CELL-FREE DETECTION OF METHYLATED TUMOR DNA
Patent Information
- Application Number
- DE602017092560
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2017-05-04
- Publication Date
- 2025-11-05
- Estimated Expiration
- 2037-05-04
AI Technical Summary
Current cancer screening methods, including mammography and MRI, face limitations in sensitivity and specificity, leading to false positives and negatives, and lack effective blood-based screens for breast cancer, while existing liquid biopsies for circulating tumour DNA are limited by high background noise and variable tumour mutations.
A method for detecting tumours through cell-free DNA analysis by amplifying and sequencing regions methylated in cancer, using PCR primers designed to target methylation sites below -0.3 in normal tissue, and detecting adjacent methylation signals in cell-free samples to indicate tumour presence.
Enhances sensitivity and specificity for tumour detection, allowing for monitoring tumour burden, response to treatment, residual disease, relapse, and primary screening, with potential applications in high-risk populations.
Description
FIELD
[0001] This disclosure relates generally to tumour detection. More particularly, this disclosure relates to tumour-specific DNA methylation detection.BACKGROUND
[0002] Cancer screening and monitoring has helped to improve outcomes over the past few decades simply because early detection leads to a better outcome as the cancer can be eliminated before it has spread. In the case of breast cancer, for instance, physical breast exams, mammography, ultrasound and MRI (in high risk patients) have all played a role in improving early diagnosis. The cost / benefit of these modalities for general screening, particularly in relatively younger women, has been controversial.
[0003] A primary issue for any screening tool is the compromise between false positive and false negative results (or specificity and sensitivity) which lead to unnecessary investigations in the former case, and ineffectiveness in the latter case. An ideal test is one that has a high Positive Predictive Value (PPV), minimizing unnecessary investigations but detecting the vast majority of cancers. Another key factor is what is called "detection sensitivity", to distinguish it from test sensitivity, and that is the lower limits of detection in terms of the size of the tumour. Screening mammography in breast cancer, for instance, is considered to have a sensitivity from 80 to 90% with a specificity of 90%. However the mean size of tumours detected by mammography remains in the range of 15 to 19 mm. It has been suggested that only 3-13% of women derive an improved treatment outcome from this screening suggesting that the detection of smaller tumours would provide increased benefit. For women at high risk of developing breast cancer the use of MRI has offered some benefit with sensitivities in the range of 75 to 97% and specificities in the area of 90 to 96% and in combination with mammography offering 93-94% sensitivity and 77 to 96% specificities. However, MRI is acknowledged to have a poor PPV, in the area of 10-20%, leading to a large number of false positives and as a consequence unnecessary invasive investigations. All of these screens have likely reached their limit of detection sensitivity (or size of the tumour) and in the case of mammography still involve exposure to radiation, which may be of particular concern in women with familial mutations which render them more sensitive to radiation damage. There are no effective blood based screens for breast cancer based on circulating analytes.
[0004] While the above discussion focusses on breast cancer as an example, many of the same challenges exist for other types of cancers as well.
[0005] The detection of circulating tumour DNA is increasingly acknowledged as a viable "liquid biopsy" allowing for the detection and informative investigation of tumours in a non-invasive manner. Typically using the identification of tumour specific mutations these techniques have been applied to colon, breast and prostate cancers. Due to the high background of normal DNA present in the circulation these techniques can be limited in sensitivity. As well, the variable nature of tumour mutations in terms of occurrence and location (such as p53 and KRAS mutations) has generally limited these approaches to detecting tumour DNA at 1% of the total DNA in serum. Advanced techniques such as BEAMing have increased sensitivity, but are still limited overall. Even with these limitations the detection of circulating tumour DNA has recently been shown to be useful for detecting metastasis in breast cancer patients.
[0006] The detection of tumour specific methylation in the blood has been proposed to offer distinct advantages over the detection of mutations 1-5< . A number of single or multiple methylation biomarkers have been assessed in cancers including lung 6-10< , colon 11,12< and breast 13-16< . These have suffered from low sensitivities as they have tended to be insufficiently prevalent in the tumours. Several multi-gene assays have been developed with improved performance. A more advanced multi-gene system using a combination of 10 different genes has been reported and uses a multiplexed PCR based assay 17< . It offers combined sensitivity and specificity of 91% and 96% respectively, due to the better coverage offered and it has been validated in a small cohort of stage IV patients. However, it has a very high background in normal blood which will limit its detection sensitivity. Methylated markers have been used to monitor the response to neoadjuvant therapy 18,19< , and recently a methylation gene signature associated with metastatic tumours has been identified 20< . Patent application US 2009 / 305256 A1 describes measuring methylation level of CpG islands comprised in chromosomal regions preferably unmethylated in normal samples and heavily methylated in a large fraction of the tumors. Patent application WO 2014 / 043763 A1 describes systems, methods, and apparatuses that can determine and use methylation profiles of various tissues and samples. In WO 2015 / 159292 A1, a method of detecting death of a cell type or tissue in a subject is outlined, wherein the method comprises determining whether cell-free DNA comprised in a fluid sample of the subject is derived from the cell type or tissue by ascertaining the methylation status. In a scientific publication by Lehmann-Werman, Roni, et al. titled "Identification of tissue-specific cell death using methylation patterns of circulating DNA." (Proceedings of the National Academy of Sciences 113.13 (2016): E1826-E1834) authors describe a method of detecting tissue-specific cell death in humans based on tissue-specific methylation patterns in cell-free circulating DNA. Additionally, chips are also available for the detection of genome-wide DNA methylation sites, such as Illumina's Infinium ®< HumanMethylation450 BeadChip (https: / / support.illumina.com / content / dam / illumina-marketing / documents / products / datasheets / datasheet_humanmethylation450.pdf)
[0007] There remains a need for more sensitive and specific screening tools, as well as for straightforward tests that allow for the assessment of tumour burden, chemotherapy response, detection of residual disease, relapse and primary screening in high risk populations.SUMMARY
[0008] It is an object of this disclosure to obviate or mitigate at least one disadvantage of previous approaches.
[0009] As defined in the claims, in a first aspect, this disclosure provides a method for detecting a tumour, comprising: extracting DNA from a cell-free sample obtained from a human subject, bisulphite converting at least a portion of the DNA, amplifying regions methylated in cancer from the bisulphite converted DNA present in the sample using a plurality of PCR primers, wherein (i) amplifying with at least one primer set designed to amplify at least one methylation site having a methylation value at or below -0.3 in normal tissue; and detecting signals wherein at least one signal comprises methylation of at least two adjacent methylation sites within at least one region of the multiple regions; wherein the multiple regions are methylated in at least 50% of the tumours in a population of samples for a selected tumour type or tumour subtype and are not methylated in tissues and blood of subjects without tumours;wherein individual primers of the plurality of PCR primers are designed based on methylated DNA within individual regions of the multiple regions; wherein the presence of a tumour in the subject is indicated when signals comprising methylation of at least two adjacent methylation sites within the at least one region of the multiple regions are detected.
[0010] In another aspect, there is provided a use of the method for determining response to treatment.
[0011] In another aspect, there is provided a use of the method for monitoring tumour load.
[0012] In another aspect, there is provided a use of the method for detecting residual tumour post-surgery.
[0013] In another aspect, there is provided a use of the method for detecting relapse.
[0014] In another aspect, there is provided a use of the method as a secondary screen.
[0015] In another aspect, there is provided a use of the method as a primary screen.
[0016] In another aspect, there is provided a use of the method for monitoring cancer development.
[0017] In another aspect, there is provided a use of the method for monitoring cancer risk.
[0018] In another aspect, there is provided a kit for detecting a tumour comprising reagents for carrying out the method, and instructions for detecting the tumour signals, as defined by the claims.
[0019] Other aspects and features of this disclosure will become apparent to those ordinarily skilled in the art upon review of the following description of specific embodiments in conjunction with the accompanying figures.BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Embodiments of this disclosure will now be described, by way of example only, with reference to the attached Figures. Fig. 1 depicts a schematic of the method. Fig. 2 depicts a schematic of the amplification of multiple target regions. Fig. 3 lists 47 CpG targets selected to identify differentially methylated regions, and shows the results of Receiver Operator Curve (ROC) analysis. Fig. 4 depicts histograms showing the frequency of patients binned according to positive (methylated) probe frequency. Panel A depicts results for luminal tumours. Panel B depicts results for basal tumours. Fig. 5 depicts sequencing results to assess methylation status of a region near the CHST11 gene (CHST11 Probe C) in breast cancer cell lines. Fig. 6 depicts sequencing results to assess methylation status of CHST11 Probe A in breast cancer tumors and normal breast tissue. Fig. 7 depicts sequencing results to assess methylation status of FOXA Probe A in breast cancer cell lines. Fig. 8 depicts sequencing results to assess methylation status of CHST Probe A and Probe B in prostate cancer cell lines. Fig. 9 depicts sequencing results to assess methylation status of FOXA Probe A in prostate cancer cell lines. Fig. 10 depicts sequencing results to assess methylation status of NT5 Probe E in breast cancer cell lines. Fig. 11 depicts a summary of BioAnalyzer electrophoresis summary for amplification product generated from various cell lines. Figs. 12A and 12B depict a numerical summary of validation data generated for 98 different probes by bisulphite sequencing six different cell lines. # Reads is indicative of the number of reads exported, and Mean Me is indicative of the mean methylation. Figs. 13A and 13B depict a numerical summary of generated methylation data for tumour samples. # Reads is indicative of the number of reads exported, and Mean Me is indicative of the mean methylation. Fig. 14 depicts a numerical summary generated methylation data for prostate cell lines. # Reads is indicative of the number of reads exported, and Mean Me is indicative of the mean methylation. Fig. 15 is a diagram showing validation of various uveal melanoma (UM) probes in two cell lines MP38 (with loss of 3p) and MP41 (3p WT). Negative controls were cell free DNA (cfDNA) consisting of a pool of 18 individuals without cancer and peripheral mononuclear cells (PBMC). Probes for the indicated regions were PCR amplified individually and sequenced. Darker shading indicates higher level of methylation. OST3F was methylated in PBMCs while LDL3F was not methylated in tumours, with the majority showing strong methylation in the UM lines but not in the PBMCs or cfDNA. Fig. 16 is a diagram showing methylation of cfDNA from patients with metastatic uveal melanoma. Methylated reads for each probe were extracted and all reads were normalized for the total number of reads in the sample. Stacked columns represent the total reads from all of the individual probes with different probes identified by shading. The patients are sorted by PAP measurements with high values on the left and lower values on the right. cfDNA is a pool of cell free DNA from 18 normal donors. Fig. 17 is a diagram showing methylation of cfDNA from patients with metastatic uveal melanoma. Methylated reads for each probe were extracted and all reads were normalized for the total number of reads in the sample. Stacked columns represent the total reads from all of the individual probes with different probes identified by shading. The patients are sorted by tumour volume with larger volume on the left and lower volume on the right, and the volume indicated at the bottom. PAP values obtained from these patients is indicated. <5 refers to no detection of ctDNA in these samples. cfDNA is a pool of cell free DNA from 18 normal donors. Figs. 18A and 18B are diagrams showing methylation of cfDNA from sequential blood samples of two patients who were part of the patient groups shown in Figs. 17 and 18. In Fig. 19A the patient was retested after seven months and the tumour at that time was assessed as being 0.5 cm 3< in volume. In Fig. 19B the patient was retested after four months where the initial tumour volume was 483 cm 3< . Fig. 19 is a log-log plot showing assay values (methylated reads) are correlated with tumour volume. The character of the metastatic tumour such as whether it is a solid mass or dispersed (miliary) was not taken into account. Fig. 20 is a log-log plot showing relationship between test results and PAP signal, where PAP and methylation signals were correlated at higher PAP levels (trend line), although below the detection threshold of PAP at 5 copies / ml (vertical dashed line) the PAP signals were not correlated (ellipse). Fig. 21 is a heat map of gene methylation in indicated prostate cancer cell lines. Fig. 22 is a heat map of multiplexed probes for each prostate cancer patient sample. Patient samples were taken before the initiation of ADT (START) and 12 months after (M12). A black square indicates that methylated reads having greater than 80% methylation per read were detected for that probe but does not take into consideration the number of reads for each. Fig. 23 is a diagram showing number of methylated reads per probe for each prostate cancer patient sample. Different probes are shown in different shading. The number of reads that were at least 80% methylated were determined for each sample and all probes are stacked per sample. Patient samples were taken before the initiation of ADT (START) and 12 months after (M12). Fig. 24 is a plot showing normalized methylation reads per sample verses PSA levels for each patient. The totals of normalized methylated reads for all probes are plotted with solid lines. Patients initiated androgen deprivation therapy (START) and PSA levels measured at that time and after 12 months of treatment (M12) and are indicated with dashed lines. The methylation detection of circulating tumour DNA (mDETECT) test was performed on 0.5 ml of plasma from these same time points. The Gleason score for each patient at initial diagnosis is shown along with grading, as is the treatment applied as primary therapy (RRP, radical retropubic prostatectomy; BT, brachytherapy; EBR, external beam radiation; RT, radiotherapy). Fig. 25 is a plot of TCGA prostate cancer tumour data, showing the average methylation for each of various Gleason groups, as well as for normal tissue from breast, prostate, lung, and colon, verses position on the genome (in this case on chromosome 8 for the region upstream of the TCF24gene, a transcription factor of unknown function and PRSS3, a serine protease gene on chromosome 9). Figs. 26A, 26B, and 26C are charts showing regions used to develop a breast cancer test according to one embodiment. The chromosomal location and nucleotide position of the first CpG residue in the region is indicated. The TCGA breast cancer cohort was divided into sub-groups based on PAM-50 criteria. The fraction of each group that is positive for that probe is indicated. "Tissue" indicates results from normal tissue samples. Fig. 27 shows theoretical area under the curve analyses of blood tests using the top 20 probes for each breast cancer subtype (LumA, LumB, Basal, HER2). These values were compared against normal tissue samples for the same probes. Fig. 28 is a heatmap of multiplexed probes for each TNBC tumour sample and selected normal samples. A black square indicates that methylated reads having greater than 80% methylation per read were detected for that probe but does not take into consideration the number of reads for each. Fig. 29 is a diagram showing results of a sensitivity test for TNBC to detect low levels of tumour DNA, using HCC1937 DNA diluted into a fixed amount of PBMC DNA (10 ng). Shaded squares indicate a distinct methylation signature. Fig. 30 is a flowchart illustrating a method for determining biological methylation signatures, and for developing probes for their detection. DETAILED DESCRIPTION
[0021] Generally, this disclosure provides a method for detecting a tumour that can be applied to cell-free samples, e.g., to detect cell-free circulating tumour DNA. The method utilizes detection of adjacent methylation signals within a single sequencing read as the basic "positive" tumour signal.
[0022] In one aspect, there is provided a method for detecting a tumour, comprising: extracting DNA from a cell-free sample obtained from a subject, bisulphite converting at least a portion of the DNA, amplifying regions methylated in cancer from the bisulphite converted DNA, generating sequencing reads from the amplified regions, and detecting tumour signals comprising at least two adjacent methylated sites within a single sequencing read, wherein the detection of at least one of the tumour signals is indicative of a tumour, as further defined in the claims.
[0023] By "cell-free DNA (cfDNA)" is meant DNA in a biological sample that is not contained in a cell. cfDNA may circulate freely in in a bodily fluid, such as in the bloodstream.
[0024] "Cell-free sample", as used herein, is meant a biological sample that is substantially devoid of intact cells. This may be a derived from a biological sample that is itself substantially devoid of cells, or may be derived from a sample from which cells have been removed. Example cell-free samples include those derived from blood, such as serum or plasma; urine; or samples derived from other sources, such as semen, sputum, feces, ductal exudate, lymph, or recovered lavage.
[0025] "Circulating tumour DNA", as used herein, accordingly refers to cfDNA originating from a tumour.
[0026] By "region methylated in cancer" is meant a segment of the genome containing methylation sites (CpG dinucleotides), methylation of which is associated with a malignant cellular state. Methylation of a region may be associated with more than one different type of cancer, or with one type of cancer specifically. Within this, methylation of a region may be associated with more than one subtype, or with one subtype specifically.
[0027] The terms cancer "type" and "subtype" are used relatively herein, such that one "type" of cancer, such as breast cancer, may be "subtypes" based on e.g., stage, morphology, histology, gene expression, receptor profile, mutation profile, aggressiveness, prognosis, malignant characteristics, etc. Likewise, "type" and "subtype" may be applied at a finer level, e.g., to differentiate one histological "type" into "subtypes", e.g., defined according to mutation profile or gene expression.
[0028] By "adjacent methylated sites" is meant two methylated sites that are, sequentially, next to each other. It will be understood that this term does not necessarily require the sites to actually be directly beside each other in the physical DNA structure. Rather, in a sequence of DNA including spaced apart methylation sites A, B, and C in the context A-(n) n -B-(n) n -C, wherein (n) n refers to the number of base pairs (bp) (e.g., up to 300bp), sites A and B would be recognized as "adjacent" as would sites B and C. Sites A and C, however, would not be considered to be adjacent methylated sites.
[0029] In one aspect, the regions methylated in cancer comprise CpG islands.
[0030] "CpG islands" are regions of the genome having a high frequency of CpG sites. CpG islands are usually 300-3000bp in length and are found at or near promotors of approximately 40% of mammalian genes. They show a tendency to occur upstream of so-called "housekeeping genes". A concrete definition is elusive, but CpG islands may be said to have an absolute GC content of at least 50%, and a CpG dinucleotide content of at least 60% of what would be statistically expected. Their occurrence at or upstream of the 5' end of genes may reflect a role in the regulation of transcription, and methylation of CpG sites within the promoters of genes may lead to silencing. Silencing of tumour suppressors by methylation is, in turn, a hallmark of a number of human cancers.
[0031] In one aspect, the regions methylated in cancer comprise CpG shores.
[0032] "CpG shores" are regions extending short distances from CpG islands in which methylation may also occur. CpG shores may be found in the region 0 to 2kb upstream and downstream of a CpG island.
[0033] In one aspect, the regions methylated in cancer comprise CpG shelves.
[0034] "CpG shelves" are regions extending short distances from CpG shores in which methylation may also occur. CpG shelves may generally be found in the region between 2kb and 4kb upstream and downstream of a CpG island (i.e., extending a further 2kb out from a CpG shore).
[0035] In one aspect, the regions methylated in cancer comprise CpG islands and CpG shores.
[0036] In one aspect, the regions methylated in cancer comprise CpG islands, CpG shores, and CpG shelves.
[0037] In one aspect, the regions methylated in cancer comprise CpG islands and sequences 0 to 4kb upstream and downstream. The regions methylated in cancer may also comprise CpG islands and sequences 0 to 3kb upstream and downstream, 0 to 2kb upstream and downstream, 0 to 1kb upstream and downstream, 0 to 500bp upstream and downstream, 0 to 400bp upstream and downstream, 0 to 300bp upstream and downstream, 0 to 200bp upstream and downstream, or 0 to 100bp upstream and downstream.
[0038] The step of amplifying may be carried out with primers designed to anneal to bisulphite converted target sequences having at least one methylated site therein. Bisulphite conversion results in unmethylated cytosines being converted to uracil, while 5-methylcytosine is unaffected. "Bisulphite converted target sequences" are thus understood to be sequences in which cytosines known to be methylation sites are fixed as "C" (cytosine), while cytosines known to be unmethylated are fixed as "U" (uracil; which can be treated as "T" (thymine) for primer design purposes). Primers designed to target such sequences may exhibit a degree of bias towards converted methylated sequences. However, in one embodiment, the primers are designed without preference as to location of the at least one methylated site within target sequences. Often, to achieve optimal discrimination, it may be desirable to place a discriminatory base at the ultimate or penultimate 3' position of an oligonucleotide PCR primer. In this embodiment, however, no preference is given to the location of the discriminatory sites of methylation, such that overall primer design is optimized based on sequence (not discrimination). This results in a degree of bias for some primer sets, but usually not complete specificity towards methylated sequences (some individual primer pairs, however, may be specific if a discriminatory site is fortuitously placed). As will be described herein, this permits some embodiments of the method to be quantitative or semiquantitative.
[0039] In one embodiment, the PCR primers are designed to be methylation specific. This may allow for greater sensitivity in some applications. For instance, primers may be designed to include a discriminatory nucleotide (specific to a methylated sequence following bisulphite conversion) positioned to achieve optimal discrimination, e.g. in PCR applications. The discriminatory may be positioned at the 3' ultimate or penultimate position.
[0040] In one embodiment, the primers are designed to amplify DNA fragments 75 to 150bp in length. This is the general size range known for circulating DNA, and optimizing primer design to take into account target size may increase the sensitivity of the method according to this embodiment. The primers may be designed to amplify regions that are 50 to 200, 75 to 150, or 100 or 125bp in length.
[0041] In some embodiments, concordant results provide additional confidence in a positive tumour signal. By "concordant" or "concordance", as used herein, is meant methylation status that is consistent by location and / or by repeated observation. As has already been stated, the basic "tumour signal" defined herein comprises at least two adjacent methylated sites within a single sequencing read. However, additional layers of concordance can be used to increase confidence for tumour detection, in some embodiments, and not all of these need be derived from the same sequencing read. Layers of concordance that may provide confidence in tumor detection may include, for example: (a) detection of methylation of at least two adjacent methylation sites; (b) detection of methylation of more than two adjacent methylation sites; (c) detection of methylation at adjacent sites within the same section of a target region amplified by one primer pair; (d) detection of methylation at non-adjacent sites within the same section of a region amplified by one primer pair; (e) detection of methylation at adjacent sites within the same target region; (f) detection of methylation at non-adjacent sites within the same target region; (g) any one of (a) to (f) in the same sequencing read; (h) any one of (a) to (f) in at least two sequencing reads; (i) any one of (a) to (f) in a plurality of sequencing reads; (j) detection over methylation at sets of adjacent sites that overlap; (k) repeated observation of any one of (a) to (j); or (l) any combination or subset of the above.
[0042] In one embodiment, each of the regions is amplified in sections using multiple primer pairs. In one embodiment, these sections are non-overlapping. The sections may be immediately adjacent or spaced apart (e.g. spaced apart up to 10, 20, 30, 40, or 50bp). Since target regions (including CpG islands, CpG shores, and / or CpG shelves) are usually longer than 75 to 150bp, this embodiment permits the methylation status of sites across more (or all) of a given target region to be assessed.
[0043] A person of ordinary skill in the art would be well aware of how to design primers for target regions using available tools such as Primer3, Primer3Plus, Primer-BLAST, etc. As discussed, bisulphite conversion results in cytosine converting to uracil and 5'-methyl-cytosine converting to thymine. Thus, primer positioning or targeting may make use of bisulphite converted methylate sequences, depending on the degree of methylation specificity required.
[0044] Target regions for amplification are designed to have at least two CpG dinucleotide methylation sites. In some embodiments, however, it may be advantageous to amplify regions having more than one CpG methylation site. For instance, the amplified regions may have 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 CpG methylation sites. In one embodiment, the primers are designed to amplify DNA fragments comprising 3 to 12 CpG methylation sites. Overall this permits a larger number of adjacent methylation sites to be queried within a single sequencing read, and provides additional certainty (exclusion of false positives) because multiple concordant methylations can be detected within a single sequencing read. In one embodiment, the tumour signals comprise more than two adjacent methylation sites within the single sequencing read. Detecting more than two adjacent methylation sites provides additional concordance, and additional confidence that the tumour signal is not a false positive in this embodiment. For example, a tumour signal may be designated as 3, 4, 5, 6, 7, 8, 9, 10 or more adjacent detected methylation sites within a single sequencing read. The detection of more than one of the tumour signals can be indicative of a tumour. Detection of multiple tumour signals, can increase confidence in tumour detection. Such signals can be at the same or at different sites. The detection of more than one of the tumour signals at the same region can be indicative of a tumour. Detection of multiple tumour signals indicative of methylation at the same site in the genome, in this embodiment, can increase confidence in tumour detection. So too can detection of methylation at adjacent sites in the genome, even if the signals are derived from different sequencing reads. This reflects another type of concordance. The detection of adjacent or overlapping tumour signals across at least two different sequencing reads can be indicative of a tumour. In one aspect, the adjacent or overlapping tumour signals are within the same CpG island. In another aspect, the detection of 5 to 25 adjacent methylated sites can be indicative of a tumour.
[0045] Methylated regions can be selected according to the purpose of the intended assay. In one aspect, the regions can comprise at least one region listed Table 1 and / or Table 2. In another aspect, the regions may comprise all regions listed in Table 1 and / or Table 2.
[0046] Likewise, primer pairs can be designed based on the intended target regions.
[0047] The step of amplification may be carried out with more than 100 primer pairs. The step of amplification may be carried out with 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, or more primer pairs. The step of amplification can be a multiplex amplification. Multiplex amplification permits large amount of methylation information to be gathered from many target regions in the genome in parallel, even from cfDNA samples in which DNA is generally not plentiful. The multiplexing may be scaled up to a platform such as ION AmpliSeq ™< , in which, e.g. up to 24,000 amplicons may be queried simultaneously. The step of amplification can be nested amplification. A nested amplification may improve sensitivity and specificity.
[0048] The nested reaction may be part of a next generation sequencing approach. Barcode and / or sequencing primers may be added in the second (nested) amplification. Alternatively, these may added in the first amplification.
[0049] In one embodiment, the method further comprises quantifying the tumour signals, wherein a number in excess of a threshold is indicative of a tumour. In one embodiment, the steps of quantifying and comparing are carried out independently for each of the sites methylated in cancer. Accordingly, a count of positive tumour signals may be established for each site. The method may further comprise determining a proportion of the sequencing reads containing tumour signals, wherein the proportion in excess of a threshold is indicative of a tumour. The step of determining may be carried out independently for each of the sites methylated in cancer.
[0050] By "threshold", as used herein, is meant a value that is selected to discriminate between a disease (e.g., malignant) state, and a non-disease (e.g., healthy) state. Thresholds can be set according to the disease in question, and may be based on earlier analysis, e.g., of a training set. Thresholds may also be set for a site according to the predictive value of methylation at a particular site. Thresholds may be different for each methylation site, and data from multiple sites can be combined in the end analysis.
[0051] Various design parameters may be used to select the regions subject to amplification in some embodiments. According to the claims, the regions are having a methylation value at or below -0.3 in healthy normal tissue. Healthy tissue would be understood to be non-malignant. Healthy tissue is often selected based on the origin of the corresponding tumour.
[0052] Regions may be selected based on desired aims or required specificity, in some embodiments. For instance, it may be desirable to screen for more than one cancer type. Thus, the regions may be collectively methylated in more than one tumour type. It may be desirable to include regions methylated generally in a group of cancers, and regions methylated in specific cancers in order to provide different tiers of information. Thus, the regions can comprise regions that are specifically methylated in specific tumours, and regions that are methylated in more than one tumour type. Likewise, it may be desirably to include a second tier of regions that can differentiate between tumour types. In one embodiment, the regions specifically methylated in specific tumours comprise a plurality of groups, each specific to one tumour type. However, it may be desirable in some contexts to have a test that is focused on one type of cancer. Thus, in one embodiment, the regions are methylated specifically in one tumour type. The regions may be selected from those listed in Table 3 and the tumour is one carrying a BRCA1 mutation.
[0053] More specifically, in some embodiments regions may be selected that are methylated in particular subtypes of a cancer exhibiting particular histology, karyotype, gene expression (or profile thereof), gene mutation (or profile thereof), staging, etc. Accordingly, the regions to be amplified may comprise one or more groups of regions, each being established to be methylated in one particular cancer subtype. In one embodiment the regions to be amplified may be methylated in a cancer subtype bearing particular mutations. With breast cancer in mind, one example subtype defined by mutation is cancer bearing BRCA1 mutations. Another subtype is cancer bearing BRCA2 mutations. Other breast cancer subtypes for which methylated regions may be determined include Basal, Luminal A, Luminal B, HER2 and Normal-like tumours. For uveal melanoma, for example, subtypes may include tumours that have retained or lost chromosome 3 (monosomy 3).
[0054] Within the context of such a test of some embodiments, information about not only the presence, but also the pattern and distribution of tumour signals both within specific regions and between different regions may help to detect or validate the presence of a form of cancer. In one embodiment, the method further comprises determining a distribution of tumour signals across the regions, and comparing the distribution to at least one pattern associated with a cancer, wherein similarity between the distribution and the pattern is indicative of the cancer.
[0055] "Distribution", as used herein in this context, is meant to indicate the number and location of tumour signals across the regions. Statistical analysis may be used to compare the observed distribution with, e.g., pre-established patterns (data) associated with a form of cancer. In other embodiments, the distribution may be compared to multiple patterns. In one embodiment, the method further comprises determining a distribution of tumour signals across the regions, and comparing the distribution to a plurality of patterns, each one associated with a cancer type, wherein similarity between the distribution and one of the plurality of patterns is indicative of the associated cancer type.
[0056] The step of generating sequencing reads may be carried out by next generation sequencing. This permits a very high depth of reads to be achieved for a given region. These are high-throughput methods that include, for example, Ilumina (Solexa) sequencing, Roche 454 sequencing, Ion Torrent sequencing, and SOLiD sequencing. The depth of sequencing reads may be adjusted depending on desired sensitivity.
[0057] The step of generating sequencing reads can be carried out simultaneously for samples obtained from multiple patients, wherein the amplified CpG islands from is barcoded for each patient. This permits parallel analysis of a plurality of patients in one sequencing run.
[0058] A number of design parameters may be considered in the selection of regions methylated in cancer. Data for this selection process may be from a variety of sources such as, e.g., The Cancer Genome Atlas (TCGA) (http: / / cancergenome.nih.gov / ), derived by the use of, e.g., Illumina Infinium HumanMethylation450 BeadChip (http: / / www.illumina.com / products / methylation 450 beadchip kits.html) for a wide range of cancers, or from other sources based on, e.g., bisulphite whole genome sequencing, or other methodologies. For instance, "methylation value" (understood herein as derived from TCGA level 3 methylation data, which is in turn derived from the beta-value, which ranges from -0.5 to 0.5) may be used to select regions. The step of amplification is carried out with primer sets designed to amplify at least one methylation site having a methylation value of below -0.3 in normal issue. This can be established in a plurality of normal tissue samples, for example 4. The methylation value may be at or below -0.3, -0.4, or -0.5. In one embodiment, the primer sets are designed to amplify at least one methylation site having a difference between the average methylation value in the cancer and the normal tissue of greater than 0.3, as defined in the claims. The difference may be greater than 0.3, 0.4, or 0.5. Proximity of other methylation sites that meet this requirement may also play a role in selecting regions, in some embodiments. In one embodiment, the primer sets include primer pairs amplifying at least one methylation site having at least one methylation site within 200 bp that also has a methylation value of below -0.3 in normal issue, and a difference between the average methylation value in the cancer and the normal tissue of greater than 0.3, as defined in the claims. The adjacent site having these features may be 300 bp. The adjacent site may be within 100, 200, 300, 400, or 500bp.
[0059] The target regions are selected for amplification based on the number of tumours in the validation set having methylation at that site. For example, a region may be selected if it is methylated in at least 50%, 55%, 60%, 65%, 70%, 75%, 80, 85%, 90, or 95% of tumours tested. For example, regions may be selected if they are methylated in at least 75% of tumours tested, including within specific subtypes. For some validations, it will be appreciated that tumour-derived cell lines may be used for the testing.
[0060] The method may further comprise oxidative bisulphite conversion. In addition to the analysis of methylation of CpG residues, additional information that may be of clinical significance may be derived from the analysis of hydroxymethylation. Bisulphite sequencing results in the conversion of unmethylated cytosine residues into uracil / thymidine residues, while both methylated and hydroxymethylated cytosines remain unconverted. However, oxidative bisulphite treatment allows for the conversion of hydroxymethylated cytosines to uracil / thymidine allowing for the differential analysis of both types of modifications. By comparison of bisulphite to oxidative bisulphite treatments the presence of hydroxymethylation can be deduced. This information may be of significance as its presence or absence may be correlated with clinical features of the tumor which may be clinically useful either as a predictive or prognostic factor. Accordingly, in some embodiments, information about hydroxymethylation could additionally be used in the above-described embodiments.
[0061] In one aspect, the presence of specific patterns of methylation is linked to underlying characteristics of particular tumours. In these cases, the methylation patterns detected by the method are indicative of clinically relevant aspects of the tumours such as aggressiveness, likelihood of recurrence, and response to various therapies. Detection of these patterns in the blood may thus provide both prognostic and predictive information related to a patient's tumor.
[0062] In another aspect, the forgoing method may be applied to clinical applications involving the detection or monitoring of cancer.
[0063] In one embodiment, the forgoing method may be applied to determine and / or predict response to treatment.
[0064] In one embodiment, the forgoing method may be applied to monitor tumour load.
[0065] In one embodiment, the forgoing method may be applied to detect residual tumour post-surgery.
[0066] In one embodiment, the forgoing method may be applied to detect relapse.
[0067] In one aspect, the forgoing method may be applied as a secondary screen.
[0068] In one aspect, the forgoing method may be applied as a primary screen.
[0069] In one aspect, the forgoing method may be applied to monitor cancer development.
[0070] In one aspect, the forgoing method may be applied to monitor cancer risk.
[0071] In another aspect, there is provided a kit for detecting a tumour comprising reagents for carrying out the aforementioned method, and instructions for detecting the tumour signals, as defined in the claims. Reagents may include, for example, primer sets, PCR reaction components, and / or sequencing reagents, as defined in the claims.
[0072] In one embodiment of the forgoing methods, the regions comprise C2CD4A, COL19A1, DCDC2, DHRS3, GALNT3, HES5, KILLIN, MUC21, NR2E1 / OSTM1, PAMR1, SCRN1, and SEZ6, and the tumour is uveal melanoma. In one embodiment, the probes comprise C2C5F, COL2F, DCD5F, DGR2F, GAL1F, GAL3F, HES1F, HES3F, HES4F, KIL5F, KIL6F, MUC2F, OST3F, OST4F, PAM4F, SCR2F, SEZ3F, and SEZ5F.
[0073] In one embodiment, the regions comprise ADCY4, ALDH1L1, ALOX5, AMOTL2, ANXA2, CHST11, EFS, EPSTI1, EYA4, HAAO, HAPLN3, HCG4P6, HES5, HIF3A, HLA-F, HLA-J, HOXA7, HSF4, KLK4, LOC376693, LRRC4, NBR1, PAH, PON3, PPM1H, PTRF, RARA, RARB, RHCG, RND2,TMP4, TXNRD1, and ZSCAN12, and the tumour is prostate cancer. In one aspect, the probes comprise ADCY4-F, ALDH1L1-F, ALOX5-F, AMOTL2-F, ANXA2-F, CHST11-F, EFS-F, EPSTI1-F, EYA4-F, HAAO-F, HAPLN3-F, HCG4P6-F, HES5-F, HIF3A-F, HLA-F-F, HLA-J-1-F, HLA-J-2-F, HOXA7-F, HSF4-F, KLK4-F, LOC376693-F, LRRC4-F, NBR1-F, PAH-F, PON3-F, PPM1H-F, PTRF-F, RARA-F, RARB-F, RHCG-F, RND2-F,TMP4-F, TXNRD1-F, and ZSCAN12-F. In another aspect, the probes additionally include C1Dtrim, C1Etrim, CHSAtrim, DMBCtrim, FOXAtrim, FOXEtrim, SFRAtrim, SFRCtrim, SFREtrim, TTBAtrim, VWCJtrim, and VWCKtrim.
[0074] In one embodiment, the regions comprise ASAP1, BC030768, C18orf62, C6orf141, CADPS2, CORO1C, CYP27A1, CYTH4, DMRTA2, EMX1, HFE, HIST1H3G / 1H2BI, HMGCLL1, KCNK4, KJ904227, KRT78, LINC240, Me3, MIR1292, NBPF1, NHLH2, NRN1, PPM1H, PPP2R5C, PRSS3, SFRP2, SLCO4C1, SOX2OT, TUBB2B, USP44, Intergenic (Chr1), Intergenic (Chr2), Intergenic (Chr3), Intergenic (Chr4), Intergenic (Chr8), and Intergenic (Chr10), and the tumour is aggressive prostate cancer. In one embodiment, the aggressive prostate cancer has a Gleason Score greater than 6. In one embodiment, the aggressive prostate cancer has a Gleason Score of 9 or greater. In one embodiment, the probes comprise ASAP1 / p, BC030768 / p, C18orf62 / p, C6orf141 / p-1, C6orf141 / p-2, CADPS2 / p, CORO1C / p-1, CORO1C / p-2, CYP27A1 / p, CYTH4 / p, DMRTA2 / p, EMX1 / p, HFE / p-1, HFE / p-2, HIST1H3G / 1H2BI / p, HMGCLL1 / p, KCNK4 / p, KJ904227 / p, KRT78 / p, LINC240 / p-1, LINC240 / p-2, Me3 / p-1, Me3 / p-2, MIR129, NBPF1 / p, NHLH2 / p, NRN1 / p, PPM1H / p-1, PPM1H / p-2, PPP2R5C / p, PRSS3 / p, SFRP2 / p-1, SFRP2 / p-2, SLCO4C1 / p, SOX2OT / p, TUBB2B / p, USP44 / p, Chr1 / p-1, Chr2 / p-1, Chr3 / p-1, Chr4 / p-1, Chr8 / p-1, and Chr10 / p-1.
[0075] In one embodiment, the regions comprise the regions depicted in Figures 26A, 26B, and 26C, and the tumour is breast cancer.
[0076] In another aspect , the regions comprise ALX1, ACVRL1, BRCA1,C1orf114, CA9, CARD11, CCL28, CD38, CDKL2, CHST11, CRYM, DMBX1, DPP10, DRD4, ERNA4, EPSTI1, EVX1, FABP5, FOXA3, GALR3, GIPC2, HINF1B, HOXA9, HOXB13, Intergenic5, Intergenic 8, IRF8, ITPRIPL1, LEF1,LOC641518, MAST1, BARHL2, BOLL, C5orf39, DDAH2, DMRTA2, GABRA4, ID4, IRF4, NT5E, SIM1, TBX15, NFIC, NPHS2, NR5A2, OTX2, PAX6, GNG4, SCAND3, TAL1, PDX1, PHOX2B, POU4F1,PFIA3, PRDM13, PRKCB, PRSS27, PTGDR, PTPRN2, SALL3, SLC7A4, SOX2OT, SPAG6, TCTEX1D1, TMEM132C, TMEM90B, TNFRSF10D, TOP2P1, TSPAN33, TTBK1, UDB, and VWC2., and the tumour is triple negative breast cancer (TNBC). In one embodiment, the probes comprise ALX1, AVCRL1, BRCA1-A, C1Dtrim, C1Etrim, CA9 - A, CARD11 - B, CCL28-A, CD38, CDKL2 - A, CHSAtrim, CRYM-A, DMBCtrim, DMRTA2exp - A, DPP10-A, DPP10-B, DPP10-C,DRD4 - A, EFNA4 - B, EPSTI1, EVX1, FABP5, FOXAtrim, FOXEtrim, GALR3 - A, GIPC2 - A, HINF C trim, HOXAAtrim, HOXACtrim, HOXB13-A, Int5, Int8, IRF8-A, ITRIPL1, LEF1 - A, MAST1 A trim, mbBARHL2 Trim, mbBOLL Trim, mbC5orf Trim, mbDDAH Trim, mbDMRTA Trim, mbGABRA A Trim, mbGABRA B Trim, mbGNG Trim, mbID4 Trim, mbIRF Trim, mbNT5E Trim, mbSIM A Trim, mbTBX15 Trim, NFIC - B, NFIC -A, NPSH2-B, NR5A2 - B, OTX2-A, PAX6-A, pbDMRTA Trim, pbGNG Trim, pbSCAND Trim, pbTAL Trim, PDX1exp - B, PHOX2B - A, POU4F1 A trim, PPFIA3-A, PRDM13, PRKCB-A, PRKCB-C, PRSS27 - A, PTGDR, PTPRN2 - A, PTPRN2 - B, SALL3-A, SALL3-B, SLC7A4 - A, SOX2OT - B, SPAG6 A trim, TCTEX1D1 - A, TMEM - A, TMEM - B, TMEM90B - A, TNFRSF10D, TOP2P1 - B, TSPAN33 - A, TTBAtrim, UBD - A, VWCJtrim, and VWCKtrim.
[0077] In one embodiment, each region is amplified with primer pairs listed for the respective region in Table 15.
[0078] The method may further comprise administering a treatment for the tumour detected.
[0079] In one aspect, there is provided a method for identifying a methylation signature indicative of a biological characteristic, the method comprising: obtaining data for a population comprising a plurality of genomic methylation data sets, each of said genomic methylation data sets associated with biological information for a corresponding sample, segregating the methylation data sets into a first group corresponding to one tissue or cell type possessing the biological characteristic and a second group corresponding to a plurality of tissue or cell types not possessing the biological characteristic, matching methylation data from the first group to methylation data from the second group on a site-by-site basis across the genome, identifying a set of CpG sites that meet a predetermined threshold for establishing differential methylation between the first and second groups, identifying, using the set of CpG sites, target genomic regions comprising at least two differentially methylated CpGs with 300bp that meet said predetermined criteria, extending the target genomic regions to encompass at least one adjacent differentially methylated CpG site that does not meet the predetermined criteria, wherein the extended target genomic regions provide the methylation signature indicative of the biological trait.
[0080] The method may further comprise validating the extended target genomic regions by testing for differential methylation within the extended target genomic regions using DNA from at least one independent sample possessing the biological trait and DNA from at least one independent sample not possessing the biological sample.
[0081] In one embodiment, the step of identifying further comprises limiting the set of CpG sites to CpG sites that further exhibit differential methylation with peripheral blood mononuclear cells from a control sample.
[0082] In one embodiment, the plurality of tissue or cell types of the second group comprises at least some tissue or cells of the same type as the first group.
[0083] In one embodiment, the plurality of tissue or cell types of the second group comprises a plurality of non-diseased tissue or cell types.
[0084] In one embodiment, the predetermined threshold is indicative of methylation in the first group and non-methylation in the second group.
[0085] In one embodiment, the predetermined threshold is at least 50% methylation in the first group.
[0086] In one embodiment, the predetermined threshold is a difference in average methylation between the first and second groups of 0.3 or greater.
[0087] In one embodiment, the biological trait comprises malignancy.
[0088] In one embodiment, the biological trait comprises a cancer type.
[0089] In one embodiment, the biological trait comprises a cancer classification.
[0090] In one embodiment, the cancer classification comprises a cancer grade.
[0091] In one embodiment, the cancer classification comprises a histological classification.
[0092] In one embodiment, the biological trait comprises a metabolic profile.
[0093] In one embodiment, the biological trait comprises a mutation.
[0094] In one embodiment, the mutation is a disease-associated mutation.
[0095] In one embodiment, the biological trait comprises a clinical outcome.
[0096] In one embodiment, the biological trait comprises a drug response.
[0097] The method may further comprise designing a plurality of PCR primers pairs to amplify portions of the extended target genomic regions, each of the portions comprising at least one differentially methylated CpG site.
[0098] The step of designing the plurality of primer pairs may comprise converting non-methylated cytosines uracil, to simulate bisulphite conversion, and designing the primer pairs using the converted sequence.
[0099] The primer pairs may be designed to have a methylation bias.
[0100] The primer pairs may be methylation-specific.
[0101] The primer pairs may have no CpG residues within them having no preference for methylation status.
[0102] In one aspect, there is provided a method for synthesizing primer pairs specific to a methylation signature, the method comprising: carrying out the forgoing method, and synthesizing the designed primer pairs.
[0103] In one aspect, there is provided a non-transitory computer-readable medium comprising instructions that direct a processor to carry out the forgoing method.
[0104] In one aspect, there is provided a computing device comprising the computer-readable medium.EXAMPLE 1 Concept Summary
[0105] The embodiments detect circulating tumour DNA using a highly sensitive and specific methylation based assay with detection limits 100 times better than other techniques.
[0106] Fig. 1 depicts a schematic of the overall strategy. CpG dinucleotides are often clustered into concentrated regions in the genome referred to as CpG islands (grey box) and are often, but not always, associated with the promoter or enhancer regions of genes. These regions are known to become abnormally methylated in tumours (CmpG) as compared to normal tissue (CpG) which may be linked to the inactivation of tumour suppressor genes by this methylation event. Methylation of CpG islands and the boundary regions (CpG island shores) is extensive and coordinated such that most or all of the CpG residues in that region become methylated. The detection of this methylation involves bisulphite conversion, PCR amplification of the relevant region (arrows), and sequencing where un-methylated CpG residues are converted to TpG dinucleotides while methylated CpG residues are preserved as CpGs. Sequencing of these PCR-amplified "probes" (BISULFITE SEQUENCING) from tumour DNA (arrows) results in the detection of multiple CpG residues being methylated within the same DNA fragment (Dashed Box) which can easily be distinguished from DNA from normal tissue (Boxes). The co-ordinated / concordant nature of this methylation produces a strong signal which can be detected over random or background changes from DNA sequencing. This is accomplished by first identifying regions of tumour specific DNA methylation with multiple correlated CpG methylation sites within the same region.
[0107] Fig. 30 depicts a flowchart showing how a methylation signature for a biological trait may be determined. One or more steps of this method may be implemented on a computer. Accordingly, another aspect of this disclosure relates to a non-transitory computer-readable medium comprising instructions that direct a processor to carry out steps of this method.
[0108] Generally "probe" is used herein to refer to a target region for amplification and / or the ensuing amplified PCR product. It will be understood that each probe is amplified by a "primer set" or "primer pair".
[0109] Fig. 2 depicts a schematic for amplification of target regions. Multiple regions from across the human genome have been identified as being differentially methylated in the DNA from various types of tumours compared to the normal DNA from a variety of different tissues. These regions can be fairly extensive spanning 100s to 1000s of base pairs of DNA. These target regions (black boxes, bottom) exhibit coordinated methylation where most or all of the CpG dinucleotides in these regions are methylated in tumour tissue with little or no methylation in normal tissues. As shown in Fig. 2, when sequencing across these regions (arrows) multiple CpG residues are seen to be methylated together in the tumour creating a concordant signal identifiable as being tumour specific. By targeting multiple PCR-amplified probes across individual regions (middle) and across the entire genome (top) large numbers of probes can be designed with the advantage that with more probes comes greater sensitivity due to the greater likelihood of detecting a tumour specific fragment in a given sample. Primers for these probes are designed to amplify regions from 75 to 150 bp in length, corresponding to the typical size of circulating tumour DNA. The primers may include CpG dinucleotides or not, which in the former case can make these primers biased towards the amplification of methylated DNA or exclusively amplify only methylated DNA.
[0110] Multiple methylation-biased PCR primer pairs can be created, which are able to preferentially amplify these regions. These multiple regions are sequenced using next generation sequencing (NGS) at a high read depth to detect multiple tumour specific methylation patterns in a single sample. As described herein, features have been incorporated into a blood based cancer detection system that provides advantages over other tests which have been developed, and provides an unprecedented level of sensitivity and specificity as well as enables the detection of minute quantities of DNA (detection sensitivity).EXAMPLE 2 Probe and Primer Set Development
[0111] The detection of circulating tumour DNA is hampered by both the presence of large amounts of normal DNA as well as by the very low concentrations of tumour DNA in the blood. Compounding this issue, both PCR and sequencing based approaches suffer from the introduction of single nucleotide changes due to the error prone nature of these processes. To deal with these issues, regions of the genome have been identified that exhibit concerted tumour specific methylation over a significant expanse of DNA so that each CpG residue is concordant 21< . Methylation-biased PCR primer pairs were designed for multiple segments of DNA across these regions each containing multiple CpG residues. Sample protocols for selection of differentially methylated regions and design of region specific PCR primers are provided.Protocol for the Selection of Differentially Methylated Regions Use of TCGA DATA for identifying Breast Specific Probes
[0112] Level 3 (processed) Illumina Infinium HumanMethylation450 BeadChip array data (http: / / www.illumina.com / techniques / microarrays / methylation-arrays.html) was downloaded from The Tumour Genome Atlas (TCGA) site (https: / / tcga-data.nci.nih.gov / tcga / tcgaHome2.jsp) for the appropriate tumour types (e.g., breast, prostate, colon, lung, etc.). Tumour and normal samples were separated and the methylation values (from -0.5 to + 0.5) for each group were averaged. The individual methylation probes were mapped to their respective genomic location. Probes that fulfilled the following example criteria were then identified: 1. The average methylation values for the normal breast, prostate, colon and lung tissues all below -0.3; 2. The difference between the average breast tumour and average breast normal values greater than 0.3, or at least 50% methylation in the tumour group; and 3. Two probes within 300 bp of each other fulfill criteria 1 and 2.
[0113] These criteria establish that the particular probe is not methylated in normal tissue, that the difference between the tumour and normal is significant, and that multiple probes in a relatively small area are co-ordinately methylated. Regions which had multiple positive consecutive probes (i.e., 3 or more) were prioritized for further analysis. Average values for approximately 10 other probes to either side of the positive region were plotted for all tumour and normal tissue samples to define the region exhibiting differential methylation. Regions exhibiting concerted differential methylation between tumour and normal for single or multiple tumour types were identified.
[0114] A secondary screen for a lack of methylation of these regions in blood was carried out by examining the methylation status of the defined regions in multiple tissues using nucleotide level genome wide bisulphite sequencing data. Specifically the UCSC Genome Browser (https: / / genome.ucsc.edu / ) was used to examine methylation data from multiple sources.
[0115] Data was processed by the method described in Song Q, et al., A reference methylome database and analysis pipeline to facilitate integrative and comparative epigenomics. PLOS ONE 2013 8(12): e81148 (http: / / journals.plos.org / plosone / article?id=10.1371 / journal.pone.0081148) for use in the UCSC Browser and to identify hypo-methylated regions (above blue lines).
[0116] The following data sources were used: Gertz J, et al., Analysis of DNA methylation in a three-generation family reveals widespread genetic influence on epigenetic regulation. PLoS Genet. 2011 7(8):e1002228 (http: / / journals.plos.org / plosgenetics / article?id=10.1371 / journal.pgen.1002228). Heyn H, et al., Distinct DNA methylomes of newborns and centenarians. Proc. Natl. Acad. Sci. U.S.A. 2012 109(26):10522-7 (http: / / www.pnas.org / content / 109 / 26 / 10522). Hon GC, et al., Global DNA hypomethylation coupled to repressive chromatin domain formation and gene silencing in breast cancer. Genome Res. 2012 22(2):246-58 (http: / / genome.cshlp.org / content / 22 / 2 / 246). Heyn H, et al., Whole-genome bisulfite DNA sequencing of a DNMT3B mutant patient. Epigenetics. 2012 7(6):542-50 (http: / / www.tandfonline.com / doi / abs / 10.4161 / epi.20523#.VsS_gdIUVIw). Hon GC, et al., Global DNA hypomethylation coupled to repressive chromatin domain formation and gene silencing in breast cancer. Genome Res. 2012 22(2):246-58 (http: / / genome.cshlp.org / content / 22 / 2 / 246).
[0117] All of the regions identified exhibited hypo-methylation in normal blood cells including Peripheral Blood Mononuclear Cells (PBMC), the prime source of non-tissue DNA in plasma.Protocol for the Design of Region Specific Primers for PCR Amplification and Next Generation Sequencing
[0118] For regions identified as being differentially methylated in tumours, PCR primers were designed that are able to recognize bisulphite converted DNA which is methylated. Using Methyprimer Express ™< or PyroMark ™< , or other web based programs, the DNA sequence of the region was converted to the sequence obtained when fully methylated DNA is bisulphite converted (i.e., C residues in a CpG dinucleotide remain Cs, while all other C residues are converted to T residues). The converted DNA was then analysed using PrimerBlast ™< (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) to generate optimal primers. Primers were not expressly selected to contain CpG residues but due to the nature of the regions, generally CpG islands, most had 1 to 3 CpGs within them. This renders them biased towards the amplification of methylated DNA but in many cases they do recognize and amplify non-methylated DNA as well. The region between the primers includes 2 or more CpG residues. Primers were chosen to amplify regions from 75 to 150 base pairs in size with melting temperatures in the range of 52 - 68°C. Multiple primers were designed for each region to provide increased sensitivity by providing multiple opportunities to detect that region. Adapter sequences (CS1 and CS2) were included at the 5' end of the primers to allow for barcoding and for sequencing on multiple sequencing platforms by the use of adaptor primers for secondary PCR.
[0119] Primers were characterized by PCR amplification of breast cancer cell line DNA and DNA from various primary tumours. PCR amplification was done with individual sets of primers and Next Generation Sequencing carried out to characterize the methylation status of specific regions. Primer sets exhibiting appropriate tumour specific methylation were then combined into a multiplex PCR reaction containing many primers.Results
[0120] Fig. 3 lists the 47 CpG probes used to identify differentially methylated regions. These were analyzed by Receiver Operator Curve analysis (ROC). Normal and tumour samples from the entire TCGA breast cancer database were compared. The Area Under the Curve (AUC) analysis for each probe is shown with the standard error, 95% confidence interval and P-value. All of them where shown to have excellent discriminatory capabilities.
[0121] Fig. 4 depicts the results of analysis methylation level for each patient in the TCGA database for the 47 CpG. Those exceeding the threshold of -0.1 were considered to be positive for methylation in that patient. The number of probes exceeding this methylation threshold were calculated for each patient. Patients were divided into those with Luminal A and B subtypes (Luminal Tumours; Fig. 4, Panel A) and those with Basal cancers (Basal Tumours; Fig. 4, Panel B) or and the number of patients with a specific range of positive probes was calculated. The histogram shows the frequency of patents within each range of positive probes. While these probes give excellent coverage in both populations, there are more positive probes amongst the Luminal tumours than the Basal tumours. Additional probes specific to the different breast cancer subtypes have been identified and appropriate probe development and validation is underway.EXAMPLE 3 Selection of Regions for Cancer and Cancer Types
[0122] For breast cancer, 52 regions in the genome were identified that are highly methylated in tumours but where multiple normal tissues do not exhibit methylation of these regions. These serve as highly specific markers for the presence of a tumour with little or no background signal.
[0123] Table 1 depicts regions selected for breast cancer screening. Table 1 Chromosome Start (hg18) End (hg18) General Location Tumour Size 2nd Generation chr1167663259167663533C1orf114P / B274chr74978357749784309VWC2P / B / C732chr142387351923873993ADCY4P / B / C474chr114355901243559541MIR129-2B / C5293rd Generation chr64331918643319213TTBK1P / B27chr14672390546724176DMBX1P / B / C271chr72717168427172029HOXA9B345chr8120720175120720579ENPP2P / B404chr109952163599521924SFRP5P / B289chr12103376281103376485CHST11P / B / C204chr195107160351072234FOXA3P / B6314th Generation chr14747053547470713TAL1B178chr15065899850659557DMRTA2B559chr16603061066030634PDE4BB24chr19096726290967924BARHL2B662chr1119331667119332616TBX15B / C949chr1153557070153557585RUSC1,C1orf104B515chr1233880632233880962GNG4B330chr2104836482104837226POU3F3B744chr2198359230198359743BOLLB / C513chr33283410332834562TRIM71B / C459chr3172228723172228985SLC2A2B262chr450719855072137CYTL1B152chr44209454942094615SHISA3B66chr44669026646690578GABRA4B312chr53829327338293312EGFLAMB39chr54307619543076642C5orf39B447chr5115179918115180393CDO1B475chr6336189337131IRF4B / C942chr61994499419945298ID4B304chr62861828528618318SCAN D3B33chr63180619731806205DDAH2B8chr63326925433269355COL11A2B101chr68621582286215929NT5EB107chr6101018889101019751SIM1B8625th Generation chr6153493505153494425RGS17B920chr7121743738121744126CAPDS2B388chr87291833872918895MSCB / C557chr102267443822674584SPAG6B / C146chr10105026601105026737INAB136chr11128068895128069316FLI1B / C421chr125235715852357378ATP5G2B220chr129446689294467095USP44B / C203chr137807552178075764POU4F1B243chr145565627555656325PELI2B50chr173317685333178091HNF1BB1238chr173236834332368604LHX1B / C / L261chr174415484444155027PRAC,C17orf93B / C183chr187309072573091121GALR1B / C396chr191283938312839805MAST1B422chr2027291222729438CPXM1B / C316chr204395220943952500CTSA, NEU RL2B291
[0124] In Table 1, 'Start' and 'End' designate the coordinates of the target regions in the hg18 build of the human genome reference sequence. The 'General Location' field gives the name of one or more gene or ORF in the vicinity of the target region. Examination of these sequences relative to nearby genes indicates that they were found, e.g., in upstream, in 5' promoters, in 5' enhancers, in introns, in exons, in distal promoters, in coding regions, or in intergenic regions. The 'Tumour' field indicates whether a region is methylated in prostate (P), breast (B), colon (C), and / or lung (L) cancers. The 'Size' field indicates the size of the target region.
[0125] In the discussion here, it should be recognized that reference to genes such as CHST11, FOXA, and NT5 are not intended to be indicative of the genes in question per se, but rather to the associated methylated regions described in Table 1.
[0126] In total, 52 regions were found to be methylated in association with breast cancer, 17 were found to be methylated in association with prostate cancer, 9 were found to be methylated in association with prostate cancer, and 1 region was found to be methylated in association with lung cancer. Thus, some regions appear to be generally indicative of the various types of cancers assessed. Other regions methylated in subgroups of these, while others are specific for cancers. In the context of this assay and the types of cancers examined, 25 regions may be described as being "specifically methylated in breast cancer". However, it is noted that the same approach may be used to identify regions methylated specifically in other cancers.
[0127] Assays may be developed for cancer generally, or to detect groups of cancers or specific cancers. A multi-tiered assay may be developed using "general" regions (methylated in multiple cancers) and "specific" regions (methylated in only specific cancers). A multi-tiered test of this sort may be run together in one multiplex reaction, or may have its tiers executed separately.Probes for Breast Cancer
[0128] Over 150 different PCR primer pairs were developed to the 52 different regions in the genome shown to exhibit extensive methylation in multiple breast cancer samples from the TCGA database but with no or minimal methylation in multiple normal tissues and in blood cells (Peripheral Blood Mononuclear Cells and others).
[0129] As proof of concept, these were then used to amplify bisulphite converted DNA from breast cancer cell lines MCF-7 (ER+, PR+), T47-D (ER+, PR+), SK-BR-3 (HER2+), MDA-MD-231 (Triple Negative) and normal breast lines MCF-10A and 184-hTERT. Sequencing adapters were added and Next Generation Sequencing carried out on an Ion Torrent sequencer. The sequencing reads were then separated by region and the sequence reads were analyzed using the BiqAnalyzer HT program.Results
[0130] Example results of methylation analysis will be discussed herein. CHST11 is an example of a region methylated in prostate, breast, and colon cancer. FOXA is a region methylated in breast and prostate cancer. NT5 is a region methylated specifically in breast cancer.
[0131] Fig. 5 depicts sequencing results from a region from near the CHST11 gene (Probe C) is shown. For each cell line the results of a single sequencing read is depicted as a horizontal bar with each box representing a single CpG residue from between the PCR primers (in this case there being 6 CpG residues, Illustration at bottom right). Methylated bases are shown in dark grey while un-methylated bases are shown in light grey. Where a CpG could not be identified by the alignment program it is shown as a white box. Multiple sequence reads are shown for each cell line, stacked on top of each other. The numbers at the bottom of each stack indicates the number of sequence reads (Reads) and the overall methylation level determined from these reads (Meth).
[0132] When sequenced, these probes produced strong concordant signals that consisted of multiple methylated CpGs (5 to 25) where there is a strong correlation between individual sites being methylated in tumours. This eliminates false positive results due to PCR and sequencing errors. These tumour specific multiple methylated sites can be detected against a high background of normal DNA, being limited only by the read depth of the sequencing. Based on bioinformatic analysis of TCGA tumours, this essentially eliminates false positive signals.
[0133] Fig. 6 depicts results for CHST11 Probe A. Methylation in the region was characterized for a variety of breast cancer tumour samples (T) and in normal breast tissue samples (N) from the same patient. As in Fig. 5 the methylated bases are shown in dark grey while unmethylated bases are shown in light grey (illustration bottom left). Tumours of various subtypes were analysed including A02324 which is positive for HER2 amplification (HER2+), A02354 and B02275 which are Triple Negative Breast Cancer (TNBC), and D01333, D02291, D02610 which are all Estrogen and Progesterone Receptor positive tumours (ER+ PR+). The values below each column refer to the number of sequence reads obtained by Next Generation Sequencing (Reads) and the overall level of methylation of all of the CpG residues (Meth) based on these reads. Where no sequence reads were obtained for a given sample and box is shown as for sample D01333 N (Normal).
[0134] Fig. 7 depicts results of similar analysis of FOXA Probe A in breast cancer cell lines.
[0135] Fig. 15 depicts a numerical summary generated methylation data for prostate cell lines. # Reads is indicative of the number of reads exported, and Mean Me is indicative of the mean methylation.
[0136] Fig. 8 depicts results of similar analysis of the CHST11 Probe A and CHST11 Probe B in prostate cancer cell lines. DU145 is an Androgen Receptor (AR-) negative cell line which is able to generate metastases in the mouse. PC3 is also AR- and also metastatic. LNCaP is an Androgen Receptor positive line (AR+) which does generate metastases in the mouse while RWPE cells are AR+ and non-metastatic.
[0137] Fig. 9 depicts results of similar analysis of FOXA Probe A in prostate cell lines.
[0138] Fig. 10 depicts sequencing results to assess methylation status NET5 Probe E in breast cancer cell lines.
[0139] These results exemplify probes of differing specificities that can be selected using the approach outlined herein.EXAMPLE 4 Probes for Uveal Cancer
[0140] Using the above-described methodologies, regions were selected for uveal cancer screening. Table 2 depicts these regions. Table 2 Chromosome Start Stop General Location Descriptor Size chr108961139989611920PTEN,KILLINShore CGI521chr113550340035504124PAMR1small CGI724chr111.18E+081.18E+08MPZL2Prox Prom599chr156014604360147120C2CD4AShore CGI1077chr172437085824371386SEZ6small CGI528chr191106047611060965LDLRProx Prom489chr21.66E+081.66E+08GALNT3CGI1465chr22.23E+082.23E+08ccdc140 / pax3Shore CGI4724chr62177463821775386FU22536 / casc15small CGI748chr62446569924466545KAAG1,DCDC2CGI846chr63103122031031651MUC21CGI431chr67063288970633262COL19A1Proc Prom373chr61.09E+081.09E+08NR2E1 / OSTM1small CGI1001chr72999624229996333SCRN1Shore CGI91chr124507252452224HES5CGI1499chr11260122812601893DHRS3Shore CGI665 EXAMPLE 5 Tests for Breast Cancer Subtypes
[0141] The screen that has been described above, which originally incorporated all breast tumours in the TCGA database, can also be done on subsets of the tumour database.
[0142] BRCA1 carriers were taken out of the dataset and analyzed individually to identify target methylated regions specific to this subgroup. Breast cancer can also be divided in other ways: e.g., into five subtypes, Basal, Luminal A., Luminal B, HER2 and Normal-like. Patients in each of these groups were identified and analyzed to identify target methylated regions for each subset.
[0143] The screen can also be changed to look at individual patients using the previously described criteria to see who are positive or negative. Target methylated regions can then be ranked based on how many individuals are positive. This can help to remove biasing due to amalgamation (averaging). Targets can then be selected, e.g., if they are present in greater than 75% of patients for each subtype, and then rationalize amongst these.Test for BRCA Carriers
[0144] Current monitoring practices for women at high risk of developing breast cancer due to familial BRCA1 or 2 mutations involve yearly MRI, however the high false positive rates result in a large number of unnecessary biopsies. Using the methodology described herein, a test may be developed to serve as a secondary screen, e.g., to be employed after a positive MRI finding; or to be used for primary screening of high risk patients. The blood test is designed to detect all types of breast cancer but because ER+ breast cancer is the most frequent it is biased towards these cancers, though some of the constituent probes do recognize HER2+ and TNBC tumours. In order to provide optimal sensitivity for the monitoring of BRCA1 and 2 an assay optimized for these patients may be developed.
[0145] Both TNBC and BRCA1 and 2 patients were selected from the TCGA 450k methylation database. Generally, most BRCA1 and 2 tumours will present as TNBC but many non-familial cancers are also TNBC. These patients were analyzed using the above-described tumour specific methylation region protocol on both the overall TNBC population and on the BRCA1 and 2 patients. 85 tumour specific regions were identified for TNBC, 67 for BRCA1 and 13 for BRCA2 populations. Of these 39 were present in any two populations and they constitute the starting point for the development of this assay. Appropriate regions for a BRCA1 specific test were identified and assessed in individual patients with known mutations. This population is surprisingly uniform and most patients are recognized by a large number of probes. AUCs for individual probes are for the most part very high. Based on these results, an assay can be developed to detect all three, i.e., TNBC, BRCA1 and 2. If additional detection sensitivity is required, then individual tests can be constructed. For high risk women who are BRCA1 or 2 mutation carriers, their mutation status should be known so that the appropriate test can be applied.Test for BRCA1 Carriers
[0146] Probes have been developed for the detection of cancer in carriers of the BRCA1 mutation. Methylation data from the TCGA Breast cancer cohort were selected from patients known to be carriers of pathogenic BRCA1 mutations. This data was then analyzed as described to identify regions of the genome specifically methylated in this sub-set of breast cancers. Table 3 lists appropriate regions identified and their genomic locations. Table 3 Target Region (hg18 reference) chr Nearest Gene Start (nt) End (nt) Size chr1LOC10537868343,023,84043,023,487353chr1NPHS2177,811,942177,811,671271chr1NR5A2198,278,599198,278,409190chr11PAX631,783,95531,782,5451,410chr11KCNE373,856,33273,855,762570chr12KCNA64,789,4914,789,342149chr12TMEM132C127,318,539127,317,0011,538chr13PDX127,390,26527,389,540725chr13EPSTI142,464,61842,463,901717chr16A2BP16,009,9306,009,020910chr16CRYM21,202,91421,202,448466chr16PRKCB23,755,50423,754,826678chr16IRF884,490,35484,490,167187chr18SALL374,842,14574,839,7052,440chr19LYPD549,016,84849,016,696152chr2:DPP10115,636,420115,635,2151,205chr20C20orf5622,507,86722,507,676191chr3SOX2OT182,919,993182,919,839154chr4CDKL276,774,88076,774,658222chr5March 1116,233,07216,232,633439chr5CCL2843,433,32943,432,559770chr5AP3B177,304,64477,304,208436chr7CARD113,050,2993,049,859440chr7BLACE154,859,799154,859,051748chr7PTPRN2157,176,806157,176,096710chr8RUNX1T193,183,48193,183,326155
[0147] 52 different probes were then developed to various parts of these regions and the methylation pattern in tumor cell lines was characterized, including MDA-MB-436 and HCC1937 which are known to carry BRCA1 mutations. These probes will be combined with previously characterized probes to other regions which are also methylated in tumours from BRCA1 patients. This would provide for a highly sensitive assay able to detect cancer in these high risk women at the earliest possible stage.Tests for Other Subtypes
[0148] A number of breast cell lines from women with known BRCA1 mutations have been isolated such as MDA-MB-436, HCC1937 and HCC1395 (all available from ATCC). These may be used to validate the assay as was done for the general blood test. For BRCA2 mutant lines there is only one ATCC cell line at present, HCC1937. There are several BRCA2 mutant ovarian cancer lines that have been identified and they may be used if the bioinformatic analysis confirms that these methylation markers are also found in ovarian cancer. The development of a single assay that detects both breast and ovarian cancer in BRCA2 carriers represents a distinct advantage as it would simultaneously monitor the two primary cancer risks in these patients.
[0149] The development of these assays follows the same course the above-described general assay proceeding from TCGA data to cells lines to patient samples. Tumour banks (some of which have mutation data) can be used for this, and analysis of these tumours provides an indication of their likely BRCA mutation. These samples can also be sequenced to confirm the prediction.EXAMPLE 6 Testing of Cell-Free Samples
[0150] Proof of concept testing was carried out using cell lines for ease of analysis. However, the assay can be applied to test for cell-free DNA, e.g., circulating cell-free tumour DNA in blood, and finds wide application in this context. A sample protocol for circulating tumour DNA is provided.Sample Protocol: Test for Circulating Tumour DNA DNA Preparation
[0151] The following example protocol may be used to detect circulating tumour DNA (tDNA). Obtain DNA to be used for bisulfite conversion and downstream PCR amplification (i.e., cell line, tumour or normal DNA). Determine DNA purity on 0.8% agarose gel. Determine genomic DNA (gDNA) for concentration in ug / uL by UV spectrophotometry. Prepare a 1:100 dilution with TE buffer. Remove RNA contaminates, if necessary, using the purification protocol for the GenElute Mammalian Genomic DNA Miniprep Kit, Sigma Aldrich, CAT# G1N350 (http: / / www.sigmaaldrich.com / technical-documents / protocols / biology / genelute-mammalian-genomic-dna-miniprep-kit.html). Follow purification protocol from steps A: 2a-3a, step 4-9. OPTIONAL: For gDNA from a cell line, sonicate gDNA to approximately 90-120bp (this represents general size of circulating tDNA). To do this, sonicate 5-10ug of sample (50-100ng / 100uL) using a sonicator. Use setting 4, and 15 pulses for 30 seconds with 30 seconds rest on ice in between. Determine sonicated DNA purity and bp size on 0.8% agarose gel. Bisulfite convert DNA - EpiTect Fast Bisulfite Conversion Kit, QIAgen, CAT# 59824 (https: / / www.qiagen.com / us / resources / resourcedetail?id=15863f2d-9d1c-4f12-b2e8-a0c6a82b2b1e&lang=en). Follow bisulfite conversion protocol on pages 1-18, 19-23. Refer to trouble shooting guide pages 30-32. Modifications to the protocol include: 1. Prepare reactions in 1.5mL tubes, 2. High concentration samples at 2ug, and low concentration samples at 500ng-1ug, 3. Perform the bisulfite conversion using 2 heat blocks set at 95°C and 60°C, 4. Incubation at 60°C extended to 20 minutes, to achieve complete bisulfite conversion, 5a Elute DNA in 10-20uL of elution buffer for ~50-100ng / uL final concentration, and 5b Dilute DNA to 10ng / uL for use in PCR. Perform nested PCR with Hot Star Taq Plus DNA Polymerase, Qiagen, CAT# 203605 (https: / / www.qiagen.com / ca / resources / resourcedetail?id=c505b538-7399-43b7-ad10-d27643013d10&lang=en). Singleplex PCR Amplification
[0152] For singleplex PCR amplification of individual probes, carry out a primary PCR reaction with methylation-biased primers (MBP), (primer forward and reverse).
[0153] Table 4 recites reaction components. Table 4 Component1X (uL)10X PCR Buffer2.55mM dNTP's15U Hot Star Taq0.125mM MgCl23PCR Grade H2O17[10ng / uL] DNA110pmol FWD Primer0.210pmol REV Primer0.2Total25
[0154] Table 5 lists thermocycler conditions. Table 5 Thermocycler Cond itionsTemp.Time95°C15 min95°C30 sec58°C30 sec72°C30 sec72°C7 min4°C∞ Carry out a secondary PCR reaction with universal primers CS1 (Barcode) and CS2 (P1 Adapter). To do this, remove an aliquot from the primary reaction, use as template DNA, this method serves as a two-step dilution PCR reaction
[0155] Table 6 recites reaction components. Table 6 Component1X (uL)10X PCR Buffer55mM dNTP's25U Hot Star Taq0.225mM MgCl26PCR Grade H2O34.4MBP PCR Template210pmol CS1 Primer0.210pmol CS2 Primer0.2Total50
[0156] Table 7 recites thermocycler conditions. Table 7 Thermocycler ConditionsTemp.Time95°C15 min95°C30 sec58°C30 sec72°C30 sec72°C7 min4°C∞ Determine PCR specificity on 2% agarose gel. Run the methylation-biased PCR product and the CS1 CS2 sequencing PCR product beside one another on the agarose to visualize the banding pattern and increase in bp size. PCR product should be between 200-300bp
[0157] For Singleplex PCR products, pool 5-10uL of each PCR reaction (CS1 CS2 Secondary RXN) into a single tube for each sample type. Purify the pooled PCR with Agencourt AMPure XP beads at a 1.2:1 ratio (90uL beads + 75uL sample), e.g., as below.Agencourt Ampure XP Bead Purification
[0158] Use freshly prepared 70% ethanol. Allow the beads and pooled DNA to equilibrate to room temperature. 1. Add indicated volume of Agencourt AMPure XP beads to each sample: 90uL beads + 75uL Pool (1.2:1) 2. Pipet up and down 5 times to thoroughly mix the bead suspension with the DNA. Incubate the suspension at RT for 5 minutes. 3. Place the tube on a magnet for 5 minutes or until the solution clears. Carefully remove the supernatant and store until purified library has been confirmed. 4. Remove the tube from the magnet; add 200uL of freshly prepared 70% EtOH. Place the tube back on the magnet and incubate for 30 seconds; turn the tube around twice in the magnet to move the beads through the EtOH solution. After the solution clears, remove and discard the supernatant without disturbing the pellet. 5. Repeat step #4 for a second EtOH wash. 6. To remove residual EtOH, pulse-spin the tube. Place the tube back on the magnet, and carefully remove any remaining EtOH with a 20uL Pipette, without disturbing the pellet. 7. Keeping the tube on the magnet, air-dry the beads at RT for ~5 minutes. 8. Remove the tube from the magnet; add 50uL of TE directly to the pellet. Flick the tube to mix thoroughly. Incubate at RT for 5 minutes. 9. Pulse-spin and place the tube back on the magnet for ~2 minutes or until the solution clears. Transfer the supernatant containing the eluted DNA to a new 1.5mL Eppendorf LoBind tube. 10. Remove the tube from the magnet; add 50uL of TE directly to the pellet. Flick the tube to mix thoroughly. Store the beads, along with the supernatant, at 4 O< c until purified library has been confirmed. 11. Visualize the sample pre- and post-purification on an 8% acrylamide gel (higher resolution). Pooled PCR product should be visualized as multiple bands (as each PCR product is a slightly different bp size). Purified sample should eliminate product beneath 150bp. Fig. 11 depicts a summary of BioAnalyzer electrophoresis summary for amplification product generated from various cell lines. 12. Perform nested PCR with Multiplex PCR Plus Kit, Qiagen, CAT# 206152 (https: / / www.qiagen.com / ca / resources / resourcedetail?id=beb1f99e-0580-42c5-85d4-ea5f37573c07&lang=en), e.g., as below.
[0159] Multiplex PCR Amplification of up to 50 Probes in a Single Reaction Create multiplex primer mix by aliquot 1uL of each forward and reverse primer at 10pmol / uL into a single 1.5mL tube. Calculate the final concentration of each primer by dividing the initial primer concentration by the final volume of primer mix in the tube, i.e., 15 probes to be multiplexed into a single reaction, would total 30 primers and at 1uL each, 30uL final volume. Thus ((10pmol)(1uL)) / 30uL=0.333pmol. Primer concentration requires optimization during PCR amplification, as the number of primers in a single reaction can influence the efficiency of the product, e.g. 15 primer sets ~2pmol final [ ] in PCR 50 primer sets ~0.5pmol final [ ] in PCR Carry out primary PCR reaction with methylation-biased primers.
[0160] Table 8 lists reaction components for multiple amplifications of 15 probes, and Table 9 lists reaction components for multiple amplifications of 50 probes. Table 10 list reaction conditions. Table 8 15 primer pairs at 2pmolComponent1X (uL)2X Multiplex MM25PCR H2O18Primer Mix6[10ng / uL] DNA1Total50 Table 9 50 primer pairs at 0.5pmolComponent1X (uL)2X Multiplex MM25PCR H2O19Primer Mix5[10ng / uL] DNA1Total50 Table 10 Thermocycling ConditionsTemp.Time95°C5 min95°C30 sec ┐58°C90 sec | X 3572°C90 sec ┘68°C10 in Determine PCR specificity on 2% agarose gel. Multiplex products should be visualized with multiple banding pattern between 100-300bp. Pooling is not required for multiplex products, as the probes have already been combined and amplified into a single tube / reaction. Purify the pooled PCR with Agencourt AMPure XP beads at a 1.2:1 ratio (60uL beads + 50uL sample) (refer within document for purification protocol). After PCR amplification, along with pooling and purifying, the samples can be quantified by qPCR, e.g., Ion Library Quantification Kit, TaqMan assay quantification of Ion Torrent libraries, Thermo Fisher Scientific, CAT# 4468802 (https: / / tools.thermofisher.com / content / sfs / manuals / 4468986_IonLibraryQuantitationKit_UG.pdf). 1. Create a standard curve of 6.8pM, 0.68pM, 0.068pM, 0.0068pM 2. Dilute samples 1:1000, and run in duplicate 3. Perform qPCR assay on the Step One Plus Real Time machine by Life Technologies 4. Sample libraries quantified ≥100pM can proceed to be sequenced on the Life Technologies Ion Torrent Sequencing platform Life Technologies Ion Torrent PGM Sequencing
[0161] Ion PGM Template OT2 200. Perform template reaction with Ion PGM Template OT2 200 Kit, Thermo Fisher Scientific, CAT# 4480974. Kit contents to be used on the One Touch 2 and Enrichment system (https: / / tools.thermofisher.com / content / sfs / manuals / MAN0007220_Ion_PGM_Template OT2 200_ Kit_UG.pdf_ Utilizing library quant. obtained from qPCR, dilute libraries appropriately to 100pM. Follow Life Technologies guide on how to further dilute libraries for input into final template reaction. Follow reference guide to complete template reaction Run the Ion One Touch 2 instrument Recover the template positive ISPs Enrich the template positive ISPs with the Ion One Touch ES Ion PGM Sequencing 200
[0162] Perform sequencing reaction with Ion PGM Sequencing 200 kit, Thermo Fisher Scientific, CAT# 4482006. Kit contents to be used on the Ion PGM system (https: / / tools.thermofisher.com / content / sfs / manuals / MAN0007273_IonPGMSequenc_200Kit_v2_UG .pdf). Plan sequencing run Select chip capacity (314, 316 or 318) Determine sequencing flows and bp read length (i.e., 500 flows and 200bp read length) Follow reference guide to complete PGM sequencing Prepare enriched template positive ISPs Anneal the sequencing primer Chip check Bind sequencing polymerase to the ISPs Load the chip Select the planned run and perform sequencing analysis
[0163] Sequencing data analysis and work flow Obtain run report generated by the PGM and Torrent Browser Run report includes the following information ISP Density and loading quality Total reads generated and ISP summary Read length distribution graph Barcoded samples: reads generated per sample and mean read length Obtain uBAM files generated by the PGM, available for download to an external hard drive Bioinformatics data analysis Upload uBAM files to a web based bioinformatics platform, Galaxy GenAp Perform quality control analysis (i.e., basic statistics and sequence quality check) Convert data files: BAM SAM FastQ Filter FastQ file: select bp size to trim (i.e., trim sequence <100bp) Convert data files: FastQ FastA Download FastA file Upload FastA files to BiqAnalyzer software platform Create project Add sample Load reference sequence Set gap extension penalty and minimal sequence identity Link in FastA files to samples and reference sequences Analyze and collect data files (pattern maps and pearl necklace diagrams) EXAMPLE 7 Uveal Melanoma Test
[0164] The molecular biology of uveal melanoma (UM) is simpler than that of breast cancer, with minimal mutations and rearrangements, and only two major sub-types which correspond to the retention or loss of chromosome 3p. A test was developed for UM which is superior to current state of the art blood assays.
[0165] Analysis of 450k methylation TCGA data for 80 UMs allowed for the identification of regions of tumour specific methylation in both 3p- and 3pWT tumours using our algorithm. Table 11 shows 16 hypermethylated regions in both 3p- and 3pWT tumours used for probe development and testing, according to one embodiment.
[0166] The top 14 of these common regions were carried forward for probe development and a total of 26 different probes were characterized, with several regions having up to three probes targeting them. Each of these probes was then validated using six different UM cell lines to assess their methylation status. As negative controls, DNA from peripheral blood mononuclear cells (PBMCs), which are the main source of contaminating DNA in blood samples, as well as a pool of cell free DNA (cfDNA) from 16 individuals, were also tested ( Fig. 15). These results indicated that the majority of the probes tested showed tumour specific methylation with little or no methylation in the negative controls. A total of 18 probes from 12 different regions were combined into a multiplex PCR reaction and used to analyze cell free DNA from plasma for a previously characterized cohort of metastatic UM patients.
[0167] The validated regions were C2CD4A, COL19A1, DCDC2, DHRS3, GALNT3, HES5, KILLIN, MUC21, NR2E1 / OSTM1, PAMR1, SCRN1, and SEZ6. The validated probes were C2C5F, COL2F, DCD5F, DGR2F, GAL1F, GAL3F, HES1F, HES3F, HES4F, KIL5F, KIL6F, MUC2F, OST3F, OST4F, PAM4F, SCR2F, SEZ3F, and SEZ5F.
[0168] These patients were previously tested using the pyrophosphorolysis-activated polymerization (PAP) assay 26< , which detects the frequent GNAQ or GNA11 mutations in UM 27< . In all cases the test detected cancer in these patients even when the PAP assay failed to register a signal ( Figs. 16 and 17). Most of the probes functioned like methylation specific PCR reactions, only giving product when there was tumour DNA present though with the additional validation that the specificity of each probe was guaranteed by the presence of multiple methylated CpG residues within each read. In two patients from which serial blood samples were obtained ( Figs. 18A and 18B) the test showed increased tumour levels over time even when the final tumour volume was 0.5 cm 3< (Fig. 18A). The test was also generally correlated with the volume of tumour, though the nature of the metastatic tumour as either a solid mass or dispersed has not yet been accounted for ( Fig. 19). The levels detected by the test were generally in line with those of the PAP assay and notably gave a signal where PAP failed due to the lack of a mutation ( Fig. 16, UM32). Where no or limited amounts of tumour DNA were detected by PAP, the test still gave significant signals ( Fig. 20). Even greater sensitivity is expected when the total number of reads analyzed per patient is increased, as this run had less than optimal overall reads due to the presence of large amounts of primer dimer, an issue that has now been resolved. The specificity of the test was demonstrated by the extremely low levels of methylation seen in the pool of 16 cfDNA controls. Overall, the test has been validated in a patient population, and it has been shown to be superior to a state of the art mutation based assay.EXAMPLE 8 Prostate Cancer Test
[0169] An important aspect of any test is that it should be applicable to all patients. Based on our experience it is essential to consider specific subtypes of a given cancer to ensure that all patients are detected by the assay. The TCGA analysis of a large prostate cohort revealed sub-groups based on specific mutations and transcriptional profiles 28< . Four subtypes were identified based on the overall pattern of methylation found in these tumours. In this example the TCGA prostate cohort was divided into groups based on the methylation pattern and subjected to methylation analysis.
[0170] Table 12 lists 40 regions associated with all sub-types of prostate cancer.
[0171] These regions common to all four methylation subtypes were identified and a total of 38 probes from 33 regions were selected and appropriate "biased" PCR probes were generated. These were characterized using four different prostate cancer lines. DU145 is an androgen receptor (AR-) negative cell line that is able to generate metastases in the mouse. PC3 is also AR- and also metastatic. LNCaP is an androgen receptor positive line (AR+) that is non-metastatic in the mouse while RWPE cells are AR+ and non-metastatic. DNA from PBMC was also tested as this represents the primary source of cell free DNA in the circulation.
[0172] A total of 34 probes from 33 regions were validated in that they showed little or no methylation in PBMCs while showing large scale methylation in one or more of the tumour cell lines ( Fig. 21).
[0173] The validated regions were ADCY4, ALDH1L1, ALOX5, AMOTL2, ANXA2, CHST11, EFS, EPSTI1, EYA4, HAAO, HAPLN3, HCG4P6, HES5, HIF3A, HLA-F, HLA-J, HOXA7, HSF4, KLK4, LOC376693, LRRC4, NBR1, PAH, PON3, PPM1H, PTRF, RARA, RARB, RHCG, RND2,TMP4, TXNRD1, and ZSCAN12.
[0174] The validated probes were ADCY4-F, ALDH1L1-F, ALOX5-F, AMOTL2-F, ANXA2-F, CHST11-F, EFS-F, EPSTI1-F, EYA4-F, HAAO-F, HAPLN3-F, HCG4P6-F, HES5-F, HIF3A-F, HLA-F-F, HLA-J-1-F, HLA-J-2-F, HOXA7-F, HSF4-F, KLK4-F, LOC376693-F, LRRC4-F, NBR1-F, PAH-F, PON3-F, PPM1H-F, PTRF-F, RARA-F, RARB-F, RHCG-F, RND2-F, TMP4-F, TXNRD1-F, and ZSCAN12-F.
[0175] To these 34 probes an additional 12 probes (from 7 regions) were added that had previously been characterized in breast cancer, which were also able to detect prostate cancer, for a total of 46 probes.
[0176] The added probes were C1 Dtrim, C1 Etrim, CHSAtrim, DMBCtrim, FOXAtrim, FOXEtrim, SFRAtrim, SFRCtrim, SFREtrim, TTBAtrim, VWCJtrim, and VWCKtrim.
[0177] These probes were multiplexed together and were then used to analyze plasma samples from five patients before they had initiated androgen deprivation therapy (ADT) and 12 months after starting treatment. These patients were part of a small cohort (~40 patients) being followed for depression and the plasma samples at 0.5 ml were much smaller than normally used for the assay (2 mls). All of the patients were M0 with no sign of metastatic disease when placed on ADT.
[0178] A variety of probes were positive depending on the particular patient ( Fig. 22). The total number of positive probes was in keeping with the total number of methylated reads, which were normalized for total reads for each sample ( Fig. 23). In all cases significant ctDNA signals were observed with results that were notably different than PSA results ( Fig. 24). Two of the patients, TM19 and RM26 were started on ADT due to their aggressive diseases (T3A and T3B) despite having low PSA levels. PSA levels for both remained low but methylation detection of circulating tumour DNA (mDETECT) either decreased slightly (TM19) or rose dramatically (RM26) suggesting their diseases did not express PSA but had stable or increasing disease. HS29 showed decreased PSA levels which mDETECT paralleled. Both GL20 and GP27 trended in opposite directions to PSA levels with mDETECT increasing even with dramatic drops in PSA levels. GL20 did develop a radiation induced secondary cancer which may be what is detected. Ongoing analysis of additional clinical data is expected to help explain these results.
[0179] Based on the literature, three of these regions appear to have prognostic significance as well. C1orf114 or CCDC1 has been shown to be correlated with biochemical relapse. HES5 is a transcription factor that is regulated by the Notch pathway and methylation of its promoter occurs early in prostate cancer development. KLK5 is part of the Kallikrein gene complex that includes KLK3 (the PSA gene). We can demonstrate that KLK5 expression is correlated with methylation and KLK5 expression has previously been shown to be increased in higher grade tumours. These results strongly suggest that the examination of a large number of methylation markers may yield significant insight into the specific processes involved in prostate cancer development and produce diagnostic and prognostic information that would be vital for management of the disease.EXAMPLE 9 Predictive Prostate Cancer Methylation Biomarkers
[0180] The 50 region assay according to embodiments described herein is sufficiently sensitive to easily detect metastatic disease and to follow changes in tumour size over time and, as indicated, has predictive value in itself. As described above, at least three regions, KLK5, HER5, and C1orf114 have potential to predict progression. In order to develop additional probes that are able to predict outcome in this patient population, the prostate cancer TCGA data was reanalysed to divide the patients by Gleason score. An inter-cohort comparison was conducted to identify regions frequently methylated in higher score cancers. Initially, Gleason grades 6 and 9 were compared as these typically represent less and more aggressive tumours and both groups had sufficient numbers of patients to ensure significance of the results. Probe development was carried out under the same criteria as with the original probe sets so that they could be used with ctDNA. No single probe will be absolutely specific for a given grade but a number of the probes showed excellent division between Gleason scores with the proportion of the cohort positive for a given grade increasing with increasing grade ( Fig. 25). One of these, PSS3, is a gene whose expression has previously been associated with prostate cancer and particularly metastasis. It should be noted that not all methylation is associated with gene repression. Forty-three new probes were developed based on selection criteria to target the 36 regions shown in Table 13, which are associated with aggressive prostate cancer. Table 13 ASAP1EMX1MIR1292SOX2OTBC030768HFENBPF1TUBB2BC18orf62HIST1H3G / 1H2BINHLH2USP44C6orf141HMGCLL1NRN1Intergenic (Chr1)CADPS2KCNK4PPM1HIntergenic (Chr8)CORO1CKJ904227PPP2R5CIntergenic (Chr2)CYP27A1KRT78PRSS3Intergenic (Chr3)CYTH4LINC240SFRP2Intergenic (Chr4)DMRTA2Me3SLCO4C1Intergenic (Chr10)
[0181] The probes were ASAP1 / p, BC030768 / p, C18orf62 / p, C6orf141 / p-1, C6orf141 / p-2, CADPS2 / p, CORO1C / p-1, CORO1C / p-2, CYP27A1 / p, CYTH4 / p, DMRTA2 / p, EMX1 / p, HFE / p-1, HFE / p-2, HIST1H3G / 1H2BI / p, HMGCLL1 / p, KCNK4 / p, KJ904227 / p, KRT78 / p, LINC240 / p-1, LINC240 / p-2, Me3 / p-1, Me3 / p-2, MIR129, NBPF1 / p, NHLH2 / p, NRN1 / p, PPM1H / p-1, PPM1H / p-2, PPP2R5C / p, PRSS3 / p, SFRP2 / p-1, SFRP2 / p-2, SLCO4C1 / p, SOX2OT / p, TUBB2B / p, USP44 / p, Chr1 / p-1, Chr2 / p-1, Chr3 / p-1, Chr4 / p-1, Chr8 / p-1, and Chr10 / p-1.
[0182] It is expected that it will be an overall pattern of hypermethylation, rather than a single probe, that will have the greatest predictive power.EXAMPLE 10 Breast Cancer Test
[0183] One approach described herein for identifying hypermethylated regions in breast cancer focused on the most frequently methylated regions within the TCGA database. Due to the large number of LumA and LumB patients in this dataset there was a significant under-detection particularly of the Basal class of tumours.
[0184] Accordingly, the data were reanalyzed based on the four molecular subtypes LumA, LumB, Her2 and Basal. The Normal-like subtype is not very frequent in the dataset and as expected is very close to normal tissue, however a small number of regions recognizing this subtype were also included. Overall, methods and probes were developed and tested for over 230 different regions (some with multiple probes), and these have been validated using a variety of breast cancer cell lines and tumour samples. Some regions are subtype-specific but most recognize multiple subtypes. These have been assembled into a single test incorporating 167 different probes which recognize all subtypes ( Fig. 26A, 26B, and 26C), with all patients being recognized by a significant number of probes. By looking at just the top 20 probes for each subtype this test has an area under the curve (AUC) per subgroup from 0.9078 to 0.9781, indicating that high detection rates have been achieved for all types of tumours ( Fig. 27). This also means that the test is able to identify the subtype of tumour based on the distribution of probe methylation.
[0185] Another test specific for the triple negative breast cancer (TNBC) subtype was developed from the larger set of general regions identified as described above. This test incorporates 86 probes from 71 regions, listed in Table 14.
[0186] The probes were ALX1, AVCRL1, BRCA1-A, C1Dtrim, C1Etrim, CA9 - A, CARD11 - B, CCL28-A, CD38, CDKL2 - A, CHSAtrim, CRYM-A, DMBCtrim, DMRTA2exp - A, DPP10-A, DPP10-B, DPP10-C,DRD4 - A, EFNA4 - B, EPSTI1, EVX1, FABP5, FOXAtrim, FOXEtrim, GALR3 - A, GIPC2 - A, HINF C trim, HOXAAtrim, HOXACtrim, HOXB13-A, Int5, Int8, IRF8-A, ITRIPL1, LEF1 - A, MAST1 A trim, mbBARHL2 Trim, mbBOLL Trim, mbC5orf Trim, mbDDAH Trim, mbDMRTA Trim, mbGABRA A Trim, mbGABRA B Trim, mbGNG Trim, mbID4 Trim, mbIRF Trim, mbNT5E Trim, mbSIM A Trim, mbTBX15 Trim, NFIC - B, NFIC -A, NPSH2-B, NR5A2 - B, OTX2-A, PAX6-A, pbDMRTA Trim, pbGNG Trim, pbSCAND Trim, pbTAL Trim, PDX1exp - B, PHOX2B - A, POU4F1 A trim, PPFIA3-A, PRDM13, PRKCB-A, PRKCB-C, PRSS27 - A, PTGDR, PTPRN2 - A, PTPRN2 - B, SALL3-A, SALL3-B, SLC7A4 - A, SOX2OT - B, SPAG6 A trim, TCTEX1D1 - A, TMEM - A, TMEM - B, TMEM90B - A, TNFRSF10D, TOP2P1 - B, TSPAN33 - A, TTBAtrim, UBD - A, VWCJtrim, and VWCKtrim.
[0187] The ability of this test to detect TNBC was validated by the analysis of 14 TNBC primary tumours as well as matched normal tissue from four of these patients. Large scale methylation was observed for the majority of probes and was distinctly different from the normal samples ( Fig. 28). EXAMPLE 11 Sensitivity of the Tests
[0188] The tests described herein are designed to detect less than one genome's worth of DNA in a sample through the use of multiple regions where a single probe out of many can signal the presence of a tumour. The more regions and probes incorporated into a test the greater is the sensitivity. This is in contrast to mutation detection where the presence of a single mutation per genome equivalent means that random sampling effects rapidly limit sensitivity when the concentration of the tumour DNA falls below one genome equivalent per sample. The presence of large amounts of normal DNA in fluid samples also creates problems for the detection of mutations through the relatively high error rates for PCR and sequencing. To assess the limits of methods and tests described herein, a dilution experiment was performed wherein DNA from a TNBC cell line (HCC1937 DNA) was diluted into a constant amount of PBMC DNA (10 ng) from a normal patient ( Fig. 29). These samples were then tested using the TNBC test. A conclusive signal was obtained from the test even when as little as 0.0001 ng of TNBC DNA was present in 10 ng of PBMC DNA. This represents a detection of 0.03 genome equivalents of tumour DNA against a background of 100,000 times more normal DNA.EXAMPLE 12 Discussion
[0189] The sensitivity of mutation based detection tests is limited by their detection of single unknown mutations in genes, such as p53 or ras. As only a single mutation is present per genome equivalent, this dramatically limits the sensitivity of these assays. Once the concentration of tumour DNA in the blood decreases to less than one genome equivalent per volume of blood analysed, the probability of detecting a mutation decreases dramatically as that particular segment of DNA may not be present in the blood sample. The assay described herein incorporates multiple probes for multiple regions from across the genome to dramatically increase sensitivity. For example, up to 100 or more probes may be incorporated into the assay, making it up to 100 or more times more sensitive than mutation based tests.
[0190] Circulating tumour DNA may be produced by the apoptotic or necrotic lysis of tumour cells. This produces very small DNA fragments in the blood. With this in mind, PCR primer pairs were designed to detect DNA in the range of 75 to 150 bp in length, which is optimal for the detection of circulating tumour DNA.
[0191] The use of DNA methylation offers one more advantage over mutation based approaches. Mutated genes are typically expressed in the cells (such as p53). They are thus in loosely compacted euchromatin, in comparison to methylated DNA which is in tightly compacted heterochromatin. This methylated and compacted DNA may be protected from apoptotic nucleases, increasing its concentration in the blood in comparison to these less compacted genes.
[0192] Extensive analysis of the genome wide methylation patterns in breast, colon, prostate and lung cancers and normal tissue in each of these organs based on TCGA data was carried out. 52 regions were identified for breast cancer which fulfill design criteria, which looks for an optimal difference in methylation between tumour and normal breast tissue, and where there is no methylation in any of the other normal tissues. As well, there should optimally be at least 2 CpG residues within 200 basepairs of each other. This ensured that regions of coordinated tumour specific methylation have been identified.
[0193] Within these 52 regions, 17 were found in common with colon cancer, and 9 in common with prostate cancer. Interestingly there were few appropriate regions identified in lung cancer, with only 1 overlapping with breast cancer. Most of these regions are associated with specific genes, though several are distantly intergenic, and almost all were found in CpG islands of various sizes. Probes were first developed for those regions with some commonality between cancers and designed PCR primers which recognize the methylated DNA sequence. This provides a bias in the amplification process for tumour DNA, enriching the tumour signal. These primer pairs amplify regions of 75 to 150 bp in accordance with our design criteria. Typically these regions contain from 3 to 12 CpG residues each, ensuring a robust positive signal when these regions are sequenced. Multiple non-overlapping probes were used as the CpG islands are generally larger than 150 bp, allowing for multiple probes for each appropriate region, providing more power to detect these regions and increasing the detection sensitivity of the assay.
[0194] Six different breast cancer lines were used in this validation analysis that have been shown to generally retain tumour specific methylation patterns 22< . MCF-7 and T47D lines are classic ER+ positive cell lines representing the most frequent class of breast cancer. SK-BR-3 cells are a HER2+ line and MDA-MB-231 cells represent a Triple Negative Breast cancer (TNBC), thus the 3 main categories of breast cancer are represented covering 95% of all tumours. Two "normal" lines were also used, the MCF10A line, though this line has been shown to contain some genomic anomalies, and the karyotypically normal 184-hTERT line. DNA was bisulphite converted, and the probes were amplified individually, barcoded then pooled according to cell line and subject to Next Generation Sequencing on an Ion Torrent sequencer. Not all PCR primer pairs produced a product due to the methylation-based nature of the primers, but in general, where a signal was detected, around 1000 reads were obtained per probe for each cell line. These reads were processed through our NGS pipeline using Galaxy and then loaded into the NGS methylation program BiqAnalyzer 23,24< . This program extracts probe specific reads, aligns them against the probe reference sequence, and calls methylated and unmethylated CpGs. It also carries out quality control measures related to bisulphite conversion and alignment criteria. In all of these probes there are several CpG residues within the primer sequence producing a bias towards amplifying methylated DNA. The analysis shown only includes CpGs outside of the primers which are solely representative of the methylation status of the sample being analysed.
[0195] Figs. 5 and 6 depict results for the CHST11 gene, which is a good example where robust PCR primers are able to recognize tumour specific methylation. Four different primer pairs were assessed, three of which amplify probes that partially overlap. In all four cases these regions are completely methylated at all CpGs (not including CpGs in the primers) and are essentially completely unmethylated in the normal lines. CHST11 primers do not recognize the Her2 or TNBC lines, but other primers such as ADCY and MIRD do. The corresponding probes cover a small region of the CpG island and information about the status of the rest of the CpG island is limited due to the relatively coarse resolution of the 450K methylation data. Clearly the remaining part of the CpG island can be developed for additional probes that would increase the sensitivity of detection.
[0196] Fig. 7 shows that FOXA probe A had similar characteristics and recognized all but one TNBC tumour. This proves that the target and probe development pipeline moving from TCGA data to cell lines and then to patient normal and tumour tissue successfully identified primer pairs that are able to specifically recognize tumour DNA based on their methylation patterns.
[0197] Validation work continues to validate potential probe regions. A further 24 regions were characterized using 52 different probes in the cell lines as an initial screen for their suitability.
[0198] Fig. 4 shows the results of analysis of all of the potential CpGs identified in the TCGA cohort for individual patients indicates most patients are recognized by a large proportion of these probes.
[0199] Fig. 3 shows the results of ROC analysis 25< and indicates each of these probes has a very high AUC, suggesting excellent performance individually and presumably even better when combined.
[0200] It has been noted that there does appear to be a population of patients with relatively few positive probes. This is not subtype specific and other probes specific for this population have been identified. As appropriate, additional probes will be developed for all suitable regions and expanded to include other parts of the associated CpG islands. Overall it is expected that 100-150 separate probes in the assay will provide optimal sensitivity.
[0201] Figs. 12A and 12B depict a numerical summary of validation data, wherein "# Reads" indicates the number of reads, and "Mean" Me indicates the mean methylation observed in results. Approximately half of the probes met the design criteria of having complete methylation of all CpG residues in the tumour samples and little or no methyation in the normal lines.
[0202] The next step in validating each of these probes was to examine their methylation patterns in actual patient tumour samples. A small cohort of patient samples was used to investigate GR methylation. From this group three ER+ tumours (one of which is positive for GR methylation), one HER2+ tumour and two TNBC tumours were chosen, as well as their corresponding normal controls. Taking the CHST11A probe as an example, Fig. 6 shows that all six of the normal breast tissue samples had either no reads due to the methylation biased amplification yielding no product or minimal methylation. In no case was there any concerted methylation signal where all CpGs were methylated. In contrast, in one TNBC and one ER+PR+ tumour a strong concordant methylation signal was seen at all six CpG sites. The other 2 ER+PR+ tumours also showed consistent methylation at four or five CpGs with their normal breast tissue controls having minimal reads with only one CpG showing any methylation.
[0203] Figs. 13A and 13B depict a numerical summary of generated methylation data for tumour samples for all probes tested to date. # Reads is indicative of the number of reads exported, and Mean Me is indicative of the mean methylation.
[0204] Initial proof of concept work involved mixing experiments where non-methylated and methylated DNA was mixed in increasing ratios. This demonstrated that based in the presence of multiple CpG signatures methylated DNA could easily be detected in the presence of at least a 500 fold excess of unmethylated DNA. These probes were amplified with PCR primers that were not methylation specific or biased, and the probes developed to date do incorporate a bias towards methylated DNA, which further increases the detection sensitivity. However, they do amplify non-methylated DNA (in part because primers were designed with no preference as to the location of methylation sites within the primers). This was done intentionally as it provides for a potential quantitative aspect to this assay. Some of the circulating normal DNA in blood samples is likely from the lysis of nucleated blood cells, which is why serum is preferred over plasma as a source of DNA. However the ratio of tumour to normal DNA in blood may provide some quantitation of the actual concentration of tumour DNA present in the blood, which is thought to be correlated with tumour load. Since tumour can be distinguished from normal DNA reads, the ratio between them can be used as a proxy for the tumour DNA concentration. The number of tumour specific reads per volume of blood, regardless of the number of normal reads, may also prove to be closely linked to circulating tumour DNA levels.
[0205] Optimizing this test may include multiplexing to allow all of the probes the opportunity to amplify their targets in a given sample of DNA. Through the use of limited concentrations of primers and cycles, excellent amplification of all probes was obtained within a set of 17 primer pairs. Expanding this to include all of the optimized primers is not expected to be an issue.
[0206] The test may be implemented as a blood based breast cancer detection system in patient blood samples.
[0207] Based on development and validation work to date, the assay offers significant advantages other current and developing tests based on sensitivity, specificity, and detection sensitivity.
[0208] Some potential applications of the embodiments described herein are listed below by level of detection sensitivity: Determining response to neo-adjuvant chemotherapy; Monitoring tumour load in diagnosed patients; Detecting residual disease post-surgery; Detecting relapse; Secondary screen after positive MRI in high risk patients; Direct monitoring of high risk patients; and Primary population screening.
[0209] The analysis of patients with active breast cancer offers the ability to assess a number of different aspects of this blood based test. Patients with locally advanced disease can be recruited preferentially, as these patients generally have larger tumours, receive neo-adjuvant therapy, are more likely to have residual disease and are at higher risk of relapse. By analysing blood samples from these patients upon diagnosis, after any neo-adjuvant treatments, pre-surgery, and at followup visits post-surgery it is possible to follow the relative tumour burden in these patients over the course of treatment. This will allow the tumour size and type to be correlated with the results of the test described herein.
[0210] Patients can be recruited in the clinic after a biopsy confirmed positive diagnosis. Blood can be drawn in conjunction with other routine blood work at diagnosis, after neo-adjuvant treatment, before surgery, within a month after surgery and every 3-6 months following that. Blood from 50 aged matched women without disease can also be collected from the community to provide control samples for the patient cohort. Relevant clinical data can be collected including radiological assessments and / or pathology reports. In particular, the receptor status of the tumours, the size of the tumour based on both radiological assessment and examination of the excised tumour, as well as treatments and response to therapy can be correlated with the circulating DNA analysis.
[0211] The assay described herein is expected to be quantitative at different levels. At very low levels of tumour DNA, the random presence of the tumour DNA in a sample will result in a subset of individual probes being positive, with the number of positive probes increasing with greater tumour DNA levels. At higher levels of tumour DNA the number of tumour specific reads will increase, either as an absolute number or in relation to the number of normal DNA reads. As a result methylation data can be treated in three ways: (1) As a binary outcome where each probe will be considered to be positive if it has any tumour specific methylation pattern present; (2) An individual threshold of methylation will be established for each probe based on the minimum number of reads required to call a tumour; or (3) Tumour specific reads per number of normal reads for each probe (or, e.g., per 100,000 total reads).
[0212] Each of these approaches may be used to carry out logistic regression on the patient and control sets. Receiver Operating Characteristic (ROC) analysis may be used to define thresholds for each probe that maximizes the sensitivity and sensitivity of the assay. The performance of the entire assay may be characterized using Area Under the Curve (AUC) analysis for overall sensitivity, specificity, classification accuracy and likelihood ratio. Pearson or Spearman correlations may be used to compare patient parameters with the test outcomes.
[0213] Changes in methylation may be important drivers of breast cancer development and that these occur very early during the process of transformation. This may explain why many of the observed methylations are common amongst different breast cancer sub-types, while some are even common to other cancers. This may mean that these changes predate the development of full malignancy and suggests that they could also have value in assessing the risk of a women developing breast cancer. It is envisaged that the assay described herein can be used to track the accumulation of risk in the form of increasing gene specific methylation levels and could be used to develop a risk assessment tool. This would be useful for the development and assessment of risk mitigation and prevention strategies.
[0214] Table 15 lists the primers used herein for each probe. Table 15 (1 / 23)GeneProbeSEQ ID NO.- 3' Primer Sequence (Bisulfite)Chr: LocationPCR Product LengthC1orf114 / CCDC181C1Df1TTGAGGTAAAGGAGATTTCGGTchr1: 167663228 -134C1Dr2ACATACGCCTACGCAAATTTTTA167663361C1Ef3TTCGGTGTTTGCGAAGGGTTAchr1: 167663398 -111+ C1Er4TCACAACCAACACAACGACACTT167663508C1Er5ACAACCAACACAACGACACTTC1Ff6TCGGTATTTGTTTTCGCGGTchr1: 167663245 -112C1Fr7CGCCTACGCAAATTTTTATCGC167663356C1Gf8CGAGAGCGATAAAAATTTGCGTchr1: 167663330 -88C1Gr9ACCCTTCGCAAACACCGAAA167663417C1 eAf10GGTAATAGCGTGTTTTTGCchr1:167663285-82C1 eAr11ATATTACATTCGCCTACGCAAA167663366C1 eBf12TTTGTGTAALATGCGGCGGTchr1:167663149-118C1 eBr13CTACCGCGAAAACAAATACCGA167663266C1 eCf14ATTTCGGTGTTTGCGAAGGGchr1:167663395-112C1 eCr15ACAACCAACACAACGACACT167663506VWC2VWCJf16TTTCGGTTGTCGGGTTTGGA+ VWCJf17TATTTCGGTTGTCGGGTTTGGAchr7: 49783871 -133VWCJr18CCCTCAATCGCTCATCCTCC49784003VWCKf19TCGTCGGTCGGTTTAGGATGchr7: 49784151 -129+ VWCKr20AAAACCGACGCCAAACCTACAT49784279VWCKr21AACCGACGCCAAACCTACATVWCLf22CGGAGGATGAGCGATTGAGGchr7: 49783983 -118VWCLr23TAACGCGCACACCGAACTAA49784100VWCMf24CGAGTTGGGGTCGCGATTATchr7: 49784021 -150VWCMr25CATCCTAAACCGACCGACGA49784170VWCNf26CGACGCGTTACGGTTGTTTAchr7: 49783849 -125VWCNr27CCGCTTCTCCGAAACCAAAC49783973VWC2 eAf28TAAGGCGGGGTTTTTAGAGCchr7:49783687-106VWC2 eAr29TAAAAACTAACGCGCCCG49783792VWC2 eBf30GGTTTCGGTGTTATTCGCchr7:49783797-126VWC2 eBr31CTCCTCTCCGCGAAAAAAT49783922VWC2 eCf32CGGAGGATGAGCGATTGAGGchr7:49783983-118VWC2 eCr33TAACGCGCACACCGAACTAA49784100VWC2 eDf34TCGTCGGTCGGTTTAGGATGchr7:49784151-127VWC2 eDr35AACCGACGCCAAACCTACAT49784277VWC2 eEf36GTCGGACGCGTTTTAGTTGGchr7:49784315-110VWC2 eEr37TCCCTACCGACCTCAACACT49784424MIRBf38TGGTTGGGGGATTTTGAGGGchr11: 43559089 -141MIRBr39AAACCTCCCCGCCTACCTAT43559229MIRCF40GCGGACGGTTTGGAGAAATGchr11: 43559343 -82MIRCr41CGCGACTCAATCTCACCACT43559424MIRDf42GGAGGTTGGGTTTCGGGATTchr11: 43559257 -127MIRDr43GCGCCCCTAAACTCGTATCT43559383MIREf44GCGGAGTGGTGAGATTGAGTchr11: 43559401 -113MIREr45ACCGACTTCTTCGATTCGCC43559513MIR129-2MIRFf46ATAGGTAGGCGGGGAGGTTTchr11: 43559205 - 43559343139MIRFr47CGATCCCCCAACTCAACCCMIR eAf48TGAGTTGGCGGTTTCGTTTGchr11:43559004-43559125122MIR eAr49CCCGAATCCCCTCTTATCCCMIR eBf50CGCGATTTTGTAGTCGGGGTchr11:43559156-4355925196MIR eBr51TTTCCTATCGCCCCAACACCMIR eCf52GGAGGTTGGGTTTCGGGATTchr11:43559257-43559383127MIR eCr53GCGCCCCTAAACTCGTATCTMIR eDf54GATTGAGTCGCGATGGAACGchr11:43559413-4355949481MIR eDr55GCCGCCTTCAACCCAAAATAADCY4ADCYFf56CGCGAGCGTATAGAGTACGAchr14: 23873573 23873735163ADCYFr57ACCCTAACCAACCCCGAAACADCYGf58TAGCGTCGCGAGCGTATAGAchr14: 23873567 - 23873754188ADCYGr59AAAAATAACCCGACGCCCGAADCYHf60GGTTTCGTAGAAGAGGTTTTCchr14: 23873642 - 23873815174ADCYHr61CGCGAAATAATAACGACTTTADCY4 eAf62AGAAGAGGTTTTCGTTGGGGGchr14:23873650-2387372980ADCY4 eAr63ACCAACCCCGAAACTCGAAAADCY4 eBf64TAGGATTTGGGGTTGGTGCGchr14:23873975-23874115141ADCY4 eBr65AACGCAACGACGAACGTAACADCY4 eCf66TGGTAGTGGGGAGATCGAGGchr14:23874376-2387447499ADCY4 eCr67AAACGCCCCCAACTCTAACCDMBX1DMBAf68GTTGCGGACGGCGTAGATchr1: 46723984 - 46724132149DMBAr69ACGCTCCCCGAAACAATAACTDMBBf70TTGTTAGTTTTGTTAGCGCGGchr1: 46723919 - 4672399375DMBBr71CGTCCGCAACGATTCATCATCDMBCf72TGTTTAGGAGATGGTTCGTGGTchr1: 46723889 - 46724003115+ DMBCr73GCATCTACGCCGTCCGCAACDMBCr74ATCTACGCCGTCCGCAACDMBX1 eAf75TGTTTAGACGTGGGTTGGGGchr1:46723237-4672332387DMBX1 eAr76TCAACTCCACTCACCCCGTADMBX1 eBf77GAGGAGGGTGGAGAGGGTAGchr1:46723478-46723610133DMBX1 eBr78ATACCGCACGTACTCCCAACDMBX1 eCf79GGAGTGGAGAGGTAGCGGTchr1:46723635-46723751117DMBX1 eCr80TTCCTAACCCTCTCCGACCADMBX1 eDf81TTTTTGAGCGGTGAAGGGGAchr1:46723764-46723888125DMBX1 eDr82AATTATTAACGCGACCGCCGHOXA9HOXAAf83GTAATAATTGGTGGTATCGGGGGchr7: 27171666 - 27171765100HOXAAr84TCTACTAAACGAACACGTAACGCHOXABf85ATAATTTGGTGGTATCGGGGGchr7: 27171669 - 27171777109HOXABr86ACGCGTTATTATTCTACTAAACGAAHOXACf87TGGGGTTTGTTTTAATTGTGGTTchr7: 27171878 - 27172029152+ HOXACr88GCGAAACCCGCGCCTTCTTAATHOXACr89GAAACCCGCGCCTTCTTAATHOXADf90GGGGAAGTATAGTTATTTAATAAGTTGchr7: 27171688 - 27171815128HOXADr91ACAAAACATCRAACCATTAATAAHOXA9 eAf92TTCGCGAAGGAGAGCGTATCchr7:27171234-27171334101HOXA9 eAr93CCCTACGTACACCCCCAAACHOXA9 eBf94CGTTTGGGGTGTACGTAGGchr7:27171314-2717140188HOXA9 eBr95AAACCCAATACACGCGACGAHOXA9 eCf96TTTGTCGGGGAGGTTGGTTTchr7:27171478-2717155982HOXA9 eCr97TTCCTACTAAACGCCGACGCHOXA9 eDf98TAGCGTTTGGTTCGTTCGGTchr7: 27171611-27171733123HOXA9 eDr99ATAAAAACGCGAACGCCGACSFRP5SFRAf100GCGGGCGTTTCGATTGATTT+ SFRAf101TTGCGGGCGTTTCGATTGATTTchr10: 99521730 - 99521860131SFRAr102TAAAAACCGCCCCCACTACCSFRBf103TGTTCGGCGGTTTAGGTGTTchr10: 99521628 - 99521751124SFRBr104AAATCAATCGAAACGCCCGCSFRCf105TAGTTCGGGTTTCGTCGTGCchr10: 99521776 - 9952186590+ SFRCr106AAAACTAAAAACCGCCCCCACTSFRCr107AACTAAAAACCGCCCCCACTSFRDF108GTGGGTGGTAGTTTGCGTTGchr10: 99521713 - 99521847135SFRDr109CACTACCTCCCCGCCTTAAASFREf110GCGTGCGTTTTCGGTTTTGA+ SFREF111CGGCGTGCGTTTTCGGTTTTGAchr10: 99521649 - 9952173183SFREr112AACGCAAACTACCACCCACCSFRP5 eAf113GGACGTTGGGTTGAGTTAGGAchr10:99520910-99521018109SFRP5 eAr114ACGACCCTACAACTCCCCTASFRP5 eBf115GGTGTTCGAATTGTACGGCGchr10:99521073-99521179107SFRP5 eBr116CTACGCGCCGCTCATAAAAASFRP5 eCf117GCGCGTACGGTTTCGTATAGchr10:99521183-9952125775SFRP5 eCr118ATACTCGCTCTTTACGCCCGSFRP5 eDf119TAGAGCGGTAGGTCGGTAGGchr10:99521393-9952147179SFRPS eDr120AACAAACCGAACCGCTACACCHST11CHSAf121GCGGCGTGGGAATGAATTTT+ CHSAf122GGGCGGCGTGGGAATGAATTTTchr12: 103376278 - 103376397120CHSAr123CTTTCCCTCGCACCCCTAAACHSBf124TGCGAGGGAAAGTTTGGGTTchr12: 103376386 - 103376508123CHSBr125CCGCGTTACCCGAAAAACTTCHSCf126TTTTAGGGGTGCGAGGGAAAchr12: 103376377 - 10337646286CHSCr127CGCAACCGAACTACTCACCCCHSDf128GTGCGAGGGAAAGTTTGGGTchr12: 103376385 - 103376510126CHSDr129ACCCGCGTTACCCGAAAAACHST11 eAf130TTTTTTTGGTTGTCGGGTCchr12:103375901-103376009109CHST11 eAr131CGAAACCCGAAACACGTACHST11 eBf132AGAGTGGTCGGGTGTTTAGCchr12:103376031-103376179149CHST11 eBr133ACGTAACCCAAAAACTCGAAACHST11 eCf134GTCGTTTTTTAGGGGTGCchr12:103376371-10337646999CHST11 eCr135TAAACTTCGCAACCGAACTACHST11 eDf136TATTAAGTTGCGTTTGGGTCchr12:103376781-103376889109CHST11 eDr137AAAACCGTATCCCTACGCFOXA3FOXAf138CGAGGTAGGAAGTTTTGCGGchr19: 51071936 - 51072038103FOXAr139CGACTCCTCCCGCGAAATAAFOXBf140CGGGGTGTTGTTGTAGGGTTchr19: 51072158 - 5107225093FOXBr141AATCACACCTACCCACGCCFOXCf142TAGGGCGGTTAGGTTTGGGGchr19: 51072076 - 51072203128FOXCr143GACGAATAACCCCACCCTCCFOXDf144TTGTCGCGTTGGTTTTTCGTchr19: 51071765 - 51071867103FOXDr145ACCTTTCTCTCGACCCCAATFOXEf146CGTTTTGTCGGTTGCGTGTTAchr19: 51071734 - 5107182491FOXEr147ATTCCCCGACCTACCCAAAACFOXA3 eAf148GGTAGGTGATAACGTTAGTGGGTTchr19:51068615-51068724110FOXA3 eAr149ACCTCCATCCCCTACCCAACFOXA3 eBf150AGTAGGGGGAGGTGGTTTTGchr19:51069110-51069244135FOXA3 eBr151TCCTCCTCCCCAACTTAACCFOXA3 eCf152AGTTTGGGTGTGGCGGTTTAchr19:51070046-51070156111FOXA3 eCr153ACCAACTTCGCCATATTAACCATTBK1TTBAf154CGCGGTGTATTGTGGGTAGTchr6: 43319189 - 4331928799TTBAr155CCTTCCGACCCGAATCATCCTTBBf156GGTCGTCGGAACGTGATGTchr6: 43319101 - 4331918686TTBBr157GCCAACATCAACACCAACCCTTBCf158TCGTTTTGTCGTTGTCGTCGchr6: 43319212 - 43319318107TTBCr159TTAAATAACCCGCTCCCTCCGTTBDf160GTCGTGATGTTAGAGCGGGCchr6: 43319130 - 43319255126TTBDr161ACCCCGATCCTCCTTAAACGTTBK1 eAf162TTAAGGAGGATCGGGGTCchr6:43319239-4331932991TTBK1 eAr163TCAATACGACGTTAAATAACCCTTBK1 eBf164TGGAGTTAAGCGGGTGGTAGchr6:43319008-43319148141TTBK1 eBr165CCCGCTCTAACATCACGACTCTAL1pbTAL f166GTATTGTCGCGGGTTCGTTCchr1: 47470631 - 47470738129pbTALr167CTCAACCAATCCCCACTCCCmbTAL f168GTTTTAGGTTTCGTTAGTATGGGchr1: 47470570 - 47470698129+ mbTAL r169CAAATTAAAATAAATCATTTAACCCATAAmbTAL r170TTAAAATAAATCATTTAACCCATAADMRTA2pbDMRTA f171CGAAGATTTCGTAGGCGGGTchr1: 50659325 - 50659469145+ pbDMRTA r172ACGACGCAAATAACGCTACGCApbDMRTA r173GACGCAAATAACGCTACGCAmbDMRTA f174TGTTTTAGAAGCGGGAGAAAGmbDMRTA r175AAATAAAACCCCCGTATCCAAT+ mbDMRTA f176AATGTTTTAGAAGCGGGAGAAAGchr1: 50659041 - 50659153113+ mbDMRTA r177AAAAATAAAACCCCCGTATCCAATDMRTAexp Af178GCGGCGGTTAGCGTTAGTTTTTCGGTAGchr1: 50659366 - 50659489124DMRTAexp Ar179CGAAACGCCAACGTATCATAACGACGCAPDE4BpbPDE f180ACGTTTTAGGGACGGCGAATchr1: 66030622 - 6603069877pbPDE r181AATCCCAACGACCGTCTACCmbPDE f182TTTCGTTTTGTATTTATGGTAGATGTchr1: 66030580 - 66030694115mbPDE r183CCAACGACCGTCTACCACTABARHL2pbBARHL f184CGTGGTATGGATTTCGGGGTchr1: 90967266 - 90967376111pbBARHL r185ACTCCTAACCCTAAACGCGAmbBARHL f186GTTTTTTTCGGTTTTTGTTCGAmbBARHL r187TTTCTCCCAATTCCAATATCCA+ mbBARHL f188TGGTTTTTTCGGTTTTTGTTCGAchr1: 90967815 - 9096790086+ mbBARHL r189ACTTTCTCCCAATTCCAATATCCATBX15pbTBX f190GCGATCGGCGATTGGTTTTTchr1: 119331668 - 119331767100pbTBX r191GCGACGACACACGACCTAAAmbTBX f192TGAGGTTTTAGGTCGTGTGT+ mbTBX f193GGTGAGGTTTTAGGTCGTGTGTchr1: 119331740 - 119331881142mbTBX r194AAAACCTTAATCGACTCAAATAAAARUSC1,C1o rf104pbRUSC f195GGGTGTAGTTGCGTAGCGTAchr1: 153557280 - 153557421142pbRUSC r196CCGAACCCTCCTCACCAAAAmbRUSC f197TAGTTGCGTAGCGTAGGGTAchr1: 153557285 - 153557410126mbRUSC r198TCACCAAAATCCTCCTAAAACGNG4 BpbGNG f199ACGTAGTGTTGGTAAGATTTGTAGAchr1: 233880823 - 233880971149pbGNG r200ACAAAAACCGCTTATAAACGACGAmbGNG f201GTAGGTTTTUGCGTIGGAGATTchr1: 233880677 - 233880817141mbGNG r202ATTTTCGTTACTTCTICTATTCCCAAAPOU3F3pbPOU3F f203GGGGTTTCGCGTTTTGAGTTchr2: 104836866 - 10483694479pbPOU3F r204AACACCAAAACCCCCGCTAAmbPOU3F f205AAAAGTAATTAATCGGAACGGTchr2: 104836837 - 104836970134mbPOU3F r206ACACTTTCCCAAATACAAAAAAABOLL B / CpbBOLL f207TTTCGAGTCGGGGCGTTTTAchr2: 198359264 - 198359401138pbBOLL r208TACCTAACCGCTCGCTCTCTmbBOLL f209GTTCGGTTTTGGGATTTTTmbBOLL r210AATCCCAAAAACCGACTCT+ mbBOLL f211GAGGGTTCGGTTTTGGGATTTTTchr2: 198359331 - 198359461131+ mbBOLL r212ACCAATCCCAAAAACCGACTCTTRIM71pbTRIM f213CGGAGGAATUTGTGTCGTCGchr3: 32834331 - 32834440110pbTRIM r214CACCAAAACAACGCTACCCGmbTRIM Af215TTGGGAATTTTTTCGTTTATchr3: 32834188 - 32834337150mbTRIM Ar216TCCTCCGAATAACTTAAAAACCmbTRIM Bf217TCGTTGGATAGTGGTATTTAATGTchr3: 32834348 - 32834497150mbTRIM Br218AAAATCACCGACTCACTCAASLC2A2pbSLC f219CGGAGTACGC;CGGTAGGAAchr3: 172228914 - 17222899380+ pbSLC r220AATACCCCGAAAACCCGCTAATApbSLC r221ACCCCGAAAACCCGCTAATAmbSLC f222ATGATATTTTGTAGGAAAGCGTchr3: 172228748 - 172228850103mbSLC r223CAAATTCCGTTTCTAAAAAAACCYTL1pbCYTL f224GGGTTCGTATGCGGGAGTAGchr4: 5071974 - 5072099126pbCYTL r225ACGAAACTACACCAACGCCTmbCYTL f226GGGGGTTTTCGTTAGGAGTAGchr4: 5072020 - 5072142123mbCYTL r227AAACCGCCCTAAACCACCSHISA3pbSHISA f228GAAGGGCGGTAGCGATAGTTchr4: 42094543 - 42094650108+ pbSHISA r229CTACGAATTCCGCAAACCGAAApbSHISA r230ACGAATTCCGCAAACCGAAAmbSHISA f231ATTGTTTTTGTCGGCGTTchr4: 42094569 - 4209465486mbSHISA r232TACACTACGAATTCCGCAAGABRA4pbGAB f233GCGTGCGTATATTCGCGTTT+ pbGAB f234CGGCGTGCGTATATTCGCGTTTchr4: 46690291 - 4669038595pbGAB r235AAATTCCGCCTCCCCTAACCmbGAB Af236TTTAGCGTTTAATGTGTATGTAGAchr4: 46690411 - 46690545135+ mbGAB Ar237CGAAATTACTATCGAAACAAACTTACmbGAB Ar238AAATTACAATCGAAACAAACTTACmbGAB Bf239GTTTTGAGTAGGGTGCGAGmbGAB Br240AAAAAAACAAAATTCCGCCT+ mbGAB Bf241GATGTTTTGAGTAGGGTGCGAGchr4: 46690248 - 46690398151+ mbGAB Br242AAACGAAAAAAACAAATTCCGCCTEGFLAMpbEGF f243TGGTAGCGTTGTAAGGTGGGchr5: 38293231 - 38293359129pbEGF r244AAAAACAAACGCGACCCTCGmbEGF f245TCGAGTTTTGGTAGCGTTGTAAchr5: 38293223 - 3829330684+ mbEGF r246AATACCCCGCAAAAAAAATCTACAmbEGF r247CCCCGCAAAAAAAATCTACAC5orf39pbC5orf f248ACGAGAAATTGGCGCGTTGAchr5: 43076304 - 43076404101pbC5orf r249AACAACACCCTTTACGACGCmbC5orf f250TGTTTGTTAGGGTTTTGTTTTAAmbC5orf r251CGCCAAAACGAATATTTATTTA+ mbC5orf f252AATTGTTTGTTAGGGTTTTGTTTTAAchr5: 43076267 - 43076390124+ mbC5orf r253CGACGCCAAAACGAATATTTATTTACDO1 BpbCDO f254GGTAGCGTAGTGGATTCGGGchr5: 115180192 - 115180333142pbCDO r255CTCGTCCTCCCTCCGAAAACmbCDO f256GTTTGTTTTATTTCGTGGGGAGchr5: 115179983 - 11518006785mbCDO r257CCAACTCCTTAACTCGCTCAAIRF4 B / CpbIRF f258TCGCGGGAAACGGTTTTAGTpbIRF r259GCCCTTAACGACCCTCCG+ pbIRF f260TTTTCGCGGGAAACGGTTTTAGTchr6: 336451 - 336550100+ pbIRF r261GCGCCCTTAACGACCCTCCGmbIRF f262CGTTTTGTAAAGCGAAGTTT+ mbIRF f263GTTATACGTTTTGTAAAGCGAAGTTTchr6: 336298 - 336405108mbIRF r264AAACCAATCAATCACTAAACTACAID4 BpbID Af265GGTTTTTGGGCGTCGTGTTAchr6: 19945064 - 19945170107pbID Ar266AAATTCACTCTCCACCGCCCpbID Bf267AGGCGAATAATGAAACGGAGGAchr6: 19944950 - 19945083134pbID Br268TAACACGACGCCCAAAAACCmbID f269ATTTTACGGATGGAGTGATG+ mbID f270GGAATTTTACGGATGGAGTGATGchr6: 19945031 - 19945148118mbID r271CTTATCCCGACTAAACTACTAAAAAASCAND3, GPX5pbSCAND f272AATTCGTTTCGCGACGTGAG+ pbSCAND f273TTAATTCGTTTCGCGACGTGAGchr6: 28618249 - 28618359111pbSCAND r274ACACGCCTTAAAACCTACTCATmbSCAND f275CGTGAGGGAGAATTTAGGAGchr6: 28618265 - 28618368104mbSCAND r276TAAAAAAACACACGCCTTAAAACCTADDAH2pbDDAH f277TCGTTTAGCGAGCGTTGTTTchr6: 31806112 - 3180621099pbDDAH r278GATCCGCCGTTACGCTATTCmbDDAH f279TGTTAGAAATCGGTATCGTTTAmbDDAH r280TCTACGAAACGTTTACAACC+ mbDDAH f281TTTTTITGTTAGAAATCGGTATCGTTTAchr6: 31806097 - 3180618997+ mbDDAH r282AAAATCTACGAAACGTTTACAACCCOL11A2pbCOL f283TTTAGGGATCGCGTTCGGAGchr6: 33269259 - 33269402144pbCOL r284AAACTCCTTTCCCTCTCATACmbCOL f285CGGAGTTTTTAATCGGATATchr6: 33269274 - 33269415142mbCOL r286TCCCTTCTCTTTAAAACTCCTNT5E BmbNT5E f287GTCGGATTTTATTTTAATCGTGmbNTSE r288AAACAAAAAAATCTCAAAAACTAAAA+ mbNTSE f289GTTGTCGGATTTTATTTTAATCGTGchr6: 86215769 - 86215912144+ mbNTSE r290CTTAAACAAAAAAATCTCAAAAACTAAAASIM1 BpbSIM Af291GTTAGGGGCGAGGCGTTTATchr6: 101019614 - 10101969582pbSIM Ar292CGAAACCTAAACGCGCGAAApbSIM Bf293AGGTTAATAGGTGGCGCGTTchr6: 101019077 - 10101917195pbSIM Br294CCCGCAACTCCGCGATAATApbSIM Cf295AGTCGTTTTTCGCGCGTTTA+ pbSIM Cf296CGAGTCGTTTTTCGCGCGTTTAchr6: 101019667 - 10101975690pbSIM Cr297GACCCGACACCCTAAACTCATmbSIM Af298AGGCGTTTATTGGTTAATAGGGchr6: 101019624 - 101019757134+ mbSIM Ar299CGACCCGACACCCTAAACTCATmbSIM Ar300ACCCGACACCCTAAACTCATmbSIM Bf301TTTAATTTGGGTTTTAAGTTTGAGGchr6: 101018944 - 101019075132mbSIM Br302ACGCTACTAAACCCCGCTTATRGS17RGS17 Af303GCGTTTAGGTGCGACGCchr6: 153493700 - 153493820121RGS17 Ar304ATACCCCGACGAAAACGACRGS17 Bf305TTTGGGATTTGGTCGAGCchr6: 153493620 - 153493730111RGS17 Br306AAAATTAAATCCCGCGTCGCAPDS2CAPDS Af307CGTTTAGGTTTGTGGACGCchr7: 121743823 - 121743951129CAPDS Ar308AAAAACGAAATCGCTAATACGCMSCMSC Af309TTTTTCGAATTTTGCGCMSC Ar310AACACGCTCCGACTAACTTC+ MSC Af311GGTTGTTTTTCGAATTTTTGCGC +chr8: 72918397 - 72918531135+ MSC Ar312TAAACACGC'-'CCGACTAACTTCMSC Bf313CGTTCGCGTTATTATTTGCMSC Br314CGCCCAATAACAACTCGT+ MSC Bf315ATTATCGTTCGCGTTATTATTTGCchr8: 72918698 - 72918852155+ MSC Br316CCTCGCCCAATAACAACTCGTSPAG6SPAG6 Af317GTCGAGTCGCCTTACGATCchr10: 22674453 - 2267452977SPAG6 Ar318CTACCCTCCTCGAACTCTACGINAINA Af319GTTTTCGGAGGGAAATTTTAGINA Ar320AAACCATCTACATCGAAATCGC+ INA Af321GTGGTTTTCGGATGGGAAATTTTAGchr10: 105026593 - 105026715123+ INA Ar322AACAAAACCATCTACATCGAAATCGCFLIFLI Af323TTTTTAGGAGTAAGTATTTTGTGTGchr11: 128068870-128068981112FLI Ar324CCCTCTTCCCCCCTACTAATATPSG2ATP5G2 Af325TAGGTATATTTCGGTCGGCchr12: 52357363 - 52357478116ATP5G2 Ar326AACTCGAAACCTCATCCGUSP44USP44 Af327ACGGGAGGGTAAATTTAGCchr12: 94466977 - 94467090114USP44 Ar328TACCAAACAATTCGACGTTAPOU4F1POU4F1 Af329GCGTACGTCGGTTTATTCPOU4F1 Ar330ACGCTCTACGCGATCAAA+ POU4F1 Af331AAGTGCGTACGTCGGTTTATTCchr13: 78075512 - 78075652141+ POU4F1 Ar332GCGACGCTCTACGCGATCAAALHX1LHX Af333CGAGCGATTGTGGGGTTAGAchr17: 32368543 - 3236862482LHX Ar334CAACTCGCGACCGCCTAAAHINF1BHINF Af335TTCGGGCGTTTATAGAGTTCchr17: 33176898 - 33177017120HINF Ar336AAAATCAAAACGCGAACGHINF Bf337TAGCGTCGCGTTAGAAAGCHINF Br338ATCGCTCAANACCTAACGAA+ HINF Bf339TTTTAGCGTCGCGTTAGAAAGCchr17: 33177225-33177341117+ HINF Br340AAAAATCGCTCAAAACCTAACGAAHINF Cf341AGGTTTAGTTTCGAAATCGCHINF Cr342AACCGAACGATCCCTAA+ HINF Cf343GTTAAGGTTTAGTTTCGAAATCGCchr17: 33177654 - 33177773120+ HINF Cr344CTAAAAAACCGAACGATTCCCTAAGALR1GALR1 Af345GAATTTTTGGAAAAGTCGGGAGALR1 Ar346CTCCTACAAAAAAAACTCCC+ GALR1 Af347TTCGGAATTTTTGGAAAAGTCGGGAchr18: 73090886 - 73090989104+ GALR1 Ar348CGACTCCTACAAAAAAAACTCCCMAST1MAST1 Af349AGAAGGTGGCGGTAAGCMAST1 Ar350ACGTAATTAAAAAAACACGCC+ MAST1 Af351GGAGAAGGTGGTCGGTAAGCchr19: 12839386 - 12839533148+ MAST1 Ar352AAAACGTAATTAATTATAAAAAACACGCCMAST1 Bf353TAGTTTTTTGGAGGCAGAGGchr19: 12839568 - 12839670103MAST1 Br354ATCCTCGTCCTCTTAAAAAACCPXM1CPXM1 Af355GTCGAGTTTGGGATTTTGGTCPXM1 Ar356AAACTCCTACTCGCCCTAACC+ CPXM1 Af357GGGGTCGAGTTTGGGATTTTGGTchr20: 2729097 - 2729214118+ CPXM1 Ar358AAAAACTCCTACTCGCCCTAACCNEURL2NEURL2 Af359TCGAGTTGGATAAGGCGTACchr20: 43952304 - 43952445142NEURL2 Ar360CCGATAACACGACCGACATANEURL2 Bf361TGTATGTCGGTCGTGTTATCchr20: 43952424 - 4395250582NEURL2 Br362TAAACGTACTACCTCCGACCACVRL1ACVRL1f363GGATGTGGGHGGTTCGGTTCGGGTGchr12:50587308-50587443136ACVRL1r364CCGCTCGCCCCTCGCTAAAACTACAAFF3AFF3f365GGCGCGAGGTAGTTTTAGTACGTAGTTTTTchr2:99542180-9954225778AFF3r366ATAACAACGTCGTCCTTTCCGCAAAACGAKR1B1f367GGGGATTTTGTAAGTTCGCGCGTGGTTTchr7:133794143-133794250108AKR1B1r368ACACTCTCCGCGCGACCTATATTAACGAAKR1B1AKR1B1R_f369GGAGACGGTTTGTTATGGTTGTTGCGTTchr15:43266838-43266959122AKR1B1R_r370ACGCCCTTTCTACCGACCTCACGAACTAALDOCALDOCf371TTTTTCGGGGGCGTGGTTTGTATGTTTchr17:23928071-23928193123ALDOCr372TACCTAACGAAACGCTCACTCCACCTCGALOX5ALOX5f373TTTTGCGGTAGGTGAAGGCGTAGAGGTchr10:45234654-45234759106ALOX5r374GACCGAATACCCCGCTTTCTCTCTCGACALOX5R_f375GAGGTCGAGAGAGAAAGCGGGGTATTCGchr10:45234729-45234838110ALOX5R_r376AACGCTCTCAACCCAACCCCTAAACTCAALX1ALX1f377AGGATAGTAGCGGTGAGTCGTTAGCGTTchr12:84198385-84198501117ALX1r378CGCTCCCACTTTTCTCCTTTCTCCCTCCALX4ALX4f379TTTTGATAAAGTGGGGAGGGCGTAGGGGchr11:44289270-44289375106ALX4r380ACACTCTCAAATACCCGTCGCGCTCTATC1orf230C1orf230f381TTTTGATAAAGTGGGGAGGGCGTAGGGGchr1:149960830-14996092192C1orf230r382ACACTCTCAAATACCCGTCGCGCTCTATC1orf230R_f383AGCGTAGCGAGTTGGAGTAGTTGCGAAchr1:149960685-149960805121C1orf230R_r384CGACGACTCTCTTCCCAATCTAAAACCCCAC6orf186C6orf186f385CGGAGTTTAGAAGGGCGTTCGGTTACGGchr6:110785585-110785700116C6orf186r386CTCCACGAATCGCATCTTTCAATACCCAC17orf64C17orf64f387AAAGGTGGTTCGAGTGAGGAAATTGCGGchr17:55853711-5585378979C17orf64r388GCGTCCCTAAACGACACACGACGAAATCC17orf64R_f389GTCGACGGCGGTTTTATCGTATTGTCGCchr17:55853578-55853689112C17orf64R_r390CCTTCTCCCGAACCTTCCTTCGTATCCTC19orf41C19orf41f391TTAGAGGTATGGCGGGGTTTTTGTGACGchr19:55358254-5535834895C19orf41r392AATACTCCCTAAACCTCCTAACCGCGCCCCDC67CCDC67f393GAGGTTTAATGTTTCGTTGGTCGCchr11:92703424-92703546123CCDC67r394ACGCAAAACCGCGTATATCACCTCCDC8CCDC8f395GGTTTTAGGGACGCGGTTGGAATTTGGGchr19:51608460-5160854889CCDC8r396CCCAACGCCTCGACCATATTAAATAACTTCD38CD38f397GCGATTAAGGCGTATCGGTGGGTATTGCchr4:15389377-15389501125CD38r398AACACCACCCGACGAACTCTCGACTAACCD8ACD8Af399TAGGACGTTGTTTGGTTCGAAGTTCGGGchr2:86871471-8687156999CD8Ar400CTCCGAACCGACCGAAAAACGCAACTTTCDH23CDH23f401GGCGGGGTATTGTTTTGTTTCchr10:72826313-72826423111CDH23r402TCTACCGATATCATAACACCGACTCDK5R2CDK5R2f403AAAGGTAGAGGGAAGGAGAGTTGTTTTTchr2:219532251-219532354104CDK5R2r404ACTCCTACCTCCTCCGAATCCTAAAACCTCHST2CHST2f405CGGAATGAAG GTGTTTCGTAGGAAGGCGchr3:144322486-144322636151CHST2r406GCTACGACACCCAACGACCCATCGAAACLCN1CLCN1f407AATGATTTTGTTGGGTTCGGTGGAGCGGchr7:142752740-142752852113CLCN1r408CCGACAACTCCGCGCCATCTCTTAAACCLCN1R_f409TTGTGTTTTGAGCGTAGGTTGCGCGTAGchr7:142752798-14275287477CLCN1R_r410GCCTTCCCGTCGTAAAACAACTCCGACACOL16A1COL16A1f411GTTTTAGGGGGTTGGGGGTTTGTTAGGGAchr1:31942237-31942382146COL16A1r412AACCCGAAACGAAACTATACACCCCGCACPNE8CPNE8f413TCGATGTTCGTAGTGTTGTTGTAGCGGTchr12:37585569-37585689121CPNE8r414CCATCCCCGUCTAACGAAAACTAACCCTDIO3DIO3f415CGTTTCGAGAAGAAGTTTCGCGGTTGGTchr14:101095917-10109600589DIO3r416ATCTAAACCCAAATCGAAAACCGCCGCCDNM3DNM3f417TTGGAGTTGTCGTAGATCGTCGTGGTGGchr1:170077504-170077626123DNM3r418AAATCGCCCCACTACCGCATCCTTACTCDNM3R_f419GCGGTTAGGTGTGGTAAAGTAGTTGGCGchr1:170077283-170077405123DNM3R_r420GCGCACAACCAACCTATAAACTCCGACGDUOX1DUOX1f421GGGATTTIGTGAAGGCGGATTTGchr15:43209229-4320930779DUOX1r422AATATTCCG CGATACCGAAAACCCGAEMX1EMX1f423CGGTTGGAGCGCGTTTTCGAGAAGAATchr2:73005041-73005163123EMX1r424AACGCAAAACAAACCGCGACCGAAAATAEMX2OSEMX2OSf425AGGAGAAGTCGTAGCGGGCGTCchr10:119291932-119292032101EMX2OSr426GACTAAACCTTCTACCGCCCACCGESPNESPNf427TAGTTGCGACGGGGTGGGAAGTTACGTTchr1:6430246-6430357112ESPNr428AAAACCATCGCCATCCACGAAAACGACAEVX1EVX1f429AGGAGGATGATAGTTTAGAAAGAAGAGGGTchr7:27248900-27249019120EVX1r430CGCGACCGCGACGATAACGATAAAAACTFABPSFABP5f431GAAACGTGTAGGCGTCGGCGTTTATGAGchr8:82355078-8235515780FABP5r432CGACCTCTCGAACGCCTCCTACAAACAAFBRSL1FBRSL1f433GTGGAGGAGGAAGTTCGTTTCchr12:131575948-131576052105FBRSL1r434AACTACTACCAAACACGAAACGCAFLI41350FLIf435GGTTAGAGTCGGTTGCGTAGTTTchr10:102979731-102979855125FLIr436TTTTTGTTAGGCGAAGTATAGAGAGCGFOXG1FOXG1f437TTTTTCGATGGTCGACGGCGAGAGAGchr14:28305617-2.8305740124FOXG1r438TTTCCGAACTACAAACGCACACTAAAACFOXL2FOXL2f439GATTCGTATGGGTTTTATCGAGTTTCchr3:140148670-14014876495FOXL2r440ACTTAAAAATAAACTCGCCCGTACGFZD2FZD2f441TCGTTGGTGAAGGTGTAGTGTTCGTTCGchr17:39990814-39990938125FZD2r442TAACGCGCGCGCTCACAAATAAAACGACFZD2R_f443TTTTTAGTGGTTCGAGCCGTTTGCGTTGCchr17:39990969-3999105991FZD2R_r444TCCGTCCTCGAAATAATTCTAACCGACGCHIF3AHIF3Af445CGTGGTATAGTTAATCGCGCGGCGTchr19:51492066-51492190125HIF3Ar446TACAACCCCAACGCCATAACTCGCCAATHIVEP3HIVEP3f447TGTCGTCGTCGTCGGGGTTTTGTTATTTchr1 :41901039-4190111476HIVEP3r448ACGACGATAAACTCCCGCTAAACCCGAAHIVEP3R_f449GAACGAGGATTTGCGTTTTTGGATCGCchr1:41901096-4190117580HIVEP3R_r450CCTAAACTCCTCTACATATTCCTCTACCTHLA-FHLA-Ff451GAATGGTTGCGATATGGGGTTCGACGGchr6:946778-946902125HLA-Fr452CCACGATATCCGCCGCGATCCAAAAACHOTAIRHOTAIRf453TAAGGGTCGGTTGTTGTTTTTTTTCchr12:52645919-52646034116HOTAIRr454ACCGACGCCTTCCTTATAAAATACGHOXA10HOXA10f455TGTGGGATAATTTGGCGAAGGGAGTAGAchr7:27180403-27180526124HOXA10r456AACTCGAAATTAACTACGAACGCCCGCCHOXD11HOXD11f457GGCGGGGGTAGTTTTTGTATTAAGGCGAchr2:176680987-176681111125HOXD11r458CCTACGCTACTACTCTTCTCGACCCCCGHOXD8f459CGTTTCGTTCGTCGGTCGTAGCGATTGchr2:176702636-176702749114HOXD8r460CCGACGAAACATTTTCGCACCACAACACHOXD8HOXD8R_f461CGCGGTTTCGGGGTATACGGAGTTTTTGchr2:176702549-176702668120HOXD8R_r462GCAATTCAATCGCTACGACCGACGAACGHSPA12BHSPA12Bf463CGTCGTAGCGGGTACGGTTAACGAGTTGchr20:3661361-3661485125HSPA12Br464TTTCTCCACCCGAAACGCCCGACAACCISL1ISL1f465CGGGGGAGAACGGTTTGAGTTTCGAGTAchr5:50714776-50714885110ISL1r466TCATATTTCAACCTCGCCGCCGCTAAACIntergenic 1Int1f467AGTAGGGATCGTCGTTCGTTGTTCGGTGchr11:68379573-68379679107Int1r468GACAAACGACCGAAAATACTCGCGCAACInt1R_f469TTTTACGGTCGGGGCGATAGTTGAAGGTchr11:68379395-6837949399Int1R_r470TCACGCCAATACCCGCTAATCCCTCCTAIntergenic 2Int2f471GGGGATGGATAATTTTTAGGCGTTAACchr17:69460223-69460339117Int2r472TAACCTCGTCTTTATCCCCGCGIntergenic 3Int3f473AGTGTGTAGTCGTTTGTGGGTGAGGAGTTchr8:95315865-95315994130Int3r474CACCGCGAAAAACGCCCACAATCTTACCInt3R_f475CGCGGGGGAGTTTATTTTTGAGGATTCGGchr8:95315775-95315892118Int3R_r476ACTCCTCACCCACAAACGACTACACACTIntergenic 4Int4f477TAGTATTTGTACGGAGTTTTTCGGCGGTCchr5:43054172-4305426392Int4r478TACGACGCAACCAACGATACTATCACCAAIntergenic 5Int5f479TAGTGATTGGTTATTTGGGCGCGGGGCchr10:43138416-43138530115Int5r480AAACGACATCCATCATCTCCCTCGACCCIntergenic 6Int6f481AGGTCGCGTTTTGGTCGTGCchr3:14827613-1482768876Int6r482ACTTAAAAATAAACTCGCCCGTACGIntergenic 7Int7f483ATTTTACGTAGGGTGGGGTTGAGGGCGTchr12:52897799-52897910112Int7r484ATCCTAACCGTCCCGCCTCAAAACCGTAIntergenic 8Int8f485CGTCGTAGTATTTGGCGGCGCGTTTCchr2:236737778-236737883106Int8r486AACGTACCTAATCCCCAAACCCACTCCTIntergenic 9Int9f487TCGTTGTGCGCGTTTCGTTTGTTGGATTAchr6:778755-77884692Int9r488TCGATAATATCTCCGTCGCCTCCGCAAAIntergenic 10Int10f489GCGCGTTTAATCGTGGGATTTTTGGGAGchr2:174899379-174899494116Int10r490CAAATTCGCGACACCCTACCCCAACACInt10R_f491GGGTGTCGCGAATTTGGGGTAchr2:174899479-174899602124Int10R_r492CTAAACCTCCCCCCTCCCAAATTTACCTIntergenic 12Int12f493ATCGAGTTTTTAGCGGTTTTTGGGGCGGchr1:119344866-119344974109Int12r494ACTAACATCGCGCACTTAAATCTTTCCGIntergenic 13Int13f495GGTAGCGGCGGGTAAAAAGTCchr7:64675119-64675225107Int13r496TACAACTTTTTACCTCCGCCGCIntergenic 14Int14f497CGTCGATTTGCGGAATTTCGTCGTCGTTchr1:238227938-238228045108Int14r498ACATCCGCGTAAACTCGCCCTTTAACACInt14R_f499TTTCGGGATTAGGGTTTCGGAGGGTGTCchr1:238227822-23822791392Int14R_r500CGTATCGATCCGTCCCTCCCGCTTAAAAIntergenic 15int15f501CGGTTTTGGTGGTAGTTTTGGTAATCchr19:48895723-4889580280Int15r502AAAACCTCCCGAACGACGAAATAATCCAInt15R_f503GTAGGCGGTCGGAACGTGAACchr19:48895536-48895660125Int15R_r504CGATAAAAACTACAATAACTCGACAACCAIntergenic 16Int16f505GTTGTGAGGGTTTTCGGCGGTATCchr1:54713046-54713165120Int16r506CATAACAACGCGCGACCCCTAIntergenic 17Int17f507TGATTATAAATTAGGGGGTTTGGTCGTCGchr12:61311832-61311945114Int17r508AAACCCTCCACCCTCGCAATACTACTCCIntergenic 18Int18f509TGTAGGAGATAATGGGAGTGAAGAGGGAchr6:4971256-497133883Int18r510TTCCACGAAACGCGCGACTTCCTAACTAInt18R_f511GTTGAGTTASGAGAGGCTCGATAGCchr6:4971467-4971570104Int18R_r512CCCGAAAACAACGACTATCGAAATCCAAIntergenic 19Int19f513ATAAGGTTT3GTGGAAGCGTAGGAGCGTchr6:3177175-3177289115Int19r514ACGCCGAATAAAAATCCCGCAACCACAAIntergenic 20Int20f515GGAGGGGAGGAGATAGCGTTATTTAGGGchr10:118912740-118912842103Int20r516AAACAAAACCCGAAACCCCACCTACACCIntergenic 21Int21f517GCGTGGTAGTTGAGGATGTAGACGTGGTchr16:45381613-45381736124Int21r518TCCGAACTACTTAAARAATCCCCGCCGCCIntergenic 22Int22f519TCGTTGGTTGTGATTTTTATGCGGGCGTchr8:68037259-6803735799Int22r520ACCTCTCCGATAAACCAAATCCTCCGCCInt22R_f521CGGGTGAGGTTTGCTGGTTAATTTCGCGTchr8:68037556-68037675120Int22R_r522CTCAACCAAACTACAACGTTCCCGCCTCIntergenic 23Int23f523AATGGAGGCGTAGATTAACGAGCGGTGTchr5:42987147-42987254108Int23r524ATCCTTAACAACCCCGCCGACTAACGTCInt23R_f525ACGGGTACGGAGAAACGTCGGATTTAGTchr5:42987852-4298794695Int23R_r526TCCCCGCGACACTCTACCTATAACGTCCKCNH8KCNH8f527CGTTTGGCGGGTATTGTTGTTCchr3:19164879-1916497193KCNH8r528CCCGACGCAAACTCCCTCTCKCNJ2KCNJ2f529GAAGTTGTTTTTTAGGGGTTTGCGCchr17:65676355-6567644086KCNJ2r530ACTCAAATCTACCCTCGCTTCAACGKCKN4KCNK4f531GCGCGGGGGTATTTTGGAGGGTTAGTTAchr11:63816449-63816549101KCNK4r532TCCCTACTCGCCCGCTACGACTATAACAKCNK17KCNK17f533CGGATTTTGTTTTCGGGAGTCGTTCGGGchr6:39390031-39390150120KCNK17r534AACTAAACGCCTAACCCTTCCCTCCCACKIAA1751KIAAf535TTCGTTTTGTTTTTCGGTTGGAGCGGGTchr1:1925171-1925288118KIAAr536TATAACCTAACCCTTCAACCGCGCCTCGKIAA1751R_f537AGGCGGCGGITTTTGGCGATTGTITTTTCchr1:1925065-192514076KIAA1751R r538TTCCGTTACCATAAAACTACCCGCCCCLASS1LASS1f539GATTTCGCGTATCGTCGTGTCchr19:18868171-18868273103LASS1r540TAATATCCCCCGTACCCCCCGLOC25516 7LOCf541TTTCGATAATAGCGTTTTTGCGGCGTGGchr5:6636474-6636619146LOCr542CAAAAACACGCGACCTACGCCCTCCTAALRRC4LRRC4f543CGAGTCGGA3TGAGCGTTAAGTGAGGGGchr7:127459680-127459780101LRRC4r544CCTATCAACGACCACCCAACTACTCCCTMIR155HGMIR155HGf545TCGGGTTTAGCGTCGTTTGTAGTTTCGGchr21:25856335-2585643096MIR155HGr546AAAAACGTCTCCTTAATTCCCCGCGCTTNEXNNEXNf547GCCGTTGGAGTAGAAGTGTTAGCGGTTAGAchr1:78126913-78127036124NEXNr548TCACCCTACAAAAACCGATAACCGACGANKX2-1NKX2-1f549AGTTGGTTATAGGCGGCGAATTGGGTTTchr14:36057307-3605739791NKX2-1r550TCAACACCCCCTCTCCTAACCTCTCCAANXX6-2f551CGGGGAAGAGTTTCGGTTCGCGTTTTAGchr10:134449988-134450110123NXX6-2r552CCCTCCTATAACCCCGACCTACCCGAAANKX6-2NKX6-2R_f553GCGCGGTAGGTGTTTTTCGGGTTGTAAAchr10:134449796-13444989297NKX6-2R_r554ACCTTTACCTAACTACACTCCCATCCAANOTUMNOTUMf555AGAGTAGGTCGTGGGGGATTCchr17:77512836-7751292287NOTUMr556CGCGCTAACCGCGATAAAAACNRN1NRN1f557AGGAGCGGGAGAGGGAAAAATAGTTAAGchr6:5952635-5952759125NRN1r558ACTACGCCCLAAACTCAACTACTAAATPLTPPLTPf559TGGGAACGGGATAGGGACGCGTTTTAATchr20:43974093-4397418492PLTPr560GAATCCCCTAAACTACCCGCCATCCCACPLTPR_f561TGTACGCGTATTTTTGGAGGGTGGTTTGCchr20:43973871-4397395080PLTPR_r562CGATCTAATCGACCACCTCCTCTCCTCCPRDM13PRDM13f563AAGTTTCGTCGAGTTGGGGTCGTTGGTTchr6:100168753-10016884492PRDM13r564GACCCTTCCC GACAACCATCTCGAACAPRDM15PRDM15f565GAAAATTGCCCGGTTGGGTTAGTAGGGGchr21:42110148-42110259112PRDM15r566ACCTACAAATACCGTCCCCACCCGAAACPTGDRTGDRf567AAGAGGGGTCTGATTCGCGAGTTTAGATchr14:51804089-51804198110TGDRr568CCGCGCGCGACTCGAACGAAAAARECKRECKf569AAGGGTGCGATGTTTTCGTTTAGGATCGchr9:36027398-3602748588RECKr570TAACTAACTLAAACCGCGATAAAACGACTRTN4RL1RTN4f571TGGTAATCGCGTAGGTGTGTGATAGGGCchr17:1827825-1827931107RTN4r572AAAATACAAAATACGCCCCCGACCCCGARTN4RL1R_f573TGAGGAGAGATTCGGAGTAGTTAGTAGAchr17:1827743-1827851109RTN4RL1R_r574CCCTATCACACACCTACGCGATTACCAASFRPSSFRPSf575TTTCGAAAAGTTGGTAGTCGGCGGTTGGchr4:154929548-154929670123SFRP5r576CATTCTACTCCCCCGAATCGAAACCCCCSFRP5R_f577AAGAGGAAGAGTTCGCGCGTCGAGTTTAchr4:154929355-154929454100SFRP5R_r578GAAATCGCGCGCCCACGATACTACAAAASHFSHFf579TTATTAGTACGCGGCGTCGGGGGTTchr15:43266978-43267127150SHFr580CGAAAACCCCTACTCCGAAAAATCGTCCGSHFR_f581GTTGAGATATCGAGGGGTTCGGGTTAGGchr15:43266838-43266959122SHFR_r582CGCCAACAACGATAAAATAAATACCGCGCCSHOX2SHOX2f583CGTTTGTTCCATCGGGGTCGTACGAGTATchr3:159304063-159304162100SHOX2r584TTTCCGCCTCCTACCTTCTAACCCGACTSNCASNCAf585GGTTGGGGGAGTGGGAGGTAAATTCGTTchr4:90977105-90977221117SNCAr586CTAAACGCTCCCTCACGCCTTACCTTCASNX32SNX32f587TTGAGGGAAACGCGGTGGGAATCGTTTTchr11:65357939-65358057119SNX32r588CCGTAACTCGCCCGAAAAACTAACCGAASP9SP9f589TGATTGGTTGCGGGGTAGTTTCchr2:174907826-17490791186SP9r590ACACCCGCTTTAAAATACCGCTAASTK33STK33f591GCGTTTCGGGTCGTTCGTTTTATTTCGCchr11:8572140-8572262123STK33r592CGACAACCTACGCCGAATATACGCACCTSYNGR3SYNGR3f593GAAGGGATGAGGTTGAGGTTGGAGGTCGchr16:1981075-1981195121SYNGR3r594ACCTCCTACCCACCAATTCCGAAAAACAATTf595TTACGGAGTTTTAGGCGGCGTTACchr6:166501979-166502099121Tr596CATTTCCCTCTCTACGCGCGAACTHBS2THBS2f597CGTAGGTTTTGTTGGAGCGAGAGATCGGchr6:169395805-16939589894THBS2r598ACATATAAAACCGCGCTACCCGAAAACCGTLXINBTLX1NBf599TGAAAGGGGAGAGGGGAATGTTATTGTTchr10:102871413-102871518106TLX1NBr600AATATTCTCGCAAACCCACCGCCAAACCTMEM22TMEM22f601AAAGAGATTCGTGTTGCGGCGGATGAAGchr3:138021575-138021691117TMEM22r602GATCAACACTCGAACCCGAACTTTCCGCTNFRSF10 DTNFRSf603AAGGGAGGAGGGTGGATCGAAAGCGTTAchr8:23077397-2307747579TNFRSr604CGAAAACCTTTACACGCGCACAAACTACGTXNRD1TXNDR1f605TATGGGTTGGTCGAGGGTAAGGTAGTGchr12:103133710-10313378879TXNDR1r606ACCATCGCCGTTCTTACCTTTCGTCTACAVSTM2BVSTM2Bf607TTTTTAATTCGGTTCGGCGTTGATTTGTchr19:34711435-34711559125VSTM2Br608ACAACCGCGCGCTCCCGATACZFPM2ZFPM2f609TAGCGCGGAAGTTGTGAGTTTAAGGCGchr8:106401146-10640124196ZFPM2r610TCCTCTAAACACCATCGAAACCCCCGAACZNF280BZNF280Bf611AGTGGCGTTCGTTGAGATTAGGGAAGGGchr22:21192757-21192877121ZNF280Br612ACCGTACGCTACCGAAACGACCTTTACALOC10537 8683LOC105 Af613GTTTGTAATTGGTATGAGCGGCchr1: 43023566-43023673108LOC105 Ar614ATAACGAAACGACGCCTCLOC105 Bf615GTAATTGGTATGAGCGGCGTchr1: 43023570-4302366091LOC105 Br616GCCTCCGCGAAATAAAACCATLOC105 Cf617AGTTAGAGTAGGTTAGGGGATchr1: 43023464 43023613150LOC105 Cr618ACGCGTAACACAAACACGACNPHS2NPHS2 Af619GGGGGATTTTAAAGATCGTCchr1:177811721-177811842122NPHS2 Ar620GACGAACGCAATCCACAANPHS2 Bf621TGGTGGAGTTGTGGATTGCGchr1:177811817-17781189175NPHS2 Br622TCCCACCCAAACCTCTCTCTNR5A2NR5A2 Af623GGTGCGTTTACGGGTTTCchr1:198278389-198278538150NR5A2 Ar624ACCTAATCCGATATTTCCCGANRSA2 Bf625GGTAGGGTTTCGGTTGCGTAchr1:198278432-198278527139+ NR5A2 Br626TATTTCCCGAAAACTCCACATCCANR5A2 Br627TCCCGAAAACTCCACATCCAPAX6PAX6 Af628ATTTGGATGTTTCGCGTTTCPAX6 Ar629TATCGCTACSACCCGACTAA+ PAX6 Af630GTTAATTTGATGTTTCGCGTTTCchr11:31783206-31783322117+ PAX6 Ar631GTTTATCGCTACGACCCGACTAAPAX6 Bf632AGGGGAGTCGCGTTTTTAGGchr11:31782520-31782652133PAX6 Br633TCCCGACCGAAACCCAAATCKCNE3KCNE3 Af634GAATAACGGCGTAAGTTTTTACchr11:73855818-7385591598KCNE3 Ar635ATCCTCCCGAACGCAATAKCNE3 Bf636TTGTACGTTTGTGGGTGTGGAchr11:73855765-73855914150KCNE3 Br637TCCTCCCGAACGCAATAATCGKCNA6KCNA6 Af638TTAACGGTTAGGTTAGATCGCchr12:4789322-4789421100KCNA6 Ar639CAATCTCTAAAACGCGACACKCNA6 Bf640CGGGTGTCGCGTTTTAGAGATchr12:4789399-478948284KCNA6 Br641TTCTCCGATCTCATACCCCCTTMEM Af642GAGAAAAGT TGTTTCGGTCTMEM Ar643GCTACGTCTCTACTATCCGA+ TMEM Af644CGGGAGAAAAGTTGTTTCGGTCchr12:127317663-127317786124+ TMEM Ar645CCGCTACGTCTCTACTATCCGATMEM132 CTMEM Bf646TTCGGGGTGAGGGTAGTCTMEM Br647CCGACGCCCAACTAAAAA+ TMEM Bf648GAGTTCGGGGTGAGGGTAGTCchr12:127318043-127318179137+ TMEM Br649GAATCCCGACGCCCAACTAAAAATMEM Cf650TTTTCGGGTTACGGGTCGTTchr12:127317330-12731742495TMEM Cr651ACGACTCCTCCGAAAATCCGPDX1PDX1 Af652GTCGATTTTTGTTTTGAGCchr13:27390195-2739028086PDX1 Ar653TAAAAATAATCTACCGAATCGCPDX1 Bf654GGCGTTAGCGGGGATTTAGAchr13:27389563-27389694132PDX1 Br655CGCATCAAACGAAACCCTCCPDX1exp Af656CGGGAAGGTGTTCGTTTAATGGTTCGGTchr13:27389489-27389590102PDX1exp Ar657GTTTCCGCTCTAAATCCCCGCTAACGCCPDX1exp Bf658GGAAAAAGGAGGAGGATAAGAAGCGCGGchr13:27396588-2739668598PDX1exp Br659CTCGCCGAAAATCACGACGCAATCCTACEPSTI1EPSTI1 Af660TAGGGGAGGCGTCGAGTTCchr13:42464253-42464369117EPSTl1 Ar661ACTCGCTAAACGTCCCAACCA2BP1A2BP1 Af662GAGTTTAGGGGTCGCGTCchr16:6009425-6009564140A2BP1 Ar663CAATACCGCCGCCTCTACTAA2BP1 Bf664GAGAGAGTAGGAGCGGATCGchr16:6009706-6009842137A2BP1 Br665ACAAATCAACCCCGCCCTAACRYMCRYM Af666AGTGAGTGTTCGGGAGTTTCCRYM Ar667TCATTTATTAAAAACGCGCG+ CRYM Af668GCAGTGAGTGCTCGGGAGCCCCchr16:21202786-21202934149+ CRYM Ar669GGTTTTCATTTGTTAGAGGCGCGCGCRYM Bf670CGGGTTCGCGTAGGATTAGGchr16:21202650-2120273283CRYM Br671ACTCCTCATCCCAACACCCTPRKCBPRKCB Af672GTTCGTAGTTCGCGGTTTCPRKCB Ar673CGATACTCTCCTCGCCCT+ PRKCB Af674TCGGTTCGTAGTTCGCGGTTTCchr16:23754928-23755052125+ PRKCB Ar675GCACGATACTCTCCTCGCCCTPRKCB Bf676TTGGGCGAGTGATAGTTTCchr16:23754821-2375490989PRKCB Br677GACCGCTACTACACCCGAPRKCB Cf678CGGTAGAAGAACGTGTATGAGGTchr16:23755076-23755216141PRKCB Cr679GCTACCCTCGAAAACCCGAAIRF8IRF8 Af680GATTTTTTTTAAGGTCGCGCchr16:84490230-84490341112+ IRF8 Af681TTACGATTTTTTTTAAGGTCGCGCIRF8 Ar682ACTATACCTACCTACCGCCGTCIRF8 Bf683ATTTCGAAGAAGGCGGGTCGchr16:84490149-84490276128IRF8 Br684CTCCAAACGATACGCCAACGSALL3SALL3 Af685TTTTGCGGGTAAGCGTTCSALL3 Ar686CCACAACTCTCTCGACGAC+ SALL3 Af687TGTTTTTTGCGGGTAAGCGTTCchr18:74841456-7484155196+ SALL3 Ar688GCCCACAACTCTCTCCACGACSALL3 Bf689ATTTCGGGAAAGGGTGGGTCchr18:74840051-74840163113SALL3 Br690ACCCTAATCCCCCTTCACCASALL3 Cf691TTTCGTTTCGTTTCGGTCGCchr18:74840452-74840573122SALL3 Cr692AACCCGCCCGAACTCAAATALYPDSLYPDS Af693ATTAGGAGCGTACGTTTATTCchr19:49016646-49016788143LYPDS Ar694TACGCACTCAAACACAALYPD5 Bf695CGGCGCGTTTTAAGGGTTTTchr19:49016738-49016863126LYPDS Br696ATTACTCTCACCTCCGCACGDPP10DPP10 Af697GATTGCGGGAAGAAGGTACDPP10 Ar698AAACGAAACCAAACGACAA+ DPP10 Af699CGGATTGCGGGAAGAAGGTACchr2:115635638-115635739102+ DPP10 Ar700GACGAAACGAAACCAAACGACAADPP10 Bf701TTTTCGAGTTTGAAGCGTTCDPP10 Br702CGACTCTCACCTAATCCGC+ DPP10 Bf703CGGTTTTCGAGTTTGAAGCGTTCchr2:115635947-115636088142+ DPP10 Br704TACCGACTCTCACCTAATCCGCDPP10 Cf705TTACGACGGGGAGTTCGTTCchr2:115635821-115635943123+ DPP10 Cr706CTTAACAACGTTCGCAAATCACGADPP10 Cr707ACAACGTTCGCAAATCACGAC20orf56C20orf Af708GTTCGTTATTTCGGAATTCchr20:22507658-22507804147C20orf Ar709CCGACCGATAAAATATAATTCC20orf Bf710GGGAGGGATTTAAGCGGGAGchr20:22507684-22507819136C20orf Br711CCCCCTTCACTAATCCCGACSOX2OTSOX2OT Af712AGTGTTGAGAGTCGACGCchr3:182919951-18292004292SOX2OT Ar713AATAAAATAACCCGAACCGCSOX2OT Bf714GGGTTACGGTTTCGGGTTGTchr3:182919884-18291996986SOX2OT Br715CGCGTCGACTCTCAACACTACDKL2CDKL2 Af716GGTCGAGTCGAGTCGTTACCDKL2 Ar717AAAACGCCTCCTAACGAA+ CDKL2 Af718ATTGGTCGAGTCGAGTCGTTACchr4:76774785-76774935151+ CDKL2 Ar719ACAAAAAAACGCCTCCTAACGAACDKL2 Bf720TATTTTTGGGCGAAGGCGTTGchr4:76774698-76774806109CDKL2 Br721GTAACGACTCGACTCGACCAMARCH11MARCH11 Af722TCGGCGTTTTCGTTTTTCchr5:16232623-1623269775MARCH11 Ar723CGACGACACAACCATAAACTTTMARCH11 Bf724AAGGTTTTGTAGTTGCGGCGchr5:16232839-1623293597MARCH11 Br725TCTCACGCGCAACCGAATCCL28CCL28 Af726GTGGAGTTTTAGGTAGCGCCCL28 Ar727ACCCGCGATAAACTAAACC+ CCL28 Af728AGGGTGGAGTTTTAGGTAGCGCchr5:43433001-43433128128+ CCL28 Ar729AACAACCCGCGATAAACTAAACCCCL28 Bf730TGTAGTCGTGGTTGTCGTGGchr5:43432695-43432834140CCL28 Br731CCAAATAAACGACGTCCCGCAP3B1AP3B1 Af732ATTTTATAGTCGCGTTAAAAGCchr5:77304383-77304519137AP3B1 Ar733ACTTTTATTACTCGCGATCCAP3B1 Bf734GGTAGGGTGAGTTTGGTCGGchr5:77304339-77304484146AP3B1 Br735CGCCGAACCACGTAAAAACTCARD11CARD11 Af736ATTTGGGGCGTTTATGTTTCchr7:3049825-3049944120CARD11 Ar737CCCTCGAAAAACGACTCCCARD11 Bf738AGGGGTTGTAGGGTCGGG+ CARD11 Bf739TTTAGGGGTTGTAGGGTCGGGchr7:3049955-3050087133CARD11Br740ATTTTACATTTCCCTCCCCCGCBLACEBLACE Af741AGAATAAAAGTAGGCGGCchr7:154859246-154859384139BLACE Ar742TCTCGAAACCAAAATAAACGBLACE Bf743AGTAGGCGGCGGATTTGTAGchr7:154859254-154859357104BLACE Br744CCGAAAATACGCGAAATCAACCPTPRN2PTPRN2 Af745GAGGAGATAAAGGTGTCGCPTPRN2 Ar746AACGTACCTAACCCGAAAAC+ PTPRN2 Af747TCGGAGGAGATAAAGGTGTCGCchr7:157176188-157176342155+ PTPRN2 Ar748CCAACGTACCTAACCCGAAAACPTPRN2 Bf749GACGGTTTCGGTAGGGTCPTPRN2 Br750CCGAACCGAATATAAAACGA+ PTPRN2 Bf751CGGACGGTTTCGGTAGGGTCchr7:157176379-15717646385+ PTPRN2 Br752GCGCCGAACCGAATATAAAACGARUNX1T1RUNX1T1 Af753TTAGGTTCGTAAAGAGGGCchr8:93183286-93183401116RUNX1T1 Ar754TTAAAACCACGTCCGAATARUNX1T1 Bf755TTTCGGGCGGGAGTTATAGGchr8:93183412-93183529118RUNX1T1 Br756ACGCGCTCTAAACTCAACCGL1TD1L1 TD1 Af757GCGCGTGGGGTTCGTAGCGTTTTAAGchr1:62433357-62433465109L1 TD1 Ar758TTACCCGAAACACCCCGCGCCCTTCPPFIA3PPFIA3 Af759AGATACGGAGATTTAGCGCGAGATCGGTchr19:54337953-54338094143PPFIA3 Ar760AAATTAACCGCCGAACACTCACAATACGFILIP1LFILIPIL Af761TTGTAGTGTCGCGTTGCGAGTCGATTGTchr3:101077651-101077753103FILIP1L Ar762ACAATAACGTAACGCCCATAAACCGAACGNUDT16PNUDT Af763GAGGACGGGTGAATCGTGGTTTGTTGGchr3:132563775-13256385884NUDT Ar764ACTACGATAATCAAAACGCTCCACGCGATOP2P1TOP Af765GTGCGCGTTTAGTAGGGCGAGAATGGchr6:28283268-28283417150TOP Ar766CGAAAACCAAATCCGAACCACCGTCTCCTOP Bf767TGATTTGGGTGGATGTAGAGGTTGTGGTchr6:28283447-28283568122TOP Br768TTTCGAATAACGCTACTCCGAACCGCGAUNKWN1UNKWN1 Af769TTGAGAGTAGGGATTGTGGTGCGTCGTCchr5:72634694-72634838145UNKWN1 Ar770CTAACTCCCGAACGCTACATTCGCTCCAGALR3GALR3 Af771GGTTGTGGTGAGTTTGGTTTACGGGCGchr22:36550907-36551049143GALR3 Ar772CGTAAAACGCGACCACCGCCAACATAPRSS27PRSS Af773GGGAGGTTATTCGTAGGATTTGGCGCGGchr16:270S610-2705748139PRSS Ar774ATCCTAACGACTACGCACTACTTCCGCASLC7A4SLC Af775GAGTTCGTTTAGTTCGTCGGCGTCchr22:19716858-19717005148SLC Ar776AACCCCGATAAACTCCGATAACGACCTLEF1LEF1 Af777AGAGTTGGGGGCGGTATAGTTAGGGTGTchr4:109307444-109307547104LEF1 Ar778TTCAATCCCTACGACCCCAACGCCTAAANFICNFIC Af779CGTGGATACGAGTTTTGGCGGCGATTATchr19:3386117-3386219103NFIC Ar780GCCACCAACCCTACCTCCTTCCATATCCNFIC Bf781TTTTTCGGTTTGAGTTATCGTGGCGGGAchr19:3386234-3386379146NFIC Br782CCGAACCGTACTTCCAACCAAACGCAACTTMEM90BTMEM90 Af783TAGGAAGGGGTCGATGTTGGTTTGGGTTchr20:24398648-24398747100TMEM90 Ar784TCTCACCAACTCCCATCGAATTCGCACATMEM90 Bf785GTTTTGGTTTCGTTTCGGAGCGCGTAGAchr20:24398510-24398642133TMEM90 Br786TTTCTCTACCGACTCAACTCCCCCTCCCUBDUBD Af787TCGGTTGCGTAAATCGCGTTTTTGGTTGchr6:29629437-29629564128UBD Ar788TTCTCGATAATATCTCCGTCGCCTCCGCGIPC2GIPC Af789GTTTAGGGGTGGAGGTCGGGGTTTTGAchr1:78284199-7828428991GIPC Ar790CCGAACCCCGCGCAAATAAAAACAACCTEFNA4ERNA Af791GGGGCGCGTTTTTATGGAAAGTTAGGGTchr1:153310423-153310549127ERNA Ar792CTACGCCCTAAAACACGCCTCGACTTCTERNA Bf793TGTGCGAAAGAGACGCGGGGTTTAGTTAchr1:153310139-153310288150ERNA Br794CCCGTAATCGCTAAAACATCCGCCCTTADRD4DRD4 Af795CGTCGGGCGATGCTTGGTTTGTTCGTGchr11:627035-627175141DRD4 Ar796GCGACGCTCCACCGTAAACCCAATATTTATCTEX1D1TCTEX Af797CGGGGAGGGTCGAGGGTTTTGTTTGAGchr1:66990668-66990782101TCTEX Ar798GCGTCCCAAACTTCATTCAACCGACGACPHOX28PHOX Af799GCGGACGTAGTAATGGATTAAACGGGGAchr4:41447111-41447255145PHOX Ar800AAATCCGACTCCCTACACTCCCGACTTTTSPAN33TSPAN Af801GGGGGTTGTGTTAGTTCTTTGTTTAGCGAchr7:128596487-128596593107TSPAN Ar802CGAAACTATTTCCCGCCAAACCGAACCCCA9CA9 Af803TTTCGGGCGGGAGTATCGGGTTTTGTAGchr9:35666101-35666239139CA9 Ar804GCTCCTTTACCCCTTCTCGACCAACTCCUNKWN2UNKWN2 Af805TTACGGATTTTATTTGTATTCGGAATCGTAchr10:102409232-102409335104UNKWN2 Ar806ACGCATCAAACTCGACACAAAATTTCATCWT1WT1 Af807GGTGTTTTCGTAAGACGGGGTAGTGGGTchr11:32406776-3240686994WT1 Ar808TTCTCCTCCGCTAARAAATCCGAATACGAOTX2OTX2 Af809AGGGATTGTATTTCGAGGTGGTCGAGGTchr14:56331673-56331781109OTX2 Ar810CCGACABRATCGAAACCTTCGCCCGAAACHOXB13HOXB13 Af811TCGCGGGTTATAAATATTTGGTTGCGGCchr17:44157793-4415788593HOXB13 Ar812GACCGCCACTACCTCGAAAACATTTCCCBRCALBRCA1 Af813GGTAACGGAAAAGCGCGGGAATTATAGAchr17:38530874-3853096895BRCA1 Ar814CCCACAACCATCCCCCGTCCAAAAAITPRIPL1ITPRIPL1f815TTTTGTACGTTGGGTTACGGGGGTTTGGchr2:96354715-96354857143ITPRIPL1r816TAAACGCGATAAACCCCTACGACCCCCAHES5HES5-F817TATCGGTTTTCGTAGTTGCGGGAGGAGGChr1:2451323-2451386118HESS-R818CCGAATAAACACCAAACTCGCCCGACGCCSRP1 / LOC 376693CSRP1 / LOC376693-F819CGGGTAGAGGGGAGGTAGGAATTGGAGAChr1:199775889-19977591480CSRP1 / LOC376693-R820CCGAATAAACGTCACCCCTACACACCGCALOX5ALOX5-F821TTTTGCGGTTAGGTGAAGGCGTAGAGGTChr10:45234681-45234732106ALOXS-R822GACCGAATACCCCGCTTTCTCTCTCGACPPM1H / M ON2PPM1H / MON2-F823AGGAGTAGTATTGCGAGGGTGGAGGGTChr12:61311943-61312001112PPM1H / MON2-R824TAAACCCGAAAAACAACGCCAATCCCGCKIAA0984KIAA0984-F825GGGGATTTGTTGTAGAGTCGTAGGAGAAChr12:63515983-6351604362KIAA0984-R826CCGCATCCCACCCTTTAAAACTCTATXNRD1TXNRD1-F827TATGGGTTGCGTCGAGGGTAAGGTAGTGChr12:103133737-10313376886TXNRD1-R828TACGACGACCATCGCCGTTCTTACCTTTCHST11CHST11-F829AAATTTGGATTGCGGGAGGGACGAGGTTChr12:103376469-103376538124CHST11-R830CTTCGCAACCGAACTACTCACCCCCGACEFSEFS-F831GGTCGTTGGAGTGGTCGTTTCGGTTTAGChr14:22904743-2290478598EFS-R832CCTCAAACCCCCGAACGCGCTAAATAAAANXA2ANXA2-F833GTTCGGGGAGGGAGGGAGATTCGTTTTGChr15:58478046-58478098107ANXA2-R834AACTCCCGACTTTAACCTCCCAACCCAARHCGRHCG-F835GTTGTAGGGGTGTTTGGTCGGGTTGGTAChr15:87840807-87840869118RHCG-R836ATCAACTACTCCGTACCCCACGTAACCGRARARARA-F837AGTCGGGGTGGTTGGTCGAAGAGGChr17:35718896-35718981137RARA-R838CCCTCTCAACTCGATTCAAAATTCCCCCPTRFPTRF-F839AAAGTAATAAGTGGTTTCGGGCGGAGTCChr17:37827277-37827326104PTRF-R840ACCCCGCATACCTACGAAAACGAAAACCRND2RND2-F841CGGGATTATGGAGGGGTAGAGCGGTCGChr17:38430910-3843095599RND2-R842ACGTCCTTAACGAACACCTACAACAACGTMP4TMP4-F843AGGTTTTGTAGTAGTAGGCGGACGAGGCChr19:16048446-16048512121TMP4-R844ACGAATACGAAACCCGAAACCGAAACGCHIF3AHIF3A-F845CGTGGTATAGTTAATCGCGCGGCGTChr19:51492259-51492376118HIF3A-R846TACAACCCCAACGCCATAACTCGCCAATKLKSKLK4-F847TAGCGGGGATTTATTAGGGGAGAGGTGGChr19:56107959-56108027123KLK4-R848ATCACCTACGAACACTATCCCTCACCCGAMOTL2AMOTL2-F849GCGGAATAGTCGCGGTTTTGGAATGTTChr3:135565786-135565856125AMOTL2-R850AAACGTTTCCGCTCCCCGAAAAACGAATSCGB3A1SCGB3A1-F851GGAGATAGTTTTGAGAGGGGGAGGTCGCChr5:179950858-179950923120SCGB3A1-R852CGCTACCTACGCCGATCGTAAATCCCAAHLA-FHLA-F-F853GAATGGTTGCGATATGGGGTTCGACGGAChr6:29799978-29800035112HLA-F-R854CGCGATCCAAAAACGCAAATCCTCGTTCHLA-J-1HLA-J,NCRNA00171-1-F855GGTTTTGGTCGAGATTTGGGCGGGTGAGChr6:30082430-30082476101HLA-J,NCRNA00171-1-R856CCCGAATCCTACGCCCCAACCAAATAAAHLA-J-3HLA-J,NCRNA00171-2-F857TGAGTGATTTCGGTTCGGGGCGTAGATTChr6:30083115-30083168125HLA-J,NCRNA00171-2-R858CGAAAATCTCTACAAATCCCGCAACCTCGPON3PON3-F859ATGGTTTCGGGGTGTTTAGCGGCGATTGChr7:94863624-94863674105PON3-R860AACGAAACCGAACGAACCCCAATCCGTALRRC4 / SN D1LRRC4-F861GAGTCGGAGCCGAGCGTTAAGTGAGGGGChr7:127459707-12745973077LRRC4-R862TCCCTCCGACCGACCCAAAATAACTACGPAHPAH-F863TTCGTTGTTCGTTTTGGGTAAAGGGAAGChr12:101835348-101835409116PAH-R864AAACTCGCTCCCCAAACTTCTAAAAATCEPSTI1EPSTI1-F865GGGGAGGCGTCGAGTTCGGAGTTTATTAChr13:42464282-42464345117EPSTI1-R866AAAACTCGCTAAACGTCCCAACCGCATCADCY4ADCY4-F867CGGGTATTGTTGGTTTAGGTTGTAGTAGGTChr14:23873644-23873710123ADCY4-R868CGACCCTAACCAACCCCGAAACTCGAAAHAPLN3HAPLN3-F869AGGGTAGAAAGGAAGCGGTAGTAGAAAAChr15:87239811-87239872116HAPLN3-R870ACAACAACTCCTCCCTTCGAACCCAACCHSF4HSF4-F871TGTGGGAGGGAAGGGAAATCGAGATTGGChr16:65762053-65762164113HSF4-R872ACGACAAAACGAAACCCACAATCCTACCCNBR1 / TME M106ANBR1 / TMEM106A-F873ATTCGGATTGGTTAGTTTTTGCGGAAGTChr17:38719260-3871929691NBR1 / TMEM106A-R874TTCGCCACGCAACAACCTAAAACGCTACHAAOHAAO-F875GGTTGCGGCGTTTATTTAGCGGGAAGTCChr2:42873761-42873822114HAAO-R876CTCGCCGAACCCGCGACGAAATCTACRARBRARB-F877TAGAGGAATTTAAAGTGTGGGTTGGGGGChr3:25444371-2544444112.5RARB-R878ACCAACTTCTCTCCCTTTACGCCTTTTTALDH1L1ALDH1L1-F879TGGGTTAAGTATTTGTTATGTGTTACGGAChr3:127382511-127382580121ALDH1L1-R880CGCTATCCACCCGAATACGCAACTHIST1H3GHIST1H3G-F881GCGCGGCGTTTTGTTATCGGTGGATTChr6:26379588-2637964760HIST1H3G-R882TCTAAAATAACCCGCACCAAACAAACTACAZSCAN12ZSCAN 12-F883TTATAAAGGTCGGAAGCGGTTACGGGGGChr6:28475534-2847557293ZSCAN12-R884AACCCCTTTCGCTCCCTTCCTAAAACGAHCG4P6HCG4P6-F885GTATGGTTGCGATTTGGGGTTGGAAGGGChr6:30002983-30003042114HCG4P6-R886GCCGCGATCCAAAAACGCAAATCCTAATHLA-J-3HLA-J,NCRNA00171-3-F887TAGGGAATGTTTGGTTGCGATTTGGGGChr6:30083115-3008316880HLA-J,NCRNA00171-3-R888TCCTTACCGTCGTAAACATACTACTCATEYA4EYA4-F889GCGTAAGTGCGAGGTTGTCGGTAGCChr6:133604154-133604229125EYA4-R890TTTCCCGCAACTCTTTCCCCCTCTCTHOXA7HOXA7-F891TGCGGTTAAAGAATTCGTTCGCGTTCGGChr7:27162955-2716298282HOXA7-R892CTAAACGCTCCCGCGAAACCTCCAAATCUSP44USP44 / p-F893TTCGGGTATTTTGAGGTTGTCGTCGGGAChr12:94466379-94466481103USP44 / p-R894GACGACGACGCGTCCGACGAATTTTACYP27A1CYP27A1 / p-F895GTTTTGGTCGGGGCGTCGTGGATATTTTChr2:219354932-219355042111CYP27A1 / p-R896AAAAACCAACTAAACCCCTTCCCGCTCGPRSS3PRSS3 / p-F897GTGTGGAAAGGGTTTGGCGGTTGTTAGGChr9:33740574-33740686113PRSS3 / p-R898CTCGCCAAATACGTCCACCCAAAAACGAC18orf62C18orf62 / p-F899TAGGAGGGGACGTAGAGTTTACGGCGAAChr18:71296729-71296833105C18orf62 / p-R900GAATACCCGACCCGACCCATCCATCACSFRP2SFRP2 / p-1-F901TGCGTTTGTAGGAGAAGTCGGGTTGGTTChr4:154929326-15492940883SFRP2 / p-1-R902ACTCTTCCTCGCCTCGCACTACTACCTASFRP2 / p-2-F903GTGCGATTCGGGGTTTCGAAAAGTTGGTChr4:154929535-154929641107SFRP2 / p-2-R904GAAACTACGCGCGAACTTACAACGCCTCSLCO4C1SLCO4C1 / p-F905GAGCGTAGAGCGTTGAGCGGGGChrS:101660047-101660169123SLCO4C1 / p-R906CGCCGCCGAATAACACGCCCACCOR01CCORO1C / p-1-F907AGCGGGGATTTTCGGAGTTGGAGAGTTTChr12:107686622-107686733112CORO1C / p-1-R908CTCCATCCGCCCGACCTAACCCTAAAAACORO1C / p-2-F909GGGAAGTGGCGTAGTGGGCGTTTGTATCChr12:107686752-10768684897CORO1C / p-2-R910TACCTCCAACGACCACGCCCACAAAATAKJ904227KJ904227 / p-F911TGGAGCGTTGAGTCGAAGTTTTGATTTTChr3:127489474-127489582109KJ904227 / p-R912TCTTACCCGAACTTTAACCCCAACCGCTC6orf141C6orf141 / p-1-F913GGTTGGGAGTTCGGAGTTGTAGTAGAGGChr6:49626357-4962645599C6orf141 / p-1-R914CTTTAACCGATTCAAACAACAAACGCCTC6orf141 / p-2-F915GTAGGGCGC3GGGTTTCGTTAGTTTCChr6:49626570-4962666899C6orf141 / p-2-R916ATCTACCGTTCTATCCTCGTAACCGCCGBC030768BC030768 / p-F917TCGTTTGGGAGGGATCGTTTTTGGGAGAChr1:26424688-2642476780BC030768 / p-R918AACCCGAATACTATCCAACTACCGCCGCDMRTA2DMRTA2 / p-F919CGAGCGTGGGTATTAAGTCGGTAGTGGAChr1:50657067-50657169103DMRTA2 / p-R920GACCTCAACCCCCTACGCCTAACCTACTHFEHFE / p-1-F921GTAGATCGCGGTTTTGTAGGGGCGTTTGChr6:26195692-2619578392HFE / p-1-R922CTAATTTCGATTTTTCCACCCCCGCCGCHFE / p-2-F923GAGTGTTTGTCGAGAAGGTTGAGTAAATChr6:26196140-2619622182HFE / p-2-R924CACCGCCCAACGCATTCGTTCTAAAATACADPS2CADPS2 / p-F925ATAAAAGTGGGGTGGGTGGCGGAGGGChr7:121744063-121744166104CADPS2 / p-R926GCGCCGAAATAACAACCCAACCTACCAACYTH4CYTH4 / p-F927TTTATCGGGGAAGTTTTCGAGGGTGGGCChr22:36050993-36051112120CYTH4 / p-R928TCCCAACTACCTCCTACGCACGAACGATIntergenic (Chr4)Chr4 / p-1-F929ATGAAATGTGGTTCGTGGAAGGTGTTTGTChr4:186174475-18617454975Chr4 / p-1-R930ACGACCCGAACGTTAATCCTCTTACTACNHLH2NHLH2 / p-F931ACGTAGTTTTCGAGTTAGTGTCGTTAGAAChr1:116172677-116172793117NHLH2 / p-R932GACAAACGCCTCAAACCCGACCGNRN1NRN1 / p-F933AGGAGCGGGAGAGGGAAAAATAGTTAAGChr6:5952635-5952767133NRN1 / p-R934CGCTCCAAACTACGCCCAAAACTCAAHMGCLL1HMGCLL1 / p-F935ATTAGAGTTGTTTTGCGTATTGCGGCGGChr6:55551934-5555203097HMGCLL1 / p-R936CAAATACCCCGTACACCCGCTACCCCAAMe3Me3 / p-1-F937GGGAGTTGAGGTTTACGCGGTTTCGTTGChr11:86061026-8606112499Me3 / p-1-R938GACCGCCAACGCGATCCACCCATTAACMe3 / p-2-F939AGTTTTGGAAGTAGATTCGGTGCGGGTGChr11:86060867-8606094882Me3 / p-2-R940GCCGCGCAATCGCCTCTTTTTCACIntergenic (Chr3)Chr3 / p-1-F941AGACGATAGATGGCGGGTAGGAAGGGAGChr3:135608250-135608374125Chr3 / p-1-R942GCCGCCTACAACCGACGAACTACAAATCIntergenic (Chr8)Chr8 / p-1-F943TCGCGGGTGAGGTTTGTGGTTAATTTCGChr8:68037553-68037676124Chr8 / p-1-R944GCTCAACCAAACTACAACGTTCCCGCCTNBPF1NBPF1 / p-F945TGAGAGGCGTATTTTGTTGGTTACGGTTChr1:146219493-14621957482NBPF1 / p-R946CGAAAACCATTCCGCTACCCTTCCAACTIntergenic (Chr10)Chr10 / p-1-F947GGGGCGTTGGGTTATGGAGATTACGTTTTChr10:42748953-42749053101Chr10 / p-1-R948GTCCCGCGCTTAACGAATTCTACGAACGASAP1ASAP1 / p-F949GTTCGGGTAGGGGTCGGGGGTCChr8:131524437-131524546110ASAP1 / p-R950CCCGAAACGACGTACTTAACGACCCGAAintergenic (Chr1)Chr1 / p-1-F951GGGAGGTTTGAGCGTCGAAGTTTTCGTTChr1:119352428-119352549122Chr1 / p-1-R952GCCCACTACCCCGCGAAACCTTATCAACPPP2R5CPPP2RSC / p-F953AGTCGTTAGGTTGTTAAGGCGCGTTGTGChr14:101317476-10131753459PPP2R5C / p-R954ACAAAAATAAAATCGAACCTAACCCCACGIntergenic (Chr2)Chr2 / p-1-F955CGTATTAAGGGTTAAGCGGCGCGGTChr22:44883312-4488340493Chr2 / p-1-R956AACTTTCTCGAACGACTCGATAAACCTAAKRT78KRT78 / p-F957AGGTTTTGGGAATTTGGAAGTTCGCGGGChr12:51554274-5155437097KRT78 / p-R958AAAAACGCTCGAACCCAACCAATCGACGLINC240LINC240 / p-1-F959AAAGGAAGATCGTGGGTAGTTCGTGCGChr6:27167780-2716785980LINC240 / p-1-R960ACTACAACTCACGTTTCCCCTCCAACACLINC240 / p-2-F961AGGTTTATTTGACGTTTTAGGTCGATAGTChr6:27172709-27172830122LINC240 / p-2-R962CGATCTCTCCCTTTCTTCCGCTTCCTAAIntergenic (Chr16)Chr16 / p-1-F963GGCGTCGGTTGCGGTTTTAGATChr16:53648145-53648269125Chr16 / p-1-R964ACGCGAAAATCTACCTTTTAATTACGAACCHIST1H3G / 1H2BIHIST1H3G / 1H2BI / p-F965TCGTCGGTGGTCGGCGCGTTTTTChr6:26379488-26379589102HIST1H3G / 1H2BI / p-R966AACCCGCACCAAACAAACTACACGCAAAPPM1HPPM1H / p-1-F967GAATGGTAGCGAGAGGTTGCGGGTTAGGChr12:61312222-6131231089PPM1H / p-1-R968CTCTACCCTCAAAATCGCGACGCAAACGPPM1H / p-2-F969AGGAGTAGTATTGCGAGGGTGGAGGGTTChr12:61311917-6131201296PPM1H / p-2-R970CGCCAATCCCGCTCCGACACTATAACAATUBB2BTUBB2B / p-F971ATAAGGTTTGGTGGAAGCGTAGGAGCGTChr12:3177175-317726288TUBB2B / p-R972ACGATATTCTAACCTCCGCCGCGAAACTC2CD4AC2CSF973GGTAGAGGGATAGGGAAGAGTTTGGCGTChr15:60146378-60146528150C2C5R974ATTCAAAACGCGCGCGACGAAATTCAACCOL19A1COL2F975GCGGAGTGGGAGGGTTATATTGGCGAGAGChr6:70633134-70633240106COL2R976CCGAACAAAACTACGACACCGCCGAAAADCDC2DCDSF977ACGACGGGTTGAGATAGGTGGTTGGATTChr6:24465938-2446602790DCDSR978CCCGACGCGAAACAACGAACTAAAACGADHRS3DGR2F979TTTTTGTACGTTTTCGGGGTCGGAGGAGChr1:12601840-12601942102DHR2R980AATCGCCGTCTAAACAAATCGCGAACTAGALNT3GAL1F981CGGCGGTCGCGGTTTGTAGTTTAGAATTGChr2:166358281-166358431150GAL1R982ACGCGCTTCCACTCCGACTAACAAATTAGAL3F983GGCGTCGTTCGGGTTAAGTTTGGTTGTChr2:166359152-16635923078GAL3R984CACAACTTACGCGAAACAACAACCTCGCHESSHES1F985TGGGTTGCTGTCGCGCGAATTTTTGTTTChr1:2451234-2451350116HES1R986CCTCCTCCCGCAACTACGAAAACCGATAHES3F987GTTGGGGGTTATGTTTGGCGCGGAATAGChr1:2451478-2451622144HES3R988CGCCTATATAAAACGTCGACGCGCGAAAHES4F989GTTCGGGCGTCGCGGTCGTTTTTATATTChr1:2453144-2453266122HES4R990AAAACGCCCATTATACCCGCGCCAATTCKILLINKILSF991TAAGAATCG3CGGTAGTTAGTAGGCGGGChr10:89611638-89611783145KIL5R992TCCTACGCCGCGACGAAAACAAAAACTCKIL6F993AGGTGGGGCGCGTTTATTAGTTTAGGGGChr10:89611428-89611578150KIL6R994ACCTCTCCATCGCTAATACCCTACCGCTMUC21MUC2F995GAGTGTTTCGAGGGTAGGAGGTTGTCGGChr6:31031426-31031559133MUC2R996CAAAAACCGCCCGCAAAACGAAACCTAANR2E1 / OS TM1OST3F997ACGGATCGATCGCGGTTTTGGTAAGGATChr6:108542828-10854291587OST3R998CGCAAAAACGAAAAACTACGTACGCGCTOST4F999GTTGTTTGAGGACGGGTCGTTTAGCGGChr6:108543090-10854318999OST4R1000ACCCCTATCCTACAACCCTACGAACGCAPAMR1PAM4F1001TTTCGGGAGGTGTGGTTACGTTTGGAGAChr11:35503958-35504077119PAM4R1002CCCCTCCTCCCAACACCCAACACTAAAASCRN1SCR2F1003GGTTGTGGTTTTTAAAAGGGAAAATTCGGGChr7:29996282-29996388106SCR2R1004TAAACGCCGAAACCCGAACGTAACAACCSEZ6SEZ3F1005AGGTGATTAGAAGGGAGAGGGGGAGGTTChr17:24371083-2437118097SEZ3R1006TCATTATACACGACGCGCCCCTCCAAATSEZSF1007TACGTGGGTGTAGGTTAGGTCGGGTTGAChr17:24371224-24371345121SEZ5R1008ACCACGCGACTACCGTATAAACAACCGAA EQUIVALENTS
[0215] The above-described embodiments are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art.REFERENCES
[0216] 1. How KA, Nielsen HM, Tost J. DNA methylation based biomarkers: practical considerations and applications. Biochimie 2012; 94: 2314-37. 2. Mikeska T, Craig JM. DNA methylation biomarkers: cancer and beyond. Genes (Basel) 2014; 5: 821-64. 3. Noehammer C, Pulverer W, Hassler MR, Hofner M, Wielscher M, Vierlinger K, et al. Strategies for validation and testing of DNA methylation biomarkers. Epigenomics. 2014; 6: 603-22. 4. Warton K, Samimi G. Methylation of cell-free circulating DNA in the diagnosis of cancer. Front Mol.Biosci. 2015; 2: 13. 5. Wittenberger T, Sleigh S, Reisel D, Zikan M, Wahl B, Alunni-Fabbroni M, et al. DNA methylation markers for early detection of women's cancer: promise and challenges. Epigenomics. 2014; 6: 311-27. 6. Usadel H, Brabender J, Danenberg KD, Jeronimo C, Harden S, Engles J, et al. Quantitative adenomatous polyposis coli promoter methylation analysis in tumour tissue, serum, and plasma DNA of patients with lung cancer. Cancer Res. 2002; 62: 371-5. 7. Esteller M, Sanchez-Cespedes M, Rosell R, Sidransky D, Baylin SB, Herman JG. Detection of aberrant promoter hypermethylation of tumour suppressor genes in serum DNA from non-small cell lung cancer patients. Cancer Res. 1999; 59: 67-70. 8. Mazurek A, Pierzyna M, Giglok M, Dworzecka U, Suwinski R, Ma UE. Quantification of concentration and assessment of EGFR mutation in circulating DNA. Cancer Biomark. 2015; 15: 515-24. 9. Ostrow KL, Hoque MO, Loyo M, Brait M, Greenberg A, Siegfried JM, et al. Molecular analysis of plasma DNA for the early detection of lung cancer by quantitative methylation-specific PCR. Clin.Cancer Res. 2010; 16: 3463-72. 10. Powrozek T, Krawczyk P, Kucharczyk T, Milanowski J. Septin 9 promoter region methylation in free circulating DNA-potential role in noninvasive diagnosis of lung cancer: preliminary report. Med.Oncol. 2014; 31: 917. 11. Lin PC, Lin JK, Lin CH, Lin HH, Yang SH, Jiang JK, et al. Clinical Relevance of Plasma DNA Methylation in Colorectal Cancer Patients Identified by Using a Genome-Wide High-Resolution Array. Ann.Surg.Oncol. 2014. 12. Philipp AB, Nagel D, Stieber P, Lamerz R, Thalhammer I, Herbst A, et al. Circulating cell-free methylated DNA and lactate dehydrogenase release in colorectal cancer. BMC.Cancer 2014; 14: 245. 13. Chimonidou M, Strati A, Malamos N, Georgoulias V, Lianidou ES. SOX17 promoter methylation in circulating tumour cells and matched cell-free DNA isolated from plasma of patients with breast cancer. Clin.Chem. 2013; 59: 270-9. 14. Chimonidou M, Tzitzira A, Strati A, Sotiropoulou G, Sfikas C, Malamos N, et al. CST6 promoter methylation in circulating cell-free DNA of breast cancer patients. Clin.Biochem. 2013; 46: 235-40. 15. Martinez-Galan J, Torres-Torres B, Nunez MI, Lopez-Penalver J, Del MR, Ruiz De Almodovar JM, et al. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumour tissue in breast cancer patients. BMC.Cancer 2014; 14: 59. 16. Matuschek C, Bolke E, Lammering G, Gerber PA, Peiper M, Budach W, et al. Methylated APC and GSTP1 genes in serum DNA correlate with the presence of circulating blood tumour cells and are associated with a more aggressive and advanced breast cancer disease. Eur.J.Med.Res. 2010; 15: 277-86. 17. Fackler MJ, Lopez BZ, Umbricht C, Teo WW, Cho S, Zhang Z, et al. Novel methylated biomarkers and a robust assay to detect circulating tumour DNA in metastatic breast cancer. Cancer Res. 2014; 74: 2160-70. 18. Avraham A, Uhlmann R, Shperber A, Birnbaum M, Sandbank J, Sella A, et al. Serum DNA methylation for monitoring response to neoadjuvant chemotherapy in breast cancer patients. Int.J.Cancer 2012; 131: E1166-E1172. 19. Sharma G, Mirza S, Parshad R, Gupta SD, Ralhan R. DNA methylation of circulating DNA: a marker for monitoring efficacy of neoadjuvant chemotherapy in breast cancer patients. Tumour.Biol. 2012; 33: 1837-43. 20. Legendre C, Gooden GC, Johnson K, Martinez RA, Liang WS, Salhia B. Whole-genome bisulfite sequencing of cell-free DNA identifies signature associated with metastatic breast cancer. Clin.Epigenetics. 2015; 7: 100. 21. Jones PA. Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat.Rev.Genet. 2012; 13: 484-92. 22. Cope LM, Fackler MJ, Lopez-Bujanda Z, Wolff AC, Visvanathan K, Gray JW, et al. Do breast cancer cell lines provide a relevant model of the patient tumour methylome? PLoS.One. 2014; 9: e105545. 23. Becker D, Lutsik P, Ebert P, Bock C, Lengauer T, Walter J. BiQ Analyzer HiMod: an interactive software tool for high-throughput locus-specific analysis of 5-methylcytosine and its oxidized derivatives. Nucleic Acids Res. 2014; 42: W501-W507 24. Lutsik P, Feuerbach L, Arand J, Lengauer T, Walter J, Bock C. BiQ Analyzer HT: locus-specific analysis of DNA methylation by high-throughput bisulfite sequencing. Nucleic Acids Res. 2011; 39: W551-W556. 25. Soreide K. Receiver-operating characteristic curve analysis in diagnostic, prognostic and predictive biomarker research. J.Clin.Pathol. 2009; 62: 1-5. 26. Madic, J. et al. Pyrophosphorolysis-activated polymerization detects circulating tumor DNA in metastatic uveal melanoma. Clinical Cancer Research: an official journal of the American Association for Cancer Research. 2012; 18: 3934-3941. 27. Bidard, F. C. et al. Detection rate and prognostic value of circulating tumor cells and circulating tumor DNA in metastatic uveal melanoma. International Journal of Cancer 2014; 134: 1207-1213. 28. The Molecular Taxonomy of Primary Prostate Cancer. Cell. 2015; 163(4): 1011-25.
Claims
1. A method for detecting a tumour, comprising: extracting DNA from a cell-free sample obtained from a human subject; bisulphite converting the DNA; amplifying multiple regions of the bisulphite converted DNA present in the sample using a plurality of PCR primers, wherein (i) amplifying with at least one primer set designed to amplify at least one methylation site having a methylation value at or below -0.3 in normal tissue; and detecting signals wherein at least one signal comprises methylation of at least two adjacent methylation sites within at least one region of the multiple regions; wherein the multiple regions are methylated in at least 50% of the tumours in a population of samples for a selected tumour type or tumour subtype and are not methylated in tissues and blood of subjects without tumours; wherein individual primers of the plurality of PCR primers are designed based on methylated DNA within individual regions of the multiple regions; wherein the presence of a tumour in the subject is indicated when signals comprising methylation of at least two adjacent methylation sites within the at least one region of the multiple regions are detected.
2. The method of claim 1, wherein (ii) the at least one primer set designed to amplify at least one methylation site has a difference between the average methylation value in the cancer and the normal tissue of greater than 0.3; and / or (iii) the at least one primer set comprising primer pairs designed to amplify at least one methylation site having at least one adjacent methylation site within 200 base pairs that also has: a methylation value below -0.3 in normal tissue; and a difference between the average methylation value in the cancer and the normal tissue of greater than 0.3.
3. The method of claims 1 or 2, wherein the at least one methylation site has a methylation value below -0.3 in normal tissue; and / or wherein the at least one methylation site has a difference between the average methylation value in the cancer and the normal tissue of greater than 0.3.
4. The method of any of claims 1-3, wherein the multiple regions of methylated DNA are determined by: obtaining data for the population of samples comprising a plurality of genomic methylation data sets, each of said genomic methylation data sets associated with biological information for a corresponding sample; segregating the methylation data sets into a first group corresponding to one tissue or cell type exhibiting a tumour characteristic, and a second group corresponding to a plurality of tissue or cell types not possessing the tumour characteristic; matching methylation data from the first group to methylation data from the second group on a site-by-site basis across the genome; identifying a set of CpG sites that meet a predetermined threshold for establishing differential methylation between the first group and second groups; identifying, using the set of CpG sites, target genomic regions comprising at least two differentially methylated CpGs with 300bp that meet said predetermined criteria; extending the target genomic regions to encompass at least one adjacent differentially methylated CpG site that does not meet the predetermined criteria; wherein the extended target genomic regions provide the methylation signature indicative of the tumour characteristic.
5. The method of claim 4, wherein: identifying further comprises limiting the set of CpG sites to CpG sites that further exhibit differential methylation with peripheral blood cells from control samples; or the predetermined threshold is indicative of methylation in the first group and nonmethylation in the second group; or the predetermined threshold is met in at least 50% methylation of the samples in the first group; or the predetermined threshold is a difference in average methylation between the first group and second group of 0.3 or greater.
6. The method of claim 4 or 5, wherein the tumour characteristic comprises one or more of: malignancy; a cancer type; a cancer classification; a molecular subtype classification; a cancer grade; a histological classification; a metabolic profile; a disease-associated mutation; a clinical outcome; and a drug response.
7. The method of any one of claims 1 to 6, further comprising determining sites of hydroxymethylation.
8. The method of any one of claims 1 to 7, wherein detecting comprises amplifying with primers designed to anneal sequences having at least one methylated site therein.
9. The method of claim 8, comprising one or more of: the primers are designed without preference of location of the at least one methylated site within target sequences; the primers are designed to amplify DNA fragments 75 to 150 bp in length; the primers are designed to amplify DNA fragments comprising 3 to 12 CpG methylation sites; each of the regions is amplified in sections using multiple primer pairs; the tumour signals comprise more than two adjacent methylation sites within the single sequencing read.
10. The method of any one of claims 1 to 9, wherein the detection of at least one signal is indicative of a tumour during one or more of: determining response to treatment; monitoring tumour load; detecting residual tumour post-surgery; detecting relapse; use as a secondary screen; use as a primary screen; monitoring cancer development; and monitoring cancer risk.
11. The method of any one of claims 1 to 10, further comprising determining a distribution of tumour signals across the multiple regions; and: comparing the distribution to at least one pattern associated with a cancer, wherein similarity between the distribution and the pattern is indicative of the cancer; or comparing the distribution to a plurality of patterns, each one associated with a cancer type, wherein similarity between the distribution and one of the plurality of patterns is indicative of the associated cancer type.
12. The method of any one of claims 1 to 11, wherein the tumour is a breast cancer tumour, a prostate cancer tumour or a subtype thereof, a colon cancer tumour or a subtype thereof, a lung cancer tumour or a subtype thereof, or a uveal melanoma cancer tumour or a subtype thereof.
13. The method of claim 12, wherein the regions comprise C2CD4A, COL19A1, DCDC2, DHRS3, GALNT3, HESS, KILLIN, MUC21, NR2E1 / OSTM1, PAMR1, SCRN1, and SEZ6, and wherein the tumour is uveal melanoma.
14. The method of claim 12, wherein the regions comprise ADCY4, ALDH1L1, ALOX5, AMOTL2, ANXA2, CHST11, EFS, EPSTI1, EYA4, HAAO, HAPLN3, HCG4P6, HESS, HIF3A, HLA-F, HLA-J, HOXA7, HSF4, KLK4, LOC376693, LRRC4, NBR1, PAH, PON3, PPM1H, PTRF, RARA, RARB, RHCG, RND2,TMP4, TXNRD1, and ZSCAN12, and wherein the tumour is prostate cancer.
15. The method of claim 12, wherein the regions comprise ASAP1, BC030768, C18orf62, C6orf141, CADPS2, CORO1C, CYP27A1, CYTH4, DMRTA2, EMX1, HFE, HIST1H3G / 1H2BI, HMGCLL1, KCNK4, KJ904227, KRT78, LINC240, Me3, MIR1292, NBPF1, NHLH2, NRN1, PPM1H, PPP2R5C, PRSS3, SFRP2, SLC04C1, SOX2OT, TUBB2B, USP44, Intergenic (Chr1), Intergenic (Chr2), Intergenic (Chr3), Intergenic (Chr4), Intergenic (Chr8), and Intergenic (Chr10), and wherein the tumour is aggressive prostate cancer.
16. The method of claim 12, wherein the regions comprise ALX1, ACVRL1, BRCA1,C1orf114, CA9, CARD11, CCL28, CD38, CDKL2, CHST11, CRYM, DMBX1, DPP10, DRD4, EFNA4, EPSTI1, EVX1, FABP5, FOXA3, GALR3, GIPC2, HINF1B, HOXA9, HOXB13, Intergenic5, Intergenic 8, IRF8, ITPRIPL1, LEF1, LOC641518, MAST1, BARHL2, BOLL, C5orf39, DDAH2, DMRTA2, GABRA4, ID4, IRF4, NT5E, SIM1, TBX15, NFIC, NPHS2, NR5A2, OTX2, PAX6, GNG4, SCAND3, TAL1, PDX1, PHOX2B, POU4F1, PFIA3, PRDM13, PRKCB, PRSS27, PTGDR, PTPRN2, SALL3, SLC7A4, SOX2OT, SPAG6, TCTEX1D1, TMEM132C, TMEM90B, TNFRSF10D, TOP2P1, TSPAN33, TTBK1, UDB, and VWC2, and wherein the tumour is triple negative breast cancer (TNBC).
17. The method according to any one of claim 1 to 16 wherein each region to be amplified is amplified with primer pairs listed for the respective region in Table 15.
18. A kit for detecting a tumour in DNA from a sample obtained from a human subject, comprising: reagents for carrying out the method of any one of claims 1 to 13 and 17; and instructions for detecting tumour signals; wherein detecting includes detecting multiple regions methylated in cancer from the DNA; wherein the multiple regions are methylated in at least 50% of the tumours in a population of samples for a selected tumour type or tumour subtype and are not methylated in normal tissues and normal blood cells; wherein the reagents comprise a plurality of PCR primers, wherein individual primers are designed based on the methylated DNA sequences of individual regions of the multiple regions and wherein the primers include a DNA sequence such that individual primers anneal to a methylated DNA sequence of individual regions of the multiple regions; wherein the reagents comprise two or more primers pairs identified in Table 15 and selected from the group consisting of SEQ ID NOs: 973-1008.