A method for separating VSIG4 based on reversible immunoaffinity magnetic beads + Methods for macrophage and applications thereof
Patent Information
- Application Number
- CN202610657119.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-13
- Publication Date
- 2026-08-28
AI Technical Summary
[0004]然而,现有技术方案存在明确的局限:首先,直接施用蛋白的疗效可能较为短暂且有限;其次,虽然从原理上获取VSIG4阳性巨噬细胞进行过继性细胞治疗是一个有前景的方向,但传统的细胞分选技术(如基于不可逆结合的磁珠分选)难以在高效分离后,仍能保证细胞的高活性、完整功能及体内治疗潜能,这成为了将实验室发现转化为有效治疗产品的关键瓶颈
[0051] (1) This invention innovatively proposes to use VSIG4 positive macrophages for adoptive cell therapy. This treatment method is long-lasting and can be dependent on the self-regulation of the liver microenvironment.
Smart Images

Figure CN122648348A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically, to a method for separating VSIG4 based on reversible immunoaffinity magnetic beads. + Macrophage methods and their applications. Background Technology
[0002] In the treatment of acute liver injury (ALI), especially for drug-induced liver injury (such as acetaminophen-induced liver injury) or acute inflammatory liver disease, current treatment options remain very limited. Conventional treatments mostly focus on supportive therapy, antioxidants, or anti-inflammatory drugs, but these methods often cannot reverse the extensive hepatocyte necrosis that has already occurred, nor can they effectively regulate the liver's immune microenvironment, leading to a high risk of progression to acute liver failure (ALF). Once liver failure occurs, liver transplantation becomes the only effective radical cure; however, donor shortages, high surgical risks, high costs, and postoperative immune rejection severely limit its clinical application.
[0003] In recent years, cell therapy has shown promise as an emerging strategy for liver injury repair. Macrophages, in particular, have attracted significant attention due to their crucial roles in inflammation regulation, tissue repair, and immune modulation. Previous studies have demonstrated that certain macrophage subsets (such as alternative activated macrophages, AAM) possess hepatoprotective effects. VSIG4 (V-set and immunoglobulin domain containing 4), a macrophage surface marker, is highly expressed, especially in macrophages with anti-inflammatory and repair functions, suggesting it may be a potential target for liver injury treatment.
[0004] However, existing technologies have clear limitations: First, the therapeutic effect of directly applying proteins may be short-lived and limited; second, although obtaining VSIG4-positive macrophages for adoptive cell therapy is a promising direction in principle, traditional cell sorting techniques (such as magnetic bead sorting based on irreversible binding) struggle to maintain high cell activity, intact function, and in vivo therapeutic potential after efficient separation. This has become a key bottleneck in translating laboratory discoveries into effective therapeutic products. Traditional sorting methods are complex and time-consuming, making them unsuitable for rapid cell preparation and reinfusion therapy in emergency conditions such as acute liver injury.
[0005] Therefore, there is an urgent need in this field to develop a method that can rapidly, gently, and efficiently isolate highly active and functionally intact VSIG4-positive macrophages, and further provide a complete treatment plan for using them to treat acute liver injury, in order to solve the problems of limited efficacy of existing treatments, low quality of cell products, and difficulty in clinical translation. Summary of the Invention
[0006] The purpose of this invention is to provide a method for rapidly, gently, and efficiently isolating highly active and functionally intact VSIG4-positive macrophages, and further to provide a method for using them to treat acute liver injury (especially to prevent its progression to liver failure).
[0007] In a first aspect of the present invention, a method for isolating VSIG4-positive macrophages is provided, comprising the following steps:
[0008] (1) Provide a sample containing macrophages;
[0009] (2) The sample is contacted with reversible immunoaffinity magnetic beads, which are coupled with anti-VSIG4 antibody;
[0010] (3) Enrich VSIG4-positive macrophages bound to magnetic beads by magnetic separation;
[0011] (4) Under mild conditions, magnetic beads were dissociated from enriched VSIG4-positive macrophages to obtain highly active VSIG4-positive macrophages.
[0012] The reversible immunoaffinity magnetic bead comprises: a magnetic carrier, an anti-VSIG4 antibody, and a linker arm connecting the magnetic carrier and the anti-VSIG4 antibody. The linker arm contains a nucleotide sequence that can be specifically cleaved and recognized by enzymes, and the nucleotide sequence contains at least one deoxyinosine (dI).
[0013] In another preferred embodiment, the nucleotide sequence is as shown in SEQ ID NO: 1.
[0014] In another preferred embodiment, in step (4), the dissociation is achieved by cleaving the linker arm using endonuclease V (Endo V).
[0015] In another preferred embodiment, the cleavage is performed in a cell separation buffer comprising: 5-20 mM HEPES, 100-150 mM NaCl, 1-10 mM KCl, 1-10 mM glucose, 1-10 mM MgCl2, 0.1-1 mM reduced glutathione, pH 6-7.
[0016] In another preferred embodiment, the buffer solution comprises: 10 mM HEPES, 120 mM NaCl, 5 mM KCl, 5 mM glucose, 5 mM MgCl2, 0.5 mM reduced glutathione, and pH 7.4.
[0017] In a second aspect of the invention, a population of VSIG4-positive macrophages is provided, wherein the cell population is isolated by the method described in the first aspect of the invention, wherein the proportion of VSIG4-positive cells in the cell population is greater than 80%, preferably greater than 90%, and the cell viability is greater than 90%, preferably greater than 95%.
[0018] In a third aspect of the invention, the use of VSIG4-positive macrophages isolated by the method of the first aspect of the invention or the VSIG4-positive macrophage population described in the second aspect of the invention in the preparation of a medicament for treating liver diseases is provided.
[0019] In another preferred embodiment, the liver disease includes acute liver injury and acute liver failure.
[0020] In another preferred embodiment, the acute liver injury includes: drug-induced liver injury, toxic liver injury, traumatic liver injury, infectious liver injury, ischemic liver injury, pregnancy-related liver injury, and physical liver injury.
[0021] In another preferred embodiment, the drug-induced liver injury includes drug-induced liver injury selected from the group consisting of acetaminophen (APAP), isoniazid, methotrexate, traditional Chinese medicine, or health products.
[0022] In another preferred embodiment, the drug is formulated as a dosage form for intravenous injection.
[0023] In another preferred embodiment, the drug is combined with a pharmaceutically acceptable carrier or excipient to form a cell therapy composition.
[0024] In another preferred embodiment, the VSIG4-positive macrophages reduce CCL2 expression and / or secretion by inhibiting the NF-κB signaling pathway, thereby blocking the recruitment of CCR2⁺ inflammatory monocytes / macrophages to alleviate liver inflammatory damage.
[0025] In another preferred embodiment, the inhibition of the NF-κB signaling pathway includes reducing the phosphorylation level of NF-κB p65.
[0026] In a fourth aspect of the invention, a pharmaceutical composition is provided comprising VSIG4-positive macrophages isolated by the method described in the first aspect of the invention or a population of VSIG4-positive macrophages as described in the second aspect of the invention, and a pharmaceutically acceptable carrier.
[0027] In another preferred embodiment, the pharmaceutical composition further includes other drugs for treating liver diseases.
[0028] In another preferred embodiment, the other medications for treating liver disease include antioxidants or anti-inflammatory drugs.
[0029] In another preferred embodiment, the pharmaceutical composition is formulated as a dosage form for intravenous injection.
[0030] In a fifth aspect of the invention, a kit is provided comprising reversible immunoaffinity magnetic beads for isolating VSIG4-positive macrophages, the magnetic beads comprising:
[0031] (a) Magnetic carrier;
[0032] (b) An affinity ligand capable of specifically binding to the VSIG4-positive macrophages; and
[0033] (c) A linker connecting the magnetic carrier and the affinity ligand;
[0034] The linker arm contains a nucleotide sequence that can be specifically cleaved and recognized by enzymes; the nucleotide sequence contains at least one deoxyinosine (dI) base.
[0035] In another preferred embodiment, the nucleotide sequence contains 2-6 deoxyinosine (dI) bases, preferably 4.
[0036] In another preferred embodiment, the linker arm is an oligonucleotide with the sequence shown in SEQ ID NO: 1, or a variant thereof comprising substitutions, deletions, or additions of one or more nucleotides, wherein the variant retains the function of being specifically recognized by enzyme cleavage.
[0037] In another preferred embodiment, one end of the connecting arm is coupled to the magnetic carrier via a first covalent bond, and the other end is coupled to the affinity ligand via a second covalent bond.
[0038] In another preferred embodiment, the first covalent bond is an amide bond.
[0039] In another preferred embodiment, the second covalent bond is an amide bond.
[0040] In another preferred embodiment, the 3' end of the connecting arm forms an amide bond with a carboxyl group on the surface of the magnetic carrier through amino modification, and the 5' end of the connecting arm forms an amide bond with an amino group on the affinity ligand through carboxyl modification.
[0041] In another preferred embodiment, the affinity ligand is an antibody or a functional fragment thereof capable of recognizing the surface markers of the VSIG4 positive macrophages.
[0042] In another preferred embodiment, the magnetic carrier is a carboxylated magnetic bead, an epoxide magnetic bead, or a streptavidin-coupled magnetic bead.
[0043] In another preferred embodiment, the enzyme is endonuclease V (Endo V).
[0044] In another preferred embodiment, the kit further comprises endonuclease V (Endo V) and / or cell separation buffer, the buffer having an osmotic pressure of 280-330 mOsm / kg and containing Mg. 2+ .
[0045] In another preferred embodiment, the buffer solution comprises: 5-20 mM HEPES, 100-150 mM NaCl, 1-10 mM KCl, 1-10 mM glucose, 1-10 mM MgCl2, 0.1-1 mM reduced glutathione, pH 6-7.
[0046] In another preferred embodiment, the buffer solution comprises: 10 mM HEPES, 120 mM NaCl, 5 mM KCl, 5 mM glucose, 5 mM MgCl2, 0.5 mM reduced glutathione, and pH 7.4.
[0047] In a sixth aspect of the invention, a method for treating liver disease is provided, the method comprising administering to a subject in need an effective amount of VSIG4-positive macrophages isolated by the method described in the first aspect of the invention, or a population of VSIG4-positive macrophages as described in the second aspect of the invention, or a pharmaceutical composition as described in the fourth aspect of the invention.
[0048] In another preferred embodiment, the VSIG4-positive macrophages are autologous or allogeneic.
[0049] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here.
[0050] Compared with the prior art, the present invention has the following technical effects:
[0051] (1) This invention innovatively proposes to use VSIG4 positive macrophages for adoptive cell therapy. This treatment method is long-lasting and can be dependent on the self-regulation of the liver microenvironment.
[0052] (2) Unlike alternative activated macrophages (AAM) used to treat liver injury, this invention uses VSIG4 positive macrophages which have strong specificity and specifically utilize the anti-inflammatory and repair effects of VSIG4.
[0053] (3) The present invention provides a complete technical solution for therapeutic applications, namely, through a specific reversible immunoaffinity magnetic bead system, highly active and functionally intact VSIG4 positive macrophages can be separated efficiently and gently.
[0054] (4) The VSIG4 positive macrophages provided by the present invention can be directly used as a therapeutic cell product for the treatment of acute liver injury, thereby overcoming the defect of the disconnect between the "separation" and "effective treatment" links in the prior art.
[0055] (5) Acute liver injury has a rapid onset and can easily progress to liver failure. After liver failure, liver transplantation is the only option, but liver transplantation is expensive due to the shortage of donors. However, the MNP@Oligo-VSIG4 method of the present invention can quickly separate macrophages and is easy to administer via intravenous injection, which can alleviate liver injury and prevent it from progressing to liver failure. Attached Figure Description
[0056] Figure 1 A schematic diagram of the preparation process of MNP@Oligo-VSIG4 in an embodiment of the present invention is shown.
[0057] Figure 2 The images show the results of isolating mouse bone marrow mononuclear macrophages using MNP@Oligo-VSIG4 in an embodiment of the present invention. The isolated VSIG4-positive mononuclear macrophages exhibited higher cell activity. In the images, A shows microscopic images and CCK8 detection results before and after isolating mouse bone marrow mononuclear macrophages using MNP@Oligo-VSIG4; B shows the immunofluorescence results.
[0058] Figure 3 This paper illustrates the effect of VSIG4-positive macrophages on acute liver injury in mice according to embodiments of the present invention. A shows a schematic diagram of the mouse acute liver injury model constructed by intraperitoneal injection of APAP and its drug administration process; B shows the mouse body weight changes at various time points, where ALI+Treatment represents the VSIG4-positive macrophage treatment group; and C shows the ALT detection results.
[0059] Figure 4 This illustration demonstrates that tail vein injection of VSIG4-positive macrophages in this embodiment of the invention significantly treats ALI and the resulting hepatocyte death. In the figures, A represents H&E staining results, and B represents TUNEL staining results and their statistical results; the white arrows indicate apoptotic hepatocytes.
[0060] Figure 5The diagram shows the results of tail vein injection of VSIG4-positive macrophages in this embodiment of the invention, which significantly improved the liver immune microenvironment. In the diagram, A represents the relative protein levels of inflammatory factors; B shows a negative correlation between the expression of the inflammatory pro-factor TNFα and VSIG4; C shows a positive correlation between the expression of tissue repair molecules (such as IL10, CD206, and TGFβ) and VSIG4; FPKM (fragmentation per million aligned reads) is a commonly used standardized indicator of gene expression in RNA-seq sequencing; D shows the inhibition of macrophage (marker F4 / 80) and neutrophil (marker MPO) infiltration in the liver of ALI model mice by VSIG4-positive macrophages, with red arrows indicating inflammatory infiltrating cells.
[0061] Figure 6 This diagram illustrates the results of VSIG4-positive macrophages alleviating ALI by inhibiting CCL2 secretion through the NF-κB pathway in an embodiment of the present invention. A shows the transcriptome sequencing (RNA-seq) results; B shows the Venn diagram analysis and gene list, displaying 29 differentially expressed genes across the three groups; C is a bubble chart of KEGG entries enriched in the 29 differentially expressed genes (DEGs). Red boxes highlight key pathways related to the inflammatory microenvironment and myeloid cell development during ALI; D shows the WGCNA analysis, displaying gene clustering across modules, reflecting the overall gene expression patterns between samples and modules. The WGCNA analysis examined the expression patterns of the light green and yellow modules in the three groups, as well as the expression levels of inflammation, chemotaxis, and NF-κB-related genes contained within them; E shows the immunoblotting analysis and quantitative results of p-P65 and CCL2 expression in mouse liver tissue of each group; F shows the CCL2 secretion level in mouse serum. In this diagram, Control 1-Control 5 or C1-C5 refer to the control groups numbered 1-5, n=5; ALI 1-ALI 5 or A1-A5 are the acute liver injury model groups, n=5; and Treatment 1-Treat 5 or T1-T5 are the VSIG4⁺ Mφ treatment groups, n=5. In Figure D, green and yellow represent different gene clustering expression modules.
[0062] Figure 7 The diagram shows the in vivo distribution results of VSIG4+Mφ after treatment in this embodiment of the invention. A is a heatmap showing the expression of inflammation-related genes in the livers of the control group, model group, and treatment group; B is a flow cytometry comparison of the abundance of specific cell populations in bone marrow-derived cells from each group of mice; C is a representative VSIG4 / CCR2 immunofluorescence staining image of liver tissue from each group of mice, along with statistical results of the number of specific cell populations. Scale bar: 100 μm.
[0063] Figure 8 The diagram shows the results of validating human liver organoids for treating ALI with VSIG4+Mφ in embodiments of the present invention. A represents the immunofluorescence staining and statistical results of various cell markers (CD68 and VSIG4) in liver organoids under different treatment conditions (scale bar: 100 μm); B represents the lactate dehydrogenase (LDH) level in the organoid culture supernatant under different treatment conditions; C represents the immunoblotting analysis of Bcl-2 and Bax levels in organoids under different treatment conditions; D represents representative TUNEL staining images of each group of organoids (scale bar: 100 μm); E represents the relative mRNA expression levels of genes related to inflammation (IL1β, IL-6, and TNF-α), chemokinetics (CCL2 and CCR2), and anti-inflammatory agents (IL10, CD206, and TGF-β); and F represents the immunoblotting detection of p-P65 and CCL2 levels in organoids under different treatment conditions. Detailed Implementation
[0064] To make the objectives, technical solutions, beneficial effects, and significant advancements of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, all the described embodiments are only some embodiments of the present invention, and not all embodiments; based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0065] the term
[0066] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0067] As used herein, “including” or “containing” includes “comprising,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.”
[0068] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, all experimental materials and reagents involved in this invention are commercially available.
[0069] Experimental materials and reagents:
[0070] Carboxylated magnetic beads (Dongna Biotechnology, catalog number Mag9404), modified Oligo (Genewiz Synthetic, catalog number 80-1816039628), 0.1 M MES buffer (pH 4.8), 0.1 M PBS (pH 7.4), 1 mg / mL bovine serum albumin (BSA), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), N-hydroxysuccinimide (NHS), 0.5 mg antibody (VSIG4 antibody, brand AntibodySystem SAS, catalog number DHK26801), 1 M hydroxylamine hydrochloride, and ultrapure water.
[0071] Experimental methods:
[0072] 1. Preparation of MNP@Oligo-VSIG4 reversible immunoaffinity magnetic beads:
[0073] Through extensive screening, an oligonucleotide containing four deoxyinosine (dI) bases (OligoDNA, 5'COOH-ATGCGATCTIGACTGAITCGAATICGGTACICATGTA-Aminolinker-3', SEQ ID NO: 1) was finally designed as a linker, where I represents the deoxyinosine (dI) base. A control linker without dI (sequence ATGCGATCTAGACTGAATCGAATACGGTACACATGTA, SEQ ID NO: 2) was used to determine the enzyme digestion effect. Carboxylated magnetic beads were directionally coupled to a specific VSIG4 antibody, specifically by connecting the amino-modified end of Oligo (3'... Aminolinker C7 modification refers to the chemical modification of an oligonucleotide (such as a primer or probe) by attaching an amino group (-NH2) to the 3' end through a methylene chain containing 7 carbon atoms (C7 intergenic arm). The Oligo C7 modification is then linked to the carboxyl group on the magnetic bead surface via an amide bond. The Oligo C7 modification end (COOH) is activated by EDC / NHS and covalently binds to the antibody's amino group. Figure 1 As shown.
[0074] The experimental procedure is as follows:
[0075] Step 1: Activation of carboxylated magnetic beads
[0076] 1) Take carboxylated magnetic beads: Take 0.2 mL of carboxylated magnetic bead suspension (about 2 mg of magnetic beads), collect the magnetic beads with a magnetic rack, and discard the supernatant.
[0077] 2) Washing: Wash three times with 2 mL of 0.1 M MES buffer, and discard the supernatant after each wash using magnetic separation.
[0078] 3) Activate carboxyl groups: Resuspend the magnetic beads in 0.2 mL of 0.1 M M EES buffer. Add EDC to a final concentration of 10 mM and NHS to a final concentration of 5 mM. Shake at room temperature (300 rpm) for 15 minutes to activate the carboxyl groups on the magnetic beads.
[0079] Step 2: Coupling Oligo DNA with Magnetic Beads
[0080] 1) Prepare aminoated Oligo DNA: Take 20 μL of 100 μM aminoated Oligo DNA solution (dissolved in 0.1 M MES buffer).
[0081] 2) Coupling reaction: Mix the activated magnetic beads with Oligo DNA solution and shake at room temperature (200 rpm) for 2 hours.
[0082] 3) Termination of reaction: Add hydroxylamine hydrochloride to a final concentration of 50 mM (e.g., add 10 μL of 1 M hydroxylamine hydrochloride), and shake at room temperature for 15 minutes to terminate the reaction.
[0083] Step 3: Block unreacted reactive groups
[0084] 1) Washing: Wash the magnetic beads three times with 2 mL PBS, and discard the supernatant after magnetic separation.
[0085] 2) Blocking: Resuspend the magnetic beads in 0.2 mL of 1 mg / mL BSA solution and shake at room temperature for 1 hour.
[0086] 3) Final washing: Wash 3 times with PBS, magnetically separate, and store in 0.2 mL PBS (4°C for later use).
[0087] Step 4: Conjugation of carboxylated Oligo DNA to antibodies
[0088] 1) Activate the carboxyl terminus: Take the above-conjugated magnetic beads and wash them three times with 2 mL of 0.1 M MES buffer. Resuspend them in 0.2 mL of MES buffer, add 10 mM EDC and 5 mM NHS to a final concentration, and shake at room temperature for 15 minutes.
[0089] 2) Prepare antibody solution: Dissolve 0.1 mg VSIG4 antibody in 100 μL PBS (final concentration 1 mg / mL).
[0090] 3) Antibody conjugation: Mix the VSIG4 antibody solution with the activated magnetic beads and shake at room temperature (200 rpm) for 2 hours.
[0091] 4) Termination of reaction: Add hydroxylamine hydrochloride to a final concentration of 50 mM and shake at room temperature for 15 minutes.
[0092] Step 5: Blocking and Purification
[0093] 1) Blocking: Add 0.2 mL of 1 mg / mL BSA solution and shake at room temperature for 1 hour.
[0094] 2) Washing: Wash 3 times with 2 mL PBS, then magnetically separate and discard the supernatant.
[0095] 3) Storage: Resuspend in 0.2 mL PBS (containing 0.05% NaN3) to obtain MNP@Oligo-VSIG4 reversible immunoaffinity magnetic beads, and store at 4°C protected from light.
[0096] After cell immunoaffinity separation, the dI site in Oligo is cleaved by Endo V nuclease (the processing buffer consists of 10 mM HEPES, pH 7.4 + 120 mM NaCl + 5 mM KCl + 5 mM glucose + 5 mM MgCl2 + 0.5 mM reduced glutathione, which is a buffer that facilitates enzymatic cleavage and cell preservation; the optimal temperature is 37℃ and the processing time is 30 min), thus achieving gentle dissociation of the magnetic beads from the cells and ensuring cell viability.
[0097] This invention solves the problem of cell damage caused by the irreversible binding of traditional immunomagnetic beads, and is suitable for cell sorting followed by culture and cell therapy. The method is simple to operate, highly specific, and reproducible, and the dissociation efficiency can be controlled by adjusting the Oligo length and dI number.
[0098] 2. Isolation of VSIG4-positive macrophages from bone marrow
[0099] (1) Acquisition and induction of differentiation of bone marrow mononuclear cells:
[0100] Under aseptic conditions, mouse femurs and tibias were harvested, and bone marrow cells were flushed out with PBS containing 2% FBS. After erythrocyte lysis, the cells were resuspended in complete medium (RPMI-1640, 10% FBS) containing 20 ng / mL M-CSF and seeded at an appropriate density in culture dishes. The cells were cultured at 37°C in a 5% CO2 incubator for 5-7 days, with half the medium replaced every 2-3 days, to induce differentiation into bone marrow-derived macrophages.
[0101] (2) Positive sorting of MNP@Oligo-VSIG4 reversible immunoaffinity magnetic beads:
[0102] Collect induced cells, resuspend them in pre-chilled cell sorting buffer (10 mM HEPES, pH 7.4 + 120 mM NaCl + 5 mM KCl + 5 mM glucose + 5 mM MgCl2 + 0.5 mM reduced glutathione) and count them. Divide the cells into groups of 10-1. 7Add 10 μL of MNP@Oligo-VSIG4 to each cell and incubate at room temperature for 15 minutes. Wash twice with buffer, place on a magnetic rack, and remove unbound cells. The sorted cells can be used immediately for subsequent experiments. A portion of the cells can be used to recheck their purity using immunofluorescence and cell viability can be detected using CCK8. Immunofluorescence detection of VSIG4 is used to identify VSIG4-positive target cells; detection of CCR2 (CC motif chemokine receptor 2) is used to identify CCR2-positive monocytes / macrophages that exhibit chemotaxis towards liver tissue.
[0103] 3. Establishment of a mouse model of acute liver injury (ALI) and cell therapy
[0104] like Figure 3 As shown in Figure A, 15 female C57BL / 6 mice (n=15), aged 8-10 weeks and weighing 20-25g, were used. The groups were as follows:
[0105] Control group: Normally fed, with 100 μL of physiological saline injected intraperitoneally;
[0106] Model group: ALI induced by intraperitoneal injection of APAP (250 mg / kg, 100 μL);
[0107] Treatment group: APAP induced ALI + VSIG4 positive macrophages (1×10⁻⁶) 6 One injection via tail vein.
[0108] Cells were housed in an SPF-protected environment with free access to food and water for one week of acclimatization. Prior to modeling, they were fasted but allowed free access to water for 12 hours. Twelve hours after modeling, the treatment group received a slow injection of 100 µL of cell suspension (containing 1×10⁻⁶ cells) using a 29G insulin syringe. 6 (1 VSIG4 positive macrophages), the model group was injected with an equal volume of PBS. 48 hours after treatment, mice were anesthetized (1% sodium pentobarbital), and blood was collected from the tail vein for subsequent liver function tests; mice were euthanized by cervical dislocation, and the livers were separated. Part of the liver was stored in neutral formalin for paraffin section preparation, and the other part was flash-frozen in liquid nitrogen for subsequent RNA or protein extraction.
[0109] 4. Serum alanine aminotransferase (ALT) level detection
[0110] Serum transaminase (ALT) detection was performed using the Amplex Red Alanine Transaminase (ALT) Activity Assay Kit (Beyotime, catalog number P2711S). The specific operating procedure is detailed in the instruction manual, and is briefly described below: For mouse plasma samples, whole blood was anticoagulated with EDTA and centrifuged at approximately 1000-2000×g for 10 minutes at 4ºC. The yellow or pale yellow supernatant was collected as plasma. Amplex Red and ALT Assay Buffer were dissolved, equilibrated to room temperature, and then mixed thoroughly. Other reagents were stored on ice. An appropriate amount of Amplex Red working solution was prepared according to the number of samples to be tested (including standards). An appropriate amount of Amplex Red working solution was prepared at a volume of 80µl per reaction. 72µl ALT Assay Buffer, 2µl Amplex Red, 2µl Enzyme Solution, 2µl Cofactor, and 2µl Substrate were mixed evenly to prepare 80µl of Amplex Red working solution. Set up standard and sample wells, add the prepared standard and the sample to be tested respectively, and then add 80µl of Amplex Red reaction working solution to each well. Immediately detect the reaction using an ELISA reader (measure A570, denoted as A1). React at 37ºC in the dark for 20-30 minutes, and record the reaction time as T. Measure A570, denoted as A2. Calculate the pyruvate concentration based on the standard curve, denoted as B. The sample dilution factor is n. Finally, the ALT concentration can be calculated using the formula ALT (U / L) = B × n / T.
[0111] 5. HE staining
[0112] Mouse liver tissue fixed in 4% paraformaldehyde or neutral formalin for more than 24 hours was collected, routinely embedded in paraffin, and sectioned (4-5 μm thick). Sections were dewaxed with xylene, rehydrated with graded ethanol, stained with hematoxylin for 5-8 minutes, and allowed to return to blue via running water; subsequently stained with eosin for 1-3 minutes. After staining, sections were dehydrated with graded ethanol, cleared with xylene, and finally mounted with neutral resin. Pathological changes in the liver tissue, including lobular structure, areas of cell necrosis, and inflammatory cell infiltration, were observed under a light microscope.
[0113] 6. TUNEL assay for hepatocellular damage
[0114] Paraffin sections of mouse liver tissue prepared as described above were dewaxed and rehydrated, then permeabilized with proteinase K (20 μg / mL) at 37°C for 15 minutes. After washing with PBS, TUNEL reaction mixture (containing terminal deoxynucleotidyl transferase and fluorescein-labeled dUTP) was added to the tissue sections according to the TUNEL assay kit instructions, and incubated in a humidified chamber at 37°C for 60 minutes in the dark. After washing with PBS, the sections were mounted with a DAPI-containing anti-fluorescence quenching mounting medium. Finally, under a fluorescence microscope, the nuclei of apoptotic cells showed green fluorescence (FITC channel), while the nuclei of normal cells showed blue fluorescence (DAPI channel). The distribution of apoptotic cells around the central vein of the hepatic lobule and in the necrotic area was observed in detail.
[0115] 7. Immunohistochemical (IHC) detection
[0116] After dewaxing and rehydration of the prepared mouse liver tissue paraffin sections, antigen retrieval was induced by heat in sodium citrate buffer (pH 6.0). The sections were then blocked with 3% hydrogen peroxide to inhibit endogenous peroxidase, and blocked with 5% BSA at room temperature for 30 minutes. Primary antibodies (rat anti-mouse F4 / 80 monoclonal antibody or rabbit anti-mouse MPO polyclonal antibody) were added, and the sections were incubated overnight at 4°C. The next day, the sections were washed with PBS, and horseradish peroxidase-labeled secondary antibodies were added, followed by incubation at room temperature for 50 minutes. DAB staining was performed, and the cell nuclei were counterstained with hematoxylin. After dehydration and clearing, the sections were mounted with neutral resin. Finally, under a light microscope, the cytoplasm of both F4 / 80 positive cells (macrophages) and MPO positive cells (neutrophils) showed a brownish-yellow staining. The extent and distribution characteristics of their infiltration around the central vein of the liver lobule and in areas of hepatocyte necrosis were analyzed.
[0117] 8. RT-qPCR detection of target gene expression
[0118] Approximately 50 mg of liver tissue from each group of mice was collected, homogenized using TRIzol reagent, and separated into layers using chloroform to extract total RNA. After determining the RNA concentration and purity, 1 μg of total RNA was used to synthesize cDNA according to the reverse transcription kit instructions. Using the cDNA as a template, amplification was performed on a real-time quantitative PCR instrument using a SYBR Green premixed system. The reaction program was: 95℃ pre-denaturation for 30 seconds, followed by 95℃ for 5 seconds, 60℃ for 30 seconds, for 40 cycles. Primer sequences were designed targeting the genes IL1B, IL6, TNF, IL10, CD206, TGFB, and VSIG4, with β-actin used as an internal control gene. Two... −ΔΔCt The relative expression levels of each target gene were calculated, the differences in their expression in liver tissues of different groups were analyzed, and correlation analysis was performed based on the expression levels.
[0119] 9. Immunoblotting detection of target gene expression
[0120] Total protein was extracted from liver tissue samples in the control, model, and treatment groups of an acute liver injury (ALI) mouse model using RIPA buffer containing protease and phosphatase inhibitors. Proteins were separated by SDS-PAGE, transferred to PVDF membranes, and incubated with primary antibodies against Bcl-2 (Abmart, China, catalog number T40056S), Bax (Selleck, USA, catalog number F0037), phosphorylated p65 (Abmart, China, catalog number TB3675), CCL2 (Abmart, China, catalog number TD7577), and β-actin (Servicebio, China, catalog number GB15003). Then, secondary antibodies labeled with HRP for the corresponding species were used for incubation. Finally, the HRP-labeled secondary antibodies were detected using the ECL Basic Femto Kit.
[0121] 10. Liver tissue RNA-seq
[0122] Total RNA was extracted from liver tissue samples in the control, model, and treatment groups of an acute liver injury (ALI) mouse model, and its quality was assessed. mRNA was enriched using Oligo(dT) magnetic beads and fragmented into short segments. cDNA libraries were sequenced by Metware Biotechnology Co., Ltd. (Wuhan, China) on the Illumina sequencing platform. Raw sequencing reads were filtered using FASTP to remove adapter sequences, reads containing more than 10% uncertain bases, or reads with more than 50% low-quality bases (Q ≤ 20). The processed reads were aligned to the mouse reference genome. Gene expression levels were quantified into FPKM values using featureCounts. Differentially expressed genes (DEGs) between groups were identified using DESeq2, with a threshold of log2-fold change ≥ 1 and a false positive rate < 0.05. Based on this, WGCNA analysis was performed for cross-module gene clustering. (WGCNA (weighted geneco-expression network analysis) is a typical systems biology algorithm for constructing gene co-expression networks. This algorithm is based on high-throughput gene messenger RNA (mRNA) expression data. First, it assumes that the gene network follows a scale-free distribution and defines the gene co-expression correlation matrix and the adjacency function for gene network formation. Then, it calculates the dissimilarity coefficients of different nodes and constructs a hierarchical clustering tree accordingly. Different branches of this clustering tree represent different gene modules (represented by different colors), with high co-expression levels within a module and low co-expression levels across different modules.) The upper part of the figure shows the clustering heatmap of genes within the module, with red indicating high expression and green indicating low expression. The lower part shows the expression pattern of module feature values in different samples. Positive values represent overall upregulation of genes in this module in that sample, negative values represent overall downregulation of genes in this module in that sample, and 0 represents the average value of the module feature value across all samples.
[0123] Example 1: Construction of VSIG4 positive cell sorting magnetic beads (MNP@Oligo-VSIG4)
[0124] like Figure 1 As shown, the carboxylated magnetic beads are first activated:
[0125] 1) Take 0.2 mL of carboxylated magnetic beads (commercial basic carboxylated magnetic beads) suspension (about 2 mg of magnetic beads), collect the magnetic beads using a magnetic rack, and discard the supernatant;
[0126] 2) Wash three times with 2 mL of 0.1 M MES buffer, and discard the supernatant after each wash using magnetic separation;
[0127] 3) Resuspend the magnetic beads in 0.2 mL of 0.1 M M MES buffer. Add EDC to a final concentration of 10 mM and NHS to a final concentration of 5 mM. Shake at room temperature (300 rpm) for 15 minutes to activate the carboxyl groups on the magnetic beads.
[0128] 4) Coupling the above Oligo DNA with activated magnetic beads:
[0129] 4.1) Take 20 μL of 100 μM one-end aminoated Oligo DNA solution (dissolved in 0.1 M MES buffer).
[0130] 4.2) Mix the activated magnetic beads with the Oligo DNA solution and shake (200 rpm) at room temperature for 2 hours;
[0131] 4.3) Add hydroxylamine hydrochloride to a final concentration of 50 mM, shake at room temperature for 15 minutes to terminate the reaction; wash the magnetic beads three times with 2 mL PBS, and discard the supernatant after magnetic separation;
[0132] 4.4) Resuspend the magnetic beads in 0.2 mL of 1 mg / mL BSA solution and shake at room temperature for 1 hour;
[0133] 4.5) Wash three times with PBS, magnetically separate, and store in 0.2 mL PBS (4°C for later use).
[0134] 5) Conjugation of carboxylated Oligo DNA with VSIG4 antibody:
[0135] 5.1) Take the magnetic beads that have been coupled with Oligo, wash them three times with 2 mL of 0.1 M MES buffer, resuspend them in 0.2 mL of MES buffer, add 10 mM EDC and 5 mM NHS to a final concentration, and shake at room temperature for 15 minutes.
[0136] 5.2) Dissolve 0.1 mg of VSIG4 antibody in 100 μL of PBS;
[0137] 5.3) Mix the antibody solution with the activated Oligo-magnetic beads and shake at room temperature (200 rpm) for 2 hours;
[0138] 5.4) Add hydroxylamine hydrochloride to a final concentration of 50 mM and shake at room temperature for 15 minutes;
[0139] 5.5) Add 0.2 mL of 1 mg / mL BSA solution and shake at room temperature for 1 hour; wash 3 times with 2 mL PBS, and magnetically separate and discard the supernatant;
[0140] 5.6) Resuspend in 0.2 mL PBS (containing 0.05% NaN3) to obtain the conjugated immunoaffinity magnetic beads: VSIG4 positive cell sorting magnetic beads (MNP@Oligo-VSIG4), which can be stored at 4°C in the dark.
[0141] Example 2: Sorting and activity detection of VSIG4-positive macrophages for cell therapy
[0142] The VSIG4-positive cell sorting magnetic beads (MNP@Oligo-VSIG4) constructed in Example 1 were used for the reversible sorting of VSIG4-positive macrophages. The cell sorting procedure is described in Experimental Method 2. Before and after sorting, bone marrow-derived mononuclear macrophages were placed in culture dishes and incubated at 37°C in a CO2 incubator, and photographed under an optical microscope.
[0143] The results are as follows Figure 2 As shown, compared with the VSIG4-positive cells before sorting with magnetic beads, the bone marrow-derived VSIG4-positive macrophages after sorting were in good cell condition, with virtually no magnetic beads remaining on the cell surface. Figure 2 A). Immunofluorescence staining for both VSIG4 and CCR2 was positive. Figure 2 (B) CCR2 is a marker of bone marrow-derived monocytes and macrophages, and a key molecule mediating the chemotaxis of bone marrow-derived monocytes and macrophages to target tissues in response to CCL2 chemotactic signals. Furthermore, CCK8 assays were performed, showing good cell proliferation capacity after sorting, even superior to that of the unsorted bone marrow-derived cell mixture (BMDM).
[0144] Example 3: Construction of a mouse model of acute liver injury (ALI) and cell therapy
[0145] The model construction method is described in the Experimental Methods section, and the schematic diagram is as follows: Figure 3 As shown in Figure A, 15 10-week-old C57 magnetic mice were divided into 3 groups: control group (PBS), ALI model group (250 mg / kg APAP + placebo), and ALI + VSIG4. + Mφ treatment group (250mg / kg APAP + 1×10) 6 VSIG4 + Mφ treatment), the weight of mice was measured and recorded daily before and after modeling until the mice were sacrificed.
[0146] The results are as follows Figure 3 As shown in Figure B, after intraperitoneal injection of APAP, the body weight of mice in both the model group and the treatment group decreased significantly, while the body weight of mice in the model group (VSIG4) decreased significantly. +Weight regain was significant after Mφ treatment, with a faster rate of recovery than in the model group, and the weight exceeded that of the model group by the second day after treatment. Simultaneously, ALT testing revealed a significant increase in ALT levels in the model group, while ALT levels in the treatment group decreased to the control group level. Figure 3 C), showing VSIG4 + Mφ showed significant therapeutic effects on acute liver injury in mice and accelerated liver repair.
[0147] Example 4: VSIG4-positive macrophage therapy can alleviate ALI hepatocellular damage.
[0148] To further determine VSIG4 + To assess the therapeutic effect of Mφ, this embodiment embedded, sectioned, and stained the liver tissue of mice in each group (see the Experimental Methods section for specific experimental procedures, and detected the alleviation of ALI hepatocyte damage by VSIG4 positive macrophages).
[0149] The results are as follows Figure 4 As shown, HE staining results revealed that the histopathological morphology of the ALI model group showed significant hepatocellular damage and inflammatory infiltration. Figure 4 A), and TUNEL fluorescence staining results also confirmed that the ALI group had a greater number of apoptotic hepatocytes (white arrows). Figure 4 B). Regarding VSIG4 + In the Mφ treatment group, both staining results showed that, compared with the ALI model group, VSIG4 + After Mφ treatment, liver tissue morphology returned to normal, damage was reduced, and hepatocyte apoptosis decreased.
[0150] Example 5: VSIG4-positive macrophage therapy can improve the inflammatory microenvironment of the liver.
[0151] A significant portion of acute liver injury is inflammatory damage caused by inflammation. Therefore, based on the experimental methods described above, this embodiment further detects VSIG4. + Does Mφ treatment improve local liver inflammation?
[0152] The results are as follows Figure 5 As shown, compared with the ALI model group, VSIG4 + Mφ treatment can significantly reduce the expression of inflammatory factors in liver tissue (such as IL-1β, TNF-α and IL-6). Figure 5 A), the expression of the pro-inflammatory factor TNF-α was negatively correlated with VSIG4; the expression of inflammatory inhibitory and tissue repair molecules (such as IL-10, CD206, and TGF-β) was positively correlated with VSIG4. Figure 5 BC), indicating VSIG4 + Injection of Mφ helps to inhibit the further development of local inflammation and is beneficial to tissue repair.
[0153] Similarly, immunohistochemical results also showed that, compared with the ALI model group, VSIG4 + Inflammatory infiltration of inflammatory cells (macrophages (F4 / 80), neutrophils (MPO)) in liver tissue in the Mφ treatment group Figure 5 The number of cases (as indicated by the red arrow in D) has decreased significantly.
[0154] In summary, the VSIG4 prepared by this invention... + Mφ can significantly inhibit APAP-induced acute liver injury (ALI), reduce hepatocyte apoptosis, improve the inflammatory microenvironment of the liver, and promote liver repair.
[0155] Example 6: VSIG4-positive macrophages alleviate ALI by inhibiting CCL2 secretion through the NF-κB pathway.
[0156] To reveal VSIG4 + Mφ alleviates the inflammatory microenvironment of the liver in ALI and treats ALI through molecular mechanisms. This invention utilizes liver tissue from mice treated in the groupings described in Example 3 for transcriptome sequencing (RNA-seq). The sequencing process is briefly described below:
[0157] Total RNA was extracted from each sample and its quality was assessed. mRNA was enriched using Oligo(dT) magnetic beads and fragmented into short fragments. cDNA libraries were constructed and sequenced on an Illumina sequencing platform. Raw reads were filtered using FastP software to remove adapter sequences, reads with an indeterminate proportion exceeding 10%, or reads with a low-quality base proportion (Q ≤ 20) exceeding 50%. The filtered reads were aligned to the mouse reference genome. Gene expression levels were quantified using featureCounts, expressed as FPKM. Differentially expressed genes (DEGs) between groups were identified using DESeq2, with a threshold of log2 fold change ≥ 1 and P < 0.05.
[0158] According to RNA-seq analysis results, VSIG4 + Mφ treatment reversed the expression of 29 differentially expressed genes ( Figure 6 These genes (A and B) are significantly enriched in pathways related to inflammatory mediator secretion, immune cell chemotaxis, and myeloid cell state. Figure 6 (The red box in C indicates this). CCL2, which encodes an important monocyte chemoattractant protein, is upregulated in ALI, while VSIG4... + Mφ processing resulted in downregulation of expression.
[0159] The CCL2-CCR2 axis is a central link in the recruitment of myeloid cells during inflammation amplification. This not only confirms the previous findings of this invention—VSIG4+ Mφ treats ALI by improving the inflammatory microenvironment of the liver, and also suggests VSIG4 + Mφ may alleviate secondary inflammatory damage in the liver by blocking CCL2-CCR2 axis-dependent chemotactic recruitment of myeloid monocytes. The NF-κB pathway is the main transcription factor signaling pathway mediating CCL2 transcription and expression during ALI. Consistent with this, further WGCNA analysis performed cross-module gene clustering. (WGCNA (weighted gene co-expression network analysis) is a typical systems biology algorithm for constructing gene co-expression networks. It is based on high-throughput gene messenger RNA (mRNA) expression data; it first assumes that the gene network follows a scale-free distribution and defines the gene co-expression correlation matrix and the adjacency function for gene network formation. Then, it calculates the dissimilarity coefficients of different nodes and constructs a hierarchical clustering tree. Different branches of this clustering tree represent different gene modules (represented by different colors), with high co-expression levels within modules and low co-expression levels between different modules.) Figure 6 The upper part of D is a clustering heatmap of genes within the module, with red indicating high expression and green indicating low expression. The lower part shows the expression pattern of module feature values in different samples. Positive values indicate that the genes of this module are upregulated in the sample, negative values indicate that the genes of this module are downregulated in the sample, and 0 indicates that the module feature value of each module is the average value across all samples.
[0160] The results showed that the expression patterns of the light green and yellow modules (containing genes related to inflammation, chemokines, and NF-κB) in the three subgroups were consistent with those of CCL2, i.e., in VSIG4. + Mφ expression decreased after treatment ( Figure 6 D).
[0161] At the protein level, VSIG4 was also confirmed. + Mφ treatment significantly inhibited the phosphorylation of NF-κB p65—a key transcriptional regulator of CCL2—leading to a significant decrease in CCL2 expression. Figure 6 EF), thereby weakening the responsibility for raising CCR2 + The chemotactic gradient from pro-inflammatory monocytes / macrophages to damaged liver.
[0162] These results confirm and extend the above findings, indicating that VSIG4 + Mφ inhibits the NF-κB-CCL2 axis, thereby preventing the amplification of inflammation caused by the recruitment of CCR2⁺ monocytes / macrophages.
[0163] Example 7: Distribution of VSIG4-positive macrophages in the liver and tissue inflammation after injection
[0164] To investigate VSIG4 + In vivo distribution of Mφ after treatment (mainly in the liver and bone marrow-blood), and flow cytometry analysis of isolated bone marrow mononuclear macrophages were performed. The procedure is briefly described below:
[0165] Under aseptic conditions, mouse femurs and tibias were harvested, and bone marrow cells were flushed out with PBS containing 2% FBS. After erythrocyte lysis, the cells were resuspended in complete medium (RPMI-1640, 10% FBS) containing 20 ng / mL M-CSF. The separated cells were collected, washed twice with pre-cooled PBS, fixed with 4% paraformaldehyde at room temperature for 20 min, washed three times with PBS, and then blocked with goat serum. Isotype control antibodies were added to isotype control tubes. VSIG4 or CCR2 specific antibodies (1:50) were added to single-staining tubes, and VSIG4 and CCR2 antibodies were added to sample tubes. After incubation at room temperature for 1 h, the cells were washed three times with PBS, and either AF488-labeled goat anti-rabbit secondary antibody (1:500) or AF568-labeled goat anti-mouse secondary antibody (1:500) was added. After incubation at room temperature in the dark for 1 h, the cells were washed three times with PBS and analyzed by flow cytometry.
[0166] Next, immunofluorescence staining was performed on the liver tissue. The procedure is briefly described as follows: Frozen liver tissue sections were fixed with 4% paraformaldehyde, permeabilized with 0.3% Triton X-100, and blocked with 10% horse serum. Primary antibodies against VSIG4 and CCR2 were then added, and the sections were incubated overnight at 4°C. Then, either AF488-labeled goat anti-rabbit secondary antibody (1:500) or AF568-labeled goat anti-mouse secondary antibody (1:500) was added. Sections were mounted with DAPI-containing mounting medium, imaged using a Pannoramic MIDI (3D HISTECH, Hungary), and analyzed using HLB-viewer software.
[0167] Furthermore, analysis of the expression of inflammation-related genes in liver tissue based on sequencing results revealed a large number of inflammation-related genes in VSIG4. + Mφ expression was reduced in the treatment group, indicating an improvement in the inflammatory state of liver tissue. Figure 7 A). Flow cytometry analysis of the above mouse bone marrow-derived cells revealed that the number of VSIG4-positive cells in the ALI model group was significantly higher than that in the control group, while VSIG4... + The number of VSIG4-positive cells was significantly reduced in the Mφ treatment group, and the changes in the number of CCR2-positive cells were consistent with the changes in the number of VSIG4-positive cells. Figure 7 B).
[0168] Immunofluorescence assays of VSIG4-positive and CCR2-positive cells within liver tissue showed a decrease in VSIG4-positive cells and an increase in CCR2-positive cells in the ALI model group; while in the VSIG4-positive cell group... + The number of VSIG4-positive cells and CCR2-positive cells was significantly increased in the Mφ treatment group. Figure 7 C).
[0169] In summary, during ALI, VSIG4-positive cells (mainly KCs) within the liver tissue are depleted, while chemotactic CCR2-positive cells (mostly VSIG4-negative) infiltrate the liver tissue, participating in the microenvironmental inflammatory response, leading to the expansion of inflammation and secondary inflammatory damage to the liver tissue; while tail vein injection of VSIG4 + Mφ significantly increases the number of VSIG4 and CCR2 double-positive cells in liver tissue, neutralizes the chemokine CCL2, and even inhibits the production of CCL2 in liver tissue, suppressing the chemotaxis of CCR2-positive (mostly VSIG4-negative) cells from bone marrow to liver tissue, thus preventing further expansion of the inflammatory response. Therefore, in VSIG4 + In the bone marrow cells isolated from the Mφ treatment group, the number of VSIG4 positive cells and CCR2 positive cells was reduced, which also reflects the reduction of intrahepatic inflammatory response after NF-κB pathway inhibition and the reduced demand for bone marrow-derived monocytes.
[0170] Example 8: Validation of human liver organoids for treating ALI with VSIG4-positive macrophages
[0171] To validate VSIG4 in human-derived systems + The therapeutic effect of Mφ on ALI was investigated by constructing a human-derived vascularized liver organoid that preserved the immune microenvironment from normal human liver tissue. Based on this, an ALI and chemotaxis model was established. The experimental procedure is briefly described below:
[0172] With informed consent, healthy human liver tissue was obtained from surgically removed specimens. The tissue was washed 3-5 times with organoid washing buffer (Lisheng Biotechnology Co., Ltd., catalog number: LSNO00400201), cut into 1-2 mm³ pieces, placed in 6 cm culture dishes, and cultured in liver organoid culture medium (Lisheng Biotechnology Co., Ltd., catalog number: LSNO00400402). The organoids were cultured at 37℃ and 5% CO2, with half of the culture medium replaced every 3-5 days. After organoid identification, an ALI model was constructed, and mature organoids were treated with APAP (2-20 mM) for 2-12 hours. The supernatant was collected for ALT / AST and LDH detection. In co-culture experiments, the organoids were placed in the lower chamber of a Transwell plate (8.0 μm pore size), and THP-1 cells (VSIG4-positive monocytes / macrophages, 1×10⁶ cells) were cultured with or without APAP (2 mM). 5 (Number of organs / cells) were added to the upper chamber. After 2 or 12 hours, organoids and cells were collected for qPCR, LDH, Western blotting, and immunofluorescence analysis.
[0173] The results are as follows Figure 8 As shown, with the extension of culture time, VSIG4 + The number of VSIG4+ cells was significantly increased in the Mφ treatment group. Figure 8 A). Further testing of the therapeutic effect showed that in VSIG4 + With the addition of Mφ, LDH activity was significantly reduced compared to the APAP group. Figure 8 B), the expression of the anti-apoptotic protein Bcl2 was significantly increased, while the expression of the apoptotic protein Bax was significantly decreased. Figure 8 C), the level of apoptosis was significantly reduced ( Figure 8 D), all of these reflect VSIG4 + The therapeutic effect of Mφ on hepatocellular damage.
[0174] Furthermore, detection of inflammatory factors confirmed that VSIG4 + The addition of Mφ, especially when the chemotaxis time was prolonged to 12 h, reduced the expression of pro-inflammatory factors and the CCL2-CCR2 axis mediating myeloid monocyte / macrophage chemotaxis, while increasing the expression of anti-inflammatory factors. Figure 8 E). Consistent with this, protein-level assays also confirmed VSIG4. + Mφ treatment decreased CCL2 expression, and also decreased the level of p-p65, which mediates its transcription. Figure 8 F).
[0175] The above results further demonstrate the effectiveness of VSIG4 in human organoids. + Mφ's therapeutic effect on ALI, and VSIG4 +Mφ does indeed inhibit the production of CCL2 in the liver microenvironment by suppressing the NF-κB signaling pathway.
[0176] The preferred embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and the devices and structures not described in detail should be understood as being implemented in a conventional manner in the art. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the scope of the present invention. This does not affect the essential content of the present invention. Therefore, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the present invention's technical solutions still fall within the protection scope of the present invention.
Claims
1. A method for isolating VSIG4-positive macrophages, characterized in that, Includes the following steps: (1) Provide a sample containing macrophages; (2) The sample is contacted with reversible immunoaffinity magnetic beads, which are coupled with anti-VSIG4 antibody; (3) Enrichment of VSIG4-positive macrophages bound to magnetic beads by magnetic separation; and (4) Under mild conditions, magnetic beads were dissociated from enriched VSIG4-positive macrophages to obtain highly active VSIG4-positive macrophages. The reversible immunoaffinity magnetic bead comprises: a magnetic carrier, an anti-VSIG4 antibody, and a linker arm connecting the magnetic carrier and the anti-VSIG4 antibody. The linker arm contains a nucleotide sequence that can be specifically cleaved and recognized by enzymes, and the nucleotide sequence contains at least one deoxyinosine (dI).
2. The method as described in claim 1, characterized in that, The nucleotide sequence is shown in SEQ ID NO:
1.
3. The method as described in claim 1, characterized in that, In step (4), the dissociation is achieved by cleaving the linker arm using endonuclease V (Endo V).
4. The method as described in claim 3, characterized in that, The cleavage was performed in a cell separation buffer comprising: 5-20 mM HEPES, 100-150 mM NaCl, 1-10 mM KCl, 1-10 mM glucose, 1-10 mM MgCl2, 0.1-1 mM reduced glutathione, pH 6-7.
5. A population of VSIG4-positive macrophages, characterized by, The cell population is obtained by means of the method described in claim 1, wherein the proportion of VSIG4 positive cells in the cell population is greater than 80%, preferably greater than 90%, and the cell viability is greater than 90%, preferably greater than 95%.
6. The use of VSIG4-positive macrophages isolated by the method of claim 1 or the VSIG4-positive macrophage population of claim 2 in the preparation of a medicament for treating liver diseases.
7. The liver diseases mentioned include: Acute liver injury and acute liver failure.
8. A pharmaceutical composition, characterized in that, It comprises VSIG4-positive macrophages isolated by the method of claim 1 or the VSIG4-positive macrophage population of claim 5, and a pharmaceutically acceptable carrier.
9. A reagent kit, characterized in that, Contains reversible immunoaffinity magnetic beads for isolating VSIG4-positive macrophages, the magnetic beads comprising: (a) Magnetic carrier; (b) An affinity ligand capable of specifically binding to the VSIG4-positive macrophages; and (c) A connecting arm that connects the magnetic carrier to the affinity ligand; The linker arm contains a nucleotide sequence that can be specifically cleaved and recognized by enzymes; the nucleotide sequence contains at least one deoxyinosine (dI) base.
10. The kit according to claim 9, characterized in that, The linker arm is an oligonucleotide with the sequence shown in SEQ ID NO: 1, or a variant thereof containing substitutions, deletions, or additions of one or more nucleotides, and the variant retains the function of being specifically recognized by enzyme cleavage.