A molecular marker for detecting wheat SDS sedimentation value, a primer set and application thereof
By applying KASP technology and specific primer sets to wheat, the problem of low efficiency in improving wheat SDS sedimentation value in traditional breeding methods has been solved, achieving rapid and accurate identification of SDS sedimentation value, improving breeding efficiency and reducing costs.
Patent Information
- Application Number
- CN202611122015.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-27
- Publication Date
- 2026-08-25
AI Technical Summary
Traditional breeding methods are inefficient and imprecise in improving wheat SDS sedimentation value, making it difficult to quickly and accurately screen for target genotypes.
A molecular marker based on KASP technology was developed. Using the wheat SDS sedimentation value-related SNP site ZJ_2DL_7490, a specific primer set was designed and combined with real-time quantitative PCR amplification to achieve rapid identification of wheat SDS sedimentation value.
This method enables rapid and accurate identification of wheat SDS sedimentation values, improves breeding efficiency, simplifies the molecular marker-assisted selection process, and reduces costs.
Smart Images
Figure CN122629232A_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of biotechnology, specifically relating to a molecular marker, primer set, and its application for detecting wheat SDS deposition values. Background Technology
[0002] wheat( Triticum aestivum Wheat (L.) is one of the world's most important food crops, playing an irreplaceable role in the supply of staple foods and the food processing industry. The protein content and quality characteristics of wheat grains directly determine the processing performance of flour and the quality of end products, and have a key impact on the processing suitability of foods such as bread and noodles. Among them, SDS sedimentation value, as an important indicator for evaluating the quantity and quality of gluten, can comprehensively reflect the degree of polymerization and strength of wheat gluten protein, and is an important parameter for measuring the processing quality of wheat. In particular, gluten quality traits with SDS sedimentation value as the core have become an important target for wheat genetic improvement.
[0003] However, wheat SDS sedimentation value, as a quantitative trait, is controlled by multiple genes and significantly influenced by environmental conditions, resulting in complex genetic patterns. Traditional breeding methods largely rely on field phenotypic data for selection. While this has promoted the breeding of varieties with high SDS sedimentation values to some extent, it is inefficient and lacks precision, often requiring multiple generations to obtain ideal materials. To address this challenge, modern molecular breeding methods have been widely introduced, providing new insights for wheat quality improvement.
[0004] Molecular marker technology provides a powerful tool for the research and application of quantitative traits. Among the many marker types, KASP (Kompetitive Allele Specific PCR) technology is widely used due to its sensitivity, stability, and low cost. KASP relies on allele-specific amplification and fluorescence signal determination to achieve accurate genotyping of target single nucleotide polymorphisms (SNPs), making it particularly suitable for rapid screening in large populations. In wheat breeding, developing KASP markers around SDS sedimentation value-related quantitative trait loci (QTL) regions allows breeders to accurately determine target genotypes in early generations, significantly improving breeding efficiency. Summary of the Invention
[0005] Objectives of this application: One objective is to provide a molecular marker associated with wheat SDS sedimentation value. A second objective is to provide the aforementioned primer set associated with wheat SDS sedimentation value. A third objective is to provide applications of the aforementioned molecular marker associated with wheat SDS sedimentation value.
[0006] Technical solution: To achieve the above objectives, the present application provides the following solution: a molecular marker for detecting wheat SDS sedimentation value, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein a T / C base mutation exists at position 24 of the sequence shown in SEQ ID NO.1, wherein when the base at this position is T, the wheat SDS sedimentation value is low, and when the base at this position is C, the wheat SDS sedimentation value is high.
[0007] In some embodiments, the molecular marker is a KASP marker.
[0008] This application also provides a primer set for detecting wheat SDS deposition values, the primer set including ZJ_2DL_7490_F1 as shown in SEQ ID NO.2, ZJ_2DL_7490_F2 as shown in SEQ ID NO.3, and ZJ_2DL_7490_R as shown in SEQ ID NO.4.
[0009] In some embodiments, the 5' end of the forward primer ZJ_2DL_7490_F1 shown in SEQ ID NO.2 is connected to a FAM fluorescent adapter sequence, and the 5' end of the forward primer ZJ_2DL_7490_F2 shown in SEQ ID NO.3 is connected to a HEX fluorescent adapter sequence; the FAM fluorescent adapter sequence is shown in SEQ ID NO.5, and the HEX fluorescent adapter sequence is shown in SEQ ID NO.6.
[0010] This application also provides a method for detecting wheat SDS deposition value, including the following steps: For the SNP site shown in SEQ ID NO.1, a primer set labeled with KASP was designed to amplify the primer set labeled with KASP related to wheat SDS sedimentation value. The primer pair sequence of the molecular marker is as follows: Two forward primers are connected to different fluorescent adapter sequences: the 5' end of forward primer ZJ_2DL_7490_F1, as shown in SEQ ID NO.2, is connected to the FAM fluorescent adapter sequence, and the 5' end of forward primer ZJ_2DL_7490_F2, as shown in SEQ ID NO.3, is connected to the HEX fluorescent adapter sequence; the FAM fluorescent adapter sequence is shown in SEQ ID NO.5, and the HEX fluorescent adapter sequence is shown in SEQ ID NO.6; Real-time PCR amplification was performed using wheat DNA as a template: If only the FAM fluorescence signal corresponding to primer ZJ_2DL_7490_F1, which is linked to the fluorescent adapter sequence, is detected in the PCR product of the sample, then the detection site is the T / T genotype, and it is determined to be a homozygous type with a low SDS sedimentation value phenotype. If only the HEX fluorescence signal corresponding to primer ZJ_2DL_7490_F2, which is linked to the fluorescent adapter sequence, is detected in the PCR product of the sample, then the detection site is the C / C genotype, and it is determined to be a homozygous type with a high SDS sedimentation value phenotype. If the PCR product of the sample simultaneously detects two types of FAM and HEX fluorescence signals corresponding to primers ZJ_2DL_7490_F1 and ZJ_2DL_7490_F2 which are linked to fluorescent adapter sequences, then the detection site is the T / C genotype, and it is determined to be a heterozygous type with a medium SDS sedimentation value phenotype.
[0011] This application also provides a KASP marker for identifying wheat SDS deposition values, which includes the aforementioned molecular marker.
[0012] This application also provides the application of molecular markers for detecting wheat SDS sedimentation values or primer sets as described above for detecting wheat SDS sedimentation values in the identification or auxiliary detection of wheat SDS sedimentation values.
[0013] This application also provides molecular markers for detecting wheat SDS deposition values or the application of the primer set for detecting wheat SDS deposition values in marker-assisted breeding of wheat SDS deposition values.
[0014] This application also provides a kit for detecting wheat SDS sedimentation value, including a primer set for detecting wheat SDS sedimentation value, wherein the primer set includes: ZJ_2DL_7490_F1 as shown in SEQ ID NO.2, ZJ_2DL_7490_F2 as shown in SEQ ID NO.3 and ZJ_2DL_7490_R as shown in SEQ ID NO.4.
[0015] In some embodiments, the 5' end of the forward primer ZJ_2DL_7490_F1 shown in SEQ ID NO.2 is connected to a FAM fluorescent adapter sequence, and the 5' end of the forward primer ZJ_2DL_7490_F2 shown in SEQ ID NO.3 is connected to a HEX fluorescent adapter sequence; the FAM fluorescent adapter sequence is shown in SEQ ID NO.5, and the HEX fluorescent adapter sequence is shown in SEQ ID NO.6.
[0016] This application also provides a method for identification using KASP markers of wheat SDS deposition values, including the following steps: (1) Extracting genomic DNA from wheat to be tested; (2) A primer set for detecting wheat SDS deposition value is designed, the primer set including ZJ_2DL_7490_F1 as shown in SEQ ID NO.2, ZJ_2DL_7490_F2 as shown in SEQ ID NO.3 and ZJ_2DL_7490_R as shown in SEQ ID NO.4; the 5' end of the forward primer ZJ_2DL_7490_F1 as shown in SEQ ID NO.2 is connected to the FAM fluorescent adapter sequence, and the 5' end of the forward primer ZJ_2DL_7490_F2 as shown in SEQ ID NO.3 is connected to the HEX fluorescent adapter sequence; the FAM fluorescent adapter sequence is shown in SEQ ID NO.5, and the HEX fluorescent adapter sequence is shown in SEQ ID NO.6; (3) Using the genomic DNA extracted in step (1) as a template, perform real-time PCR amplification using the primer set of molecular markers described in step (2), and analyze the results of real-time PCR amplification. (4) Analyze the results of quantitative real-time PCR amplification. If the sample PCR product only detects the FAM fluorescence signal corresponding to primer ZJ_2DL_7490_F1 with fluorescent adapter sequence, then the site is a T / T genotype and is determined to be a homozygous type with a low wheat SDS sedimentation value phenotype. If the sample PCR product only detects the HEX fluorescence signal corresponding to primer ZJ_2DL_7490_F2 with fluorescent adapter sequence, then the site is a C / C genotype and is determined to be a homozygous type with a high wheat SDS sedimentation value phenotype. If both FAM and HEX fluorescence signals corresponding to primers ZJ_2DL_7490_F1 and ZJ_2DL_7490_F2 with fluorescent adapter sequence are detected at the same time, then the site is a T / C genotype and is determined to be a heterozygous type.
[0017] Beneficial effects: (1) This application measures the SDS sedimentation value of wheat grain powder and locates a linkage region in wheat through extreme pooling analysis of recombinant inbred line population. The linkage region contains a significant SNP site, named ZJ_2DL_7490. This molecular marker is located on chromosome 2D of the wheat reference genome. Using the molecular marker ZJ_2DL_7490 of this application, the level of wheat SDS sedimentation value can be quickly identified; (2) This application uses a marker linked to wheat SDS sedimentation value for screening, which is beneficial to molecular marker-assisted selection breeding. The method is simple and feasible, which is conducive to improving efficiency and saving costs; (3) The molecular marker of this application has the characteristics of convenient detection, stable amplification products and high specificity. It can be applied to the practice of molecular marker-assisted breeding and material identification of wheat SDS sedimentation value related to SDS sedimentation value in a simple, fast and high-throughput manner. Attached Figure Description
[0018] Figure 1 The KASP marker typing results for wheat SDS sedimentation values in Example 1; Figure 2 This is a box plot showing the distribution of wheat SDS sedimentation values corresponding to the genotypes at the ZJ_2DL_7490 locus in the wheat recombinant inbred line population of Example 1. C / C indicates that the genotype at the ZJ_2DL_7490 locus is homozygous with high SDS sedimentation value, and T / T indicates that the genotype at the ZJ_2DL_7490 locus is homozygous with low SDS sedimentation value. The dots represent the distribution of SDS sedimentation value data.
[0019] Figure 3 The KASP marker typing results for wheat SDS sedimentation values in Example 2; Figure 4 This is a box plot showing the distribution of SDS sedimentation values of wheat at the ZJ_2DL_7490 locus in the natural wheat population of Example 2. C / C indicates that the genotype at the ZJ_2DL_7490 locus is homozygous with high SDS sedimentation value, and T / T indicates that the genotype at the ZJ_2DL_7490 locus is homozygous with low SDS sedimentation value. The dots represent the distribution of SDS sedimentation value data. Detailed Implementation
[0020] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.
[0021] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.
[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0023] Example 1: Development and validation of molecular markers associated with wheat SDS sedimentation value This invention utilizes Zhenmai 9 and Shengxuan 6 as parents to construct a population of 252 recombinant inbred lines. The sedimentation volume (mL) of wheat grain powder was measured; a higher value indicates a higher SDS sedimentation value, and a lower value indicates a lower SDS sedimentation value. Using the SDS sedimentation values of the recombinant inbred line population, the highest and lowest 10% values were mixed in pools. Combined with 100K microarray data, allele frequency differences between different pools were compared to locate a linkage region containing a significant SNP site named ZJ_2DL_7490. This site is located at positions 617, 437, and 490 on chromosome 2D of the wheat reference genome v1.0. This site contains a T / C base mutation. The nucleotide sequence of this SNP site is shown in SEQ ID NO.1, and it is located at position 24 (counting from the first base at the 5' end as position 1). ACCTGAATGTTCCTATCATCCCA T / C GATTTGTTATAAATCTGTTAAACCAACGCATCATCAGCATCATCATGACACTATACACTATTCAGCAAGGACGGTAATTAGCAATACAACAACCTACTTTCTAATAAAAT (The bold and underlined parts represent the SNP sites Chr2D_617,437,490).
[0024] When the base at this locus is T (TT genotype), wheat SDS sedimentation value is low; when the base at this locus is C (CC genotype), wheat SDS sedimentation value is high. There is also a heterozygous case, the TC genotype, which has a moderate SDS sedimentation value. The box plot of SDS sedimentation value distribution for the ZJ_2DL_7490 locus in the recombinant inbred line population is shown below. Figure 2 Among them, wheat materials with genotype C / C had high SDS sedimentation values, while wheat materials with genotype T / T had low SDS sedimentation values. Furthermore, the SDS sedimentation value of wheat materials with genotype T / T was significantly lower than that of wheat materials with genotype C / C, meaning that the difference in SDS sedimentation values between the two was significant.
[0025] Based on this SNP site and its upstream and downstream sequences, markers for KASP detection were developed, and the following primer set was designed using SnapGene: ZJ_2DL_7490_F1: GAAGGTGACCAAGTTCATGCTACCTGAATGTTCCTATCATCCCAT (shown in SEQ IDNO.2); ZJ_2DL_7490_F2: GAAGGTCGGAGTCAACGGATTACCTGAATGTTCCTATCATCCCAC (shown in SEQ IDNO.3); ZJ_2DL_7490_R: TATTGCTAATTACCGTCCTTGCTG (shown as SEQ ID NO.4).
[0026] Two forward primers are attached to different fluorescent adapter sequences; the 5' end of forward primer ZJ_2DL_7490_F1 is attached to the FAM fluorescent adapter sequence, and the 5' end of forward primer ZJ_2DL_7490_F2 is attached to the HEX fluorescent adapter sequence; the FAM and HEX fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5); HEX: GAAGGTCGGAGTCAACGGATT (shown in SEQ ID NO. 6).
[0027] The primer set was used to perform real-time PCR amplification on the wheat DNA samples to be tested: wheat DNA was used as the template for real-time PCR amplification, and the primer pair corresponding to the molecular marker ZJ_2DL_7490 was used for real-time PCR amplification. The reaction system for real-time PCR amplification is shown in Table 1. Table 1. Reaction system for PCR amplification
[0028] Pre-read fluorescence at 30℃ for 1 min, initial denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing and extension at 61℃ for 1 min, 10 cycles; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 1 min, 26 cycles; final fluorescence reading at 30℃ for 1 min.
[0029] The results showed that if the PCR product of the sample only detected the FAM fluorescence signal corresponding to primer ZJ_2DL_7490_F1 with the fluorescent adapter sequence, the detection site was the T / T genotype, and it was determined to be a homozygous type with a low SDS sedimentation value phenotype; if the PCR product only detected the HEX fluorescence signal corresponding to primer ZJ_2DL_7490_F2 with the fluorescent adapter sequence, the detection site was the C / C genotype, and it was determined to be a homozygous type with a high SDS sedimentation value phenotype; if both FAM and HEX fluorescence signals corresponding to primers ZJ_2DL_7490_F1 and ZJ_2DL_7490_F2 with the fluorescent adapter sequence were detected simultaneously, the detection site was the T / C genotype, and it was determined to be a heterozygous type with a medium SDS sedimentation value phenotype. Figure 1 ).
[0030] Results: Marker detection was performed on 252 wheat recombinant inbred lines. 124 wheat materials showed the T / T genotype at this locus; 3 wheat materials showed the T / C genotype; and 125 wheat materials showed the C / C genotype. The T-test showed that the difference between the C / C and T / T genotypes was highly significant. P <0.001) Figure 2 ).
[0031] Example 2: Accuracy verification of the molecular markers described in this application To further verify the technical solution of this application, 122 wheat germplasm resources randomly selected from natural populations were identified using the above molecular markers. The variety name, SDS sedimentation value and genotype corresponding to the ZJ_2DL_7490 locus are shown in Table 2.
[0032] Table 2 Genotypes and SDS values of different wheat varieties
[0033]
[0034] Using the genomic DNA of the wheat to be identified as a template, the primer pair was used for real-time PCR amplification to obtain the real-time PCR product.
[0035] The reaction system for real-time PCR amplification is as follows: 1 μL genomic DNA, 5 μL 2×PCR Mix, 0.16 μL ROX supplement, 0.1 μL upstream primer F1 (SEQ ID NO.2), 0.1 μL upstream primer F2 (SEQ ID NO.3), 0.3 μL downstream primer R (SEQ ID NO.4), and sterile distilled water to a final volume of 10 μL.
[0036] The preferred reaction program for quantitative real-time PCR amplification is as follows: 30℃ pre-read fluorescence for 1 min, 94℃ initial denaturation for 15 min; 94℃ denaturation for 20 s, 61℃ annealing and extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 1 min, 26 cycles; 30℃ final fluorescence reading for 1 min.
[0037] Determining the wheat SDS sedimentation value based on quantitative real-time PCR products: Table 2 shows that, in the identification of 122 wheat germplasm resources in this application, 33 wheat materials had the T / T genotype at the ZJ_2DL_7490 locus, with the SDS sedimentation volume of the T / T genotype generally ranging from 26 mL to 54.5 mL. No wheat materials had the T / C genotype at the ZJ_2DL_7490 locus; 89 wheat materials had the C / C genotype at the ZJ_2DL_7490 locus, with the SDS sedimentation volume of the C / C genotype generally ranging from 30 mL to 64 mL. The T-test showed that the difference between the T / T and C / C genotypes was extremely significant. P <0.001). The detection results are consistent with the genotype at the ZJ_2DL_7490 locus and the actual SDS sedimentation value. Figure 4 Therefore, the KASP marker of this application can effectively identify the level of SDS sedimentation value of wheat materials and can be used for the prediction and screening of wheat SDS sedimentation value.
[0038] The primer set of the molecular markers in this application can be used in future molecular marker-assisted breeding. By extracting DNA from seedling leaves, the presence of the molecular markers of this invention can be detected, thereby identifying the wheat SDS sedimentation value of wheat materials.
[0039] For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of this invention should be included within the scope of the patent application of this invention.
Claims
1. A molecular marker for detecting wheat SDS deposition values, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein there is a T / C base mutation at position 24 of the sequence shown in SEQ ID NO.
1. When the base at this position is T, the wheat SDS sedimentation value is low, and when the base at this position is C, the wheat SDS sedimentation value is high.
2. The molecular marker for detecting wheat SDS sedimentation value according to claim 1, characterized in that, The molecular marker is the KASP marker.
3. A primer set for detecting wheat SDS deposition values, characterized in that, The primer set includes ZJ_2DL_7490_F1 as shown in SEQ ID NO.2, ZJ_2DL_7490_F2 as shown in SEQ ID NO.3, and ZJ_2DL_7490_R as shown in SEQ ID NO.
4.
4. The primer set for detecting wheat SDS deposition values according to claim 3, characterized in that, The 5' end of the forward primer ZJ_2DL_7490_F1 shown in SEQ ID NO.2 is connected to the FAM fluorescent adapter sequence, and the 5' end of the forward primer ZJ_2DL_7490_F2 shown in SEQ ID NO.3 is connected to the HEX fluorescent adapter sequence; the FAM fluorescent adapter sequence is shown in SEQ ID NO.5, and the HEX fluorescent adapter sequence is shown in SEQ ID NO.
6.
5. A method for detecting SDS sedimentation value in wheat, characterized in that, Includes the following steps: For the SNP site shown in SEQ ID NO.1, a primer set labeled with KASP was designed to amplify the primer set labeled with KASP related to wheat SDS sedimentation value. The primer pair sequence of the molecular marker is as follows: Two forward primers are connected to different fluorescent adapter sequences: the 5' end of forward primer ZJ_2DL_7490_F1, as shown in SEQ ID NO.2, is connected to the FAM fluorescent adapter sequence, and the 5' end of forward primer ZJ_2DL_7490_F2, as shown in SEQ ID NO.3, is connected to the HEX fluorescent adapter sequence; the FAM fluorescent adapter sequence is shown in SEQ ID NO.5, and the HEX fluorescent adapter sequence is shown in SEQ ID NO.6; Real-time PCR amplification was performed using wheat DNA as a template: If only the FAM fluorescence signal corresponding to primer ZJ_2DL_7490_F1, which is linked to the fluorescent adapter sequence, is detected in the PCR product of the sample, then the detection site is the T / T genotype, and it is determined to be a homozygous type with a low SDS sedimentation value phenotype. If only the HEX fluorescence signal corresponding to primer ZJ_2DL_7490_F2, which is linked to the fluorescent adapter sequence, is detected in the PCR product of the sample, then the detection site is the C / C genotype, and it is determined to be a homozygous type with a high SDS sedimentation value phenotype. If the PCR product of the sample simultaneously detects two types of FAM and HEX fluorescence signals corresponding to primers ZJ_2DL_7490_F1 and ZJ_2DL_7490_F2 which are linked to fluorescent adapter sequences, then the detection site is the T / C genotype, and it is determined to be a heterozygous type with a medium SDS sedimentation value phenotype.
6. A KASP marker for identifying wheat SDS deposition values, characterized in that, It includes the molecular marker described in claim 1.
7. The use of the molecular marker for detecting wheat SDS sedimentation value as described in any one of claims 1 to 2, or the primer set for detecting wheat SDS sedimentation value as described in any one of claims 3 to 4, in identifying or assisting in the detection of wheat SDS sedimentation value.
8. The application of the molecular marker for detecting wheat SDS sedimentation value as described in any one of claims 1 to 2, or the primer set for detecting wheat SDS sedimentation value as described in any one of claims 3 to 4, in marker-assisted breeding of wheat SDS sedimentation value related to molecular markers.
9. A reagent kit for detecting SDS sedimentation value in wheat, characterized in that, Includes the primer set for detecting wheat SDS deposition values as described in any one of claims 3 to 4.
10. A method for identification using KASP markers based on wheat SDS sedimentation values, characterized in that, Includes the following steps: (1) Extracting genomic DNA from wheat to be tested; (2) A primer set for detecting wheat SDS deposition value is designed, the primer set including ZJ_2DL_7490_F1 as shown in SEQ ID NO.2, ZJ_2DL_7490_F2 as shown in SEQ ID NO.3 and ZJ_2DL_7490_R as shown in SEQ ID NO.4; the 5' end of the forward primer ZJ_2DL_7490_F1 as shown in SEQ ID NO.2 is connected to the FAM fluorescent adapter sequence, and the 5' end of the forward primer ZJ_2DL_7490_F2 as shown in SEQ ID NO.3 is connected to the HEX fluorescent adapter sequence; the FAM fluorescent adapter sequence is shown in SEQ ID NO.5, and the HEX fluorescent adapter sequence is shown in SEQ ID NO.6; (3) Using the genomic DNA extracted in step (1) as a template, perform real-time PCR amplification using the primer set of molecular markers described in step (2), and analyze the results of real-time PCR amplification. (4) Analyze the results of quantitative real-time PCR amplification. If the sample PCR product only detects the FAM fluorescence signal corresponding to primer ZJ_2DL_7490_F1 with fluorescent adapter sequence, then the site is a T / T genotype and is determined to be a homozygous type with a low wheat SDS sedimentation value phenotype. If the sample PCR product only detects the HEX fluorescence signal corresponding to primer ZJ_2DL_7490_F2 with fluorescent adapter sequence, then the site is a C / C genotype and is determined to be a homozygous type with a high wheat SDS sedimentation value phenotype. If both FAM and HEX fluorescence signals corresponding to primers ZJ_2DL_7490_F1 and ZJ_2DL_7490_F2 with fluorescent adapter sequence are detected at the same time, then the site is a T / C genotype and is determined to be a heterozygous type.