Plant-mediated VIGS silencing system for tomato leafminer TaSUC2 gene and application thereof

CN122588095APending Publication Date: 2026-08-18GUIYANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610995880.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-06
Publication Date
2026-08-18

AI Technical Summary

Technical Problem

[0005]基于此,有必要针对上述技术问题,提供一种植物介导番茄潜叶蛾TaSUC2基因VIGS沉默体系及其应用,用于解决现有昆虫基因沉默技术操作复杂、成本高昂、稳定性差、难以田间规模化应用的技术问题

Benefits of technology

[0029] 1. This invention provides a plant-mediated VIGS silencing system for the TaSUC2 gene of the tomato leafminer and its application. The nucleotide sequence of the TaSUC2 gene of the tomato leafminer is obtained. Based on VIGS technology, it can specifically target the tomato leafminer and reduce the impact on non-target organisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122588095A_ABST
    Figure CN122588095A_ABST
Patent Text Reader

Abstract

The present application relates to the field of agricultural biotechnology, and particularly relates to a plant-mediated Heliothis armigera TaSUC2 gene VIGS silencing system and application thereof. The present application relates to a virus-induced gene silencing (VIGS) technology for modifying a host plant, so that the host plant can stably express a dsRNA fragment of a Heliothis armigera TaSUC2 gene, and through the Heliothis armigera feeding on the host plant, the target gene in the Heliothis armigera is cross-border silenced, so that the size of the Heliothis armigera is reduced, the mortality of the Heliothis armigera is significantly improved, the delivery efficiency of the dsRNA is effectively improved, and a new method is provided for a green and sustainable prevention and control strategy of the Heliothis armigera.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, and in particular to a plant-mediated TaSUC2 gene VIGS silencing system for the tomato leafminer and its application. Background Technology

[0002] The tomato leafminer is a global quarantine pest characterized by high reproductive capacity and strong environmental adaptability, leading to its rapid spread across Europe and numerous countries in Asia, Europe, and Africa. As of 2024, it had been found in 116 countries and regions worldwide. The tomato leafminer has a wide host range, primarily damaging solanaceous plants, especially tomatoes. Its larvae prefer to burrow into the leaf tissues of host plants to feed, and some larvae also burrow into the stems, penetrating or feeding on the tomato fruit. This causes gaps in the leaves, hindering photosynthesis, resulting in widespread wilting and fruit drop. In severely affected areas, tomato yields can be reduced by 80-100%, posing a significant threat to the global tomato industry. Currently, tomato leafminer control mainly relies on chemical pesticides. However, the broad-spectrum nature of traditional pesticides easily leads to the death of natural enemies of pests in the field, disrupts the ecological balance of farmland, and exacerbates pesticide resistance year by year, resulting in prominent problems of pesticide residues and soil and water pollution. This is inconsistent with the concept of green agriculture development, thus necessitating the search for new targets for green pest control.

[0003] Insect gene function research and green pest control are core research directions in the field of agricultural plant protection. Existing insect gene silencing technologies have significant shortcomings: the traditional in vitro dsRNA feeding / soaking method is prone to RNA degradation by the environment, has a short silencing period, extremely high in vitro synthesis costs, and is only suitable for small-scale laboratory experiments, and cannot be applied to large-scale field control; the in vivo VIGS mediated by insect baculoviruses requires direct infection of the insect body, which is complicated to operate, has unstable infection efficiency, and is difficult to process pests in batches.

[0004] To address the shortcomings of existing technologies, such as high sunk costs, cumbersome operation, poor field applicability, and inability to be applied on a large scale, this invention designs a plant-mediated TaSUC2 gene VIGS silencing system for tomato leafminer and its application, achieving low-cost, long-term, and large-scale insect gene silencing and pest control, providing an alternative technical solution to the aforementioned technical problems. Summary of the Invention

[0005] Therefore, it is necessary to provide a plant-mediated TaSUC2 gene VIGS silencing system for the tomato leafminer and its application to address the aforementioned technical problems, thereby solving the technical issues of existing insect gene silencing technologies, such as complex operation, high cost, poor stability, and difficulty in large-scale field application.

[0006] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0007] A specific nucleotide fragment for plant-mediated insect virus-induced gene silencing, the nucleotide fragment targeting the conserved coding region of the insect target gene TaSUC2, the sequence of the specific nucleotide fragment being shown in SEQ ID NO.2.

[0008] A plant-mediated insect virus-induced gene silencing recombinant vector comprising the specific nucleotide fragment as described in claim 1; the backbone of the recombinant vector is a plant RNA virus vector capable of infecting and replicating within a host plant, wherein the specific nucleotide fragment is inserted into the multiple cloning site of the plant RNA virus vector and transcription is driven by a viral subgenomic promoter.

[0009] Preferably, the plant RNA virus vector is a pTRV2 vector.

[0010] A method for constructing a recombinant vector for plant-mediated insect virus-induced gene silencing as described in claim 2, comprising the following steps:

[0011] (1) Design specific upstream and downstream primers according to SEQ ID NO.1, and introduce restriction enzyme sites at both ends of the primers;

[0012] PCR amplification was performed using a template containing the sequence shown in SEQ ID NO.1 to obtain the specific nucleotide fragment described in claim 1;

[0013] (2) The plant virus vector backbone and PCR amplification product were double-digested with restriction endonucleases corresponding to the restriction enzyme sites introduced at both ends of the primers, and the vector and target fragment were recovered and purified.

[0014] (3) The target fragment and the vector were ligated by DNA ligase, competent cells were transformed, positive clones were screened, and the correct VIGS recombinant vector was obtained by sequencing.

[0015] Preferably, the sequence of the upstream primer is shown in SEQ ID NO.3, and the sequence of the downstream primer is shown in SEQ ID NO.4.

[0016] A method for cultivating a virus-carrying host plant involves transforming Agrobacterium tumefaciens with the recombinant vector described in claim 2, and / or the recombinant vector prepared by the construction method described in claim 4 and the pTRV1 plasmid vector, respectively, and then jointly infecting the host plant to cultivate a virus-carrying host plant that can stably express an insect gene silencing fragment.

[0017] Preferably, the infection method is one or more of Agrobacterium tumefaciens infiltration and leaf injection.

[0018] A plant-mediated insect target gene virus-induced gene silencing method includes the following steps:

[0019] A. Virus-carrying host plants were obtained by cultivating the method described in claim 6;

[0020] B. The target insects are placed on infected host plants and raised there. The insects ingest recombinant viruses and silent RNA fragments by naturally feeding on plant tissues.

[0021] C was continuously cultured under conventional insect and plant culture conditions for 7–14 days to achieve specific and efficient silencing of target genes in insects.

[0022] The nucleotide fragment of claim 1, and / or the recombinant vector of claim 2, and / or the virus-carrying host plant of claim 6, and / or any of the following applications of the silencing method of claim 8:

[0023] Analysis of insect gene function;

[0024] Green control of agricultural target pests;

[0025] Screening of insecticidal targets;

[0026] Pest trait regulation

[0027] It is clear without a doubt that the technical problems to be solved by the present invention can be solved by the above-described technical solutions of the present invention.

[0028] Meanwhile, through the above technical solutions, the present invention has at least the following beneficial effects:

[0029] 1. This invention provides a plant-mediated VIGS silencing system for the TaSUC2 gene of the tomato leafminer and its application. The nucleotide sequence of the TaSUC2 gene of the tomato leafminer is obtained. Based on VIGS technology, it can specifically target the tomato leafminer and reduce the impact on non-target organisms.

[0030] 2. The recombinant virus of this invention can continuously replicate and stably express silent RNA in the host plant without the need for in vitro synthesis of large amounts of dsRNA, and can be continuously supplied to insects.

[0031] 3. The present invention enables the tomato leafminer to feed on plants containing the target gene fragment, effectively silencing the TaSUC2 gene of the tomato leafminer. This not only reduces its size but also increases the mortality rate of the tomato leafminer, thereby improving the control effect of the tomato leafminer.

[0032] 4. This invention relies on cross-species expression of plant virus vectors, with no foreign gene integration and no ecological residue, and has high safety. It is an environmentally friendly pest control technology that meets the needs of green agricultural development. Attached Figure Description

[0033] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0034] Figure 1 This is a schematic diagram showing that the expression level of the TaSUC2 gene was significantly reduced after the tomato leafminer fed on plants treated with pTRV2-TaSUC2 according to the present invention.

[0035] Figure 2 This is a schematic diagram illustrating the effect of the tomato leafminer on the survival rate of tomato leafminer after feeding on plants treated with pTRV2-TaSUC2 according to the present invention.

[0036] Figure 3 This is a schematic diagram illustrating the effect of the tomato leafminer on the body size of the tomato leafminer after feeding on plants treated with pTRV2-TaSUC2 according to the present invention.

[0037] Figure 4 This is a schematic diagram illustrating the effect of the tomato leafminer on the phenotype of the tomato leafminer after feeding on plants treated with pTRV2-TaSUC2. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0039] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0040] It should be noted that, unless otherwise specified, the embodiments and features and technical solutions in the present invention can be combined with each other.

[0041] It should be noted that similar labels and letters in the following figures indicate similar items. Therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures.

[0042] Example 1:

[0043] The plant-mediated VIGS silencing system for the TaSUC2 gene of the tomato leafminer and its construction method are as follows:

[0044] S1. Obtain the TaSUC2 gene of the tomato leafminer moth. Its nucleotide sequence is obtained from the tomato leafminer transcriptome database. The nucleotide sequence of the TaSUC2 gene is shown in SEQ ID NO.1.

[0045] S2. Using the TaSUC2 gene of the tomato leafminer moth from S1, the dsRNA of the TaSUC2 gene was designed and synthesized. The nucleotide sequence of the dsRNA fragment is shown in SEQ ID NO.2.

[0046] Preferably, in step S2, the method for synthesizing dsRNA of the TaSUC2 gene of the tomato leafminer includes the following steps: designing an upstream primer as shown in SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4 according to the sequence SEQ ID NO.1, and then obtaining the product as shown in SEQ ID NO.2 by PCR amplification, which is then purified, transcribed, and synthesized into dsRNA.

[0047] S3. The dsRNA fragment in S2 is ligated into the pTRV2 plasmid to obtain the pTRV2-TaSUC2 recombinant plasmid vector containing the target gene dsRNA fragment.

[0048] S4. Transform Agrobacterium GV3101 with the vector described in S3 and the pTRV1 plasmid vector respectively to prepare the infection solution ( =0.4~0.6), tomato leaves were injected with the target gene TaSUC2, cultured in the dark at 24℃ for 24 h, and then cultured in a photoperiodic environment for 7~14 days to obtain plants with silenced target gene TaSUC2.

[0049] Example 2: Design and Amplification of the TaSUC2 Gene Silent Fragment in Tomato Leafminer

[0050] A 500 bp specific silencing fragment was designed from the conserved coding region of the TaSUC2 gene of the tomato leafminer. The sequence is shown in SEQ ID NO.2. This fragment has no hairpin structure and no homologous sequences to the plant genome, and only specifically silences the insect target gene without affecting the normal growth and development of the host plant. Upstream specific primer SEQ ID NO.3 and downstream specific primer SEQ ID NO.4 were designed. The PCR amplification system consisted of 10 μL of 2×Taq PCR Mix, 0.5 μL each of the upstream and downstream primers, 1 μL of template DNA, and 8 μL of sterile water. The PCR program was as follows: 94℃ pre-denaturation for 3 min; 35 cycles of 94℃ for 30 s, 56℃ for 30 s, and 72℃ for 40 s; and a final extension at 72℃ for 5 min. The amplified product was purified by agarose gel electrophoresis and gel recovery to obtain a high-purity target fragment.

[0051] The gene sequence list is as follows:

[0052] SEQ ID NO.1 (TaSUC2 gene):

[0053]

[0054] SEQ ID NO.2 (Specific Silencing Fragment):

[0055] ATGTGGGAACAACATTATCCTGAACAAAGCGATGGCTTCAATGGATTTATGACCATTCCAAGAGAACTTACACTTACTACAGACCTTCGTATGCTACAGAATCCAGTATCACAGATTGCTAGTGCTACAGGTAGAGAACTACGGTCAGGAAGAGGCGAAAAAGGGGCCACAGCGGTACTAGAAGACAAAGCTGGTGAAGTAACAATAACAGCACAAAGGGATAAAGACTTAGAAGTGGTACTAGAAGGTG AGAGCGGACAAACTGTGACGTTGAGCTACAACTATCTGAAAGGCACCGTTACCCTTGACCGTGGAGGAGCAGATCCTATTCGAAGGACCAAATGGCGACCACGAGATGAGCTACGTTGGAGGATTTACATTGATGCCAGTTCAGTAGAACTATTTTGTGGTGATGGAGAGGTTACTTTCTCAAGCAGATTTTTCCCTGAAGGACCAATAAAAGTCCGACTAGGAGATCAATGCGAAACCAAAGAATTCAG

[0056] SEQ ID NO.3 (upstream primer):

[0057] TAATACGACTCACTATAGGGGCTACAGAATCCAGTATCAC

[0058] SEQ ID NO.4 (downstream primer):

[0059] TAATACGACTCACTATAGGGCGCATTGATCTCCTAGTCGG

[0060] Example 3: Construction of plant-mediated VIGS recombinant vector

[0061] The pTRV2 plant virus vector was used as the backbone. The purified target fragment and the pTRV2 empty vector were digested and purified separately. The linearized vector and the target gene fragment were recovered. Ligation was performed overnight at 16°C using T4 DNA ligase. The ligation product was transformed into *E. coli* DH5α competent cells, plated on LB agar plates containing kanamycin resistance, and incubated upside down at 37°C for 12 h. Single clones were picked for colony PCR and sequencing verification. Positive clones with correct sequencing were identified as the recombinant vector pTRV2-TaSUC2. The positive recombinant vector and the pTRV1 plasmid vector were transformed into *Agrobacterium* GV3101 competent cells to obtain engineered bacteria, which were stored at -80°C for later use.

[0062] Example 4: Cultivation of Tomato Plants with Virus-Infected Hosts

[0063] Single clones of Agrobacterium containing pTRV2-TaSUC2 and Agrobacterium containing pTRV1 were inoculated into LB liquid medium containing the corresponding antibiotics and cultured at 28°C with shaking until... =0.6; Centrifuge to collect bacterial cells, resuspend the cells in infection buffer, and activate at room temperature for 3 h to prepare Agrobacterium infection solution. Select healthy tomato plants and inoculate them using the leaf injection method. The treatment group was injected with Agrobacterium solution containing pTRV1+pTRV2-TaSUC2 vector, while the control group was injected with Agrobacterium solution containing pTRV1+pTRV2-eGFP vector. (Reference) Figure 1 (Plants fed with pTRV2-eGFP were used as the control group, and plants fed with pTRV2-TaSUC2 were used as the treatment group. The bar chart represents the mean ± standard error.) (P < 0.01). After infection, the plants were cultured in the dark at 24°C for 24 h, followed by normal photoperiod culture for 7–14 days to obtain stably infected tomato plants carrying the recombinant virus, which were plants with the target gene TaSUC2 silenced.

[0064] Example 5: Plant-mediated TaSUC2 gene silencing experiment in tomato leafminer

[0065] Third-instar larvae of the tomato leafminer with similar growth characteristics were selected. The treatment group larvae were fed tomato leaves treated with pTRV2-TaSUC2, while the control group was fed tomato leaves treated with pTRV2-eGFP. Both groups were cultured in a constant temperature incubator, and the growth, development, and survival status of the larvae were observed regularly. Samples were taken and the relative expression level of the TaSUC2 gene in the tomato leafminer was detected by qPCR. Figure 2 ( (Indicates P<0.001) Figure 3 ( This indicates that P < 0.05. (Indicates P<0.001) Figure 4 .

[0066] Experimental results: The expression level of TaSUC2 gene in the tomato leafminer was significantly reduced in the treatment group, the insect size was smaller, and the mortality rate was significantly increased, proving that the system of the present invention has strong specificity and stable silencing effect.

[0067] The preferred embodiments of the present invention disclosed above are merely illustrative of the invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the invention to the specific implementations described. Clearly, many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention. The invention is limited only by the claims and their full scope and equivalents.

Claims

1. A specific nucleotide fragment for plant-mediated insect virus-induced gene silencing, characterized in that, The nucleotide fragment targets the conserved coding region of the insect target gene TaSUC2, and the specific nucleotide fragment sequence is shown in SEQ ID NO.

2.

2. A recombinant vector for plant-mediated insect virus-induced gene silencing, characterized in that, The recombinant vector comprises the specific nucleotide fragment as described in claim 1; the backbone of the recombinant vector is a plant RNA virus vector that can infect and replicate in the host plant, and the specific nucleotide fragment is inserted into the multiple cloning site of the plant RNA virus vector and is transcribed by a viral subgenome promoter.

3. The recombinant vector according to claim 2, characterized in that, The plant RNA virus vector is the pTRV2 vector.

4. A method for constructing a recombinant vector for plant-mediated insect virus-induced gene silencing as described in claim 2, characterized in that, Includes the following steps: (1) Design specific upstream and downstream primers according to SEQ ID NO.1, and introduce restriction enzyme sites at both ends of the primers; PCR amplification was performed using a template containing the sequence shown in SEQ ID NO.1 to obtain the specific nucleotide fragment described in claim 1; (2) The plant virus vector backbone and PCR amplification product were double-digested with restriction endonucleases corresponding to the restriction enzyme sites introduced at both ends of the primers, and the vector and target fragment were recovered and purified. (3) The target fragment and the vector were ligated by DNA ligase, competent cells were transformed, positive clones were screened, and the correct VIGS recombinant vector was obtained by sequencing.

5. The method for constructing a recombinant vector for plant-mediated insect virus-induced gene silencing according to claim 4, characterized in that, The sequence of the upstream primer is shown in SEQ ID NO.3, and the sequence of the downstream primer is shown in SEQ ID NO.

4.

6. A method for cultivating a virus-carrying host plant, characterized in that, Using the recombinant vector described in claim 2, and / or the recombinant vector prepared by the construction method described in claim 4 and the pTRV1 plasmid vector, respectively, Agrobacterium is transformed and then used to infect host plants, thereby cultivating virus-carrying host plants that can stably express insect gene silencing fragments.

7. The method for cultivating a virus-carrying host plant according to claim 6, characterized in that, The infection method is one or more of Agrobacterium tumefaciens infiltration and leaf injection.

8. A method for plant-mediated insect target gene virus-induced gene silencing, characterized in that, Includes the following steps: A. Virus-carrying host plants were obtained by cultivating the method described in claim 6; B. The target insects are placed on infected host plants and raised there. The insects ingest recombinant viruses and silent RNA fragments by naturally feeding on plant tissues. C was continuously cultured under conventional insect and plant culture conditions for 7–14 days to achieve specific and efficient silencing of target genes in insects.

9. Any of the following applications of the nucleotide fragment of claim 1, and / or the recombinant vector of claim 2, and / or the virus-carrying host plant of claim 6, and / or the silencing method of claim 8: Analysis of insect gene function; Green control of agricultural target pests; Screening of insecticidal targets; Pest trait regulation.