Method and kit for identifying the creeping trait and early embryonic lethal genotypes of miyi chicken based on hrm

Abstract

The application discloses a method and a kit for identifying a creeping trait and an early embryo lethal genotype of a Miyi chicken based on HRM, and relates to the fields of genetic engineering and chicken genetic breeding. The Miyi chicken creeping trait and early embryo lethal genotype are two discontinuous deletions on a No. 7 chromosome of the Miyi chicken, the lengths of the two deletions are 13,472 bp and 11,560 bp respectively, and the total deletion length is 25,032 bp; a 672 bp fragment between the two deletion fragments is inverted. The application provides a specific three-primer set (SEQ ID NO: 6-8) for HRM detection and a kit containing the primer set. Through the HRM method, the melting curve analysis of the amplification product can be carried out under closed tube conditions, and three genotypes of normal type (+ / +), creeping type (Cp / +) and homozygous lethal type (Cp / Cp) can be accurately distinguished according to a normalized difference map.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and chicken genetic breeding, specifically to a method and kit for identifying the crawling trait and early embryonic lethal genotype of Miyi chickens based on HRM. Background Technology

[0002] Creeper trait is a unique limb phenotype in poultry, characterized by severely shortened long bones (achondroplasia) and short stature. This trait is widely present in many excellent local chicken breeds in China, including the Miyi Chicken, Xingyi Dwarf Chicken, Yunlong Dwarf Chicken, and Japanese Dwarf Chicken. Creeper chickens not only possess unique ornamental and economic value, but as a typical example of a single-gene-determined trait, they are also important model organisms for developmental biology and research on human achondroplasia. However, in actual breeding production, the embryonic lethality associated with this trait leads to low hatchability, inconsistent shank lengths in offspring, and significant differences in individual weight, severely restricting the conservation efficiency and industrialization of local specialty chicken breeds.

[0003] Research on the creeping trait began in the early 20th century, with Landauer and Dunn (1930) proposing that the creeping trait is caused by a dominant semi-lethal gene on an autosome ( Cp Controlled, homozygous lethal embryos ( Cp / Cp Japanese dwarf chickens typically die very early in embryonic development (days 3-4) accompanied by multiple developmental abnormalities in the microvascular, nervous, and digestive systems; while heterozygous individuals (Cp / +) survive but exhibit typical chondrodystrophy characteristics such as short tibia and stunted growth. With the development of high-throughput genomics technology, recent research has confirmed that this leads to... Cp The trait was caused by a mutation that was a large deletion of a genomic segment spanning approximately 25 kb, which also covered the Indian hedgehog factor (…). IHH ) gene and non-homologous end connective 1 ( NHEJ1 ) gene. Due to IHH Signaling pathways play an irreplaceable core regulatory role in the proliferation, differentiation, and bone formation of vertebrate chondrocytes. Haploid deficiency in their expression levels directly leads to impaired chondrogenesis and limb shortening in heterozygous (Cp / +) chondrocytes. On the other hand... NHEJ1 It plays an indispensable role in the cellular DNA double-strand break repair pathway, especially during the rapid cell division stage in early embryonic development. NHEJ1 The complete loss of DNA (homozygous state) triggers the collapse of DNA repair mechanisms and systemic apoptosis, which is precisely... Cp / Cp Homozygous individuals exhibit early lethal molecular factors before skeletal development.

[0004] The Miyi chicken, originating from Miyi County, Panzhihua City, Sichuan Province, is a valuable poultry genetic resource in my country and has been included in the "National List of Livestock and Poultry Genetic Resources." In the breeding and industrial promotion of the Miyi chicken, the dominant half-lethal effect associated with the crawling trait has become a core bottleneck restricting the expansion of its population. Due to... Cp The presence of genes has led to long-term problems for Miyi chickens during the breeding process, such as low embryo hatching rate, poor uniformity of chick shank length, and a high proportion of weak chicks.

[0005] Currently, DNA molecular markers and diagnostic primers for the creeping trait of Xingyi dwarf chickens have been developed (Chinese invention patent application number CN201610144985.4). This technical solution is based on... IHH A PCR detection system was designed for single-gene deletion (approximately 11.9 kb). Additionally, a three-primer multiplex PCR detection technology for Yunlong dwarf chickens (Chinese patent application CN202410505278.8) was developed, based on primers designed for the deletion and inversion complex structure of Yunlong dwarf chickens. However, using Miyi chicken genomic DNA as a template, various PCR amplification conditions, including those published by Jin et al. and optimized conditions, were used to test diagnostic primers for Xingyi dwarf chickens, but none yielded the expected specific amplification combination suitable for Miyi chicken genotyping. Comparative analysis of primer binding regions and breakpoint sequences further indicated substantial differences between Miyi and Xingyi dwarf chickens in deletion breakpoints, inversion structures, and corresponding primer binding sequences. Existing Xingyi dwarf chicken primers cannot form the specific amplification combination required by the original detection system on the Miyi chicken genome. Similarly, molecular marker technology for Yunlong dwarf chickens cannot be directly applied to Miyi chickens, as there are breed-specific differences in the nucleotide sequences of deletion breakpoints, inversion fragments, and primer binding regions between the two.

[0006] To reveal the underlying genetic characteristics of the crawling trait in Miyi chickens, Sanger sequencing was performed on crawling (Cp / +) and normal (+ / +) individuals. The results showed that the crawling trait also exists on chromosome 7 of Miyi chickens. IHH and NHEJ1 A complex structural variation in the gene was observed. Specifically, it manifested as two large, discontinuous deletions (with deletion lengths of approximately 13,472 bp and 11,560 bp, respectively, for a total deletion length of approximately 25,032 bp), and an inversion of a 672 bp genomic sequence located between the two deletions. This structural variation, confirmed by sequencing results, identified a molecular genetic marker for the crawling trait and early embryonic lethality in Miyi chickens.

[0007] High-resolution melting (HRM) analysis is a technique that, after PCR amplification, uses saturated double-stranded DNA bound to a fluorescent dye to continuously monitor the fluorescence signal changes of the amplified products as they melt with increasing temperature. Sequence variation identification and genotyping are then performed based on the melting curve morphology and melting temperature differences. Compared to conventional PCR amplification followed by agarose gel electrophoresis, HRM allows for sequential amplification and melting analysis within the same reaction tube, eliminating the need for opening the tube, gel preparation, and electrophoretic separation. This reduces the risk of cross-contamination of amplified products, shortens the detection process, and facilitates objective and automated genotyping of large batches of samples on multi-well plate platforms. However, the resolution of HRM is affected by factors such as amplified fragment length and GC content, primer specificity, DNA quality and concentration, fluorescent dye, and instrument temperature resolution. Therefore, establishing a dedicated primer system and standardized reaction conditions that can stably distinguish different genotypes for specific structural variations in Miyi chickens is crucial for applying this technology to Miyi chicken breeding detection.

[0008] Therefore, it is necessary to develop a method based on the unique characteristics of Miyi chicken. IHH and NHEJ1 The HRM precise typing method for large fragment combined with missing regions is of great practical significance for optimizing the breeding program of Miyi chickens at the molecular level, accurately removing lethal embryos, improving the reproductive efficiency of the population, and promoting the sustainable utilization of local high-quality breeding stock. Summary of the Invention

[0009] The purpose of this invention is to overcome the shortcomings of the prior art and provide a specific primer set for HRM identification of creeping traits and early embryonic lethal genotypes in Miyi chickens.

[0010] Another objective of this invention is to provide a kit for identifying the crawling trait and early embryonic lethal genotype of Miyi chickens based on HRM technology.

[0011] Another object of the present invention is to provide an HRM method for accurately identifying the normal (+ / +), creeping (Cp / +), and homozygous lethal (Cp / Cp) phenotypes of Miyi chickens.

[0012] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a DNA molecular marker associated with the crawling trait and early embryonic lethality of the Miyi chicken. The DNA molecular marker consists of two discontinuous deletions on chromosome 7 of the Miyi chicken, with lengths of 13,472 bp and 11,560 bp respectively, for a total deletion length of 25,032 bp. The deleted regions simultaneously cover… IHH Genes and NHEJ1In addition to the deletion described above, the mutant allele also has an inversion in the 672 bp segment between the two deleted segments, compared to the wild-type allele.

[0013] This DNA molecular marker is the genomic target identified by the HRM detection system of this invention. The sequence differences between its mutant alleles and wild-type alleles provide a molecular basis for HRM typing.

[0014] Preferably, the deletions and inversions are based on the Gallus gallus GRCg6a reference genome version, and the breakpoint connection sequences of its mutant alleles are shown in SEQ ID NO:5.

[0015] Secondly, the present invention provides a specific primer set for HRM identification of the crawling trait and early embryonic lethal genotype in Miyi chickens, the primer set consisting of three primers: The upstream primer MY-qF2 used for HRM analysis has the nucleotide sequence shown in SEQ ID NO:6; The upstream primer MY-qF3 used for HRM analysis has the nucleotide sequence shown in SEQ ID NO:7; The downstream primer MY-qR1 used for HRM analysis has the nucleotide sequence shown in SEQ ID NO:8.

[0016] The primer set was designed as follows: MY-qF2 and MY-qR1 were paired to amplify the mutant allele fragment, producing a 100 bp amplification product. The amplified region spanned the new breakpoint connection sequences formed by deletions and inversions. MY-qF3 and MY-qR1 were paired to amplify the wild-type allele fragment, producing a 161 bp amplification product. In the mutant allele, due to the deletion of two segments and the inversion of the middle 672 bp segment, the binding region of the MY-qF2 primer was pulled closer to MY-qR1, thus specifically amplifying the short fragment. In the wild-type allele, the amplification direction of MY-qF2 was consistent with MY-qR1, resulting in ineffective amplification; only the pairing of MY-qF3 and MY-qR1 amplified the longer fragment. In heterozygous (Cp / +) samples, both alleles coexist, and the PCR reaction forms a mixed system containing amplification products of different lengths and their heteroduplexes. This results in unique melting curve characteristics in HRM analysis, thus clearly distinguishing them from the two homozygous (+ / + and Cp / Cp) samples.

[0017] Preferably, the amplification products of primers MY-qF2 and MY-qR1 have the nucleotide sequence shown in SEQ ID NO:15; and the amplification products of primers MY-qF3 and MY-qR1 have the nucleotide sequence shown in SEQ ID NO:16.

[0018] Thirdly, the present invention provides an HRM identification kit for creeping traits and early embryonic lethal genotypes in Miyi chickens, comprising the specific primer set described in the second aspect.

[0019] Furthermore, the HRM identification kit also includes a saturated fluorescent dye and PCR amplification reagents.

[0020] Preferably, the saturated fluorescent dye is EvaGreen dye.

[0021] Furthermore, the HRM identification kit also includes: Genomic DNA extraction reagent comprising an alkaline lysis buffer (25 mmol / L NaOH, 0.2 mmol / L EDTA, pH 12.0) and a neutralization solution (40 mmol / L Tris-HCl, pH 5.0). The standard control includes a positive control of Miyi chicken genomic DNA with a known genotype of creeping heterozygote Cp / +, a negative control of Miyi chicken genomic DNA with a known genotype of normal + / +, and a blank control of ddH2O without nuclease.

[0022] Fourthly, this invention provides an HRM method for accurately identifying the normal (+ / +), creeping (Cp / +), and homozygous lethal (Cp / Cp) phenotypes in Miyi chickens, comprising the following steps: 1) Extract genomic DNA from the Miyi chicken samples to be tested; 2) Using the genomic DNA of the sample to be tested as a template, quantitative real-time PCR amplification was performed in a reaction system containing saturated fluorescent dye using the HRM-specific primer set described in the second aspect. 3) After amplification, high-resolution melting curve analysis is performed on the amplification products, and the genotype of the individual to be tested is determined based on the differences in the melting curves.

[0023] Preferably, the Miyi chicken sample to be tested in step 1) includes blood, body tissue, or early embryonic tissue.

[0024] Preferably, the extraction of genomic DNA in step 1) is performed using the HOTSHOT method, which specifically includes: adding alkaline lysis buffer to an EP tube, adding a small amount of sample, vortexing to mix, incubating at 95°C for 20 min, adding neutralization solution, mixing, centrifuging, and taking the supernatant to obtain genomic DNA.

[0025] Preferably, the reaction system for the real-time PCR amplification in step 2) is as follows: 2 μL of Miyi chicken genomic DNA, 0.4 μL of high-fidelity DNA polymerase, 10 μL of 2× reaction buffer, 1 μL of EvaGreen dye, 0.4 μL each of primers MY-qF2, MY-qF3, and MY-qR1 at a concentration of 10 pmol / μL, and ddH2O to bring the total volume to 20 μL.

[0026] Preferably, the amplification program for the real-time PCR amplification in step 2) is as follows: pre-denaturation at 94℃ for 1 min; denaturation at 98℃ for 10 sec, annealing at 58℃ for 5 sec, extension at 68℃ for 16 sec, and collection of amplified fluorescence signals during the extension phase, for a total of 40 cycles.

[0027] Preferably, the procedure for high-resolution melting curve analysis in step 3) is as follows: denature at 95°C for 1 min, then cool down to 50°C and hold for 1 min to allow the amplified product to fully anneal and form heteroduplexes; then gradually increase the temperature from 70°C to 95°C in increments of 0.2°C, holding each increment for 5 sec, and continuously collect fluorescence signals during this heating process to plot a high-resolution melting curve.

[0028] Preferably, step 3) of determining the genotype of the individual to be tested based on the difference in melting curves includes the following steps: (1) Data normalization: The low-temperature fluorescence plateau region before melting was selected as the 100% fluorescence baseline, and the plateau region after complete double-strand dissociation was selected as the 0% fluorescence baseline. The fluorescence values ​​of each sample were scaled proportionally to the 0~100% range to generate normalized melting curves. (2) Generate a relative difference spectrum: Using the known Cp / + creeping sample as a reference, subtract the reference curve from the normalized curve of all tested samples to generate a difference spectrum with temperature as the abscissa and fluorescence relative difference change as the ordinate. (3) Clustering and typing: Clustering analysis is performed based on the morphological characteristics and changing trends of the curves of each sample in the differential map. The genotype of the sample to be tested is determined by comparing it with the control samples with known genotypes of + / +, Cp / + and Cp / Cp.

[0029] This HRM method uses Miyi chicken genomic DNA as a template and performs closed-tube amplification in a reaction system containing EvaGreen saturated fluorescent dye. After amplification, a high-resolution melting program is run continuously. By normalizing the melting curves and generating relative difference maps using known Cp / + samples as a reference, and by clustering the test samples with known Cp / Cp, Cp / +, and + / + genotype control samples, the genotype can be determined based on whether the test sample clusters with the corresponding control. This method eliminates the need for opening the cap and conventional agarose gel electrophoresis, enabling rapid genotyping of the three genotypes.

[0030] Fifthly, the present invention provides the application of the DNA molecular markers described in the first aspect or the specific primer sets described in the second aspect in the preparation of products for molecular marker-assisted breeding of Miyi chickens, products for germplasm resource identification, or products for constructing animal models of crawling traits of Miyi chickens.

[0031] In a sixth aspect, the present invention provides the application of the HRM detection kit described in the third aspect in the preparation of products for molecular marker-assisted breeding of Miyi chickens or products for germplasm resource identification.

[0032] Compared with the prior art, the advantages of this invention are as follows: (1) This invention is the first to target the 25 kb dual-gene combined deletion (coverage) unique to Miyi chicken. IHH and NHEJ1 Based on the 672bp inversion complex structural variation, a dedicated HRM typing primer set and detection method were developed. This primer set (MY-qF2, MY-qF3, MY-qR1) is designed based on the breakpoint connection sequence specific to Miyi chickens, and can simultaneously identify wild-type and mutant alleles in a single reaction tube, exhibiting high breed specificity and detection accuracy.

[0033] (2) The HRM method provided by the present invention is a closed-tube operation. PCR amplification and melting analysis are completed continuously in the same reaction tube without opening the cap, gel preparation and electrophoresis separation, which effectively avoids aerosol contamination of PCR products and significantly reduces the risk of false positives.

[0034] (3) The method of the present invention is simple to operate and has a high detection throughput. It can perform parallel detection of large-scale samples on 96-well or 384-well plates. Combined with an automated data analysis process, it can achieve objective and standardized determination of genotypes, which is very suitable for large-scale screening of the core breeding population of Miyi chicken.

[0035] (4) This invention can complete the genotyping of embryos in the early stage of incubation (60 h embryonic age) without relying on phenotype, accurately distinguishing between normal type (+ / +), creeping type (Cp / +) and homozygous lethal type (Cp / Cp), providing a reliable technical means for the scientific selection of Miyi chickens, helping to effectively eliminate lethal genes in the population, reduce the probability of Cp / Cp lethal embryos, and improve the hatching rate and reproductive efficiency of the population. Attached Figure Description

[0036] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are used to explain the invention, but do not constitute an undue limitation of the invention. In the drawings: Figure 1 This is a schematic diagram illustrating the principle of dual-gene combined deletion mutation and three-primer PCR typing of the crawling trait in Miyi chickens in Example 1 of the present invention. A shows the genomic structure and primer binding positions of the wild-type (+) alleles; B shows the deletion and inversion of the mutant (Cp) compared to the wild-type.

[0037] Figure 2 The electrophoretic detection results of the extraction of the Miyi chicken genome using the HOTSHOT method in Example 1 of this invention, and the amplification using a three-primer PCR system (MY-F3, MY-R1, MY-F2), show characteristic bands of three genotypes (+ / +, Cp / +, Cp / Cp).

[0038] Figure 3 The electrophoretic detection results of early lethal gene screening in Miyi chicken embryos in Example 2 of this invention show that Cp / + heterozygous embryos were detected in the offspring of phenotypically normal parents; where M is the DL2000 DNA Marker. Cp / Cp The Cp / + group showed lethal bands (366 bp); the Cp / + group showed creeping bands (502 bp and 366 bp); and the + / + group showed normal bands (502 bp).

[0039] Figure 4 The above is a melting curve diagram of three different genotypes of Miyi chicken identified by HRM technology in Example 4 of the present invention; wherein, A is the raw fluorescence melting curve, and B is the relative change in difference (ΔHelicity%). The diagram shows that the three genotype samples (Cp / Cp, Cp / +, + / +) form three clearly defined and non-overlapping differential groups.

[0040] Figure 5The electrophoretic detection results for PCR amplification of the Miyi chicken genome using existing Xingyi dwarf chicken diagnostic primers in Comparative Example 1 of this invention are shown below. M represents the DL2000 DNA Marker, Cp / + group represents the crawling type of Miyi chicken, and + / + group represents the normal type of Miyi chicken. According to the system disclosed by Jin et al., the expected amplification products for the mutant and wild types are 224 bp and 438 bp, respectively. No specific bands suitable for genotyping were obtained in the Miyi chicken samples, and non-specific amplification bands were observed. Detailed Implementation

[0041] In this embodiment of the invention, all primer synthesis and sequencing were outsourced to commercial companies.

[0042] In the description of this invention, it should be noted that unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0043] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0044] Example 1: Obtaining DNA molecular markers associated with crawling traits and early embryonic lethality in Miyi chickens This embodiment provides the acquisition and verification of DNA molecular markers and primers related to the crawling trait and early embryonic lethality of Miyi chickens, as detailed below: 1.1 Experimental Materials The rearing and sample collection of Miyi chickens were completed at the Miyi Breeding Experimental Base. Blood was collected using EDTA anticoagulant blood collection tubes. Individual Miyi chickens (including suspected creeping and suspected normal types) were selected based on preliminary traditional morphological identification (shank length and body shape). Simultaneously, a creeping Miyi chicken breeding pedigree (i.e., creeping rooster × creeping hen) was constructed, fertilized eggs were collected for artificial incubation, and dead embryos in the early incubation period were selected. Blood and dead embryo tissue samples were collected from the aforementioned Miyi chickens.

[0045] To confirm the breakpoint sequence of the mutant allele in Miyi chicken, genomic DNA was first extracted from relevant samples using the SteadyPure universal genomic DNA extraction kit before verification with the multiplex PCR primer system of this invention. Following the method of Kinoshita (2020), specific primers DE_fd3 (TTCGTTTTCTGGCAACATGCAGCTCC, SEQ ID NO:13) and IJ_delrv5 (AAGCACTTGGCCTGTCAACATCCCTG, SEQ ID NO:14) were used to amplify the breakpoint region of the mutant allele, and the amplified products were then subjected to Sanger sequencing. This step was used to obtain and confirm the breakpoint region sequence of the mutant allele in Miyi chicken, and is not intended as an independent genotyping method to distinguish between Cp / + and Cp / Cp genotypes. Based on the sample phenotype, embryo origin, and molecular detection results, early dead embryo samples from Miyi chickens with known genotypes (normal (+ / +), creeping (Cp / +), and homozygous lethal (Cp / Cp) were selected as standard controls for the subsequent three-primer multiplex PCR system.

[0046] 1.2 Genomic DNA Extraction and Detection Genomic DNA was extracted from blood or embryonic tissue using the HOTSHOT method, and the steps are as follows: (1) Add 80 μL of alkaline lysis buffer (25 mmol / L NaOH, 0.2 mmol / L EDTA, pH 12.0) to each 1.5 mL EP tube. (2) Add 2 μL of fresh blood or a small amount of embryonic tissue to each EP tube and vortex to mix. (3) Incubate at 95℃ for 20 min; (4) After incubation, add 80 μL of neutralization solution (40 mmol / L Tris-HCl, pH 5.0) to the EP tube and mix well; (5) Centrifuge the EP tube at 12000 rpm for 5 min, take the supernatant and place it in a new EP tube. This is the extracted genomic DNA, which can be stored at -20℃ for a long time.

[0047] 1.3 Primer Design and Generating Principles Primers were designed using Primer3Plus. During primer design, hairpin structures, primer dimers, and mismatches were avoided to optimize the primer sequences. The primer sequences used for amplification are as follows: MY-F3: 5′-ACAGGTTTTGCAGGGAGGAC-3′ (SEQ ID NO: 1), MY-R1: 5′-TAAGCTGACACCTCCGTTGC-3′ (SEQ ID NO: 2), MY-F2: 5′-AACAATGAGGGGCTGGGATG-3′ (SEQ ID NO: 3).

[0048] In wild-type alleles (+) Figure 1 A), primer MY-F2 is aligned with MY-R1, failing to generate effective amplification; only primer MY-F3 paired with MY-R1 to amplify a 502 bp fragment; while in the mutant allele ( Cp )middle( Figure 1 B) Due to the deletion of two fragments and the inversion of the middle 672 bp fragment, the MY-F2 primer binding to this region is flipped and pulled closer to MY-R1, thereby specifically amplifying the 366 bp target fragment that crosses the breakpoint.

[0049] 1.4 Experimental Methods Using the genomic DNA extracted by the above method as a template, multiplex PCR amplification was performed in the same reaction tube using the above three primers.

[0050] PCR reaction system (10.0 μL): 1 μL of Miyi chicken genomic DNA, 5 μL of KOD One PCR Master Mix, 0.2 μL each of primers MY-F2, MY-F3, and MY-R1 at a concentration of 10 pmol / μL, and ddH2O to bring the total volume to 10 μL.

[0051] PCR reaction conditions: 98℃ pre-denaturation for 1 min; 98℃ denaturation for 10 sec, 58℃ annealing for 5 sec, 68℃ extension for 5 sec, for a total of 30 cycles; 68℃ extension for 5 min; store at 4℃ for later use.

[0052] Electrophoresis detection and sequencing verification: Prepare a 1.5% agarose gel and perform electrophoresis detection at 120 V for 20 min.

[0053] 1.5 Experimental Results PCR amplification products such as Figure 2 As shown, the specific amplified band representing the wild-type allele (+) is 502 bp in size, and its nucleotide sequence is shown in SEQ ID NO:4; it successfully crossed [the boundary]. IHH and NHEJ1 Mutant alleles with two deletion breakpoints of 25 kb between genes ( Cp The amplified band size was 366 bp, and its nucleotide sequence is shown in SEQ ID NO:5.

[0054] SEQ ID NO: 4 (MY-F3 / R1 amplification product, 502 bp): 5'-ACAGGTTTTGCAGGGAGGACGGGGAAGGCAAAGGTGGTGGCAGAGGGAAGAGCTGCAAATGGTCAATAAGCAATCAAACGATGATCTTGGTCCAAGCCCCCCATCCGTGCTCATCATCCCGAAGAGAGCTGGAACAGGGCTGAAATGCAGCCAGCAGTAAGGAAATGGCATCCGAAGCCTCCAGGGCATTGGGTTTTGAAGAGGTCACTGATCCTGAAGAAGGTGAAGGGGACGTCTGGGCACGGACGCCGTGCACACAGCGGCCCCAGCACAGAATGGAGGGAAGTGTGGGAACGGAGGGGCTGTGCCTTATTGCAGGGGGGGCTCTGCAGCAGCGATGGGGGCAGTCCCTCACCGGCGGGCACAGGCGCAGAGCGGTCTGTGCTGAGCCAACACTCCAGGAATTTAATTTGTTTAATATATTCCCTGGGAAAGAAGAAAATAAATAAGTGGCACCTTGCGTGCCCCCATGGCTCACTCTCGCAACGGAGGTGTCAGCTTA-3'.

[0055] SEQ ID NO: 5 (MY-F2 / R1 amplification product, 366 bp): 5′-AACAATGAGGGGCTTCCCCTTCTAGCTGCCAAAAGGGGAAAGTAAATACAACACCCTGATTTCAGGAGCGAGGGTTCGCGGGGCCCCCCTGAGTCTCCCCCAGCTGCATGCCGGGGAAGGGGTCCGGCTGCACTCTGCCTGCACCCCTGCAAGTTCCCTGTGGCCTTCCCAGG TGAGGCAGCACCTCGGGACGGCCCTACGCACACCGCCTCGGCCGGGACGTCCCCTCACATCCCTCGGGTGGGCACACGGGAGGAATTTAATTTGTTTAATATATTCCCTGGGAAAGAAGAAAATAAATAAGTGGCACCTTGCGTGCCCCCATGGCTCACTCTCGCAACGGAGGTGTCAGCTTA-3′.

[0056] The genotype determination criteria are as follows: Normal type (+ / +): only a single band of 502 bp was detected; Creeping type carrying the lethal gene (Cp / +): both 502 bp and 366 bp bands were detected simultaneously; Lethal type ( Cp / Cp ): Under conditions where PCR amplification was effective and the control system was amplified normally, only a single band of 366 bp was detected.

[0057] The above results indicate that the three-primer PCR system provided by this invention can accurately distinguish the three genotypes of Miyi chicken in a single reaction tube.

[0058] Example 2: Early screening of lethal genes in Miyi chicken embryos This embodiment utilizes the molecular markers from Example 1 for early screening of lethal genes in Miyi chicken embryos, as detailed below: 2.1 Experimental Objective In actual Miyi chicken breeding production, some heterozygotes (Cp / +) carrying lethal genes may exhibit extremely mild short-legged phenotypic characteristics due to differences in genetic background, environmental factors, or developmental delays. These individuals are easily misjudged as normal (+ / +) during artificial morphological screening, thus incorrectly mixing them into the pure breeding core population, leading to continued embryonic death in subsequent breeding. This embodiment aims to verify the accuracy and necessity of this invention in correcting phenotypic misjudgments and purifying the core breeding population by conducting early detection on artificially identified suspected pure wild-type hatching eggs.

[0059] 2.2 Experimental Materials At the Miyi Chicken Core Breeding Farm, experienced breeders selected a group of roosters and hens identified as having normal high-legged (+ / +) characteristics using traditional morphological methods, such as visual observation of shank length and body shape, to form a breeding flock. Fertilized eggs from this flock were randomly collected for artificial incubation. After 60 hours of incubation, 62 early-developing chicken embryo tissue samples were blindly drawn as test materials.

[0060] 2.3 Experimental Methods Rapid genomic DNA extraction was performed from a small amount of chicken embryo tissue using the HOTSHOT method described in 1.2 of Example 1. Using this DNA as a template, amplification was performed using the three-primer PCR system of this invention (primers MY-F3, MY-R1, and MY-F2, i.e., SEQ ID NO: 1-3). The PCR reaction system and amplification procedure were strictly consistent with those described in 1.4 of Example 1. The amplification products were detected by electrophoresis on a 1.5% agarose gel.

[0061] 2.4 Experimental Results and Analysis The results of agarose gel electrophoresis of PCR products are as follows: Figure 3 As shown. Theoretically, if the parents are pure normal type (+ / +), their offspring chicken embryos should amplify a single 502 bp target band in 100% of cases. However, the electrophoresis results showed that although the vast majority of chicken embryo samples amplified only one normal type target band of 502 bp as expected, three samples amplified two target bands simultaneously: one 502 bp and the other 366 bp. This proves at the molecular level that these three embryos are creeping heterozygotes (Cp / +) carrying a lethal gene.

[0062] To verify the blind genotyping results, as described in 1.1 of Example 1, the three heterozygous samples identified were amplified with mutant allele breakpoint regions and sequenced using specific primers DE_fd3 and IJ_delrv5. Two normal samples were randomly selected as negative controls for repeated multiplex PCR detection using the three primers of this invention. The three samples identified as heterozygous by electrophoresis all yielded mutant allele breakpoint region sequences. The multiplex PCR results of the two normal control samples remained positive / positive, consistent with the blind test results.

[0063] The presence of Cp / + heterozygotes in the offspring confirms the existence of heterozygous individuals in the artificially selected normal parent population that were missed due to incomplete penetrance or mild phenotype. Relying solely on traditional morphology cannot completely purify the core breeding population of Miyi chickens. The dual-gene combined deletion molecular marker of this invention is unaffected by developmental stage and phenotypic expression. Using this technology for pre-population screening can accurately detect misidentified heterozygotes, providing a reliable means to completely eliminate lethal genes from the population and achieve scientific breeding of Miyi chickens. Combined with the HOTSHOT extraction method, this invention successfully achieves efficient and stable amplification of chicken embryos incubated for only 60 hours, significantly advancing the genotype screening window and greatly saving the time and space costs of ineffective incubation.

[0064] This result confirms that the 25 kb dual-gene deletion molecular marker provided by this invention is a proprietary technical solution for accurately locating the unique genetic background of the Miyi chicken. It can be stably and effectively applied as a highly specific, hybridization-free molecular diagnostic tool for genotyping and pedigree construction in the core breeding population of Miyi chickens.

[0065] Example 3: HRM primer design and reaction system optimization This embodiment provides a method for typing the crawling trait of Miyi chickens based on high-resolution melting curve (HRM) technology, as detailed below: 3.1 Experimental Objective While conventional PCR combined with agarose gel electrophoresis is accurate, it has limitations such as cumbersome operation and susceptibility to contamination upon opening the gel. Therefore, based on the aforementioned research results, this embodiment further develops a closed-tube typing method based on high-resolution melting curve (HRM) technology and further optimizes primer design to achieve rapid and automated identification of Miyi chicken samples.

[0066] 3.2 Primer Design and Experimental Materials Three specific primers suitable for qPCR short fragment amplification were designed and optimized using Primer3Plus. During primer design, hairpin structures, primer dimers, and mismatches were avoided as much as possible to optimize the primer sequences. The primer sequences used for amplification are as follows: MY-qF2: 5′-GACGTCCCCTCACATCCCTC-3′ (SEQ ID NO: 6); MY-qF3: 5′-TGTGCCTTATTGCAGGGG-3′ (SEQ ID NO:7); MY-qR1: 5'-CACGCAAGGTGCCACTTATTT-3' (SEQ ID NO: 8).

[0067] Among them, MY-qF2 and MY-qR1 were paired to amplify the mutant allele fragment, and the amplification product was 100 bp in length, and its nucleotide sequence is shown in SEQ ID NO:15; MY-qF3 and MY-qR1 were paired to amplify the wild-type allele fragment, and the amplification product was 161 bp in length, and its nucleotide sequence is shown in SEQ ID NO:16.

[0068] The amplification product sequence of MY-qF2 / qR1 is 100bp: GACGTCCCCTCACATCCCTCGGGTGGGCACACGGGAGGAATTTAATTTGTTTAATATATTCCCTGGGAAAGAAGAAAATAAATAAGTGGCACCTTGCGTG (SEQ ID NO: 15); The amplification product sequence of MY-qF3 / qR1 is 161 bp: TGTGCCTTATTGCAGGGGGGGCTCTGCAGCAGCGATGGGGGCAGTCCCTCACCGGCGGGCACAGGCGCAGAGCGGTCTGTGCTGAGCCAACACTCCAGGAATTTAATTTGTTTAATATATTCCCTGGGAAAGAAGAAAATAAATAAGTGGCACCTTGCGTG (SEQ ID NO: 16).

[0069] In the mutant allele, due to the deletion of two segments and the inversion of the middle 672 bp segment, the binding region of the MY-qF2 primer is pulled closer to MY-qR1, thus specifically amplifying a short fragment of 100 bp. In the wild-type allele, the orientation of the MY-qF2 primer is consistent with MY-qR1, failing to form effective amplification; only MY-qF3 pairs with MY-qR1 to amplify a long fragment of 161 bp. In heterozygous (Cp / +) samples, both amplification products coexist, and the PCR product contains a mixture of homoduplex and heteroduplex, exhibiting intermediate melting curve characteristics in HRM analysis.

[0070] 3.3 Experimental Methods Six genomic DNA samples of Miyi chickens with known genotypes were selected, including two Cp / Cp early dead embryo samples, two Cp / + creeping individual samples, and two + / + normal individual samples; among them, the breakpoint region sequences of mutant alleles were confirmed by Sanger sequencing.

[0071] Using the above gDNA as a template, the above three primers were placed in the same reaction tube and amplified using a Bio-Rad CFXConnect real-time quantitative PCR instrument. Data were collected using Bio-Rad CFX Manager software.

[0072] qPCR reaction system: 2 μL of Miyi chicken genomic DNA, ApexHF HS DNA Polymerase CL 0.4μL, 2× ApexHF 10 μL of CL Buffer, 1 μL of Biotium EvaGreen dye, 0.4 μL each of primers MY-qF2, MY-qF3, and MY-qR1 at a concentration of 10 pmol / μL, and ddH2O to bring the total volume to 20 μL.

[0073] qPCR reaction conditions: 94℃ pre-denaturation for 1 min; 98℃ denaturation for 10 sec, 58℃ annealing for 5 sec, and 68℃ extension for 16 sec, with fluorescence signals collected during the extension phase, for a total of 40 cycles. After amplification, denaturation was performed at 95℃ for 1 min, followed by cooling to 50℃ and holding for 1 min to promote sufficient annealing of the amplified products and formation of heteroduplexes. For high-resolution melting (HRM) analysis, the temperature was gradually increased from 70℃ to 95℃ in 0.2℃ increments, with each increment lasting 5 sec. Fluorescence signals were continuously collected during this temperature increase to plot high-resolution melting curves.

[0074] 3.4 Experimental Results and Analysis The collected HRM fluorescence data were processed and analyzed. Data processing and genotyping steps included: (1) Data normalization: In the analysis software, the low-temperature fluorescence plateau region before melting is about to occur is selected as the 100% fluorescence baseline, and the plateau region after the double strand is completely defused is selected as the 0% fluorescence baseline. The fluorescence values ​​of each sample curve are scaled proportionally to the 0~100% range to generate normalized melting curves. (2) Generation of relative difference map: Select a known Cp / + creeping sample as a reference, subtract the reference curve from the normalization curve of all tested samples, and generate a difference map with temperature as the abscissa and fluorescence relative difference change as the ordinate to amplify the melting characteristic differences between different genotypes. (3) Clustering: Cluster analysis is performed based on the morphological characteristics and changing trends of the curves of each sample in the difference map to complete automatic classification.

[0075] Alternatively, the above data analysis and clustering process can also be completed using professional HRM analysis software (such as Bio-RadPrecision Melt Analysis software), or the exported data files can be uploaded to a high-resolution melting analysis online tool (such as uAnalyze website) for rapid automated processing.

[0076] Taking the processing of collected fluorescence data using the uAnalyze website as an example, the results are as follows: Figure 4 As shown, in the raw fluorescence melting curves and relative difference maps (ΔHelicity % vs. Reference), samples of the three different genotypes exhibited different melting kinetic characteristics. The software categorized all test samples into three independent clusters; by comparing with control samples of known Cp / Cp, Cp / +, and + / + genotypes, the genotype corresponding to each cluster could be determined. Two independent samples of the same genotype showed consistent curves within their respective groups, and no cross-clustering occurred among the three genotypes, indicating that under the reaction and analytical conditions disclosed in this embodiment, the HRM system can reliably distinguish between the Cp / Cp, Cp / +, and + / + genotypes.

[0077] The HRM genotyping technology developed in this embodiment uses a closed-tube operation throughout the reaction, eliminating the need for subsequent agarose gel electrophoresis. This not only effectively avoids aerosol contamination of PCR products but also shortens the detection time, making it suitable for early lethal gene screening during core colony establishment.

[0078] Example 4: Assembly of HRM Detection Kit This embodiment provides the assembly scheme and usage method of the HRM identification kit for crawling traits and early embryonic lethal genotypes in Miyi chickens.

[0079] 4.1 Components of the reagent kit Assemble the Miyi Chicken Crawling Trait and Early Embryonic Lethal Genotype HRM Identification Kit (50-reaction specification) according to the following formula: (1) DNA extraction reagent (stored in a sealed container at room temperature): Place 5 mL of alkaline lysis buffer (formulation: 25 mmol / L NaOH, 0.2 mmol / L EDTA, pH 12.0) in a separate reagent tube.

[0080] Place 5 mL of neutralization reagent (formulation: 40 mmol / L Tris-HCl, pH 5.0) in a separate reagent tube.

[0081] (2) HRM specific primers (stored at -20℃): contains three individually dispensed tubes of specific primers, each with a working concentration of 10 pmol / μL.

[0082] Primer MY-qF2 (SEQ ID NO:6): 20 μL / tube.

[0083] Primer MY-qF3 (SEQ ID NO:7): 20 μL / tube.

[0084] Primer MY-qR1 (SEQ ID NO:8): 20 μL / tube.

[0085] (3) HRM amplification premix (stored at -20℃): 1 mL of 2× reaction premix containing high-fidelity DNA polymerase, dNTPs mixture, MgCl2 and PCR reaction buffer was dispensed into 5 tubes (200 μL / tube).

[0086] (4) EvaGreen saturated fluorescent dye (stored at -20℃ protected from light): 50 μL / tube.

[0087] (5) Standard reference material (stored at -20℃): Positive control (Cp / +): Genomic DNA of Miyi chickens with a known genotype of creeping heterozygote, at a concentration of 50 ng / μL, 20 μL / tube; Negative control (+ / +): Genomic DNA of Miyi chickens with known normal genotype, at a concentration of 50 ng / μL, 20 μL / tube; Blank control: ddH2O without nuclease, 50 μL / tube.

[0088] (6) Nuclease-free ddH2O (stored at room temperature in a sealed container): 1 mL / tube.

[0089] (7) Instruction manual: 1 copy.

[0090] 4.2 Instructions for using the reagent kit Take samples of the Miyi chickens to be tested (including but not limited to fresh peripheral blood, body tissue, or chicken embryo tissue in the early stages of incubation) and follow the steps below: (1) Genomic DNA extraction: Add 80 μL of alkaline lysis buffer to a 1.5 mL EP tube, add 2 μL of fresh blood sample or a small amount of tissue sample, vortex mix, incubate at 95℃ for 20 min, add 80 μL of neutralization solution, mix, centrifuge at 12,000 rpm for 5 min, and take the supernatant as the genomic DNA template.

[0091] (2) HRM-PCR amplification: Prepare a 20.0 μL reaction system, including: 2 μL genomic DNA template, 10 μL 2× reaction premix, 1 μL EvaGreen dye, 0.4 μL each of primers MY-qF2, MY-qF3, and MY-qR1 (10 pmol / μL), and ddH2O to a final volume of 20 μL. The amplification program was: 94℃ pre-denaturation for 1 min; 98℃ denaturation for 10 sec, 58℃ annealing for 5 sec, and 68℃ extension for 16 sec (acquiring amplified fluorescence signals), for a total of 40 cycles.

[0092] (3) HRM melting analysis: After amplification, denature at 95℃ for 1 min, hold at 50℃ for 1 min, and then increase the temperature from 70℃ to 95℃ in 0.2℃ increments, holding for 5 sec at each increment. Fluorescence signals are continuously collected and melting curves are plotted.

[0093] (4) Genotype determination: The melting curve data are normalized and a relative difference map is generated with the Cp / + positive control provided by the kit as a reference. The curve of the test sample is clustered and compared with the curves of the three standard controls (+ / +, Cp / +, Cp / Cp) to determine the genotype of the test sample.

[0094] Each test should include a positive control, a negative control, and a blank control to ensure the reliability of the test results.

[0095] Example 5: HRM screening for early embryo lethal genes in Miyi chickens In this embodiment, the DNA molecular markers associated with the crawling trait and early embryonic lethality of Miyi chickens in Example 1, as well as the HRM screening system established in Examples 3 and 4, were used to screen for lethal genes in early embryos of Miyi chickens.

[0096] 5.1 Experimental Objective In actual Miyi chicken breeding production, some heterozygotes (Cp / +) carrying lethal genes may exhibit extremely mild short-legged phenotypic characteristics due to differences in genetic background, environmental factors, or developmental delays. These individuals are easily misjudged as normal (+ / +) during artificial morphological selection, thus incorrectly mixing them into the pure breeding core population, leading to continued embryonic death in subsequent breeding. This embodiment aims to verify the accuracy and necessity of this invention in correcting phenotypic misjudgments and purifying the core breeding population by conducting early HRM testing on artificially identified suspected pure wild-type hatching eggs.

[0097] 5.2 Experimental Materials Sixty-two early-stage chicken embryo tissue samples from Example 2 were used as the test materials.

[0098] 5.3 Experimental Methods Rapid genomic DNA extraction from trace amounts of chicken embryo tissue was performed using the HOTSHOT method. The specific steps were as follows: 80 μL of alkaline lysis buffer (25 mmol / L NaOH, 0.2 mmol / L EDTA, pH 12.0) was added to a 1.5 mL EP tube, followed by 2 μL of embryo tissue. After vortexing, the mixture was incubated at 95°C for 20 min. Then, 80 μL of neutralization solution (40 mmol / L Tris-HCl, pH 5.0) was added, and the mixture was centrifuged at 12,000 rpm for 5 min. The supernatant was collected as the genomic DNA template. Using this DNA as a template, amplification and melting curve analysis were performed using the HRM system established in Example 3. The HRM reaction system and amplification procedure were strictly consistent with section 3.3 of Example 3.

[0099] Meanwhile, in order to verify the accuracy of the HRM typing results, the results of amplification and agarose gel electrophoresis of the above 62 samples using the three-primer PCR system (primers MY-F3, MY-R1, MY-F2, i.e. SEQ ID NO:1-3) in Example 2 were used as a reference. The three-primer PCR typing results were compared with the HRM typing results, and the typing consistency of the two methods was statistically analyzed.

[0100] 5.4 Experimental Results and Analysis HRM melting curve analysis showed that among the 62 chicken embryo samples, the melting curves of 59 samples clustered with the + / + normal control and were identified as normal (+ / +); the melting curves of 3 samples clustered with the Cp / + heterozygous control and were identified as creeping heterozygotes (Cp / +).

[0101] The results of the three-primer PCR typing were completely consistent with the results of the HRM typing. Among them, 59 samples were identified as + / + and 3 samples were identified as Cp / +. The overall typing consistency rate of the two methods was 100% (62 / 62). The specific results are shown in Table 1.

[0102] Table 1 Comparison of genotyping results of HRM and three-primer PCR on 62 early-stage chicken embryo samples from Miyi chickens.

[0103] The above results show that the HRM method established in this invention is completely consistent with the three-primer PCR method established in Examples 1 and 2 in the typing results of 62 early chicken embryo samples in this example, indicating that the HRM method can accurately distinguish between + / + and Cp / + genotypes and can be used for rapid screening of Cp-related alleles in early chicken embryos of Miyi chickens.

[0104] The presence of Cp / + heterozygotes in the offspring confirms the existence of heterozygous individuals in the artificially selected normal-type parent population that were missed due to incomplete penetrance or mild phenotype. Traditional morphology alone cannot completely purify the core breeding population of Miyi chickens. The HRM genotyping method of this invention does not depend on the degree of phenotypic expression. Using this technology for pre-population screening can detect misidentified heterozygotes, making it a reliable means of eliminating lethal genes and achieving scientific breeding of Miyi chickens. Combined with the HOTSHOT rapid extraction method, this invention successfully achieves efficient and stable genotyping of chicken embryos incubated for only 60 hours, significantly advancing the genotyping window and greatly saving time and space costs associated with ineffective incubation.

[0105] Comparative Example 1: Applicability evaluation of Xingyi dwarf chicken molecular markers in Miyi chicken population This comparative example evaluated the applicability of Xingyi dwarf chicken molecular markers to the Miyi chicken population, demonstrating that the primer set of this invention was specifically developed for Miyi chickens and has non-obviousness.

[0106] 1.1 Experimental Objective Jin et al. (Jin S, et al. Deletion of Indian hedgehog gene causes dominant semi-lethal Creeper trait in chicken. Sci Rep, 2016, 6:30172.) disclosed a set of DNA molecular markers and diagnostic primers for identifying the creeping trait in Xingyi dwarf chickens. This comparative example aims to test whether the existing primers disclosed in this literature can be universally used to identify the creeping trait phenotype in Miyi chickens.

[0107] 1.2 Experimental Materials and Methods Blood samples were collected from Miyi chickens with well-defined phenotypes (including creeping Cp / + and normal + / +), and genomic DNA was extracted. Existing Xingyi dwarf chicken-specific primer pairs were synthesized: IHH-F: 5′-CTGCCTTGTGCGTTCTCA-3′ (SEQ ID NO:9) IHH-R: 5′-CAGGAAGTCGCTGTAGGTG-3′ (SEQ ID NO:10) delF: 5′-AGCCCCTCATTGTTGTCTCA-3′ (SEQ ID NO:11) delR: 5′-TCGTTAAGCTGACACCTCCG-3′ (SEQ ID NO: 12) Using Miyi chicken genomic DNA as a template, various PCR amplification conditions were employed, including publicly available conditions such as those provided by Jin et al., as well as optimized conditions (annealing temperature gradient 55-65℃, cycle number 25-40, extension time 15-60 sec). The primers described above were used for repeated testing. Amplification products were detected by agarose gel electrophoresis. Simultaneously, the four primers were compared with the corresponding Miyi chicken genomic sequences to evaluate their primer binding regions and expected amplification combinations.

[0108] 1.3 Analysis of Differences Between Experimental Results and Mechanisms Agarose gel electrophoresis results are as follows Figure 5 As shown in the figure, under different PCR amplification conditions tested, no specific bands (i.e., 224 bp for mutant and 438 bp for wild-type) were obtained for the genotyping of Miyi chickens, and non-specific amplification and heterogeneous bands were present. Sequence alignment results showed that the corresponding regions of Miyi chickens differed from those of Xingyi dwarf chickens in terms of deletion breaks, inversion structures, and primer binding sequences, which prevented the primers from forming the expected specific amplification combination required by the original detection system for Xingyi dwarf chickens in the Miyi chicken genome.

[0109] The above experimental and sequence alignment results indicate that although both Miyi chickens and Xingyi dwarf chickens exhibit a "dwarf-legged, creeping" phenotype, their causative structural variations, breakpoint connections, and corresponding primer binding regions are different. Existing primers for Xingyi dwarf chickens cannot form the expected specific amplification combinations for genotyping in Miyi chickens. This inapplicability stems from an inherent mismatch caused by differences in target sequences and structures, and cannot be eliminated simply by adjusting annealing temperature, cycle number, or gel concentration. Therefore, it is necessary to develop dedicated molecular markers and genotyping methods based on the specific structural variations of Miyi chickens. This also verifies the novelty and inventiveness of the primer set and HRM method of this invention.

[0110] Comparative Example 2: Comparative analysis of the HRM primers of this invention with the PCR primer systems established in Examples 1 and 2. To further verify the features and advantages of the HRM technology solution of the present invention, the HRM primer set of the present invention was compared and analyzed with the three-primer PCR system (SEQ ID NO:1-3) designed for the same molecular marker.

[0111] 2.1 Comparison of primer sequences and amplification products The HRM primer set (MY-qF2 / qF3 / qR1, SEQ ID NO:6-8) and the three-primer PCR system (MY-F3 / R1 / F2, SEQ ID NO:1-3) of this invention are both designed for the same complex structural variation region of chromosome 7 of Miyi chicken, but they differ significantly in primer binding position, amplification product length, and detection principle: (1) The PCR primers MY-F3 / MY-R1 amplified the wild-type allele fragment with a length of 502 bp, while MY-F2 / MY-R1 amplified the mutant allele fragment with a length of 366 bp. The difference in product length is large, making it suitable for differentiation by agarose gel electrophoresis.

[0112] (2) The HRM primers MY-qF3 / MY-qR1 amplify the wild-type allele fragment with a length of 161 bp, and MY-qF2 / MY-qR1 amplify the mutant allele fragment with a length of 100 bp. The product length is relatively short and the difference is small (only 61 bp), which is suitable for the requirements of HRM analysis for short fragment amplification, and the typing is achieved by the difference in melting temperature rather than the difference in length.

[0113] 2.2 Comparison of Detection Process and Throughput (1) The PCR method requires amplification followed by agarose gel electrophoresis, including steps such as gel preparation, sample loading, electrophoresis, and imaging. The total time is about 2-3 hours, and the operation requires opening the lid, which poses a risk of cross-contamination.

[0114] (2) The HRM method of the present invention completes amplification and melting analysis under closed tube conditions, with a total time of about 1.5 hours. It does not require opening the cap and electrophoresis, and can realize automated and high-throughput detection. It can complete the typing of nearly 100 samples in one batch on a 96-well plate.

[0115] The above comparison shows that the HRM primer set and detection method of the present invention are further optimizations and upgrades based on PCR, with significant advantages such as simpler operation, faster detection speed, higher throughput and lower risk of contamination, and are suitable for large-scale core population screening application scenarios.

[0116] Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents. The embodiments described above merely illustrate several implementations of the invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the invention, and these all fall within the protection scope of the invention. Therefore, the protection scope of this invention should be determined by the appended claims.

Claims

1. A specific primer set for HRM identification of creeping traits and early embryonic lethal genotypes in Miyi chickens, characterized in that, The primer set consists of three primers: The upstream primer MY-qF2 has the nucleotide sequence shown in SEQ ID NO:6; The upstream primer MY-qF3 has the nucleotide sequence shown in SEQ ID NO:7; The downstream primer MY-qR1 has the nucleotide sequence shown in SEQ ID NO:

8.

2. The specific primer set according to claim 1, characterized in that, The primers MY-qF2 and MY-qR1 are paired to amplify the mutant allele fragment, with an amplification product length of 100 bp; the primers MY-qF3 and MY-qR1 are paired to amplify the wild-type allele fragment, with an amplification product length of 161 bp.

3. An HRM detection kit for accurately identifying the normal (+ / +), creeping (Cp / +) and homozygous lethal (Cp / Cp) genotypes of Miyi chickens, characterized in that, It contains the specific primer set as described in claim 1 or 2.

4. The HRM detection kit according to claim 3, characterized in that, It also contains saturated fluorescent dyes and PCR amplification reagents.

5. The HRM detection kit according to claim 4, characterized in that, Also includes: Genomic DNA extraction reagent, wherein the extraction reagent comprises an alkaline lysis buffer and a neutralization solution; The standard control includes a positive control of Miyi chicken genomic DNA with a known genotype of creeping heterozygote Cp / +, a negative control of Miyi chicken genomic DNA with a known genotype of normal + / +, and a blank control of ddH2O without nuclease.

6. The application of the specific primer set as described in claim 1 or 2 in the preparation of molecular marker-assisted breeding or germplasm resource identification products for Miyi chicken.

Images