bacterial diseases are the most prominent problem in yellow catfish farming, with the main pathogens including Edwardsiella tarda, Aeromonas verrucosa, Aeromonas hydrophila, Vibrio mimicus, and Streptococcus. Vibrio mimicus (… Vibrio mimicus It belongs to the genus Vibrio of the family Vibrioceae, and is a Gram-negative short bacillus, similar to Vibrio cholerae (Vibrio spp.). V. cholera This bacterium is closely related to Vibrio mimicry. It can infect not only economically important aquatic organisms such as yellow catfish, catfish, red swamp crayfish, and Chinese mitten crab, but also humans. Ingesting contaminated seafood can cause symptoms such as fever, acute diarrhea, and even bloody stools. In yellow catfish, Vibrio mimicry initially manifests as discolored spots on the body surface. As the disease progresses, regular ulcers appear on the skin, commonly known as "body rot disease." Eventually, the bacteria spread through the bloodstream to all internal organs, causing multi-organ damage and death. Because yellow catfish are bottom-dwelling fish, early detection of Vibrio mimicry infection is difficult in production, causing significant economic losses to yellow catfish farmers.
[0003] Currently, the main methods for preventing and controlling Vibrio mimicry include antibiotics, vaccines, traditional Chinese medicine, and probiotics. Existing technologies have improved VmDM culture media, enabling rapid detection even when Vibrio mimicry concentrations are much lower than other pathogens, and significantly reducing the cost of preparing the culture medium. Studies on the virulence factors and drug resistance of Vibrio mimicry from yellow catfish have also been conducted, finding that various strains are sensitive to ciprofloxacin, enrofloxacin, florfenicol, and doxycycline. Antibiotics are characterized by rapid onset and good efficacy, so they are still the primary treatment for Vibrio mimicry in production. However, due to the uneven level of aquaculture practices leading to antibiotic overuse, some bacteria have developed strong resistance to certain antibiotics. There is considerable research on using vaccines to prevent Vibrio mimicry. One study prepared a whole-cell inactivated vaccine for Vibrio mimicry and compared the effects of immersion immunization and injection immunization. The results showed that both immersion and injection immunization with the whole-cell inactivated vaccine provided immune protection to yellow catfish, with injection immunization showing better efficacy. Some researchers have used a targeted DNA strategy to enhance vaccine efficacy, constructing a dual-target DNA vaccine against Vibrio mimicryl using BGS and ICLP as exogenous and endogenous targeting vectors, respectively. Efficacy evaluation through oral administration to grass carp showed that this dual-target DNA vaccine induced significantly higher systemic and intestinal mucosal immune protection compared to single-target and naked DNA vaccines. Existing technologies target the type II secretion system, hemolysin genes, and... TonB 1 system, TonB 2After targeted knockout treatment, the resulting deletion strains showed no plasmid residue and were genetically stable, providing a simple method for genetic manipulation of Vibrio mimicry. This will contribute to a better understanding of the pathogenicity of Vibrio mimicry and the development of attenuated vaccines. Some studies have focused on Vibrio mimicry... ompu Using marker-carrying Vibrio mimicry as a subunit vaccine, this study found that the vaccine can induce an immune response in yellow catfish, making it a candidate vaccine for Vibrio mimicry disease in yellow catfish. The vaccine offers high protection, but due to limitations such as administration methods, aquatic environment, and aquaculture costs, no Vibrio mimicry vaccine is currently available for production. Traditional Chinese medicine (TCM) has advantages in preventing and treating fish diseases, including being green, natural, pollution-free, having low drug residues, and minimal toxicity. It also plays an important role in the prevention and treatment of Vibrio mimicry. An antibacterial study was conducted using 11 TCM herbs, including Coptis chinensis, rhubarb, and honeysuckle, in a compound herbal formula. The results showed that the compound formula containing Coptis chinensis, honeysuckle, forsythia, rhubarb, Poria cocos, Plantago asiatica, Astragalus membranaceus, and licorice had the best inhibitory effect on Vibrio mimicry, with a MIC value of 1.96 g / L. However, TCM suffers from problems such as unclear mechanisms of action, diverse effective components, fluctuating therapeutic effects, and susceptibility to environmental influences, which seriously hinder its clinical application.
[0004] Probiotics have advantages such as promoting intestinal health and growth in fish, antagonizing pathogens, enhancing immunity, and improving meat quality, and are frequently used in the prevention and treatment of bacterial diseases. Current research mainly focuses on screening probiotics from samples such as water, sediment, and intestines. One study used the plate confrontation method and Oxford cup method to screen a strain of Aeromonas hydrophila antagonistic bacteria from 29 bacterial strains isolated from mudflats and water bodies around Lianyungang. This probiotic was identified as *Bacillus besylate*, and its extracellular products showed inhibitory effects against various aquatic pathogens, including *Aeromonas hydrophila*, *Aeromonas vesiculosus*, *Vibrio parahaemolyticus*, *Vibrio vulnificus*, and *Escherichia coli*. Another study used the filter paper disc method and co-culture method to screen a highly effective antagonistic strain of *Vibrio cholerae*, YB-99, from 120 *Bacillus* strains preserved in the laboratory. The study found that after co-culturing with *Vibrio cholerae* for 16 hours, the antagonistic effect against *Vibrio cholerae* reached 96.8%. After expanding the culture of this strain, the results showed that the survival rate of Pacific white shrimp in the treated group was 92.81% higher than that in the control group. The screening of antagonistic bacteria in aquatic organisms has been explored since the last century, mainly focusing on screening probiotics that have antagonistic effects against pathogenic bacteria such as Aeromonas hydrophila, Vibrio alginolyticus, and Vibrio parahaemolyticus. Currently, research on antagonistic bacteria against Vibrio mimicry is limited; only two Alcaligenes strains with antagonistic effects were screened from nine non-pathogenic bacteria. Summary of the Invention
[0005] In view of the above-mentioned prior art, the present invention provides *Bacillus urealyticum*, an antibacterial agent based on *Bacillus urealyticum*, and their applications. To achieve the above objectives, the technical solution adopted by the present invention is: to provide a ureobacillus, whose Latin name is... Paenibacillus urinalis It is deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20242902, deposited on December 25, 2024, and named Y6N9.
[0006] Based on the above technical solution, the present invention can be further improved as follows.
[0007] Furthermore, an antibacterial agent includes the aforementioned Ureaplasma urealyticum.
[0008] Furthermore, the above-mentioned *Bacillus urealyticum* and / or antibacterial agents are used in the preparation of formulations that antagonize pathogens in aquaculture.
[0009] Furthermore, the pathogens are Vibrio mimicus, Edwardsiella, Streptococcus dolphinus, Aeromonas hydrophila, and / or Aeromonas vernix.
[0010] Furthermore, the aquatic product is the yellow catfish.
[0011] The preservation information of the present invention, *Bacillus urealyticum*, is as follows: Bacterial species name: Ureaplasma, Latin name: Paenibacillus urinalis ; Naming: Y6N9; Preservation institution: China Center for Type Culture Collection; Abbreviation for depository institution: CCTCC; Address of the depository: Wuhan University, Wuhan, China Accession number: CCTCC NO: M 20242902; Deposit date: December 25, 2024.
[0012] The beneficial effects of this invention are as follows: This invention selects the mucus on the skin surface of yellow catfish suffering from Vibrio mimicry disease as a sample for screening antagonistic bacteria. To screen for skin probiotics capable of antagonizing Vibrio mimicry in yellow catfish, during the peak season for Vibrio mimicry, skin flora from yellow catfish experiencing outbreaks of the disease are collected, isolated, cultured, and subjected to antibacterial effect experiments. The antagonistic bacteria with the best antibacterial effect are screened, followed by a series of probiotic characteristic analyses, including related enzyme activity, hemolysis, and safety. Through the above method, this invention screens for Bacillus urealyticum (… Paenibacillus urinalisY6N9 exhibits significant antagonistic effects against various pathogens in aquaculture, including Vibrio mimicus, Edwardsiella tarda, Streptococcus dolphinii, Aeromonas hydrophila, and Aeromonas vesiculosus. Ureaplasma urealyticum Y6N9 secretes proteases and is sensitive to commonly used antibiotics such as florfenicol and doxycycline. It does not cause hemolysis in yellow catfish or rabbit blood, is non-pathogenic to yellow catfish, and has good safety profile. It can be used as a probiotic for disease control in yellow catfish farming and shows promising application prospects. Attached Figure Description
[0013] Figure 1 The images show the morphology of some isolated pathogenic bacteria, where A1-A5 are colony morphologies and B1-B5 are Gram staining results. Figure 2 The image shows a gel electrophoresis pattern of pathogens, where M represents the D2000 DNA Marker; numbers 1-1 to 5-2 represent the gyr B gene of different pathogens. Figure 3 Image showing the results of coating some aerobic and facultative anaerobic bacteria; Figure 4 Image showing the results of partial Bacillus spore coating; Figure 5 This is a diagram showing the Gram staining results of some Bacillus species. Figure 6 This is a diagram showing the results of partial lactic acid bacteria coating. Figure 7 This is a diagram showing the Gram staining results of some lactic acid bacteria. Figure 8 This is a diagram showing the inhibition zones of some antagonistic bacteria. Figure 9 Antimicrobial spectrum analysis of 10 antagonistic bacteria: A1 and A2 were antagonistic to Edwardsiella tarda, B1 and B2 were antagonistic to Streptococcus dolphinus, C1 and C2 were antagonistic to Aeromonas hydrophila, and D1 and D2 were antagonistic to Aeromonas versicolor. Figure 10 The image shows the activity results of four antagonistic bacterial enzymes. In the plate, 0 is the negative control, A is the protease, B is the amylase, and C is the lipase. Figure 11 The study observed the hemolytic activity of four antagonistic bacteria, where 0 was the negative control, A was yellow catfish blood, and B was rabbit blood. Figure 12 For the identification and phylogenetic analysis of strain Y6N9, A is the PCR identification electrophoresis image, M is the Maker D2000, 1 is the Y6N9 strain gyrB primer amplification fragment, 2 is the negative control; B is the phylogenetic analysis. Detailed Implementation
[0014] The specific embodiments of the present invention will be described in detail below with reference to examples.
[0015] 1. Experimental subjects: Samples for this experiment were collected from yellow catfish farms in Leshan and Meishan. Mucus was scraped from yellow catfish experiencing outbreaks of Vibrio mimicry disease, immediately preserved at low temperatures, and transported to the laboratory for bacterial isolation and culture.
[0016] Indicator strains Vibrio mimicus (SCLS1901), Aeromonas hydrophila (LS230902), Aeromonas verrucosa (PJ231101), Edwardsiella tarda (LS230918), and Streptococcus dolphinus (LS230804) were all preserved in the Sichuan Provincial Key Laboratory of Fish Resources Conservation and Utilization in the Middle and Upper Reaches of the Yangtze River.
[0017] 2. Main instruments: Portable multi-parameter water quality analyzer (Qingdao Lubo Jianye Co., Ltd.), benchtop high-speed refrigerated centrifuge (Hunan Bainuoke Co., Ltd.), Axioscope 5 optical microscope (Carl Zeiss AG, Germany), constant-speed mini centrifuge (Hunan Bainuoke Co., Ltd.), adjustable mixer (Dalong Xingchuang Co., Ltd.), constant temperature shaker (Shanghai Xinmiao Co., Ltd.), vertical pressure steam sterilizer (Shanghai Shenan Co., Ltd.), electric constant temperature drying oven (Shanghai Xinmiao Co., Ltd.), biochemical incubator (Shanghai Heheng Co., Ltd.), precision constant temperature liquid bath (Hangzhou Xuezhongtan Co., Ltd.), constant temperature metal bath (Shanghai Sheyan Co., Ltd.), vacuum pump (Tianjin Aotesains Co., Ltd.), medical clean bench (Jinan Xinbeixi Co., Ltd.), ultra-low temperature storage box (Anhui Zhongke Duling Co., Ltd.), gradient PCR instrument (Bio-Rad Laboratories, USA), electrophoresis apparatus (Bio-Rad Laboratories, USA), gel imaging system (Bio-Rad Laboratories, USA).
[0018] 3. Main reagents: Tryptone (OXOID, UK), yeast extract, Gram staining kit, McFarland turbidimetric tubes, agarose (Beijing Solarbio Science & Technology Co., Ltd.), NaCl, polysorbate-80 (Chengdu Kelong Chemical Co., Ltd.), agar powder, 2×Taq PCR Master mix, 50×TAE Buffer (Sangon Biotech (Shanghai) Co., Ltd.), Lactobacillus selective medium (LBS), MRS medium (Qingdao Haibo Biotechnology Co., Ltd.), DNA extraction kit, D2000 DNA Marker (Tiangen Biotech (Beijing) Co., Ltd.), nucleic acid staining agent (Beijing Biotech Technology Co., Ltd.), skim milk powder (Wuhan Sewell Biotechnology Co., Ltd.), soluble starch (Sinopharm Chemical Reagent Co., Ltd.), antimicrobial susceptibility testing discs (Hangzhou Microbial Reagent Co., Ltd.), ethylene glycol phenyl ether (Chengdu Xiya Chemical Co., Ltd.).
[0019] Example 1: Sample Collection and Pretreatment (1) Collection: During the outbreak season of Vibrio mimicry disease in yellow catfish, skin mucus samples were collected from yellow catfish ponds in the main yellow catfish farming areas of Sichuan that had experienced outbreaks of "square" skin rot disease. Mucus samples from healthy yellow catfish were used as controls. At the same time, the water quality was measured using a portable multi-parameter water quality analyzer. The collected samples and water quality conditions are shown in Table 1.
[0020] (2) Pretreatment: Take 1 mL of mucus sample and add 4 mL of physiological saline, mix thoroughly, and then dilute with physiological saline for 10 mL. 3 times, 10 4 Double 10 5 Store at 4℃ for later use.
[0021] Table 1 Water quality of the sampled ponds
[0022] Example 2: Isolation and Identification of Pathogens (1) Pathogen isolation: Bacteria were isolated from the liver and kidneys of yellow catfish with typical "square" skin rot disease on site. After being transported back to the laboratory, they were cultured at 28℃ for 24 h. Healthy samples were observed on site for any abnormalities on the body surface and inside the body. The gill filaments, body surface mucus and intestines were examined under a microscope by water pressing method for the presence of parasites. Bacteria were isolated using the same method.
[0023] (2) Pathogen DNA extraction: The purified pathogen was inoculated onto LB nutrient medium and cultured overnight at 28°C. After washing with physiological saline, a bacterial suspension was obtained. The bacterial suspension was centrifuged at 12,000 rpm for 1 min to obtain bacterial cell precipitate. The pathogen DNA was extracted according to the instructions of the DNA extraction kit. The extracted pathogen DNA was stored at -20°C.
[0024] (3) gyr B gene sequence amplification: Synthesize the following PCR amplification primers; gyr BF:GAAGTCATCATGACCGTTCTGCAY (SEQ ID NO.1); gyr BR: AGCAGGGTACGGATGTGCGAGCC (SEQ ID NO. 2).
[0025] Configure the PCR reaction system as shown in Table 2; Table 2 PCR reaction system
[0026] The PCR amplification program was as follows: 94℃, 5 min; 94℃, 30 s; 56℃, 30 s; 72℃, 1 min 30 s, 35 cycles; 72℃, 1 min 30 s; stored at 12℃. The band length was checked by 1% agarose gel electrophoresis. After confirming the correct band length, the samples were sent to Sangon Biotech (Shanghai) Co., Ltd. for gene sequencing.
[0027] Experimental results: After culturing the isolated pathogen at 28℃ for approximately 24 hours, colonies were observed to be round, smooth-surfaced, milky-white, and with regular edges. Figure 1 As shown in (A1-A5). Gram staining revealed that all bacteria were Gram-negative bacilli, with slightly curved cells, as... Figure 1 As shown in (B1-B5). Using the above... gyr DNA extracted from bacteria was amplified by PCR using primers for gene B. The results of agarose gel electrophoresis are as follows: Figure 2 As shown, all bacterial genomes amplified to approximately 1300 bp bands. Nucleic acid sequence alignment was performed using NCBI, and the results showed that the experimental strains… gyr Gene B and Vibrio mimicry genome in NCBI gyr The consistency of the B gene reached over 99%, indicating that the bacteria isolated from the "square" skin rot disease of yellow catfish were all Vibrio mimicus.
[0028] Dissection and microscopic observation revealed that the collected, disease-free yellow catfish from the pond were vigorous, with intact body surfaces and internal organs, normal color and texture, and no lesions. Microscopic examination of the gills, body surface mucus, and intestines also showed no parasites. LB agar plates containing liver, kidney, or spleen tissues were inoculated and cultured at 28°C for 48 hours, showing no bacterial growth. These results indicate that the collected yellow catfish were healthy.
[0029] Example 3: Isolation and culture of antagonistic bacteria (1) Isolation and culture of aerobic and facultative anaerobic bacteria: Take 10 diluted 3 times, 10 4 Double 10 5 Three dilution gradients (200 μL each) were plated onto LB agar plates, with three plates for each dilution. The plates were incubated at 28°C for 24–48 h. After incubation, plates with clearly dispersed colonies were selected. For each sample, an optimal dilution gradient was chosen, and different colonies were randomly selected as test strains. The test strains were purified and inoculated into centrifuge tubes containing 1 mL of sterile LB medium. After incubation at 28°C for 24–48 h, the tubes were stored at 4°C for later use.
[0030] Experimental Results: Diluted samples were spread onto LB agar and incubated at 28°C for 24–48 h. Bacteria of varying sizes, shapes, and colors grew on the plates. Individual colonies were randomly selected for expansion culture, prioritizing colonies with different sizes, shapes, and colors. Some of the obtained colonies are shown below. Figure 3 As shown.
[0031] (2) Isolation of Bacillus: 200 μL of the pretreated undiluted sample was inoculated into LB broth and enriched at 28°C for 48 h. Then, the sample was heated in a water bath at 85°C for at least 30 min. The sample was then serially diluted 10-fold to a final concentration of 10. 3 ~10 7 Take 200 μL of the diluted sample and spread it on LB agar medium. Incubate at 28°C for 24-48 h. Pick a single colony and re-inoculate it on LB agar medium. Incubate at 28°C for 24-48 h. Gram-stain the purified strain and preserve all Gram-positive bacteria with spores for later use.
[0032] Experimental results: After diluting the heat-treated bacterial suspension and spreading it on LB medium, and incubating at 28℃ for 24-48 hours, bacteria of varying sizes, shapes, and colors grew on the plates, such as... Figure 4 As shown. Single colonies were picked for expansion culture, then Gram staining was performed. All Gram-positive bacteria with spores were preserved for later use, such as... Figure 5 As shown.
[0033] (3) Isolation of lactic acid bacteria: Take 10 diluted with water 3 times, 10 4 Double 10 5 Three dilution gradients of samples, each at 200 μL, were spread onto Lactobacillus selective agar (LBS agar) and incubated in an anaerobic jar at 28°C for 24–48 h. Single colonies with or suspected of having a calcification ring were picked and re-inoculated onto MRS agar and incubated at 28°C for 48 h. Gram staining was performed to determine the purity of the strain. The purified and stained positive bacteria were then inoculated into MRS broth and incubated at 28°C for 48 h, and stored at 4°C for later use.
[0034] Experimental results: Diluted samples were spread on LBS agar medium and incubated under anaerobic conditions for 24–48 h. Some culture dishes showed white, moist, round colonies with irregular edges and calcium-dissolving rings around the colonies. Figure 6 As shown. After selecting bacteria with a calcification ring and performing Gram staining, all bacteria were observed to be Gram-positive, with bacterial cells including spherical, oval, and rod-shaped forms, such as... Figure 7 As shown.
[0035] A total of 157 aerobic and facultative anaerobic bacteria, 129 Bacillus strains, and 126 lactic acid bacteria strains were coarsely screened from 10 samples. The details of the number of bacterial strains screened for each sample are shown in Table 3.
[0036] Table 3 Number of strains screened for each sample
[0037] Example 4: Analysis of antibacterial activity of antagonistic bacteria (1) Antibacterial effect of antagonistic bacteria against Vibrio mimicus The antimicrobial activity of the antagonistic bacteria was determined using the Oxford cup method. The indicator strain of *Vibrio mimicus*, SCLS1901, was inoculated onto LB agar medium and cultured overnight. The culture was then washed with sterile physiological saline to obtain a bacterial suspension. The concentration of *Vibrio mimicus* was adjusted to 1 × 10⁻⁶ using McFarland turbidimetric tubes. 6 CFU / mL. Spread 200 μL of the *Vibrio mimicus* bacterial suspension onto an agar plate and let it stand at room temperature for several minutes to allow excess suspension to dry. Sterilize metal tweezers by flaming them over an alcohol lamp, then gently press the sterilized Oxford cup into the LB agar medium containing *Vibrio mimicus*, ensuring the bottom of the Oxford cup is suspended in the agar medium. Add 100 μL of the antagonistic bacterial suspension obtained in Example 3 to the Oxford cup. Then, place the petri dish upright and incubate at 28°C for 18-24 hours. After incubation, measure the diameter of the inhibition zone using a ruler.
[0038] Initial screening of antagonistic effects of antagonistic bacteria: Antagonistic bacteria are initially screened based on the antagonistic results, and the strains with the best antagonistic effects among all samples are retained as reserve bacteria for subsequent research.
[0039] Experimental results: After incubating LB agar plates containing Oxford cups upright at 28℃ for 24 hours, a clear inhibition zone appeared near some of the Oxford cups, such as... Figure 8 As shown in Table 4, the diameter of the inhibition zone was observed and recorded. Based on a comprehensive analysis of the antibacterial activity results, 10 antagonistic bacteria with good antagonistic effects were retained for probiotic and safety analysis, as shown in Table 4.
[0040] Table 4. Antibacterial activity of some antagonistic bacteria
[0041] (2) Antibacterial effect of antagonistic bacteria on other strains The antibacterial ability of the reserve bacteria against common pathogenic bacteria of yellow catfish, such as Aeromonas hydrophila, Aeromonas vernix, Edwardsiella edodes, and Streptococcus dolphinus, was determined using the same method as in step (1), and the bacteria were screened again based on the size of their inhibition zone.
[0042] Experimental results: After adding the pre-screened bacterial culture to the prepared Oxford cups, they were incubated at 28℃ for 24 hours. A clear inhibition zone appeared near some of the Oxford cups, such as... Figure 9 As shown in Table 5, the diameter of the inhibition zone was observed and recorded. Based on the antagonistic effects of the 10 antagonistic bacteria against common pathogens of yellow catfish, Y3N1, Y6N9, Y10N6, and R5N7 were ultimately selected as reserve probiotic strains for this study.
[0043] Table 5. Statistics on the antibacterial spectrum of antagonistic bacteria
[0044] Example 5: Analysis of antagonistic bacterial enzyme activity Bacterial enzyme activity detection media were prepared by adding 1% polysorbate-80, 8% skim milk powder, and 1% soluble starch to LB agar medium. The method for determining antagonistic bacterial enzyme activity was referenced from Cai Hongdan and improved (Cai Hongdan. Screening, Identification, and Probiotic Effects of Probiotics in the Intestine of Grouper [D]. Daqing: Heilongjiang Bayi Agricultural Reclamation University, 2021). The method is as follows: Holes were punched in the prepared enzyme activity medium using a sterile punch, excess agar blocks were removed, and 50 μL of undried LB medium was used as a seal. The medium was left at room temperature for 30 min to allow complete solidification. 50 μL of antagonistic bacterial solution was added to the wells of the prepared enzyme activity medium. The petri dishes were placed upright in a constant temperature incubator and incubated at 28℃ for 24 h. The presence of a transparent ring or turbidity around the wells was observed. Each antagonistic bacterium was tested in triplicate, and one negative control was performed. The negative control only involved replacing the antagonistic bacterial solution with ddH2O.
[0045] Experimental results: Four antagonistic bacterial strains (Y3N1, Y6N9, Y10N6, and R5N7) were inoculated into their respective enzyme activity media and cultured at 28°C for 24 h. As... Figure 10 As shown, clear circles appeared in the protease culture media of strains Y3N1, Y6N9, and Y10N6, while no clear circle appeared in the protease culture media of strain R5N7. No clear circles appeared in the lipase and amylase cultures of any of the four strains. The size of the clear circles for each strain is shown in Table 6. Based on this, it can be preliminarily determined that strains Y3N1, Y6N9, and Y10N6 possess the property of secreting proteases.
[0046] Table 6 Enzyme Activities of Strains
[0047] Example 6: Antagonistic Bacterial Drug Sensitivity Analysis The drug susceptibility of probiotics was determined using the disk diffusion method. Following the Vibrio mimicry dilution method described in Example 4, the bacterial suspensions of four antagonistic bacterial strains (Y3N1, Y6N9, Y10N6, and R5N7) were adjusted to a concentration of 1×10⁻⁶.8 CFU / mL. Using a pipette, pipette 200 μL of antagonistic bacterial suspension into LB medium, then spread the suspension evenly using a spreader that has been heated with an alcohol lamp and cooled. Let it stand at room temperature for several minutes to dry any excess suspension. Using tweezers that have been heated with an alcohol lamp and cooled, pick up the drug sensitivity test strip, place it on the medium, and gently press it to secure it. Then place the culture dish upright in a constant temperature incubator and incubate at 28°C for 24 hours. After incubation, use a ruler to measure the size of the inhibition zone around the drug sensitivity test strip and compare it with the inhibition zone size range specified in the drug sensitivity kit instructions to determine the drug sensitivity range.
[0048] Experimental Results: The drug susceptibility range of four antagonistic bacteria strains was determined using the disk diffusion method. After incubation at 28℃ for 24 h, the inhibition zones of each drug were statistically analyzed, and the susceptibility levels of the probiotics to the drugs were determined. The results are shown in Table 7. Among the four antagonistic bacterial strains, Y3N1 showed resistance to 16 antibiotics, including commonly used antibiotics such as florfenicol, enrofloxacin, and sulfamethoxazole. Y6N9 showed resistance to a few antibiotics but was sensitive to commonly used antibiotics such as florfenicol and doxycycline. Y10N6 showed resistance to commonly used antibiotics such as florfenicol, tetracycline, and sulfamethoxazole. R5N7 was sensitive only to norfloxacin and vancomycin.
[0049] Table 7. Sensitivity range of antagonistic bacteria drugs
[0050] Note: R indicates drug resistance; I indicates intermediate; S indicates susceptibility. Example 7: Hemolytic activity analysis of antagonistic bacteria Following the method described in Example 6, 8% rabbit blood and yellow catfish blood were added to LB agar medium to prepare rabbit blood medium and yellow catfish blood medium, and the plates were sealed with wells. 50 μL of antagonistic bacterial suspension was added to the wells of the blood agar plates, and the plates were incubated at 28°C for 24 h. After incubation, the presence of hemolysis zones around the wells was observed, and the diameter of the hemolysis zones was measured using a ruler. Each probiotic strain underwent three parallel assays and one negative control. The negative control was performed by replacing the antagonistic bacterial suspension with ddH2O, while all other conditions remained the same.
[0051] Experimental Results: Four antagonistic bacterial strains were inoculated onto different blood agar plates and incubated at 28°C for 24 h. The size of the hemolysis zone on rabbit blood and yellow catfish blood was observed and measured. The hemolysis zone sizes are shown in Table 8. The results showed that strain Y10N6 produced obvious clear hemolysis zones on both yellow catfish blood and rabbit blood agar plates, exhibiting β-hemolysis (complete hemolysis). The other three strains showed no hemolysis on either yellow catfish blood or rabbit blood agar plates, exhibiting γ-hemolysis (non-hemolysis). Figure 11 .
[0052] Table 8. Solubility of antagonistic bacteria in rabbit and fish blood.
[0053] Example 8: Artificial Infection Experiment Using the method of diluting Vibrio mimicry described in Example 4, the bacterial suspensions of the four antagonistic bacteria were adjusted to 1×10⁻⁶. 9 CFU / mL, Vibrio mimicry concentration adjusted to 1×10 6 CFU / mL. Sixty healthy yellow catfish, weighing 50 g ± 10 g, were selected and temporarily held for 7 days. The fish were divided into 6 groups of 10 each: 4 groups were antagonistic bacteria experimental groups, 1 group was a Vibrio mimicry positive control group, and 1 group was a blank control group. Each fish was injected intraperitoneally with 100 μL of the corresponding sample. The antagonistic bacteria experimental groups were injected with an adjusted concentration of antagonistic bacteria solution, the positive control group was injected with Vibrio mimicry bacterial solution, and the negative control group was injected with 0.9% physiological saline. During the experiment, the water temperature was maintained at 25℃ using a heater, and an aerator was used for aeration. Mortality was recorded every 24 hours for 7 consecutive days. After 7 days, the surviving fish were dissected to observe for any lesions on their body surface and inside the body.
[0054] Experimental Results: After intraperitoneal injection of four antagonistic bacteria into yellow catfish, the fish were observed for 7 days. The survival rates of each group are shown in Table 13. The survival rate of the experimental group was 100%, the positive control was 0%, and the negative control was 100%. Seven days later, the yellow catfish in each group were dissected. The experimental and negative control groups showed uniform body shape and no damage, intact mucus layer on the body surface, no congestion, ecchymosis, hemorrhage, or ulceration in the muscle layer, intact gill filaments, normal color, and no lesions in the internal organs. The results indicate that none of the four antagonistic bacteria are pathogenic to yellow catfish.
[0055] Table 13 Safety test of antagonistic bacteria on yellow catfish
[0056] Example 9: Identification of Antagonistic Bacteria The antagonistic bacteria were identified using the method described in Example 2. The PCR amplification products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were analyzed using a neighbor-joining phylogenetic tree constructed using MEGA6.0 software.
[0057] Experimental Results: Based on the above characteristics and safety analysis, strain Y6N9 exhibits strong antagonistic ability against common pathogens in yellow catfish, can produce proteases, and has good safety profile. Therefore, it can be considered a candidate probiotic strain for disease control in yellow catfish farming. PCR identification... gyrThe specific fragment amplified by primers B (SEQ ID NO.1 and SEQ ID NO.2) is approximately 1300 bp (e.g. Figure 12 As shown in A), phylogenetic analysis of the sequencing sequence revealed that it clustered with *Bacillus urealyticum* and was on the same large branch as other *Bacillus* species, but its phylogenetic relationship with other *Bacillus* species and aquatic animal pathogens was relatively distant (e.g., ...). Figure 12 (As shown in B). The above results indicate that the probiotic Y6N9 is a ureobacillus (Bacillus urealyticum). Paenibacillus urinalis Strain Y6N9 is deposited at the China Center for Type Culture Collection, accession number: CCTCC M 20242902.
[0058] In summary, from 5 samples of patients with Vibrio mimicry and 5 healthy samples, aerobic and facultative anaerobic bacteria, Bacillus, and lactic acid bacteria were isolated, resulting in 2 strains of Bacillus and 2 strains of lactic acid bacteria with good antagonistic effects. Enzyme activity analysis of the 4 antagonistic bacteria revealed that Y3N1, Y6N9, and Y10N6 could produce proteases. Drug sensitivity testing of the antagonistic bacteria showed that Y3N1 was resistant to 16 antibiotics; Y6N9 was resistant to a few antibiotics but sensitive to commonly used antibiotics such as florfenicol and doxycycline; Y10N6 was resistant to commonly used antibiotics such as florfenicol, tetracycline, and sulfamethoxazole. R5N7 was resistant only to norfloxacin and vancomycin. Safety evaluation of the antagonistic bacteria revealed that Y10N6 exhibited β-hemolysis, while the other three strains did not. Animal experiments showed that all four strains were non-pathogenic in experimental animals. The above studies indicate that the antagonistic bacterium Y6N9 (Bacillus urealyticum, China Center for Type Culture Collection, accession number: CCTCC M 20242902) has higher application value in the prevention and control of diseases in yellow catfish.
[0059] Although specific embodiments of the present invention have been described in detail with reference to examples, they should not be construed as limiting the scope of protection of this patent. Various modifications and variations that can be made by those skilled in the art without inventive effort within the scope described in the claims are still within the scope of protection of this patent.
Claims
1. A type of ureobacillus, in Latin name... Paenibacillus urinalis It is deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20242902, deposited on December 25, 2024, and named Y6N9.
2. An antibacterial agent, characterized in that: Includes the ureobacillus described in claim 1.
3. The use of the ureobacillus of claim 1 and / or the antibacterial agent of claim 2 in the preparation of an antimicrobial agent for antagonizing pathogens in aquaculture.
4. The application according to claim 3, characterized in that: The pathogens are Vibrio mimicus, Edwardsiella tarda, Streptococcus dolphinus, Aeromonas hydrophila, and / or Aeromonas vernix.
5. The application according to claim 3, characterized in that: The aquatic product mentioned is yellow catfish.