A primer probe combination and kit for detecting avian influenza virus and its H5 subtype, Gamma genus and Delta genus avian coronavirus

Abstract

The present application relates to the field of virus detection technology and animal epidemic disease molecular detection technology, and particularly relates to a primer probe combination and kit for detecting avian influenza virus, H5 subtype, Gamma genus and Delta genus avian coronavirus, the primer probe combination is designed based on the M gene fragment and H5 subtype HA gene fragment of avian influenza virus and the conserved region of avian coronavirus RdRp gene, and includes specific primers and corresponding fluorescent probes for universal avian influenza virus, H5 highly pathogenic subtype, avian coronavirus Gamma subtype and Delta subtype respectively, and the four targets can be simultaneously amplified and distinguished in the same reaction system.

Description

Technical Field

[0001] This invention relates to the fields of virus detection technology and molecular detection technology of animal disease sources, specifically to a primer and probe combination and kit for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the Gamma and Delta genera. Background Technology

[0002] Avian influenza virus (AIV) comprises multiple subtypes, among which highly pathogenic subtypes such as H5N1 and H5N6 have been proven to directly infect humans and cause severe illness with high mortality rates. In recent years, the H5N1 virus has continued to spread globally, frequently infecting mammals across species, significantly increasing its potential risk of adaptation to humans. Meanwhile, avian coronavirus (ACoV), a class of RNA viruses widely found in poultry and wild birds, exhibits differences in genetic characteristics, host adaptability, and transmission modes between its Gamma and Delta subtypes. Furthermore, monitoring has revealed an increasing coexistence of these two subtypes, adding complexity to disease surveillance.

[0003] Currently, laboratory testing for avian influenza virus mainly relies on real-time fluorescent RT-PCR as an early diagnostic tool. However, traditional methods require combining agarose gel electrophoresis and Sanger sequencing to determine the specific subtype, a process that is time-consuming and prone to aerosol contamination. Although dual-fluorescent RT-qPCR can identify whether an avian influenza virus is the highly pathogenic H5 subtype while simultaneously identifying it, it still cannot fully cover the detection needs of co-infection with multiple pathogens. Existing detection methods for avian coronaviruses are mostly established for single subtypes, requiring the construction of separate detection systems, which leads to increased detection costs, complex operations, and low efficiency, especially in samples with co-existing multi-subtype viruses, where accurate differentiation is difficult.

[0004] With the expansion of poultry farming and the strengthening of wild-bird disease monitoring, the monitored targets are becoming increasingly complex, and the sample sources are becoming more diversified. There is an urgent need for a highly efficient detection technology that can simultaneously detect and differentiate avian influenza virus (including the highly pathogenic H5 subtype) and avian coronavirus (Gamma / Delta subtype) within the same detection system to meet the current practical needs of disease monitoring for high throughput, simultaneous detection, and accurate typing. However, developing such a quadruple real-time quantitative RT-qPCR technology faces multiple technical bottlenecks, including high complexity in primer and probe design, difficulty in achieving reaction condition compatibility, strict requirements for fluorescence channel coordination, and significant challenges in balancing sensitivity. The quadruple real-time quantitative RT-qPCR detection method established in this invention can simultaneously detect and identify four targets—avian influenza virus, H5 highly pathogenic subtype, avian coronavirus Gamma subtype, and Delta subtype—in a single reaction. It has many advantages, such as simple operation, short detection time, good specificity, high sensitivity, and the ability to detect two pathogens in wild birds at the same time. It fills the gap in the existing technology for simultaneous detection of two pathogens and provides efficient technical support for epidemiological investigation, risk assessment, and prevention and control decisions for poultry diseases.

[0005] In view of the above-mentioned defects, the inventors of this invention have finally obtained this invention after a long period of research and practice. Summary of the Invention

[0006] The purpose of this invention is to solve the problems of detection and separation of avian influenza virus and avian coronavirus in the prior art, and the difficulty in achieving simultaneous identification of co-infection. This invention provides a primer and probe combination and kit for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the Gamma and Delta genera.

[0007] To achieve the above objectives, this invention discloses a primer-probe combination for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the genera Gamma and Delta. The primer-probe combination comprises primer-probe sets for the following four detection targets:

[0008] The upstream primer of the avian influenza M gene, AIV-MF, has the nucleotide sequence shown in SEQ ID NO.1;

[0009] The downstream primer of the avian influenza M gene, AIV-MR, has the nucleotide sequence shown in SEQ ID NO.2;

[0010] The avian influenza M gene probe AIV-MP has the nucleotide sequence shown in SEQ ID NO.3;

[0011] The upstream primer H5-HA-F for the avian influenza H5-HA gene has the nucleotide sequence shown in SEQ ID NO.4;

[0012] The downstream primer H5-HA-R of the avian influenza H5-HA gene has the nucleotide sequence shown in SEQ ID NO.5;

[0013] The avian influenza H5-HA gene probe H5-HA-P has the nucleotide sequence shown in SEQ ID NO.6;

[0014] The upstream primer ACoV-GF of the Gamma avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.7;

[0015] The downstream primer ACoV-GR of the Gamma avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.8;

[0016] The Gamma avian coronavirus RdRp gene probe ACoV-GP has the nucleotide sequence shown in SEQ ID NO.9;

[0017] The upstream primer ACoV-DF for the Delta avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.10;

[0018] The downstream primer ACoV-DR of the Delta avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.11;

[0019] The Delta avian coronavirus RdRp gene probe ACoV-DP has the nucleotide sequence shown in SEQ ID NO.12.

[0020] The primer-probe set described herein has fluorescent and quenching groups labeled at both ends of the probe sequence, and the fluorescent and quenching groups labeled are different between the probe sequences. The fluorescent group is selected from any one of AM, VIC, TAMRA, ROX, HEX, Texas-Red, Cy3 and CY5, and the quenching group is selected from any one of BHQ1, BHQ2, BHQ3, TAMRA and MGB.

[0021] The present invention also discloses a kit for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the Gamma and Delta genera, characterized in that it comprises the primer and probe combination as described above.

[0022] The kit also includes reaction buffer, enzyme mixture, enzyme-free water, positive control and negative control, wherein the enzyme mixture includes DNA polymerase, reverse transcriptase and UDG enzyme.

[0023] The positive controls include:

[0024] (1) Positive control for avian influenza virus detection: plasmid M-Plasmid containing the full-length fragment of the M gene of avian influenza virus, which has the nucleotide sequence shown in SEQ ID NO.13; plasmid H5-HA-Plasmid containing the full-length fragment of the HA gene of H5 subtype avian influenza virus, which has the nucleotide sequence shown in SEQ ID NO.14.

[0025] (2) Positive controls for avian coronavirus detection: in vitro transcribed RdRp-Gamma RNA standard Gamma-RNA, which has the nucleotide sequence shown in SEQ ID NO.15; in vitro transcribed RdRp-Delta RNA standard Delta-RNA, which has the nucleotide sequence shown in SEQ ID NO.16.

[0026] This invention also discloses a method for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the Gamma and Delta genera, using the above-mentioned kit, comprising the following steps:

[0027] S1, extract RNA from wild bird or poultry samples;

[0028] S2, using the RNA obtained in step S1 as a template, perform a quadruple real-time quantitative RT-qPCR reaction using the detection kit;

[0029] S3, acquire the signal of the fluorescent channel corresponding to the probe fluorescent group, and obtain the Ct value of each channel;

[0030] S4 interprets the results based on the Ct value and simultaneously detects four targets: avian influenza virus and its H5 subtype, as well as avian coronaviruses of the Gamma and Delta genera.

[0031] In step S2, the conditions for the quadruple real-time quantitative RT-qPCR reaction are as follows: UDG enzyme reaction 25~30℃, 5 min; reverse transcription 50~60℃, 2~10 min; pre-denaturation 95℃, 1~5 min; cycling phase: 95℃ 5~15 s; 56~60℃, 10~25 s, 40~45 cycles.

[0032] The primer and probe concentrations for the quadruple real-time quantitative RT-qPCR reaction are as follows: AIV-MF and AIV-MR have a final concentration of 0.1–0.25 μmol / L; AIV-MP has a final concentration of 0.1–0.5 μmol / L; H5-HA-F and H5-HA-R have a final concentration of 0.1–0.25 μmol / L; H5-HA-P has a final concentration of 0.1–0.5 μmol / L; ACoV-GF and ACoV-GR have a final concentration of 0.1–0.25 μmol / L; ACoV-GP has a final concentration of 0.1–0.5 μmol / L; ACoV-DF and ACoV-DR have a final concentration of 0.1–0.25 μmol / L; and the probe ACoV-DP has a final concentration of 0.1–0.5 μmol / L.

[0033] Preferably, the primer and probe concentrations for the quadruple real-time quantitative RT-qPCR reaction are as follows: AIV-MF and AIV-MR are both 0.125 μmol / L, AIV-MP is 0.2 μmol / L; H5-HA-F and H5-HA-R are both 0.125 μmol / L, H5-HA-P is 0.1 μmol / L; ACoV-GF and ACoV-GR are both 0.143 μmol / L, ACoV-GP is 0.1 μmol / L; ACoV-DF and ACoV-DR are both 0.107 μmol / L, and the probe ACoV-DP is 0.2 μmol / L.

[0034] In step S4, the result interpretation includes standard control determination, test sample determination, invalid sample determination, and negative sample determination.

[0035] The standard comparison determination includes:

[0036] Positive control: Ct≤30, and exhibiting a typical amplification curve;

[0037] Negative control: Ct > 40 in all four fluorescence channels or no amplification curve;

[0038] If both the positive and negative controls are valid, the result is considered valid.

[0039] If the above control results are valid, and the sample to be tested has a Ct ≤ 35 and shows a typical amplification curve, it is judged as positive.

[0040] If the sample to be tested has Ct > 35 and ≤ 40 and a typical amplification curve appears, it is considered suspicious and needs to be retested. If the test result is still Ct > 35 and ≤ 40, it is considered positive. If Ct > 40, it is considered negative.

[0041] A positive result for the H5 subtype of avian influenza requires a positive result for the avian influenza M gene test as a prerequisite; otherwise, the sample is considered invalid.

[0042] The negative sample was determined as follows: Ct > 40 in all four fluorescence channels or no amplification curve was observed.

[0043] Compared with existing technologies, the advantages of this invention are as follows: The primer-probe combination, kit, and detection method provided by this invention, through optimized design, integrate for the first time the simultaneous detection of a universal target of avian influenza virus (M gene), a highly pathogenic H5 subtype target (HA gene), a target of Gamma avian coronavirus (RdRp gene), and a target of Delta avian coronavirus (RdRp gene) within the same reaction system, achieving quadruple real-time quantitative RT-qPCR. This method is simple to operate, capable of identifying four targets within a single reaction (1.5 hours), and accurately distinguishing six different single or co-infection situations, exhibiting high detection sensitivity and strong specificity. This technology significantly improves the monitoring efficiency of important viral pathogens in wild birds and poultry samples, reduces detection costs and operational complexity, and provides efficient and reliable technical support for epidemiological investigations, risk assessments, and prevention and control decisions for avian diseases. Attached Figure Description

[0044] Figure 1 This diagram illustrates the overall design of a phylogenetic analysis and quadruple detection method for AIV and ACoV. A and B represent the phylogenetic trees of AIVA and ACoV, respectively; C shows the primer and probe design based on multiple sequence alignment; and D illustrates the principle and workflow of the quadruple detection method.

[0045] Figure 2 The regions for avian influenza virus gene sequence alignment and primer / probe design are defined as follows: A is the region for M gene sequence alignment and primer / probe design, and B is the region for H5-HA gene sequence alignment and primer / probe design.

[0046] Figure 3 A represents the sequence alignment and primer / probe design region of the RdRp gene of avian coronaviruses; B represents the sequence alignment and primer / probe design region of the Gamma gene; and C represents the sequence alignment and primer / probe design region of the Delta gene.

[0047] Figure 4 Electrophoresis images of the prepared AIV and ACoV standard positive controls;

[0048] Figure 5 The Ct values ​​of the single-component monitoring system at different annealing temperatures;

[0049] Figure 6Ct values ​​for gradient concentration template detection in dual detection systems, where A, B, C, and D are the gradient concentration detection Ct values ​​for dual detection systems using AIV-M, H5-HA, ACoV-Gamma, and ACoV-Delta templates, respectively.

[0050] Figure 7 Ct values ​​are the gradient concentration template detection values ​​of the quadruple detection system, where A, B, C, and D are the gradient concentration detection values ​​of the quadruple detection system using AIV-M, H5-HA, ACoV-Gamma, and ACoV-Delta as templates, respectively.

[0051] Figure 8 These are real-time fluorescence curves for sensitivity testing, where A, B, C, and D are real-time fluorescence curves for sensitivity testing using AIV-M, H5-HA, ACoV-Gamma, and ACoV-Delta as templates, respectively.

[0052] Figure 9 These are the standard curves for avian influenza and avian coronavirus; where A, B, C, and D are the standard curves using AIV-M, H5-HA, ACoV-Gamma, and ACoV-Delta as templates, respectively.

[0053] Figure 10 The Ct value is the specificity test result.

[0054] Figure 11 A scatter plot for repeatability testing;

[0055] Figure 12 The Ct value is used to simulate the co-infection test;

[0056] Figure 13 The Ct values ​​are for clinical sample testing. A represents a comparison of the results of the quadruple RT-qPCR detection method with those of PCR-Sanger sequencing. B represents the statistical analysis of the clinical validation results, including sensitivity, specificity, accuracy, and Kappa value. Detailed Implementation

[0057] The above-mentioned and other technical features and advantages of the present invention will be described in more detail below with reference to the accompanying drawings.

[0058] Example 1

[0059] Design and synthesis of primer and probe sets

[0060] Two sets of primers and probes were designed based on the highly conserved regions of the full-length sequences of the M and H5-HA genes of avian influenza virus from avian influenza-positive samples that have been published in GenBank and sequenced by the patent applicant:

[0061] The upstream primer of the avian influenza M gene, AIV-MF, has the nucleotide sequence shown in SEQ ID NO.1;

[0062] The downstream primer of the avian influenza M gene, AIV-MR, has the nucleotide sequence shown in SEQ ID NO.2;

[0063] The avian influenza M gene probe AIV-MP has the nucleotide sequence shown in SEQ ID NO.3;

[0064] The upstream primer H5-HA-F for the avian influenza H5-HA gene has the nucleotide sequence shown in SEQ ID NO.4;

[0065] The downstream primer H5-HA-R of the avian influenza H5-HA gene has the nucleotide sequence shown in SEQ ID NO.5;

[0066] The avian influenza H5-HA gene probe H5-HA-P has the nucleotide sequence shown in SEQ ID NO.6;

[0067] Sequence alignment and primer design regions, such as Figure 1 , Figure 2 As shown.

[0068] Two sets of primers and probes were designed based on the highly conserved regions of the Gamma and Delta avian coronavirus RdRp genes, which have been published in GenBank and sequenced by the patent applicant:

[0069] The upstream primer ACoV-GF of the Gamma avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.7;

[0070] The downstream primer ACoV-GR of the Gamma avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.8;

[0071] The Gamma avian coronavirus RdRp gene probe ACoV-GP has the nucleotide sequence shown in SEQ ID NO.9;

[0072] The upstream primer ACoV-DF for the Delta avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.10;

[0073] The downstream primer ACoV-DR of the Delta avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.11;

[0074] The Delta avian coronavirus RdRp gene probe ACoV-DP has the nucleotide sequence shown in SEQ ID NO.12.

[0075] Sequence alignment and primer design regions, such as Figure 1 , Figure 3 As shown.

[0076] All primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and purified by HPLC. The fluorescent groups (NED, ROX, FAM, VIC) and quenching groups (BHQ2, MGB, BHQ1) labeled on the probes do not interfere with each other, ensuring the independence and accuracy of signal acquisition in the quadruple detection. The primer and probe sequences are shown in Table 1.

[0077] Table 1 Primer and probe sequences

[0078]

[0079] Example 2

[0080] Preparation of positive control standards:

[0081] 1. Preparation of M gene plasmid and H5-HA gene plasmid standards:

[0082] cDNA was obtained by reverse transcription of RNA samples that were identified as positive for avian influenza and H5 subtype avian influenza by the unit of this patent application. The cDNA was then subjected to PCR to obtain the full-length M gene sequence and the full-length H5-HA gene sequence (SEQ ID NO.13-SEQ ID NO.14). The PCR primers for the full-length fragments of the M and HA genes were obtained from the literature: Hoffmann E, Stech J, Guan Y, Webster RG, Perez DR. Universal primer set for the full-length amplification of all influenza A viruses. Arch Virol. 2001 Dec;146(12):2275-89. Homologous arm recombination primers (SEQ ID NO.17-SEQ ID NO.20) were designed based on the SacⅠ and XhoⅠ cleavage sites of the pUC57 vector and the PCR primers for the M and HA genes.

[0083] The reverse transcription reaction system and procedure are as follows:

[0084] 6 μL RNA template, 2 μL Unit 12, 2 μL 10 mM dNTPs, 6 μL Nuclease-free H2O, incubate at 65°C for 5 minutes, briefly centrifuge and immediately place on ice; then add 10 µL 2× ABScript II Reaction Mix and 2 µL 10× ABScript II Enzyme Mix to the above system, mix well, incubate at 42°C for 1 hour, and heat at 80°C for 5 minutes.

[0085] The PCR reaction system and reaction procedure are as follows:

[0086] The PCR reaction volume per 25 μL was: 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 12.5 μL of TaKaRa Taq HS Perfect Mix (2×) (TaKaRa, catalog number R300A), 2 μL of genomic cDNA, and 8.5 μL of ddH2O.

[0087] The PCR reaction program was as follows: 35 cycles, each cycle consisting of denaturation at 94°C for 5 seconds, annealing at 55°C for 1 second, and extension at 68°C (M gene 17 seconds, HA gene 34 seconds).

[0088] After the PCR reaction, the amplified products were subjected to 1% agarose gel electrophoresis at 120 V for 30 minutes. Based on the size of the amplified bands, the amplified M gene fragment was approximately 870 bp and the HA gene fragment was approximately 1700 bp. Figure 4 This indicates that the full-length sequences of the M gene and H5-HA gene of avian influenza were obtained. The amplified fragments were recovered by gel electrophoresis and ligated into the pUC57 vector using homologous arm recombination to obtain a standard plasmid. The sequence was verified to be correct by sequencing.

[0089] According to the formula (concentration ng / μL × 6.02 × 10), 23 ×10 -9 The copy number was calculated as 10^660 / (660 × plasmid length) after dilution. 9 M gene plasmid standard with copies / μL and a copy number of 10. 9 The H5-HA gene plasmids were divided into copies / μL and named M gene positive control and H5-HA gene positive control, respectively.

[0090] 2. Preparation of avian coronavirus positive control RNA standard:

[0091] Preparation of avian coronavirus positive control RNA standard:

[0092] Conserved fragments of the RdRp gene were amplified from wild bird coronavirus RNA samples using T7-PolyT primers (SEQ ID NO.21-SEQ ID NO.24). The obtained PCR products were transcribed in vitro using a T7 promoter to generate RNA of the target gene. Template DNA was removed using DNase treatment. RNA integrity was assessed by electrophoresis; the amplified bands showed a Gamma gene fragment of approximately 738 bp (SEQ ID NO.15) and a Delta gene fragment of approximately 666 bp (SEQ ID NO.16). Figure 4 The RNA product of the desired length was purified; the concentration of the purified RNA was determined using a Qubit RNA BR. The concentration was calculated according to the formula (concentration ng / μL × 6.02 × 10⁻⁶). 23 ×10 -9 The copy number was calculated as 10^35 (325 × RNA length) after dilution. 10 Gamma avian coronavirus RNA standard with copies / μL and a copy number of 10 10 The Delta avian coronavirus RNA standards, in copies / μL, were named Gamma avian coronavirus positive control and Delta avian coronavirus positive control, respectively.

[0093] The avian influenza virus plasmid insertion amplification fragment, avian coronavirus RNA sequence, recombinant amplification primers, and reverse transcription amplification primer sequences are shown below:

[0094] M-Plasmid:

[0095]

[0096] H5-HA-Plasmid:

[0097]

[0098] Gamma-RNA:

[0099] UAAGUACCUUGAUGGAUACGAUGGUGGUUGUCUUAAUGCACAGUCAGUUGUGGUCAAUAAUUUGGACAAAUCAGCGGGUUACCCGUUUAAUAAACUUGGUAAGGCACGUAAUUAUUACGAUAUGUCUUACAAUGAACAGAAUCAAUUGUUUGAGUAUACAAAACGUAAUGUUUUGCCUACACUCACUCAAAUGAACCUCAAGUAUGCUAUAUCAGCAAAAGAUCGUGCUCGUACUGUUGCUGGUGUUUCUAUAAUUAGCACCAUGACAAACAGACAGUACCAUCAGAAAUUGCUGAAGUCAAUCUCACUUGCCCGUAAUCAGACUAUCGUGAUAGGAACAACCAAAUUUUAUGGUGGUUGGGACAACAUGUUACGUAGGCUGAUGAAUGGUAUUAAUAAUCCCGUUUUAGUGGGUUGGGAUUACCCUAAGUGUGACAGGUCUAUGCCAAACAUAUUGCGUAUCGCAUCUUCUUGUUUGCUAGCCCGUAAACACACUUGCUGCAAUCAAAGUCAGCGAUUCUAUCGUCUGGCUAAUGAAUGUUGUCAGGUAUUAUCAGAAGUGGUAAUAUCCGGCAAUAAUCUUUAUGUGAAACCAGGUGGUACUAGCAGCGGUGACGCCACUACUGCAUAUGCCAACUCGGUCUUUAACAUUUUACAAGUAGUUAC(SEQ IDNO.15)。

[0100] Delta-RNA:

[0101] (SEQ IDNO.16)。

[0102] PM-F:

[0103] ACGGCCAGAGAATTCGAGCTCAGCAAAAGCAGTAGATATTGAAAGA (SEQ ID NO.17)。

[0104] PM-R:

[0105] GATTACACCAAGCTTCTCGAGAGTAGAAACAAGGTAGTTTTTTACTCCAG (SEQ ID NO.18)。

[0106] PH5HA-F:

[0107] ACGGCCAGAGAATTCGAGCTCGGGTTCACTCTGTCAAAATGGAG (SEQ ID NO. 19).

[0108] PH5HA-R:

[0109] GATTACACCAAGCTTCTCGAGGCTCACAAATCTAAATGCAAATTCTG (SEQ ID NO. 20).

[0110] GF-T7:

[0111] TAATACGACTCACTATAGGGTGGTTGCATATCTGCTAG (SEQ ID NO. 21).

[0112] GR-PolyT:

[0113] TTTTTTTTTTTTTTTTTTTCATCATACACAATGTCGCGTG (SEQ ID NO. 22).

[0114] DF-T7:

[0115] TAATACGACTCACTATAGGGATGGTGGTTGTCTTAATGCAC (SEQ ID NO. 23).

[0116] DR-PolyT:

[0117] TTTTTTTTTTTTTTTTTTAAAGACCGAGTTGGCATATGC (SEQ ID NO. 24).

[0118] Example 3

[0119] Optimization of annealing temperature for single-strand RT-qPCR detection methods for avian influenza and avian coronavirus:

[0120] In a 20 µL singlet qPCR reaction system, the final concentrations of all AIV-F / R and ACoV-F / R primers were 0.2 µmol / L; the final concentrations of all probes were also 0.2 µmol / L. The amplification conditions were: 25℃ for 5 min, 50℃ for 5 min, and 95℃ for 3 min; followed by 45 cycles of amplification: 95℃ for 15 s, and 56 / 58 / 60℃ (three temperature gradients) for 34 s. The optimal cycle was 58℃ for 34 s. Results are as follows... Figure 5 As shown.

[0121] Example 4

[0122] Establishment of a dual detection system and optimization of primer ratios:

[0123] 1. Establishment of a dual RT-qPCR detection kit for influenza M gene fragment and H5-HA gene and optimization of primer concentration:

[0124] The instrument used was an Applied Biosystems QuantStudio 3, and the RT-qPCR reagent used was the ABScript III One Step RT-qPCR Probe Kit with UDG V5, purchased from Ibotek Biotechnology Co., Ltd., catalog number: RK20412.

[0125] To improve the sensitivity of the reaction, the reaction system, namely the primer ratio and concentration of the M gene and HA gene, was first determined. Both the probe and primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and were in dry powder form, diluted to 10 μmol / L with RNase-free water as the stock solution.

[0126] Equal masses of the prepared M gene and HA gene positive control standard stock solutions were mixed and serially diluted 10-fold to 1 copy / μL as templates. Using the M gene and HA gene RT-qPCR primers and probes shown in Table 1, the reaction program was as follows: UDG reaction at 25℃ for 5 min, reverse transcription at 50℃ for 5 min, pre-denaturation at 95℃ for 3 min, cycling phase: 95℃ for 15 s, 58℃ for 10 s, 45 cycles. NED and ROX fluorescence signals were collected. RT-qPCR detection was performed according to the reaction system shown in Table 3.

[0127] The reaction system is shown in Table 2. The primer ratios with the lowest detection concentration and lowest Ct value were selected, meaning that in the final reaction system, AIV-MF and AIV-MR were both 0.2 μmol / L, H5-HA-F and H5-HA-R were both 0.2 μmol / L, AIV-MP was 0.2 μmol / L, and H5-HA-P was 0.1 μmol / L. The results are as follows: Figure 6 As shown.

[0128] Table 2. Avian Influenza Dual Response System

[0129]

[0130] 2. Establishment of a dual RT-qPCR detection kit for avian coronaviruses Gamma / Delta and optimization of primer concentrations:

[0131] The instrument used was an Applied Biosystems QuantStudio 3, and the RT-qPCR reagent used was the ABScript III One Step RT-qPCR Probe Kit with UDG V5, purchased from Ibotek Biotechnology Co., Ltd., catalog number: RK20412.

[0132] To improve the sensitivity of the reaction, the reaction system, namely the primer ratio and concentration of Gamma-RNA and Delta-RNA, was first determined. Both probes and primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and were in dry powder form, diluted to 10 μmol / L with RNase-free water as the stock solution.

[0133] Using prepared Gamma-RNA and Delta-RNA positive control standard stock solutions, serially diluted 10-fold to 1 copy / µL as templates, RT-qPCR primers and probes for Gamma-RNA and Delta-RNA fragments as shown in Table 1 were employed. The reaction program was as follows: UDG reaction at 25℃ for 5 min, reverse transcription at 50℃ for 5 min, pre-denaturation at 95℃ for 3 min, and cycling phases of 95℃ for 15 s and 58℃ for 34 s for 45 cycles. FAM and VIC fluorescence signals were collected during the cycling process. RT-qPCR detection was performed according to the reaction system shown in Table 3.

[0134] The primer ratios with the lowest detection concentration and lowest Ct value were selected, meaning that in the final reaction system, ACoV-GF and ACoV-GR were both 0.2 μmol / L, ACoV-DF and ACoV-DR were both 0.15 μmol / L, ACoV-DP was 0.2 μmol / L, and ACoV-GP was 0.1 μmol / L. The results are as follows: Figure 6 As shown.

[0135] Table 3. Avian coronavirus dual response system

[0136]

[0137] Example 5

[0138] Establishment of a quadruple detection system and optimization of primer and probe concentrations:

[0139] The amplification conditions were: 25℃ for 5 min, 50℃ for 5 min, and 95℃ for 3 min; followed by 45 cycles of amplification: 95℃ for 15 s and 58℃ for 34 s. In a 20 µL quadruple qPCR reaction system, both primer and probe concentrations were 10 μmol / L. Primers were pre-mixed in two groups: Combination 1 was the M-H5-Primer Mix, composed of AIV-MF, AIV-MR, and H5-HA-F, H5-HA-R in the optimal ratio optimized in Example 3; Combination 2 was the Gamma-Delta-Primer Mix, composed of ACoV-GF, ACoV-GR, and ACoV-DF, ACoV-DR in the optimal ratio optimized in Example 3. After optimizing the primer combination ratio, 1 µL of each primer mixture was added to the reaction system. The optimal final concentrations for each primer set were: AIV-MF and AIV-MR, both 0.125 μmol / L; H5-HA-F and H5-HA-R, both 0.125 μmol / L; ACoV-GF and ACoV-GR, both 0.143 μmol / L; and ACoV-DF and ACoV-DR, both 0.107 μmol / L. 0.2 µL each of H5-HA-P and ACoV-GP, and 0.4 µL each of AIV-MP and ACoV-DP were added. The optimal final concentrations for each probe were: H5-HA-P 0.1 μmol / L, ACoV-GP 0.1 μmol / L, AIV-MP 0.2 μmol / L, and ACoV-DP 0.2 μmol / L. The reaction system is shown in Table 4, and the results are as follows. Figure 7 As shown.

[0140] Table 4. Four-way response system for avian influenza and avian coronavirus

[0141]

[0142] Example 6

[0143] Sensitivity test:

[0144] Gamma coronavirus standard RNA sample, Delta coronavirus standard RNA sample, M gene standard plasmid sample, and a mixed standard positive sample of M+H5-HA with equimolar mass were used as detection targets. Each standard positive control regimen was prepared by serial dilution as follows:

[0145] The standard positive control of known concentration was serially diluted 10-fold with enzyme-free water, starting from 10... 4The RNA was diluted to 1 copy / μL and used as the template for the test sample. An equal volume of enzyme-free water was used instead of RNA template in the negative control group.

[0146] The standard positive gradient samples of the above four groups of different targets were tested respectively, and the results are as follows: Figure 8 As shown.

[0147] like Figure 8 As shown in (A), the M gene positive control concentration still showed a clear fluorescence curve for the corresponding fluorescence channel at the lowest test concentration of 1 copy / μL, indicating that the detection sensitivity of the M gene can reach 1 copy / μL.

[0148] like Figure 8 As shown in (B), even at the lowest test concentration of 1 copy / μL, the mixed positive control of M+H5-HA of equal mass still showed obvious fluorescence curves for the corresponding fluorescence channels, indicating that the detection sensitivity of the mixed gene target of M+H5-HA of equal mass can reach 1 copy / μL.

[0149] like Figure 8 As shown in (C), when the concentration of the positive control Gamma avian coronavirus RNA was reduced to 1 copy / μL, a clear fluorescence curve of the corresponding fluorescence channel still appeared, indicating that the detection sensitivity of Gamma avian coronavirus RNA by the method of the present invention can reach 1 copy / μL.

[0150] like Figure 8 As shown in (D), when the concentration of Delta avian coronavirus RNA positive control was reduced to 10 copies / μL, a clear fluorescence curve of the corresponding fluorescence channel still appeared, indicating that the detection sensitivity of the method of the present invention for Delta avian coronavirus RNA can reach 1 copy / μL.

[0151] Example 7

[0152] Creating a standard curve:

[0153] A single amplification target was added to the optimized quadruple reaction system. The amplification conditions were: 25℃ for 5 min, 50℃ for 5 min, and 95℃ for 3 min; followed by 45 cycles of amplification: 95℃ for 15 s and 58℃ for 34 s. Three sets of samples with the same concentration gradient were prepared, and three sets of CT value data were obtained to plot a standard curve.

[0154] like Figure 9 As shown in (A), the standard curve linear regression equation for gene M is: Y = -2.905X + 8.331, correlation coefficient R² = 0.9952, and amplification efficiency E = 120.9%; Figure 9As shown in (B), the linear regression equation of the standard curve for the H5-HA gene is: Y = -3.592 X + 7.618, with a correlation coefficient R² = 0.9992 and an amplification efficiency E = 89.8%; Figure 9 As shown in (C), the standard curve linear regression equation for Gamma is: Y = -3.239X + 8.260, correlation coefficient R² = 0.9931, amplification efficiency E = 103.6%; the regression equation is as follows: Figure 9 As shown in (D), the standard curve linear regression equation of Delta is: Y = -3.601X + 6.606, the correlation coefficient R² = 0.9921, and the amplification efficiency E = 89.5%.

[0155] Example 8

[0156] Specificity testing was performed on 21 national standard samples of respiratory pathogens:

[0157] Twenty-one national standard samples of respiratory pathogens, including L. pneumonia (Legionella pneumophila), K. pneumonia (Klebsiella pneumoniae), HACoV-OC43 (human coronavirus OC43), HACoV-NL63 (human coronavirus NL63), Parainfluenza virus 2 (parainfluenza virus type 2), and H5N1flu virus (avian influenza A H5N1), were selected as templates for specificity experiments using the aforementioned kits.

[0158] Experimental results are as follows Figure 10 As shown: Standards for influenza A H5 subtype showed specific amplification in the NED and ROX channels; standards for influenza A H3, H1, and H7 showed specific amplification in the NED channel; positive controls for Gamma and Delta avian coronaviruses also showed specific amplification in the FAM and VIC channels; other viral genera showed no amplification, indicating that the detection method of this kit has good specificity. Results are as follows... Figure 9 As shown.

[0159] Example 9

[0160] Repeatability test:

[0161] Twenty intra-assay replicates were performed on the same batch of low-copy standard samples, followed by real-time quantitative PCR amplification. Changes in Ct values ​​were compared, and the stability of the method was evaluated using the intra-assay coefficient of variation (CIV). The CIV ranged from 0.92% to 4.81%, indicating good reproducibility. CIV values ​​are shown in Table 5. Figure 11 As shown.

[0162] Table 5 Repeatability coefficient of variation

[0163]

[0164] Example 10

[0165] Simulated co-infection test:

[0166] Sensitivity analysis was performed using four simulated co-infection models (AIV-M ± H5-HA and ACoV-Gamma or Delta). Optimized primer and probe concentrations in the quadruple system were used as the final RT-qPCR reaction conditions. This detection method exhibited high analytical sensitivity: when the AIV and ACoV positive control concentration was 100 copies / μL, all targets in the four co-infection models were stably detected with low Ct values ​​and strong signal intensities; when the AIV and ACoV positive control concentration was reduced to 10 copies / μL, although the Ct value increased, the corresponding targets in all models were still detected with positive signals. Furthermore, no false-positive amplification of non-target pathogens was observed in any of the co-infection models, indicating no non-specific cross-reaction among the multiplexed co-occurring targets. These results confirm that the developed quadruple RT-qPCR detection method for simultaneous detection and typing of avian influenza virus and avian coronavirus has high analytical sensitivity, accurately distinguishes each target under co-infection conditions, and has no significant signal interference. Results are as follows: Figure 12 As shown.

[0167] Example 11

[0168] The clinical samples in this study consisted of 37 positive and 30 negative samples (oropharyngeal swabs, cloacal swabs, and feces) from wild birds and poultry in Shanghai and Zhejiang provinces, detected in the laboratory. All samples were analyzed using the quadruple RT-qPCR detection method described in this patent and compared with Sanger sequencing results. Results showed that in 70 tested samples, the quadruple RT-qPCR detection method achieved an overall accuracy of 100% (70 / 70) for AIV-M, AIV-H5-HA, and ACoV-Delta, and an accuracy of 97.7% (68 / 70) for ACoV-Gamma. One ACoV-Gamma positive sample was not detected (26 / 27), and one negative sample was misclassified as a false positive (42 / 43). No false positives or false negatives were observed in the detection of AIV-M, AIV-H5-HA, and ACoV-Delta. The Kappa values ​​for all four detection targets were higher than 0.944. The two methods showed high consistency, indicating that the established detection method has good diagnostic performance, combining high sensitivity and high specificity. The detection results are shown in [link to results]. Figure 13 Detailed sample information is shown in Table 6.

[0169] Table 6 Clinical Sample Information

[0170]

[0171] The above description is merely a preferred embodiment of the present invention and is illustrative rather than restrictive. Those skilled in the art will understand that many changes, modifications, and even equivalents can be made within the spirit and scope defined by the claims of the present invention, all of which will fall within the protection scope of the present invention.

Claims

1. A primer-probe combination for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the genera Gamma and Delta, characterized in that, The primer-probe combination includes the following four primer-probe sets for detecting targets: The upstream primer of the avian influenza M gene, AIV-MF, has the nucleotide sequence shown in SEQ ID NO.1; The downstream primer of the avian influenza M gene, AIV-MR, has the nucleotide sequence shown in SEQ ID NO.2; The avian influenza M gene probe AIV-MP has the nucleotide sequence shown in SEQ ID NO.3; The upstream primer H5-HA-F for the avian influenza H5-HA gene has the nucleotide sequence shown in SEQ ID NO.4; The downstream primer H5-HA-R of the avian influenza H5-HA gene has the nucleotide sequence shown in SEQ ID NO.5; The avian influenza H5-HA gene probe H5-HA-P has the nucleotide sequence shown in SEQ ID NO.6; The upstream primer ACoV-GF of the Gamma avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.7; The downstream primer ACoV-GR of the Gamma avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.8; The Gamma avian coronavirus RdRp gene probe ACoV-GP has the nucleotide sequence shown in SEQ ID NO.9; The upstream primer ACoV-DF for the Delta avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.10; The downstream primer ACoV-DR of the Delta avian coronavirus RdRp gene has the nucleotide sequence shown in SEQ ID NO.11; The Delta avian coronavirus RdRp gene probe ACoV-DP has the nucleotide sequence shown in SEQ ID NO.

12.

2. The primer-probe combination for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the genera Gamma and Delta, as described in claim 1, is characterized in that... The primer-probe set has fluorescent and quenching groups labeled at both ends of the probe sequence, and the fluorescent and quenching groups are different between the probe sequences. The fluorescent group is selected from any one of AM, VIC, TAMRA, ROX, HEX, Texas-Red, Cy3 and CY5, and the quenching group is selected from any one of BHQ1, BHQ2, BHQ3, TAMRA and MGB.

3. A kit for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the genera Gamma and Delta, characterized in that, It includes the primer-probe combination as described in claim 1 or 2.

4. The kit for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the genera Gamma and Delta, as described in claim 3, is characterized in that... The kit also includes reaction buffer, enzyme mixture, enzyme-free water, positive control and negative control, wherein the enzyme mixture includes DNA polymerase, reverse transcriptase and UDG enzyme.

5. The kit for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the genera Gamma and Delta, as described in claim 4, is characterized in that... The positive controls include: (1) Positive control for avian influenza virus detection: plasmid M-Plasmid containing the full-length fragment of the M gene of avian influenza virus, which has the nucleotide sequence shown in SEQ ID NO.13; plasmid H5-HA-Plasmid containing the full-length fragment of the HA gene of H5 subtype avian influenza virus, which has the nucleotide sequence shown in SEQ ID NO.

14. (2) Positive controls for avian coronavirus detection: in vitro transcribed RdRp-Gamma RNA standard Gamma-RNA, which has the nucleotide sequence shown in SEQ ID NO.15; in vitro transcribed RdRp-Delta RNA standard Delta-RNA, which has the nucleotide sequence shown in SEQ ID NO.

16.

6. A method for detecting avian influenza virus and its H5 subtype, Gamma and Delta avian coronaviruses using the kit as described in claim 4 or 5, characterized in that, Includes the following steps: S1, extract RNA from wild bird or poultry samples; S2, using the RNA obtained in step S1 as a template, perform a quadruple real-time quantitative RT-qPCR reaction using the detection kit; S3, acquire the signal of the fluorescent channel corresponding to the probe fluorescent group, and obtain the Ct value of each channel; S4 interprets the results based on the Ct value and simultaneously detects four targets: avian influenza virus and its H5 subtype, as well as avian coronaviruses of the Gamma and Delta genera.

7. The method for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the genera Gamma and Delta, as described in claim 6, is characterized in that... In step S2, the conditions for the quadruple real-time quantitative RT-qPCR reaction are as follows: UDG enzyme reaction 25~30℃, 5 min; reverse transcription 50~60℃, 2~10 min; pre-denaturation 95℃, 1~5 min; cycling phase: 95℃ 5~15s; 56~60℃, 10~25s, 40~45 cycles.

8. The method for detecting avian influenza virus and its H5 subtype, as well as avian coronaviruses of the genera Gamma and Delta, as described in claim 7, is characterized in that... The primer and probe concentrations for the quadruple real-time quantitative RT-qPCR reaction are as follows: AIV-MF and AIV-MR have a final concentration of 0.1–0.25 μmol / L; AIV-MP has a final concentration of 0.1–0.5 μmol / L; H5-HA-F and H5-HA-R have a final concentration of 0.1–0.25 μmol / L; H5-HA-P has a final concentration of 0.1–0.5 μmol / L; ACoV-GF and ACoV-GR have a final concentration of 0.1–0.25 μmol / L; ACoV-GP has a final concentration of 0.1–0.5 μmol / L; ACoV-DF and ACoV-DR have a final concentration of 0.1–0.25 μmol / L; and the probe ACoV-DP has a final concentration of 0.1–0.5 μmol / L.

9. The method for detecting avian influenza virus and its H5 subtype, and avian coronaviruses of the genera Gamma and Delta as described in claim 6, characterized in that, In step S4, the result interpretation includes standard control determination, test sample determination, invalid sample determination, and negative sample determination.

10. The method for detecting avian influenza virus and its H5 subtype, and avian coronaviruses of the genera Gamma and Delta as described in claim 9, characterized in that, The standard comparison determination includes: Positive control: Ct≤30, and exhibiting a typical amplification curve; Negative control: Ct > 40 in all four fluorescence channels or no amplification curve; If both the positive and negative controls are valid, the result is considered valid. If the above control results are valid, and the sample to be tested has a Ct ≤ 35 and a typical amplification curve appears, it is judged as positive. If the sample to be tested has Ct > 35 and ≤ 40 and a typical amplification curve appears, it is considered suspicious and needs to be retested. If the test result is still Ct > 35 and ≤ 40, it is considered positive. If Ct > 40, it is considered negative. A positive result for the H5 subtype of avian influenza requires a positive result for the avian influenza M gene test as a prerequisite; otherwise, the sample is considered invalid. The negative sample was determined as follows: Ct > 40 in all four fluorescence channels or no amplification curve was observed.

Images