COMPOUNDS AND COMPOSITIONS FOR INTRACELLULAR ADMINISTRATION OF DRUGS

Description

RELATED APPLICATIONS

[0001] This application claims priority to, and the benefit of, U.S. Provisional Application No. 62 / 519,826, filed June 14, 2017.TECHNICAL FIELD

[0002] The present disclosure provides compounds, compositions comprising such compounds, and methods involving lipid nanoparticle compositions to deliver one or more therapeutic and / or prophylactic agents to and / or produce polypeptides in mammalian cells or organs. In addition to an amino lipid, lipid nanoparticle compositions of the disclosure may include one or more cationic and / or ionizable amino lipids, phospholipids including polyunsaturated lipids, PEG lipids, structural lipids, and / or therapeutic and / or prophylactic agents in specific fractions.BACKGROUND

[0003] The effective targeted delivery of biologically active substances such as small molecule drugs, proteins, and nucleic acids represents a continuing medical challenge. In particular, the delivery of nucleic acids to cells is made difficult by the relative instability and low cell permeability of such species. Thus, there exists a need to develop methods and compositions to facilitate the delivery of therapeutic and / or prophylactic agents such as nucleic acids to cells.

[0004] Lipid-containing nanoparticle compositions, liposomes, and lipoplexes have proven effective as transport vehicles into cells and / or intracellular compartments for biologically active substances such as small molecule drugs, proteins, and nucleic acids. Such compositions generally include one or more "cationic" and / or amino (ionizable) lipids, phospholipids including polyunsaturated lipids, structural lipids (e.g., sterols), and / or lipids containing polyethylene glycol (PEG lipids). Cationic and / or ionizable lipids include, for example, amine-containing lipids that can be readily protonated. Though a variety of such lipid-containing nanoparticle compositions have been demonstrated, improvements in safety, efficacy, and specificity are still lacking.

[0005] WO2017 / 201346 describes mRNA therapy for the treatment of Acute Intermittent Porphyria where the mRNAs are preferably encapsulated in lipid nanoparticles US 2012 / 295832 discloses amino-lipids that form lipid nanoparticles suitable for the intracellular delivery of biologically active compounds, such as nucleic acids.SUMMARY

[0006] The invention is defined in the appended claims. Embodiments not encompassed by the claims are provided for reference purposes. The present disclosure provides compounds and compositions, and their use in methods. In the present disclosure, all references to methods of treatment are to be interpreted as references to compounds or compositions for use in those methods.

[0007] In one aspect, the disclosure provides a compound selected from:

[0008] In a further aspect, the disclosure features a nanoparticle composition including a lipid component comprising a compound as described above. In some embodiments, the lipid component of the nanoparticle composition includes a phospholipid. In certain embodiments, a phospholipid of a nanoparticle composition includes a phospholipid moiety and one or more fatty acid moieties, one or more of which may be unsaturated. For example, a nanoparticle composition may include a lipid according to formula (V) in which R p represents a phospholipid moiety and R 1 and R 2 represent unsaturated fatty acid moieties that may be the same or different.

[0009] A phospholipid moiety may be selected from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin. A fatty acid moiety may be selected from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, arachidic acid, arachidonic acid, phytanic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. For example, in certain embodiments, a phospholipid is selected from the group consisting of 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine,1,2-dioleoyl-sn-glycero-3-phosphoethanol amine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin. In certain embodiments, the phospholipid is DOPE. In other embodiments, the phospholipid is DSPC. Non-natural species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated.

[0010] In some embodiments, the lipid component of the nanoparticle composition includes a structural lipid. In certain embodiments, a structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, and alpha-tocopherol. In certain embodiments, the structural lipid is cholesterol.

[0011] In some embodiments, the lipid component of the nanoparticle composition includes a PEG lipid. In certain embodiments, the PEG lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, and a PEG-modified dialkylglycerol.

[0012] In certain embodiments, a PEG lipid may be of Formula (VI): or a salt or isomer thereof, wherein: R 3PEG< is-OR O< ; R O< is hydrogen, C 1-5 alkyl or an oxygen protecting group; r is an integer between 1 and 100; R 5PEG< is C 10-40 alkyl, C 10-40 alkenyl, or C 10-40 alkynyl; and optionally one or more methylene groups of R 5PEG< are independently replaced with C 3-10 carbocyclylene, 4 to 10 membered heterocyclylene, C 6-10 arylene, 4 to 10 membered heteroarylene, -N(R N< )-, -O-, -S-, -C(O)-, -C(O)N(R N< )-, -NR N< C(O)-, -NR N< C(O)N(R N< )-, -C(O)O-, -OC(O)-, -OC(O)O-, - OC(O)N(R N< )-, -NR N< C(O)O-, -C(O)S-, -SC(O)-, -C(=NR N< )-, -C(=NR N< )N(R N< )-, - NR N< C(=NR N< )-, -NR N< C(=NR N< )N(R N< )-, -C(S)-, -C(S)N(R N< )-, -NR N< C(S)-, -NR N< C(S)N(R N< )-, -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O) 2 -, -S(O) 2 O-, -OS(O) 2 O-, -N(R N< )S(O)-, - S(O)N(R N< )-, -N(R N< )S(O)N(R N< )-, -OS(O)N(R N< )-, -N(R N< )S(O)O-, -S(O) 2 -, -N(R N< )S(O) 2 -, - S(O) 2 N(R N< )-, -N(R N< )S(O) 2 N(R N< )-, -OS(O) 2 N(R N< )-, or -N(R N< )S(O) 2 O-; and each instance of R N< is independently hydrogen, C 1-6 alkyl, or a nitrogen protecting group.

[0013] In certain embodiments, the compound of Formula (VI) is of Formula (VI-a): or a salt or isomer thereof.

[0014] In certain embodiments, a compound of Formula (VI) is of Formula (VI-b): or a salt or isomer thereof.

[0015] In certain embodiments, the compound of Formula (VI-b) is a compound having the formula: (PEG 1) or a salt or isomer thereof.

[0016] In certain embodiments, the incorporation of lipids of one of formulae (VI), (VI-a) or (VI-b) in the nanoparticle formulation can improve the pharmacokinetics and / or biodistribution of the lipid nanoparticle formulations. For example, incorporation of PEG-OH lipids in the nanoparticle formulation can reduce the accelerated blood clearance (ABC) effect.

[0017] In some examples, the nanoparticle composition includes a lipid component comprising a compound according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), a phospholipid (which may or may not be unsaturated), a PEG lipid, and a structural lipid. In certain examples, the lipid component of the nanoparticle composition includes about 30 mol % to about 60 mol % compound of one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), about 0 mol % to about 30 mol % phospholipid, about 18.5 mol % to about 48.5 mol % structural lipid, and about 0 mol % to about 10 mol % of PEG lipid. In some examples, the lipid component of the nanoparticle composition includes about 30 mol % to about 45 mol % compound of one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), about 5 mol % to about 25 mol % phospholipid, about 30 mol % to about 40 mol % structural lipid, and about 0 mol % to about 10 mol % of PEG lipid. In some examples, the lipid component of the nanoparticle composition includes about 35 mol % to about 55 mol % compound of one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), about 5 mol % to about 25 mol % phospholipid, about 30 mol % to about 40 mol % structural lipid, and about 0 mol % to about 10 mol % of PEG lipid. In certain examples, the lipid component includes about 50 mol % said compound, about 10 mol % phospholipid, about 38.5 mol % structural lipid, and about 1.5 mol % of PEG lipid. In other examples, the lipid component includes about 40 mol % said compound, about 20 mol % phospholipid, about 38.5 mol % structural lipid, and about 1.5 mol % of PEG lipid. In some of these examples, the phospholipid is DOPE, while in other examples the phospholipid is DSPC. In certain examples, the structural lipid is cholesterol. In certain examples, the PEG lipid is PEG-DMG. In certain examples, the PEG lipid is a compound of one of formulae (VI), (VI-a) or (VI-b). In any of the above, the total content of the lipid component may not exceed 100%.

[0018] In some embodiments, the nanoparticle composition includes more than one phospholipid, PEG lipid, structural lipid, or other lipid. In certain embodiments, the nanoparticle composition further includes a cationic and / or ionizable lipid such as an amino-lipid. In certain embodiments, a cationic and / or ionizable lipid is selected from the group consisting of 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA or MC3), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-y loxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-die n-1-yloxy]propan-1-amine (Octyl-CLinDMA (2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-die n-1-yloxy]propan-1-amine (Octyl-CLinDMA (2S)), (12Z, 15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine, and N,N-dimethyl-1-{(1S,2R)-2-octylcyclopropyl}heptadecan-8-amine.

[0019] In some embodiments, the nanoparticle composition includes a therapeutic and / or prophylactic agent. In certain embodiments, the therapeutic and / or prophylactic agent may be selected from the group consisting of a protein, a small molecule drug, a cytotoxic agent, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that elicits an immune response, and / or a nucleic acid (such as a deoxyribonucleic acid or a ribonucleic acid). In certain embodiments, the therapeutic and / or prophylactic agent is a ribonucleic acid (RNA). An RNA may be selected from the group consisting of a small interfering RNA (siRNA), an asymmetrical interfering RNA (aiRNA), a microRNA (miRNA), a Dicer-substrate RNA (dsRNA), a small hairpin RNA (shRNA), a messenger RNA (mRNA), and mixtures thereof. In certain embodiments, the therapeutic and / or prophylactic agent is a messenger RNA (mRNA). An RNA of a nanoparticle composition may be naturally or non-naturally occurring and may include one or more of a stem loop, a chain terminating nucleoside, a polyA sequence, a polyadenylation signal, and / or a 5' cap structure.

[0020] In some embodiments, the nanoparticle composition includes more than one therapeutic and / or prophylactic agent, such as one or more RNAs. The therapeutic and / or prophylactic agents may be of the same or different types (e.g., two mRNAs, two siRNAs, one mRNA and one siRNA, one mRNA and one small molecule drug, etc.).

[0021] In some embodiments, the encapsulation efficiency of a therapeutic and / or prophylactic agent of a nanoparticle composition is at least 50%. In certain embodiments, the encapsulation efficiency is at least 80%. In certain embodiments, the encapsulation efficiency is greater than 90%.

[0022] In some embodiments, the wt / wt ratio of the lipid component to a therapeutic and / or prophylactic agent in the nanoparticle composition is from about 10:1 to about 60:1. In certain embodiments, the wt / wt ratio is about 20:1.

[0023] In some embodiments, the N:P ratio of the nanoparticle composition is from about 2:1 to about 30:1. In certain embodiments, the N:P ratio is from about 2:1 to about 8:1. In certain embodiments, the N:P ratio is from about 5:1 to about 8:1. For example, the N:P ratio may be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. In some embodiments, the mean size of a nanoparticle composition is from about 40 nm to about 150 nm. In certain embodiments, the mean size is from about 70 nm to about 100 nm. In one embodiment, the mean size may be about 80 to about 100 nm. In certain embodiments, the mean size may be about 80 nm. In other embodiments, the mean size may be about 100 nm.

[0024] The polydispersity index of the nanoparticle composition is from about 0 to about 0.25 in certain embodiments. In certain embodiments, the polydispersity index is from about 0.10 to about 0.20.

[0025] In some embodiments, the nanoparticle composition has a zeta potential of about -10 mV to about +20 mV.

[0026] In some embodiments, upon contacting a compound according to the invention or a nanoparticle composition thereof with a mammalian cell, the cell uptake of the compound or nanoparticle composition is LDLR-independent. In some embodiments, the cell uptake of the compound or nanoparticle composition is LDLR-dependent. In some embodiments, the cell uptake of the compound or nanoparticle composition is apoE-independent. In some embodiments, the cell uptake of the compound or nanoparticle composition is apoE-dependent. In some embodiments, the cell uptake of the compound or nanoparticle composition is LDLR-apoE-interaction independent. In some embodiments, the cell uptake of the compound or nanoparticle composition is LDLR-apoE-interaction dependent.

[0027] In some embodiments, upon contacting a compound according to the invention or the nanoparticle composition thereof with a mammalian cell to produce a polypeptide, the production of the polypeptide is higher in mammalian hepatocytes than cells from a different tissue (e.g., spleen or kidney).

[0028] In some embodiments, upon contacting the compound according to the invention or the nanoparticle composition thereof with a mammalian cell to produce a polypeptide, the production of the polypeptide occurs substantively in mammalian hepatocytes (e.g., little or no production of the polypeptide in other cells, e.g., spleen cells or renal cells).

[0029] In some embodiments, the nanoparticle composition includes one or more other components including, but not limited to, one or more pharmaceutically acceptable excipients, small hydrophobic molecules, therapeutic and / or prophylactic agents, carbohydrates, polymers, permeability enhancing molecules, buffers, and surface altering agents.

[0030] In yet another aspect, the disclosure features a pharmaceutical composition comprising a nanoparticle composition according to the preceding aspects and a pharmaceutically acceptable carrier. For example, the pharmaceutical composition is refrigerated or frozen for storage and / or shipment (e.g., being stored at a temperature of 4 °C or lower, such as a temperature between about -150 °C and about 0 °C or between about -80 °C and about -20 °C (e.g., about -5 °C, -10 °C, -15 °C, -20 °C, -25 °C, -30 °C, -40 °C, -50 °C, -60 °C, -70 °C, -80 °C, -90 °C, -130 °C or - 150 °C). For example, the pharmaceutical composition is a solution that is refrigerated for storage and / or shipment at, for example, about -20° C, -30 °C, -40 °C, -50 °C, -60 °C, -70 °C, or -80 °C.

[0031] The disclosure provides a method of delivering a therapeutic and / or prophylactic agent (e.g., an mRNA) to a cell (e.g., a mammalian cell). This method includes the step of administering to a subject (e.g., a mammal, such as a human) a nanoparticle composition including (i) a lipid component including a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (1d1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), and (ii) a therapeutic and / or prophylactic agent, in which administering involves contacting the cell with the nanoparticle composition, whereby the therapeutic and / or prophylactic agent is delivered to the cell.

[0032] The disclosure provides a method of producing a polypeptide of interest in a cell (e.g., a mammalian cell). The method includes the step of contacting the cell with a nanoparticle composition including (i) a lipid component including a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), and (ii) an mRNA encoding the polypeptide of interest, whereby the mRNA is capable of being translated in the cell to produce the polypeptide.

[0033] In yet another aspect, the disclosure provides a method of treating a disease or disorder in a mammal (e.g., a human) in need thereof. The method includes the step of administering to the mammal a therapeutically effective amount of a nanoparticle composition including (i) a lipid component including a phospholipid (such as a polyunsaturated lipid), a PEG lipid, a structural lipid, and a compound according to the invention, and (ii) a therapeutic and / or prophylactic agent (e.g., an mRNA). In some embodiments, the disease or disorder is characterized by dysfunctional or aberrant protein or polypeptide activity. For example, the disease or disorder is selected from the group consisting of rare diseases, infectious diseases, cancer and proliferative diseases, genetic diseases (e.g., cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardio- and reno-vascular diseases, and metabolic diseases.

[0034] The disclosure provides a method of delivering (e.g., specifically delivering) a therapeutic and / or prophylactic agent to a mammalian organ (e.g., a liver, spleen, lung, or femur). This method includes the step of administering to a subject (e.g., a mammal) a nanoparticle composition including (i) a lipid component including a phospholipid, a PEG lipid, a structural lipid, and a compound according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), and (ii) a therapeutic and / or prophylactic agent (e.g., an mRNA), in which administering involves contacting the cell with the nanoparticle composition, whereby the therapeutic and / or prophylactic agent is delivered to the organ such as liver.

[0035] The disclosure features a method for the enhanced delivery of a therapeutic and / or prophylactic agent (e.g., an mRNA) to a target tissue (e.g., a liver, spleen, lung, or femur). This method includes administering to a subject (e.g., a mammal) a nanoparticle composition, the composition including (i) a lipid component including a compound according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), a phospholipid, a structural lipid, and a PEG lipid; and (ii) a therapeutic and / or prophylactic agent, the administering including contacting the target tissue with the nanoparticle composition, whereby the therapeutic and / or prophylactic agent is delivered to the target tissue. In some examples, the delivery is enhanced as compared to a reference composition which comprises a reference lipid instead of a compound of one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa).

[0036] The disclosure features a method of lowering immunogenicity comprising introducing the nanoparticle composition of the disclosure into cells, wherein the nanoparticle composition reduces the induction of the cellular immune response of the cells to the nanoparticle composition, as compared to the induction of the cellular immune response in cells induced by a reference composition which comprises a reference lipid instead of a compound of one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa). For example, the cellular immune response is an innate immune response, an adaptive immune response, or both.

[0037] In certain embodiments and examples of the above methods, a cell contacted in a method is in a mammal.

[0038] In any of the preceding methods, a mammal may be, for example, a rodent, non-human primate, or a human. In certain embodiments, the mammal is a human. In certain embodiments, the mammal is LDLR-deficient, or apoE-deficient, or both. In certain embodiments, the mammal is not LDLR-deficient. In certain embodiments, the mammal is not apoE-deficient. In certain embodiments, the mammal is neither LDLR-deficient nor apoE-deficient. In certain embodiments, the mammal has an abnormal LDLR-apoE interaction. In certain embodiments, the mammal has a normal LDLR-apoE interaction.

[0039] In any of the preceding aspects, a therapeutic and / or prophylactic agent may be an mRNA.

[0040] In some embodiments of the above methods, the therapeutic and / or prophylactic agent may be specifically delivered to a target tissue of interest (e.g., a mammalian liver, spleen, lung, or femur).

[0041] In some embodiments of the above methods, a polypeptide of interest may be specifically produced in a target cell or tissue of interest (e.g., a hepatocyte, a mammalian liver, spleen, lung, or femur), e.g., the production of polypeptide is substantively higher in the target cell or tissue than in a non-target cell / tissue.

[0042] In some embodiments, the nanoparticle composition is administered intravenously, intramuscularly, intradermally, subcutaneously, intra-arterially, intra-tumor, or by inhalation. A dose of about 0.001 mg / kg to about 10 mg / kg of therapeutic and / or prophylactic agent (e.g., mRNA) is administered to a mammal in certain embodiments.

[0043] In any of the preceding aspects, in some embodiments, the delivery (e.g., delivery efficiency) of the therapeutic and / or prophylactic agent to the mammalian cell is LDLR-independent. In some embodiments, the delivery of the therapeutic and / or prophylactic agent to the mammalian cell is LDLR-dependent. In some embodiments, the delivery of the therapeutic and / or prophylactic agent to the mammalian cell is apoE-independent. In some embodiments, the delivery of the therapeutic and / or prophylactic agent to the mammalian cell is apoE-dependent. In some embodiments, the delivery of the therapeutic and / or prophylactic agent to the mammalian cell is LDLR-apoE-interaction independent. In some embodiments, the delivery of the therapeutic and / or prophylactic agent to the mammalian cell is LDLR-apoE-interaction dependent.

[0044] In any of the preceding aspects, in some embodiments, the production (e.g., yield) of the polypeptide of interest in the mammalian cell is LDLR-independent. In some embodiments, the production of the polypeptide of interest in the mammalian cell is LDLR-dependent. In some embodiments, the production of the polypeptide of interest in the mammalian cell is apoE-independent. In some embodiments, the production of the polypeptide of interest in the mammalian cell is apoE-dependent. In some embodiments, the production of the polypeptide of interest in the mammalian cell is LDLR-apoE-interaction independent. In some embodiments, the production of the polypeptide of interest in the mammalian cell is LDLR-apoE-interaction dependent.

[0045] In the preceding aspects, one or more nanoparticle compositions each including one or more therapeutic and / or prophylactic agents may be used in combination. In some embodiments, one or more nanoparticle compositions each including one or more therapeutic and / or prophylactic agents may be simultaneously contacted with a cell or delivered to a mammalian cell or organ. In other embodiments, the one or more nanoparticle compositions are contacted with a cell or delivered to a mammalian cell or organ at different times.

[0046] In the preceding aspects, one or more additional therapeutic and / or prophylactic agents or compounds may be used in combination with a nanoparticle composition including a therapeutic and / or prophylactic agent. In some embodiments, an additional therapeutic and / or prophylactic agent or compound may be administered at or near the same time as a nanoparticle composition (e.g., within one hour). In other embodiments, an additional therapeutic and / or prophylactic agent or compound may be administered before or after (e.g., one or more hours before or after) a nanoparticle composition as a pretreatment or post-treatment therapy. In some embodiments, an additional therapeutic and / or prophylactic agent or compound is selected from the group consisting of an anti-inflammatory compound, a steroid (e.g., a corticosteroid), a statin, an estradiol, a BTK inhibitor, an S1P1 agonist, a glucocorticoid receptor modulator (GRM), or an anti-histamine. In certain embodiments, an additional therapeutic and / or prophylactic agent or compound is selected from the group consisting of dexamethasone, methotrexate, acetaminophen, an H1 receptor blocker, or an H2 receptor blocker.BRIEF DESCRIPTION OF THE DRAWINGS

[0047] The skilled artisan will understand that the drawings primarily are for illustrative purposes and are not intended to limit the scope of the inventive subject matter described herein. The drawings are not necessarily to scale; in some instances, various aspects of the inventive subject matter disclosed herein may be shown exaggerated or enlarged in the drawings to facilitate an understanding of different features. In the drawings, like reference characters generally refer to like features (e.g., functionally similar and / or structurally similar elements).

[0048] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0049] The above and further features will be more clearly appreciated from the following detailed description when taken in conjunction with the accompanying drawings. Figure 1A is a graph comparing luciferase expression levels in mice (whole body) after administration of nanoparticle compositions containing compounds of the disclosure over time. Figure 1B is a graph comparing luciferase expression levels in mice (whole body) after administration of nanoparticle compositions containing compounds of the disclosure over time. Figure 2 is a graph summarizing luciferase expression levels at 3 h after administration of nanoparticle compositions containing compounds of the disclosure. Total light flux values were acquired via body luminescent imaging (BLI) 3 h after administration. In this Figure, the numbers 1-12 refer to the compositions containing Compounds 42-52 and MC3 respectively. Figure 3 is a graph summarizing luciferase expression levels at 6 hr after administration of nanoparticle compositions containing compounds of the disclosure. Total light flux values were acquired via BLI 6 h after administration. In this Figure, the numbers 1-12 refer to the compositions containing Compounds 42-52 and MC3 respectively. Figure 4 is graph summarizing luciferase expression levels at 24 h after administration of nanoparticle compositions containing compounds of the disclosure. Total light flux values were acquired via BLI 24 h after administration. In this Figure, the numbers 1-12 refer to the compositions containing Compounds 42-52 and MC3 respectively. Figure 5 is graph summarizing expression levels of luciferase in mouse liver 6 hours after administration of nanoparticle compositions including compounds of the disclosure. In this Figure, the numbers 1-12 refer to the compositions containing Compounds 42-52 and MC3 respectively. Figure 6 is a graph summarizing expression levels of luciferase in mouse lungs 6 hours after administration of nanoparticle compositions including compounds of the disclosure. In this Figure, the numbers 1-12 refer to the compositions containing Compounds 42-52 and MC3 respectively. Figure 7 is a graph summarizing expression levels of luciferase in mouse spleen 6 hours after administration of nanoparticle compositions including compounds of the disclosure. In this Figure, the numbers 1-12 refer to the compositions containing Compounds 42-52 and MC3 respectively. Figures 8A and 8B are a pair of graphs illustrating hEPO expression levels in rats dosed with compounds of the disclosure as compared to with KL22, showing that KL22 and its chain length derivatives (previously showing improved protein expression in mice), do not express hEPO in rats. PBS (phosphate buffered saline) is used as control. Figure 8A compares the hEPO concentration after administration of nanoparticle compositions containing Compound 23, Compound 11, KL22, and MC3 at 2 mpk, i.v. administration. Compound 11 LNP showed hEPO expression comparable to MC3 and improved tolerability as compared to KL22. Figure 8B illustrates the results of a dose response study using Compound 20, KL22, and MC3 at dose of 0.2, 0.5 and 1 mpk. KL22 and Compound 23 were shown to be toxic at the 2 mg / kg dose. In Figure 8A, the numbers 1-5 refer to compositions containing the following: 1: Compound 23, 2: Compound 11, 3: KL22; 4: MC3; 5: PBS. In Figure 8B, the numbers 1-9 refer to compositions containing the following: 1: Compound 20, 0.2 mpk; 2: Compound 20, 0.5 mpk; 3: Compound 20, 1 mpk; 4: KL22, 0.2 mpk; 5: KL22, 0.5 mpk; 6: KL22, 1 mpk; 7: MC3, 0.2 mpk; 8: MC3, 0.5 mpk; 9: MC3, 1 mpk; 10: PBS. Figures 9A and B are a pair of graphs illustrating performance of Compound 11 as an LDLr independent lipid. Figure 9A is a bar graph showing expression of luciferase induced by administration of nanoparticle compositions including Compound 11 at dosages of 0.05 mpk, 0.25 mpk, and 0.5 mpk to LDLR - / - knockout and wild-type mice. Figure 9B shows LDL-c levels in LDLR knockout mice after administration of a control mRNA, i.e., non-translating Factor IX ("NT-FIX") and various compositions comprising mRNAs encoding the LDL receptor in mice, with KL22 at 0.5 mpk, or with Compound 11 at 0.5 and 1 mpk. LDL-c levels in mice were found to drop with nanoparticle composition containing Compound 11. Figure 10 is a graph showing hEPO levels in non-human primates up to ~50 h after administration of a nanoparticle composition containing Compound 4, compared to a composition containing MC3. The Compound 4 LNP demonstrated 3-fold expression of hEPO compared to MC3, establishing Compound 4 as an LDLr independent lipid that translates to higher species. Figures 11A and 11B are a pair of images comparing the results of a mouse liver immunohistochemistry (IHC) using mRNA expressing green fluorescent protein (GFP) after administration of nanoparticle compositions containing Compound 4 and MC3. Figure 11A shows CD-1 mouse liver cells after administration of GFP mRNA in a MC3 LNP, 6h after intravenous administration at a dose of 0.5 mpk. GFP mRNA Protein expression from the MC3 LNP composition was observed in both hepatocytes and Kupffer cells. Figure 11B shows LDLR knockout mouse liver cells after administration of GFP mRNA in a Compound 4 LNP, 8h after intravenous administration at a dose of 0.5 mpk. In contrast to MC3, the LNP containing Compound 4 appears to show less protein expression in Kupffer cells. Figures 12A-12C are a set of graphs illustrating hEPO expression levels in CD-1 mice dosed with compounds of the disclosure, compared to MC3. PBS is used as control. Figure 12A shows the hEPO concentration 3 h after administration of the nanoparticle compositions. Figure 12B shows the hEPO concentration 6 h after administration of the nanoparticle compositions. Figure 12C shows the hEPO concentration 24 h after administration of the nanoparticle compositions. In Figures 12A-12C numbers 1-14 refer to compositions containing the following: 1: Compound 73, 2: Compound 80, 3: Compound 70; 4: Compound 81; 5: Compound 69; 6: Compound 82; 7: Compound 83; 8: Compound 62; 9: Compound 84; 10: Compound 85; 11: Compound 86; 12: Compound 87; 13: MC3; 14: PBS. Figure 13 is a graph showing hEPO levels (pg / mL) in CD-1 mice up to ~25 h after administration of a nanoparticle composition containing compounds of the disclosure, compared to a composition containing MC3. Numbers 1-13 refer to compositions containing the following: 1: Compound 73, 2: Compound 80, 3: Compound 70; 4: Compound 81; 5: Compound 69; 6: Compound 82; 7: Compound 83; 8: Compound 62; 9: Compound 84; 10: Compound 85; 11: Compound 86; 12: Compound 87; 13: MC3. Figures 14A and 14B are a pair of graphs showing percentages of activated B-cells in the spleens of CD-1 mice dosed with compounds of the disclosure, compared to MC3, and compared to mice not having received any treatment (naïve test subject). PBS is used as control. Figure 14A shows the percentage of CD19+ cells. Figure 14B shows the percentage of CD19+ CD69+ CD86+ cells. Numbers 1-13 refer to compositions containing the following: 1: Compound 73, 2: Compound 80, 3: Compound 70; 4: Compound 81; 5: Compound 69; 6: Compound 82; 7: Compound 83; 8: Compound 62; 9: Compound 84; 10: Compound 85; 11: Compound 86; 12: Compound 87; 13: MC3; 14: PBS; 15: treatment naïve subject. Figure 15 is a graph summarizing luciferase expression levels at 6 h after administration of nanoparticle compositions containing compounds of the disclosure to CD-1 mice at a dose of 0.5 mpk. Total light flux values were acquired via body luminescent imaging (BLI) 6 h after administration. In this Figure, the numbers 1-8 refer to the compositions containing Compounds 4-10 and MC3 respectively. Figure 16 is a graph showing GFP levels in the livers of LDLR knockout mice at 30 min to 24 h after intravenous administration of an eGFP RNA in a lipid composition containing Compound 4. The liver GFP levels were determined via IHC. The square markers represent the number of GFP positive cells following administration of a dose of 0.1 mpk of the composition. The circular markers represent the number of GFP positive cells following administration of a dose of 0.5 mpk of the composition. Figures 17A and B are a pair of graphs showing the ApoE dependence of luciferase ("Luc") expression following administration of a composition containing Luc mRNA and Compound 4 to mice at a dose 0.5 mpk. The expression following administration of a composition containing Luc mRNA and MC3 is presented for comparison. Figure 17A shows the total flux in the liver 6h after administration. The % change in Luc expression in livers of ApoE knockout vs. wild-type mice (i.e., (WT mean expression-KO mean expression) / WT mean expression]*100%) was 91.9 % for Compound 4 and 97.5 % for MC3. Figure 17B shows the total flux in the spleen 6h after administration. The % change in expression in spleens of ApoE knockout vs. wild-type mice was 4.34 % for Compound 4 and 72.2 % for MC3. Numbers 1-4 refer to the following: 1: Composition containing Compound 4, administered to ApoE knockout mice; 2: Composition containing Compound 4, administered to wild-type mice; 3: Composition containing MC3, administered to ApoE knockout mice; 4: Composition containing MC3, administered to wild-type mice. Figures 18A and 18B are a pair of graphs showing the effect of a composition containing Compound 4 on liver enzymes. The composition was administered to rats at 0.1 mpk and 1 mpk. The effects of MC3 are shown for comparison. PBS is used as a control. Figure 18A shows the effect on aspartate aminotransferase (AST). Figure 18B shows the effect on alanine aminotransferase (ALT). Figures 19A - 19C are a set of graphs showing immune cell activation by a composition containing Compound 4. The effects of MC3 are shown for comparison. PBS (phosphate buffered saline) is used as control. Compositions were administered to rats at 0.1 mpk or 1 mpk. Figure 19A shows the effect on activation of neutrophil. Figure 19B shows the effect on activation of lymphocytes. Figure 19C shows the effect on activation of monocytes. Numbers 1-5 in Figures 19A-19C refer to the following: 1: Compound 4, 0.1 mpk; 2: Compound 4; 1 mpk; 3: MC3, 0.1 mpk 4: MC3, 1 mpk; 5: PBS. Figure 20 is a graph showing the expression of Stefin A Quadruple Mutant-Tracy (SQT) protein in mouse liver determined via FLAG IHC at different time points following intravenous administration of various nanoparticle compositions comprising SQT mRNA and lipids disclosed herein. Numbers 1-11 in the figure refer to the following: 1: 0 h, PBS; 2: 0 h, Compound 4; 3: 0.5 h, Compound 4; 4: 4 h, Compound 4; 5: 8 h, Compound 4; 6: 24 h, Compound 4; 7: 0 h, MC3; 8: 0.5 h, MC3; 9: 4 h, MC3; 10: 8 h, MC3; 11: 24 h, MC3. Figure 21 is a graph illustrating hEPO expression levels in CD-1 mice dosed with compositions of the disclosure. Compositions were administered intravenously, once weekly for 4 weeks at a dose of 0.5 mpk. Samples were collected 6h after each administration. In the graph, numbers 1-1 through 1-4 refer to hEPO levels at 1, 2, 3, and 4 weeks of administration of a composition comprising Compound 4, DOPE, and PEG DMG. Numbers 2-1 through 2-4 refer to hEPO levels at 1, 2, 3, and 4 weeks of administration of a composition comprising Compound 4, DOPE, and PEG 1. Figures 22A and 22B are a pair of graphs illustrating the anti-PEG IgM response in CD-1 mice dosed with compositions of the disclosure. Compositions were administered intravenously, once weekly for 4 weeks at a dose of 0.5 mpk. Anti-PEG IgM levels were measured at 96 h after administration. PBS was used as a control. The numbers 1-3 refer to 1: a composition comprising Compound 4, DOPE and PEG DMG, 2: a composition comprising Compound 4, DOPE and PEG 1, and 3: PBS. Figure 22A shows the anti-PEG IgM levels after dose 2, and Figure 22B shows the anti-PEG IgM levels after dose 3. Figures 23A and 23B are a pair of images of immunohistochemistries (IHC) illustrating hepatocyte distributions after administration of a nanoparticle composition comprising Compound 4, DOPE and PEG DMG. Figure 23A shows a CD-1 mouse liver (high natural IgM). Figure 23B shows a Cynomolgus monkey liver (high anti-PEG IgM). The composition was administered to the CD-1 mouse at a dose of 0.2 mpk and to the Cynomolgus monkey at a dose of 0.5 mpk. Figure 24 is a graph showing the decrease of LNP-bound PEG over time, comparing a nanoparticle composition comprising Compound 4 to a composition comprising MC3. Figure 25 is a graph illustrating serum LDL levels LDLr knockout (KO) mice following administration of nanoparticle compositions comprising compounds of the disclosure intravenously at 0.5 mpk. PBS was used as a control and administered to LDLr KO mice as well as wild type mice. Serum LDL levels were measured 24 h after administration. In the graph, the numbers 1-16 refer to 1: Compound 4; 2: Compound 56; 3: Compound 57; 4: Compound 58; 5: Compound 61; 6: Compound 71; 7: Compound 80; 8: Compound 81; 9: Compound 82; 10: Compound 83; 11: Compound 156; 12: Compound 84; 13: Compound 85; 14: Compound 87; 15: PBS (WT mouse); 16: PBS (LDLr KO mouse). Figure 26 is a graph demonstrating the efficacy of nanoparticles comprising compounds of the disclosure in LDLR knockout (KO) mice. Compositions were administered intravenously at 0.5 mpk. PBS was used as a control and administered to C57 / BI6 and LDLr KO mice. LDL-c levels were measured 24 h after administration. In the graph, the numbers 1-18 refer to 1: PBS (C57 / BI6 mouse); 2: PBS (LDLr KO mouse); 3: Compound 4; 4: Compound 111; 5: Compound 91; 6: Compound 90; 7: Compound 89; 8: Compound 109; 9: Compound 117; 10: Compound 94; 11: Compound 93; 12: Compound 92; Compound 13: Compound 116; 14: Compound 114; 15: Compound 102; 16: Compound 115; 17: Compound 107; 18: Compound 119. Figures 27A-27C are a set of graphs illustrating hEPO expression levels in CD-1 mice dosed with mRNA expressing hEPO in compounds of the disclosure (0.5 mg / kg; mRNA dose), compared to MC3. PBS is used as control. Figure 27A shows the hEPO concentration 3 h after administration of the nanoparticle compositions. Figure 27B shows the hEPO concentration 6 h after administration of the nanoparticle compositions. Figure 27C shows the hEPO concentration 24 h after administration of the nanoparticle compositions. In Figures 27A-27C numbers 1-13 refer to compositions containing the following: 1: Compound 146, 2: Compound 140, 3: Compound 141; 4: Compound 155; 5: Compound 157; 6: Compound 153; 7: Compound 158; 8: Compound 154; 9: Compound 159; 10: Compound 160; 11: Compound 4; 12: MC3; 13: PBS. Figure 28 is a graph illustrating hEPO expression levels up to ~24 h after administration of mRNA expressing hEPO in compounds of the disclosure (0.5 mg / kg; mRNA dose), to CD-1 mice, compared to MC3. The numbers 1-12 refer to compositions containing the following: 1: Compound 146, 2: Compound 140, 3: Compound 141; 4: Compound 155; 5: Compound 157; 6: Compound 153; 7: Compound 158; 8: Compound 154; 9: Compound 159; 10: Compound 160; 11: Compound 4; 12: MC3. Figures 29A and 29B are a pair of graphs showing percentages of activated B-cells in the spleens of CD-1 mice dosed with compounds of the disclosure, compared to MC3, and compared to mice not having received any treatment (naïve test subject). PBS is used as control. Figure 29A shows the percentage of CD19+ cells. Figure 29B shows the percentage of CD19+ CD69+ CD86+ cells. The numbers 1-12 refer to compositions containing the following: 1: Compound 146, 2: Compound 140, 3: Compound 141; 4: Compound 155; 5: Compound 157; 6: Compound 153; 7: Compound 158; 8: Compound 154; 9: Compound 159; 10: Compound 160; 11: Compound 4; 12: MC3, 13: PBS, 14: treatment naïve subject. Figure 30 is a graph showing ApoE binding to the nanoparticles in nanoparticle compositions of the disclosure after incubation in two types of human serum and against the pure recombinant ApoE protein, relative to ApoE binding to Compound 4. Compound 4 was used in a composition comprising PEG 1 and DOPE. Numbers 1-13 refer to compositions containing the following: 1: MC3 in PEG-DMG, 2: Compound 146, 3: Compound 140, 4: Compound 141; 5: Compound 155; 6: Compound 157; 7: Compound 153; 8: Compound 158; 9: Compound 154; 10: Compound 159; 11: Compound 160; 12: Compound 4; 13: MC3. Figure 31 is a graph showing the IgM binding to the nanoparticles in nanoparticle compositions of the disclosure after incubation in C57BI / 6 serum and serum with a high concentration of anti-PEG IgM antibodies, relative to the concentration of ApoE binding to Compound 4. Compound 4 was used in a composition comprising PEG 1 and DOPE. Numbers 1-13 refer to compositions containing the following: 1: MC3 in PEG-DMG, 2: Compound 146, 3: Compound 140, 4: Compound 141; 5: Compound 155; 6: Compound 157; 7: Compound 153; 8: Compound 158; 9: Compound 154; 10: Compound 159; 11: Compound 160; 12: Compound 4; 13: MC3. Figures 32A-32C are a set of graphs illustrating hEPO expression levels in CD-1 mice dosed with mRNA expressing hEPO in compounds of the disclosure (0.5 mg / kg; mRNA dose), compared to MC3. PBS is used as control. Figure 32A shows the hEPO concentration 3 h after administration of the nanoparticle compositions. Figure 32B shows the hEPO concentration 6 h after administration of the nanoparticle compositions. Figure 32C shows the hEPO concentration 24 h after administration of the nanoparticle compositions. In Figures 32A-32C numbers 1-12 refer to compositions containing the following: 1: Compound 161; 2: Compound 162, 3: Compound 163; 4: Compound 164; 5: Compound 165; 6: Compound 166; 7: Compound 167; 8: Compound 168; 9: Compound 169; 10: Compound 4; 11: MC3; 12: PBS. Figure 33 is a graph illustrating hEPO expression levels up to ~24 h after administration of mRNA expressing hEPO in compounds of the disclosure (0.5 mg / kg; mRNA dose), to CD-1 mice, compared to MC3. The numbers 1-12 refer to compositions containing the following: 1: Compound 161; 2: Compound 162, 3: Compound 163; 4: Compound 164; 5: Compound 165; 6: Compound 166; 7: Compound 167; 8: Compound 168; 9: Compound 169; 10: Compound 4; 11: MC3; 12: PBS. Figures 34A and 34B are a pair of graphs showing percentages of activated B-cells in the spleens of CD-1 mice dosed with compounds of the disclosure, compared to MC3, and compared to mice not having received any treatment (naïve test subject). PBS is used as control. Figure 29A shows the percentage of CD19+ cells. Figure 29B shows the percentage of CD19+ CD69+ CD86+ cells. The numbers 1-13 refer to the following: 1: Compound 161; 2: Compound 162, 3: Compound 163; 4: Compound 164; 5: Compound 165; 6: Compound 166; 7: Compound 167; 8: Compound 168; 9: Compound 169; 10: Compound 4; 11: MC3; 12: PBS; 13: treatment naïve subject. Figure 35 shows the binding of compounds of the disclosure to the Heparin column in a Heparin Sepharose binding assay. The numbers 1-11 refer to the following: 1: Compound 161; 2: Compound 162, 3: Compound 163; 4: Compound 164; 5: Compound 165; 6: Compound 166; 7: Compound 167; 8: Compound 168; 9: Compound 169; 10: Compound 4; 11: MC3. Figure 36 is a graph showing ApoE binding to the nanoparticles in nanoparticle compositions of the disclosure after incubation in two types of human serum and against the pure recombinant ApoE protein, relative to ApoE binding to Compound 4. Compound 4 was used in a composition comprising PEG 1 and DOPE. Numbers 1-12 refer to compositions containing the following: 1: MC3 in DSPC, cholesterol and PEG-DMG; 2: Compound 161; 3: Compound 162, 4: Compound 163; 5: Compound 164; 6: Compound 165; 7: Compound 166; 8: Compound 167; 9: Compound 168; 10: Compound 169; 11: Compound 4; 12: MC3. Figure 37 is a graph showing the IgM binding to the nanoparticles in nanoparticle compositions of the disclosure after incubation in C57BI / 6 serum and serum with a high concentration of anti-PEG IgM antibodies, relative to the concentration of ApoE binding to Compound 4. Compound 4 was used in a composition comprising PEG 1 and DOPE. Numbers 1-12 refer to compositions containing the following: 1: MC3 in DSPC, cholesterol and PEG-DMG; 2: Compound 161; 3: Compound 162, 4: Compound 163; 5: Compound 164; 6: Compound 165; 7: Compound 166; 8: Compound 167; 9: Compound 168; 10: Compound 169; 11: Compound 4; 12: MC3. Figures 38A-38C are a set of graphs illustrating hEPO expression levels in CD-1 mice dosed with mRNA expressing hEPO in compounds of the disclosure (0.5 mg / kg; mRNA dose), compared to MC3. PBS is used as control. Figure 38A shows the hEPO concentration 3 h after administration of the nanoparticle compositions. Figure 38B shows the hEPO concentration 6 h after administration of the nanoparticle compositions. Figure 38C shows the hEPO concentration 24 h after administration of the nanoparticle compositions. In Figures 38A-38C numbers 1-12 refer to compositions containing the following: 1: Compound 181; 2: Compound 182, 3: Compound 183; 4: Compound 184; 5: Compound 185; 6: Compound 186; 7: Compound 187; 8: Compound 188; 9: Compound 189; 10: Compound 4; 11: MC3; 12: PBS. Figure 39 is a graph illustrating hEPO expression levels up to ~24 h after administration of mRNA expressing hEPO in compounds of the disclosure (0.5 mg / kg; mRNA dose), to CD-1 mice, compared to MC3. The numbers 1-12 refer to compositions containing the following: : 1: Compound 181; 2: Compound 182, 3: Compound 183; 4: Compound 184; 5: Compound 185; 6: Compound 186; 7: Compound 187; 8: Compound 188; 9: Compound 189; 10: Compound 4; 11: MC3; 12: PBS. Figures 40A and 40B are a pair of graphs showing percentages of activated B-cells in the spleens of CD-1 mice dosed with compounds of the disclosure, compared to MC3, and compared to mice not having received any treatment (naïve test subject). PBS is used as control. Figure 29A shows the percentage of CD19+ cells. Figure 29B shows the percentage of CD19+ CD69+ CD86+ cells. The numbers 1-13 refer to the following: : 1: Compound 181; 2: Compound 182, 3: Compound 183; 4: Compound 184; 5: Compound 185; 6: Compound 186; 7: Compound 187; 8: Compound 188; 9: Compound 189; 10: Compound 4; 11: MC3; 12: PBS; 13: treatment naïve subject. DETAILED DESCRIPTION

[0050] The invention is defined in the appended claims. Embodiments not encompassed by the claims are provided for reference purposes. The disclosure relates to novel lipids and lipid nanoparticle compositions including a novel lipid. The disclosure also provides methods of delivering a therapeutic and / or prophylactic agent to a mammalian cell, specifically delivering a therapeutic and / or prophylactic agent to a mammalian organ, producing a polypeptide of interest in a mammalian cell, and treating a disease or disorder in a mammal in need thereof. For example, a method of producing a polypeptide of interest in a cell involves contacting a nanoparticle composition comprising an mRNA with a mammalian cell, whereby the mRNA may be translated to produce the polypeptide of interest. A method of delivering a therapeutic and / or prophylactic agent to a mammalian cell or organ may involve administration of a nanoparticle composition including the therapeutic and / or prophylactic agent to a subject, in which the administration involves contacting the cell or organ with the composition, whereby the therapeutic and / or prophylactic agent is delivered to the cell or organ.Lipids

[0051] The present disclosure provides lipids that may be advantageously used in lipid nanoparticle compositions for the delivery of therapeutic and / or prophylactic agents to mammalian cells or organs. For example, the lipids described herein have little or no immunogenicity. For example, the lipid compound of any of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa) has a lower immunogenicity as compared to a reference lipid (e.g., MC3, KC2, or DLinDMA). For example, a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent has an increased therapeutic index as compared to a corresponding formulation which comprises a reference lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.

[0052] Lipids may be compounds of formula (I), or salts or isomers thereof, wherein W is ring A is or t is 1 or 2; A 1 and A 2 are each independently selected from CH or N; Z is CH 2 or absent wherein when Z is CH 2 , the dashed lines (1) and (2) each represent a single bond; and when Z is absent, the dashed lines (1) and (2) are both absent; R 1 , R 2 , R 3 , R 4 , and R 5 are independently selected from the group consisting of C 5-20 alkyl, C 5-20 alkenyl, -R"MR', -R*YR", -YR", and -R*OR"; R X1 and R X2 are each independently H or C 1 - 3 alkyl; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O) 2 -, -C(O)S-, -SC(O)-, an aryl group, and a heteroaryl group; M* is -O-, or C 1 -C 6 alkyl, W 1< and W 2< are each independently selected from the group consisting of a bond, -O- and -N(R 6 )-; each R 6 is independently selected from the group consisting of H and C 1-5 alkyl; X 1< , X 2< , and X 3< are independently selected from the group consisting of a bond, -CH 2 -, -(CH 2 ) 2 -, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -(CH 2 ) n -C(O)-, -C(O)-(CH 2 ) n -, -(CH 2 ) n -C(O)O-, -OC(O)-(CH 2 ) n -, -(CH 2 ) n -OC(O)-, -C(O)O-(CH 2 ) n -, -CH(OH)-, -C(S)-, and -CH(SH)-; each Y is independently a C 3-6 carbocycle; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each R is independently selected from the group consisting of C 1 - 3 alkyl and a C 3-6 carbocycle; each R' is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, and H; each R" is independently selected from the group consisting of C 3-12 alkyl, C 3-12 alkenyl and -R*MR'; and n is an integer from 1-6; wherein when ring A is then i) at least one of X 1< , X 2< , and X 3< is not -CH 2 -; and / or ii) at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is -R"MR'.

[0053] In some examples, M* is C 1 -C 6 alkyl and W 1< and W 2< are each independently selected from the group consisting of -O- and -N(R 6 )-.

[0054] In some examples, W is

[0055] In some examples, ring A is

[0056] In some examples, the compound is of any of formulae (Ia1)-(Ia7): or

[0057] In some examples, W is

[0058] In some examples, the compound is of any of formulae (Ia8)-(Ia10): or

[0059] The compounds of Formula (I) or any of (Ia1)-(Ia10) include one or more of the following features when applicable.

[0060] In some examples, ring A is

[0061] In some examples, ring A is

[0062] In some examples, ring A is

[0063] In some examples, ring A is

[0064] In some examples, ring A is

[0065] In some examples, ring A is

[0066] In some examples, ring A is or

[0067] In some examples, ring A is wherein ring, in which the N atom is connected with X 2< .

[0068] In some examples, Z is CH 2 .

[0069] In some examples, Z is absent.

[0070] In some examples, at least one of A 1 and A 2 is N.

[0071] In some examples, each of A 1 and A 2 is N.

[0072] In some examples, each of A 1 and A 2 is CH.

[0073] In some examples, A 1 is N and A 2 is CH.

[0074] In some examples, A 1 is CH and A 2 is N.

[0075] In some examples, at least one of W 1< and W 2< is -O-.

[0076] In some examples, W 1< and W 2< are each a bond.

[0077] In some examples, W 1< and W 2< are each -O-.

[0078] In some examples, at least one of W 1< and W2 is -N(R 6 )-.

[0079] In some examples, W 1< and W 2< are each -N(R 6 )-.

[0080] In some examples, at least one R 6 is H.

[0081] In some examples, each R 6 is H.

[0082] In some examples, at least one R 6 is C 1 alkyl. In certain examples, each R 6 is C 1 alkyl. In some examples, at least one R 6 is C 2 alkyl. In certain examples, each R 6 is C 2 alkyl. In some examples, at least one R 6 is C 3 alkyl. In certain examples, each R 6 is C 3 alkyl.

[0083] In some examples, M* is C 1 alkyl. In some examples, M* is C 2 alkyl. In some examples, M* is C 3 alkyl. In some examples, M* is C 4 alkyl. In some examples, M* is C 5 alkyl. In some examples, M* is C 6 alkyl.

[0084] In some examples, M* is -O-.

[0085] In some examples, at least one of X 1< , X 2< , and X 3< is not -CH 2 -. For example, in certain examples, X 1< is not -CH 2 -. In some examples, at least one of X 1< , X 2< , and X 3< is -C(O)-.

[0086] In some examples, X 1< is -CH 2 -.

[0087] In some examples, X 2< is -(CH 2 ) n -C(O)-, -C(O)-(CH 2 ) n -, -(CH 2 ) n -C(O)O-, - OC(O)-(CH 2 ) n -, -(CH 2 ) n -OC(O)-, -C(O)O-(CH 2 ) n -. In some examples, X 2< is -CH 2 -. In some examples, X 2< is -(CH 2 ) 2 -.

[0088] In some examples, X 3< is -(CH 2 ) n -C(O)-, -C(O)-(CH 2 ) n -, -(CH 2 ) n -C(O)O-, - OC(O)-(CH 2 ) n -, -(CH 2 ) n -OC(O)-, -C(O)O-(CH 2 ) n -.

[0089] In some examples, n is 1, 2, 3, 4, or 5. In certain examples, n is 1. In certain examples, n is 2. In certain examples, n is 3.

[0090] In some examples, X 2< is -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH 2 -, -CH 2 -C(O)-, -C(O)O-CH 2 -, -OC(O)-CH 2 -, -CH 2 -C(O)O-, or -CH 2 -OC(O)-.

[0091] In some examples, X 3< is -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH 2 -, -CH 2 -C(O)-, -C(O)O-CH 2 -, -OC(O)-CH 2 -, -CH 2 -C(O)O-, or -CH 2 -OC(O)-. In other examples, X 3< is -CH 2 -. In some examples, X 3< is -(CH 2 ) 2 -.

[0092] In some examples, X 2< and X 3< are each -C(O)-.

[0093] In some examples, X 3< is a bond or -(CH 2 ) 2 -.

[0094] In some examples, R 1 and R 2 are the same. In certain examples, R 1 , R 2 , and R 3 are the same. In some examples, R 4 and R 5 are the same. In certain examples, R 1 , R 2 , R 3 , R 4 , and R 5 are the same.

[0095] In some examples, at least one of R 1 , R 2 , and R 3 is R*YR". In some examples, R 1 is R*YR". In some examples, R 2 is R*YR". In some examples R 3 is R*YR".

[0096] In some examples, at least one of R 4 and R 5 is R*YR". In some examples, R 4 is R*YR". In some examples, R 5 is R*YR".

[0097] In some examples, Y is a C 3 carbocycle.

[0098] In some examples, R" is -R*MR'.

[0099] In some examples, R X1 and R X2 are each independently C 1 - 3 alkyl. For example, R X1 and R X2 are each C 1 alkyl. For example, R X1 and R X2 are each C 2 alkyl. For example, R X1 and R X2 are each C 3 alkyl. For example, R X1 is C 1 alkyl and R X2 is C 2 alkyl. For example, R X1 is C 2 alkyl and R X2 is C 1 alkyl. For example, R X1 is C 1 alkyl and R X2 is C 3 alkyl. For example, R X1 is C 3 alkyl and R X2 is C 1 alkyl. For example, R X1 is C 2 alkyl and R X2 is C 3 alkyl. For example, R X1 is C 3 alkyl and R X2 is C 2 alkyl.

[0100] In some examples, R X1 is H and R X2 is C 1 - 3 alkyl. For example, R X1 is H and R X2 is C 1 alkyl. For example, R X1 is H and R X2 is C 2 alkyl. For example, R X1 is H and R X2 is C 3 alkyl.

[0101] In some examples, R X1 is C 1 - 3 alkyl and R X2 is H. For example, R X1 is C 1 alkyl and R X2 is H. For example, R X1 is C 2 alkyl and R X2 is H. For example, R X1 is C 3 alkyl and R X2 is H.

[0102] In some examples, R X1 and R X2 are each H.

[0103] In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is -R"MR'. In some examples, at most one of R 1 , R 2 , R 3 , R 4 , and R 5 is -R"MR'. For example, at least one of R 1 , R 2 , and R 3 may be -R"MR', and / or at least one of R 4 and R 5 is -R"MR'. In certain examples, at least one M is -C(O)O-. In some examples, each M is -C(O)O-. In some examples, at least one M is -OC(O)-. In some examples, each M is -OC(O)-. In some examples, at least one M is -OC(O)O-. In some examples, each M is -OC(O)O-. In some examples, at least one M is - C(O)S-. In some examples, each M is -C(O)S-. In some examples, at least one M is -SC(O)-. In some examples, each M is -SC(O)-.

[0104] In some examples, at least one R" is C 2-5 alkyl. In some examples, each R" is C 2-5 alkyl. In some examples, at least one R" is C 3-7 alkyl. In some examples, each R" is C 3-7 alkyl. In some examples, at least one R" is C 3 alkyl. In certain examples, each R" is C 3 alkyl. In some examples, at least one R" is C 5 alkyl. In certain examples, each R" is C 5 alkyl. In some examples, at least one R" is C 6 alkyl. In certain examples, each R" is C 6 alkyl. In some examples, at least one R" is C 7 alkyl. In certain examples, each R" is C 7 alkyl. In some examples, at least one R" is C 8 alkyl. In certain examples, each R" is C 8 alkyl. In some examples, at least one R" is C 9 alkyl. In certain examples, each R" is C 9 alkyl. In some examples, at least one R" is C 10 alkyl. In certain examples, each R" is C 10 alkyl. In some examples, at least one R" is C 11 alkyl. In certain examples, each R" is C 11 alkyl. In some examples, at least one R" is branched C 3-12 alkyl or C 3-12 alkenyl. In some examples, each R" is branched C 3-12 alkyl or C 3-12 alkenyl.

[0105] In other examples, at least one R' is C 10-18 alkyl. In some examples, each R' is C 10-18 alkyl. In some examples, at least one R' is C 1-9 alkyl. In certain examples, each R' is C 1-9 alkyl. In some examples, at least one R' is C 1-5 alkyl. In certain examples, each R' is C 1-5 alkyl. In certain examples, at least one R' is C 1 alkyl. In certain examples, each R' is C 1 alkyl. In some examples, at least one R' is C 2 alkyl. In certain examples, each R' is C 2 alkyl. In some examples, at least one R' is C 5 alkyl. In certain examples, each R' is C 5 alkyl. In some examples, at least one R' is C 6 alkyl. In certain examples, each R' is C 6 alkyl. In some examples, at least one R' is C 7 alkyl. In certain examples, each R' is C 7 alkyl. In some examples, at least one R' is C 8 alkyl. In certain examples, each R' is C 8 alkyl. In some examples, at least one R' is C 9 alkyl. In certain examples, each R' is C 9 alkyl.

[0106] In some examples, at least one R' is branched C 3-12 alkyl or C 3-12 alkenyl. In some examples, each R' is branched C 3-18 alkyl or C 3-18 alkenyl. In some examples, each R' is branched C 3-18 alkyl or C 3-18 alkenyl. In some examples, at least one R' is branched C 17 alkyl. In some examples, each R' is branched C 17 alkyl. In some examples, at least one R' is branched C 17 alkenyl. In some examples, each R' is branched C 17 alkenyl.

[0107] In some examples at least one R" is C 3-7 alkenyl. In some examples, each R" is C 3-7 alkenyl. In some examples at least one R" is C 4-10 alkenyl. In some examples, each R" is C 4-10 alkenyl. In some examples at least one R" is C 11-18 alkenyl. In some examples, each R" is C 11-18 alkenyl. In certain examples, at least one R" is C 3 alkenyl. In certain examples, each R" is C 3 alkenyl. In certain examples, at least one R" is C 4 alkenyl. In certain examples, each R" is C 4 alkenyl. In certain examples, at least one R" is C 5 alkenyl. In certain examples, each R" is C 5 alkenyl. In certain examples, at least one R" is C 6 alkenyl. In certain examples, each R" is C 6 alkenyl. In certain examples, at least one R" is C 7 alkenyl. In certain examples, each R" is C 7 alkenyl. In certain examples, at least one R" is C 8 alkenyl. In certain examples, each R" is C 8 alkenyl. In certain examples, at least one R" is C 9 alkenyl. In certain examples, each R" is C 9 alkenyl.

[0108] In some examples, at least one R" is branched C 3-12 alkyl or C 3-12 alkenyl.

[0109] In some examples, at least one R' is C 4-10 alkenyl. In some examples, each R' is C 4-10 alkenyl. In certain examples, at least one R' is C 4 alkenyl. In certain examples, each R' is C 4 alkenyl. In certain examples, at least one R' is C 5 alkenyl. In certain examples, each R' is C 5 alkenyl. In certain examples, at least one R' is C 6 alkenyl. In certain examples, each R' is C 6 alkenyl. In certain examples, at least one R' is C 7 alkenyl. In certain examples, each R' is C 7 alkenyl. In certain examples, at least one R' is C 8 alkenyl. In certain examples, each R' is C 8 alkenyl. In certain examples at least one R' is C 9 alkenyl. In certain examples, each R' is C 8 alkenyl. In certain examples, at least one R' is C 10 alkenyl. In certain examples, each R' is C 10 alkenyl.

[0110] In some examples, M is -O-C(O)- or -C(O)O-, and at least one R' is C 1-12 alkyl or C 2-12 alkenyl. For example, -R"MR' is

[0111] In some examples, M is -O-C(O)- or -C(O)O- and at least one R" is branched C 3-12 alkyl, C 3-12 alkenyl. For example, -R"MR' is

[0112] In some examples, R' is C 2-12 alkenyl (e.g., R' is non-2-enyl or pent-2-enyl). In some examples, R' is non-2-enyl or pent-2-enyl and M' is -OC(O)-. In other examples, R' is non-2-enyl or pent-2-enyl and M' is -C(O)O-. For example R"MR' is

[0113] In some examples, R" is or. In some examples, R' is but-2-ene and M' is - OC(O)-. In other examples, R' is but-2-ene and M' is -C(O)O-. For example R"MR' is

[0114] In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is substituted C 5-20 alkyl or substituted C 5-20 alkenyl. For example, one of R 4 , and R 5 is substituted C 5-20 alkyl or substituted C 5-20 alkenyl (e.g. substituted with a C 1 - 3 alkyl or substituted with OH or alkoxy). For example, R 4 or R 5 is

[0115] In some examples, R 1 , R 2 , R 3 , R 4 , and R 5 are each independently selected from -R"MR' and C 5-10 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 5 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 6 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 7 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 8 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 9 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 10 alkyl.

[0116] In some examples, at least one of R 4 and R 5 is C 9 alkyl. In some examples, one of R 4 and R 5 is C 9 alkyl. In some examples, at least one of R 4 and R 5 is C 10 alkyl. In some examples, one of R 4 and R 5 is C 10 alkyl. In some examples, at least one of R 4 and R 5 is C 11 alkyl. In some examples, one of R 4 and R 5 is C 11 alkyl. In some examples, at least one of R 4 and R 5 is C 12 alkyl. In some examples one of R 4 and R 5 is C 12 alkyl. In some examples, at least one of R 4 and R 5 is C 13 alkyl. In some examples, one of R 4 and R 5 is C 13 alkyl. In some examples, at least one of R 4 , and R 5 is C 14 alkyl. In some examples, one of R 4 , and R 5 is C 14 alkyl.

[0117] In some examples, at least one of R 4 and R 5 is -R"MR'. In some examples, each of R 4 and R 5 is -R"MR'. In some examples, one of R 4 and R 5 is -R"MR'.

[0118] In some examples, R 4 and R 5 have the same number of carbon atoms. In some examples, R 4 and R 5 have 6, 8, 9, 12, 14, or 18 carbon atoms.

[0119] In some examples, R 4 and R 5 are C 6 alkyl. In some examples, R 4 and R 5 are C 7 alkyl. In some examples, R 4 and R 5 are C 8 alkyl. In some examples, R 4 and R 5 are C 9 alkyl. In some examples, R 4 and R 5 are C 10 alkyl. In some examples, R 4 and R 5 are C 11 alkyl. In some examples, R 4 and R 5 are C 12 alkyl. In some examples, R 4 and R 5 are C 12 alkyl. In some examples, R 4 and R 5 are C 14 alkyl. In some examples, R 4 and R 5 are C 16 alkyl. In some examples, R 4 and R 5 are C 18 alkenyl. In some examples, R 4 and R 5 are linoleyl.

[0120] In some examples, R 1 , R 2 , and R 3 have the same number of carbon atoms. In some examples, R 1 , R 2 , and R 3 have 6, 8, 9, 12, 14, or 18 carbon atoms. In some examples, R 1 , R 2 , and R 3 are linoleyl. In some examples, at least one of R 1 , R 2 , and R 3 is C 5-10 alkenyl. In some examples, R 1 , R 2 , and R 3 each independently are C 5-10 alkenyl.

[0121] In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is C 12 alkyl. In certain examples, each of R 1 , R 2 , R 3 , R 4 , and R 5 are C 12 alkyl. In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is C 9 , C 12 , or C 14 alkyl.

[0122] In some examples, R 1 , R 2 , R 3 , R 4 , and R 5 each independently are C 5-10 alkyl. In certain examples, R 1 , R 2 , R 3 , R 4 , and R 5 each are C 8 alkyl. In certain examples, R 1 , R 2 , R 3 , R 4 , and R 5 each are C 9 alkyl. In certain examples, R 1 , R 2 , R 3 , R 4 , and R 5 each are C 10 alkyl. In certain examples, R 1 , R 2 , R 3 , R 4 , and R 5 each are C 11 alkyl. In certain examples, R 1 , R 2 , R 3 , R 4 , and R 5 each are C 12 alkyl. In certain examples, R 1 , R 2 , R 3 , R 4 , and R 5 each are C 13 alkyl. In certain examples, R 1 , R 2 , R 3 , R 4 , and R 5 each are C 14 alkyl. In some examples, R 1 , R 2 , R 3 , R 4 , and R 5 each independently are C 9 , C 12 , or C 14 alkyl.

[0123] In some examples, at least one of R 1 , R 2 , and R 3 is C 5-10 alkenyl. In some examples, R 1 , R 2 , and R 3 each independently are C 5-10 alkenyl. In certain examples, at least one of R 1 , R 2 , and R 3 is C 9 alkenyl. In certain examples, R 1 , R 2 , and R 3 each are C 9 alkenyl.

[0124] In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is C 5-10 alkenyl. In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is C 5 alkenyl. In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is C 6 alkenyl. In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is C 7 alkenyl. In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is C 8 alkenyl. In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is C 9 alkenyl. In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is C 10 alkenyl.

[0125] In some examples, R 4 is selected from C 5-20 alkenyl. In some examples, R 4 is C 10 alkenyl. In some examples, R 4 is C 11 alkenyl. In some examples, R 4 is C 12 alkenyl. In some examples, R 4 is C 13 alkenyl. In some examples, R 4 is C 14 alkenyl. In some examples, R 4 is C 15 alkenyl. In some examples, R 4 is C 16 alkenyl. In some examples, R 4 is C 17 alkenyl. In some examples, R 4 is C 18 alkenyl.

[0126] In some examples at least one of R 4 and R 5 is C 14 alkenyl.

[0127] In certain embodiments and examples, the compound is selected from the group consisting of: and with compounds marked * being compounds of the invention.

[0128] In other examples, a lipid has the formula (II) or a salt or isomer thereof, wherein A 1 and A 2 are each independently selected from CH or N and at least one of A 1 and A 2 is N; Z is CH 2 or absent wherein when Z is CH 2 , the dashed lines (1) and (2) each represent a single bond; and when Z is absent, the dashed lines (1) and (2) are both absent; R 1 , R 2 , R 3 , R 4 , and R 5 are independently selected from the group consisting of C 6-20 alkyl and C 6-20 alkenyl; wherein when ring A is then i) R 1 , R 2 , R 3 , R 4 , and R 5 are the same, wherein R 1 is not C 12 alkyl, C 18 alkyl, or C 18 alkenyl; ii) only one of R 1 , R 2 , R 3 , R 4 , and R 5 is selected from C 6-20 alkenyl; iii) at least one of R 1 , R 2 , R 3 , R 4 , and R 5 have a different number of carbon atoms than at least one other of R 1 , R 2 , R 3 , R 4 , and R 5 ; iv) R 1 , R 2 , and R 3 are selected from C 6-20 alkenyl, and R 4 and R 5 are selected from C 6-20 alkyl; or v) R 1 , R 2 , and R 3 are selected from C 6-20 alkyl, and R 4 and R 5 are selected from C 6-20 alkenyl.

[0129] In some examples, the compound is of formula (IIa):

[0130] The compounds of Formula (II) or (IIa) include one or more of the following features when applicable.

[0131] In some examples, Z is CH 2 .

[0132] In some examples, Z is absent.

[0133] In some examples, at least one of A 1 and A 2 is N.

[0134] In some examples, each of A 1 and A 2 is N.

[0135] In some examples, each of A 1 and A 2 is CH.

[0136] In some examples, A 1 is N and A 2 is CH.

[0137] In some examples, A 1 is CH and A 2 is N.

[0138] In some examples, R 1 , R 2 , R 3 , R 4 , and R 5 are the same, and are not C 12 alkyl, C 18 alkyl, or C 18 alkenyl. In some examples, R 1 , R 2 , R 3 , R 4 , and R 5 are the same and are C 9 alkyl or C 14 alkyl.

[0139] In some examples, only one of R 1 , R 2 , R 3 , R 4 , and R 5 is selected from C 6-20 alkenyl. In certain such examples, R 1 , R 2 , R 3 , R 4 , and R 5 have the same number of carbon atoms. In some examples, R 4 is selected from C 5-20 alkenyl. For example, R 4 may be C 12 alkenyl or C 18 alkenyl.

[0140] In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 have a different number of carbon atoms than at least one other of R 1 , R 2 , R 3 , R 4 , and R 5 .

[0141] In certain examples, R 1 , R 2 , and R 3 are selected from C 6-20 alkenyl, and R 4 and R 5 are selected from C 6-20 alkyl. In other examples, R 1 , R 2 , and R 3 are selected from C 6-20 alkyl, and R 4 and R 5 are selected from C 6-20 alkenyl. In some examples, R 1 , R 2 , and R 3 have the same number of carbon atoms, and / or R 4 and R 5 have the same number of carbon atoms. For example, R 1 , R 2 , and R 3 , or R 4 and R 5 , may have 6, 8, 9, 12, 14, or 18 carbon atoms. In some examples, R 1 , R 2 , and R 3 , or R 4 and R 5 , are C 18 alkenyl (e.g., linoleyl). In some examples, R 1 , R 2 , and R 3 , or R 4 and R 5 , are alkyl groups including 6, 8, 9, 12, or 14 carbon atoms.

[0142] In some examples, R 1 has a different number of carbon atoms than R 2 , R 3 , R 4 , and R 5 . In other examples, R 3 has a different number of carbon atoms than R 1 , R 2 , R 4 , and R 5 . In further examples, R 4 has a different number of carbon atoms than R 1 , R 2 , R 3 , and R 5 .

[0143] In some examples, the compound is selected from the group consisting of:

[0144] In other examples, the compound has the formula (III) or a salt or isomer thereof, in which A 3 is CH or N; A 4 is CH 2 or NH; and at least one of A 3 and A 4 is N or NH; Z is CH 2 or absent wherein when Z is CH 2 , the dashed lines (1) and (2) each represent a single bond; and when Z is absent, the dashed lines (1) and (2) are both absent; R 1 , R 2 , and R 3 are independently selected from the group consisting of C 5-20 alkyl, C 5-20 alkenyl, -R"MR', -R*YR", -YR", and -R*OR"; each M is independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH) -, -P(O)(OR')O-, -S(O) 2 -, an aryl group, and a heteroaryl group; X 1< and X 2< are independently selected from the group consisting of -CH 2 -, -(CH 2 ) 2 -, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH 2 -, -CH 2 -C(O)-, -C(O)O-CH 2 -, -OC(O)-CH 2 -, -CH 2 -C(O)O-, -CH 2 -OC(O)-, -CH(OH)-, -C(S)-, and -CH(SH)-; each Y is independently a C 3-6 carbocycle; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each R is independently selected from the group consisting of C 1 - 3 alkyl and a C 3-6 carbocycle; each R' is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, and H; and each R" is independently selected from the group consisting of C 3-12 alkyl and C 3-12 alkenyl.

[0145] In some examples, the compound is of formula (IIIa):

[0146] The compounds of Formula (III) or (IIIa) include one or more of the following features when applicable.

[0147] In some examples, Z is CH 2 .

[0148] In some examples, Z is absent.

[0149] In some examples, at least one of A 3 and A 4 is N or NH.

[0150] In some examples, A 3 is N and A 4 is NH.

[0151] In some examples, A 3 is N and A 4 is CH 2 .

[0152] In some examples, A 3 is CH and A 4 is NH.

[0153] In some examples, at least one of X 1< and X 2< is not -CH 2 -. For example, in certain examples, X 1< is not -CH 2 -. In some examples, at least one of X 1< and X 2< is -C(O)-.

[0154] In some examples, X 2< is -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH 2 -, -CH 2 -C(O)-, -C(O)O-CH 2 -, -OC(O)-CH 2 -, -CH 2 -C(O)O-, or -CH 2 -OC(O)-.

[0155] In some examples, R 1 , R 2 , and R 3 are independently selected from the group consisting of C 5-20 alkyl and C 5-20 alkenyl. In some examples, R 1 , R 2 , and R 3 are the same. In certain examples, R 1 , R 2 , and R 3 are C 6 , C 9 , C 12 , or C 14 alkyl. In other examples, R 1 , R 2 , and R 3 are C 18 alkenyl. For example, R 1 , R 2 , and R 3 may be linoleyl.

[0156] In some examples, the compound is selected from the group consisting of: and

[0157] In another aspect, the disclosure provides a compound according to formula (Ib): or a salt or isomer thereof, in which A 6 and A 7 are each independently selected from CH or N, wherein at least one of A 6 and A 7 is N; Z is CH 2 or absent wherein when Z is CH 2 , the dashed lines (1) and (2) each represent a single bond; and when Z is absent, the dashed lines (1) and (2) are both absent; X 4< and X 5< are independently selected from the group consisting of -CH 2 -, -(CH 2 ) 2 -, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH 2 -, -CH 2 -C(O)-, -C(O)O-CH 2 -, -OC(O)-CH 2 -, -CH 2 -C(O)O-, -CH 2 -OC(O)-, -CH(OH)-, -C(S)-, and -CH(SH)-; R 1 , R 2 , R 3 , R 4 , and R 5 each are independently selected from the group consisting of C 5-20 alkyl, C 5-20 alkenyl, -R"MR', -R*YR", -YR", and -R*OR"; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O) 2 -, an aryl group, and a heteroaryl group; each Y is independently a C 3-6 carbocycle; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each R is independently selected from the group consisting of C 1-3 alkyl and a C 3-6 carbocycle; each R' is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, and H; and each R" is independently selected from the group consisting of C 3-12 alkyl and C 3-12 alkenyl.

[0158] In some examples, R 1 , R 2 , R 3 , R 4 , and R 5 each are independently selected from the group consisting of C 6-20 alkyl and C 6-20 alkenyl.

[0159] In some examples, R 1 and R 2 are the same. In certain examples, R 1 , R 2 , and R 3 are the same. In some examples, R 4 and R 5 are the same. In certain examples, R 1 , R 2 , R 3 , R 4 , and R 5 are the same.

[0160] In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is C 9-12 alkyl. In certain examples, each of R 1 , R 2 , R 3 , R 4 , and R 5 independently is C 9 , C 12 or C 14 alkyl. In certain examples, each of R 1 , R 2 , R 3 , R 4 , and R 5 is C 9 alkyl.

[0161] In some examples, R 2 , R 3 , R 4 , and R 5 are C 10-20 alkenyl. In some examples, R 2 , R 3 , R 4 , and R 5 are C 18 alkenyl.

[0162] In some examples, A 6 is N and A 7 is N. In some examples, A 6 is CH and A 7 is N.

[0163] In some examples, X 4< is-CH 2 - and X 5< is -C(O)-. In some examples, X 4< and X 5< are -C(O)-.

[0164] In some examples, when A 6 is N and A 7 is N, at least one of X 4< and X 5< is not -CH 2 -, e.g., at least one of X 4< and X 5< is -C(O)-. In some examples, when A 6 is N and A 7 is N, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is -R"MR'.

[0165] In some examples, at least one of R 1 , R 2 , R 3 , R 4 , and R 5 is not -R"MR'.

[0166] In some examples, the compound is

[0167] In an example, the compound has the formula (IV)

[0168] In another aspect, the disclosure provides a compound according to formula (Ic): or a salt or isomer thereof, wherein ring A is or t is 1 or 2; A 1 and A 2 are each independently selected from CH or N; Z is CH 2 or absent wherein when Z is CH 2 , the dashed lines (1) and (2) each represent a single bond; and when Z is absent, the dashed lines (1) and (2) are both absent; R 1 , R 2 , R 3 , and R 4 are independently selected from the group consisting of C 5-20 alkyl, C 5-20 alkenyl, -R"MR', -R*YR", -YR", and -R*OR"; R X1 is H or C 1-3 alkyl; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, - CH(OH)-, -P(O)(OR')O-, -S(O) 2 -, -C(O)S-, -SC(O)-, an aryl group, and a heteroaryl group; X 1< , X 2< , and X 3< are independently selected from the group consisting of a bond, -CH 2 -, -(CH 2 ) 2 -, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -(CH 2 ) n -C(O)-, -C(O)-(CH 2 ) n -,-(CH 2 ) n -C(O)O-, -OC(O)-(CH 2 ) n -, -(CH 2 ) n -OC(O)-, -C(O)O-(CH 2 ) n -, -CH(OH)-, -C(S)-, and -CH(SH)-; each Y is independently a C 3-6 carbocycle; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each R is independently selected from the group consisting of C 1-3 alkyl and a C 3-6 carbocycle; each R' is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, and H; each R" is independently selected from the group consisting of C 3-12 alkyl, C 3-12 alkenyl and -R*MR'; and n is an integer from 1-6.

[0169] The compounds of formula (Ic) may include one or more of the following features when applicable.

[0170] In some examples, ring A is

[0171] In some examples, ring A is

[0172] In some examples ring A is

[0173] In some examples, ring A is

[0174] In some examples, ring A is

[0175] In some examples, ring A is

[0176] In some examples, ring A is

[0177] In some examples, ring A is or

[0178] In some examples, ring A is wherein ring, in which the N atom is connected with X 2< .

[0179] In some examples, when ring A is then i) at least one of X 1< , X 2< , and X 3< is not -CH 2 -; ii) at least one of X 2< and X 3< is -C(O)-; and / or iii) at least one of R 1 , R 2 , R 3 , and R 4 is -R"MR'.

[0180] In some examples, Z is CH 2 .

[0181] In some examples, Z is absent.

[0182] In some examples, at least one of A 1 and A 2 is N.

[0183] In some examples, each of A 1 and A 2 is N.

[0184] In some examples, each of A 1 and A 2 is CH.

[0185] In some examples, A 1 is N and A 2 is CH.

[0186] In some examples, A 1 is CH and A 2 is N.

[0187] In some examples, X 1< is -CH 2 -.

[0188] In some examples, X 2< and X 3< are independently selected from the group consisting of -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH 2 -, -CH 2 -C(O)-, -C(O)O-CH 2 -, -OC(O)-CH 2 -, -CH 2 -C(O)O-, and -CH 2 -OC(O)-.

[0189] In some examples, at least one of X 2< and X 3< is -C(O)-. In some examples, X 2< and X 3< are each -C(O)-.

[0190] In some examples, X 3< is a bond or -(CH 2 ) 2 -.

[0191] In some examples, R 1 and R 2 are the same. In certain examples, R 1 , R 2 , and R 3 are the same. In some examples, R 4 and R 5 are the same. In certain examples, R 1 , R 2 , R 3 , R 4 , and R 5 are the same.

[0192] In some examples, R 1 , R 2 , and R 3 are each C 9 alkyl. In some examples, R 1 , R 2 , and R 3 are each C 10 alkyl.

[0193] In some examples, R 4 is C 9 alkyl. In some examples, R 4 is C 10 alkyl. In some examples, R 4 is C 11 alkyl. In some examples, R 4 is C 12 alkyl. In some examples, R 4 is C 13 alkyl. In some examples, R 4 is C 14 alkyl.

[0194] In some examples, R 4 is -R"MR'.

[0195] In some examples, R 4 is -R"MR' and R 1 , R 2 , and R 3 are each C 9 alkyl. In some examples, R 4 is -R"MR' and R 1 , R 2 , and R 3 are each C 10 alkyl.

[0196] In some examples, at least one of R 1 , R 2 , R 3 , and R 4 , is -R"MR'. In some examples, at most one of R 1 , R 2 , R 3 , and R 4 , is -R"MR'. For example, at least one of R 1 , R 2 , and R 3 may be -R"MR', and / or R 4 is -R"MR'. In certain examples, at least one M is -C(O)O-. In some examples, each M is -C(O)O-. In some examples, at least one M is -OC(O)-. In some examples, each M is -OC(O)-. In some examples, at least one M is -OC(O)O-. In some examples, each M is -OC(O)O-. In some examples, at least one M is -C(O)S-. In some examples, each M is -C(O)S-. In some examples, at least one M is -SC(O)-. In some examples, each M is -SC(O)-.

[0197] In some examples, at least one R" is C 2-5 alkyl. In some examples, each R" is C 2-5 alkyl. In some examples, at least one R" is C 3 alkyl. In certain examples, each R" is C 3 alkyl. In some examples, at least one R" is C 5 alkyl. In certain examples, each R" is C 5 alkyl. In some examples, at least one R" is C 6 alkyl. In certain examples, each R" is C 6 alkyl. In some examples, at least one R" is C 7 alkyl. In certain examples, each R" is C 7 alkyl. In some examples, at least one R" is C 8 alkyl. In certain examples, each R" is C 8 alkyl. In some examples, at least one R" is C 9 alkyl. In certain examples, each R" is C 9 alkyl. In some examples, at least one R" is C 10 alkyl. In certain examples, each R" is C 10 alkyl. In some examples, at least one R" is C 11 alkyl. In certain examples, each R" is C 11 alkyl. In other examples, at least one R' is C 1-9 alkyl. In certain examples, each R' is C 1-9 alkyl. In certain examples, R' is C 1 alkyl. In certain examples, each R' is C 1 alkyl. In some examples, at least one R' is C 2 alkyl. In certain examples, each R' is C 2 alkyl. In some examples, at least one R' is C 5 alkyl. In certain examples, each R' is C 5 alkyl. In some examples, at least one R' is C 6 alkyl. In certain examples, each R' is C 6 alkyl. In some examples, at least one R' is C 7 alkyl. In certain examples, each R' is C 7 alkyl. In some examples, at least one R' is C 8 alkyl. In certain examples, each R' is C 8 alkyl. In some examples, at least one R' is C 9 alkyl. In certain examples, each R' is C 9 alkyl.

[0198] In some examples at least one R" is C 3-7 alkenyl. In some examples, each R" is C 3-7 alkenyl. In certain examples, at least one R" is C 3 alkenyl. In certain examples, each R" is C 3 alkenyl. In certain examples, at least one R" is C 4 alkenyl. In certain examples, each R" is C 4 alkenyl. In certain examples, at least one R" is C 5 alkenyl. In certain examples, each R" is C 5 alkenyl. In certain examples, at least one R" is C 6 alkenyl. In certain examples, each R" is C 6 alkenyl. In certain examples, at least one R" is C 7 alkenyl. In certain examples, each R" is C 7 alkenyl.

[0199] In some examples, at least one R" is branched C 3-12 alkyl, C 3-12 alkenyl.

[0200] In some examples, at least one R' is C 4-10 alkenyl. In certain examples, at least one R' is C 4 alkenyl. In certain examples, at least one R' is C 5 alkenyl. In certain examples, at least one R' is C 6 alkenyl. In certain examples, at least one R' is C 7 alkenyl. In certain examples, at least one R' is C 8 alkenyl. In certain examples at least one R' is C 9 alkenyl. In certain examples, at least one R' is C 10 alkenyl.

[0201] In some examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 5-10 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 5 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 6 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 7 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 8 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 9 alkyl. In certain examples, R 1 , R 2 , R 3 , and R 4 are each independently selected from -R"MR' and C 10 alkyl.

[0202] In another aspect, the disclosure provides a compound according to formula (Id): or a salt or isomer thereof, wherein W is ring A is or t is 1 or 2; A 1 and A 2 are each independently selected from CH or N; Z is CH 2 or absent wherein when Z is CH 2 , the dashed lines (1) and (2) each represent a single bond; and when Z is absent, the dashed lines (1) and (2) are both absent; R 1 , R 2 , R 4 , and R 5 are independently selected from the group consisting of C 5-20 alkyl, C 5-20 alkenyl, -R"MR', -R*YR", -YR", and -R*OR"; R X1 and R X2 are each independently H or C 1 - 3 alkyl; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, - CH(OH)-, -P(O)(OR')O-, -S(O) 2 -, -C(O)S-, -SC(O)-, an aryl group, and a heteroaryl group; M* is -O-, C 1 -C 6 alkyl, -((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s -, or - ((CH 2 ) t C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s -; W 1< and W 2< are each independently selected from the group consisting of a bond, -O- and -N(R 6 )-; each R 6 is independently selected from the group consisting of H and C 1-3 alkyl; each R 7 is independently selected from the group consisting of C 1-3 alkyl, (CH 2 ) o CN, C 1-3 hydroxyalkyl, and C 1 -C 3 haloalkyl; each R 8 is independently selected from the group consisting of CH(CH 2 ) o CN, CH(CH 2 ) o CH 3 , CH(CH 2 ) o OH, and CHX Hal< ; X Hal< is C 1 -C 3 haloalkyl; X 2< and X 3< are independently selected from the group consisting of a bond, -CH 2 -, -(CH 2 ) 2 -, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -(CH 2 ) n -C(O)-, -C(O)-(CH 2 ) n -, -(CH 2 ) n -C(O)O-, -OC(O)-(CH 2 ) n -, -(CH 2 ) n -OC(O)-, -C(O)O-(CH 2 ) n -, -CH(OH)-, -C(S)-, and -CH(SH)-; X 6 and X 7 are each independently selected from the group consisting of -C(O)-, -C(S)-, -C((CH 2 ) w OH)-, and -C(X Hal< )-; each Y is independently a C 3-6 carbocycle; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each R is independently selected from the group consisting of C 1-3 alkyl and a C 3-6 carbocycle; each R' is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, and H; each R" is independently selected from the group consisting of C 3-12 alkyl, C 3-12 alkenyl and -R*MR'; m1 and m2 are each independently 0 or 1; n is an integer from 1-6; o is an integer from 0-3; p, q, r, t, u, and v are each independently an integer from 0-3; and s is an integer from 1-3.

[0203] In some examples, when ring A is then i) at least one of X 2< , and X 3< is not -CH 2 -; ii) at least one of X 2< and X 3< is -C(O)-; and / or iii) at least one of R 1 , R 2 , R 4 , and R 5 is -R"MR'.

[0204] In some examples, W is and ring A is or

[0205] In some examples, m1 and m2 are each 1. In some examples, m1 and m2 are each 0. In some examples, m1 is 1 and m2 is 0. In some examples, m1 is 0 and m2 is 1.

[0206] In some examples, is

[0207] In some examples, is

[0208] In some examples, is

[0209] In some examples, the compound is of any of formulae (Id1)-(Id10): or

[0210] In some examples, Z is CH 2 .

[0211] In some examples, Z is absent.

[0212] In some examples, at least one of A 1 and A 2 is N.

[0213] In some examples, each of A 1 and A 2 is N.

[0214] In some examples, each of A 1 and A 2 is CH.

[0215] In some examples, A 1 is N and A 2 is CH.

[0216] In some examples, A 1 is CH and A 2 is N.

[0217] In some examples, X 2< and X 3< are independently selected from the group consisting of -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH 2 -, -CH 2 -C(O)-, -C(O)O-CH 2 -, -OC(O)-CH 2 -, -CH 2 -C(O)O-, and -CH 2 -OC(O)-.

[0218] In some examples, at least one of X 2< and X 3< is -C(O)-. In some examples, X 2< and X 3< are each -C(O)-.

[0219] In some examples X 2< and X 3< are independently selected from the group consisting of -C(O)-, C(O)-(CH 2 ) n -, and -(CH 2 ) n -C(O)-.

[0220] In some examples, X 2< is -CH 2 -.

[0221] In some examples, X 2< is -(CH 2 ) n -.

[0222] In some examples, X 2< is a bond.

[0223] In some examples, X 2< is -C(O)-.

[0224] In some examples, X 2< is -(CH 2 ) n C(O)-.

[0225] In some examples, X 3< is -CH 2 -.

[0226] In some examples, X 3< is -(CH 2 ) n -. In some examples, X 3< is a bond.

[0227] In some examples, X 3< is -C(O)-.

[0228] In some examples, wherein X 3< is -(CH 2 ) n C(O)-.

[0229] In some examples, n is 1. In some examples, n is 2. In some examples, n is 3. In some examples, n is 4. In some examples, n is 5.

[0230] In some examples, R 1 and R 2 are the same. In certain examples, R 1 , and R 3 are the same. In some examples, R 4 and R 5 are the same. In certain examples, R 1 , R 2 , R 4 , and R 5 are the same.

[0231] In some examples, R X1 and R X2 are each independently C 1-3 alkyl. For example, R X1 and R X2 are each C 1 alkyl. For example, R X1 and R X2 are each C 2 alkyl. For example, R X1 and R X2 are each C 3 alkyl. For example, R X1 is C 1 alkyl and R X2 is C 2 alkyl. For example, R X1 is C 2 alkyl and R X2 is C 1 alkyl. For example, R X1 is C 1 alkyl and R X2 is C 3 alkyl. For example, R X1 is C 3 alkyl and R X2 is C 1 alkyl. For example, R X1 is C 2 alkyl and R X2 is C 3 alkyl. For example, R X1 is C 3 alkyl and R X2 is C 2 alkyl.

[0232] In some examples, R X1 is H and R X2 is C 1-3 alkyl. For example, R X1 is H and R X2 is C 1 alkyl. For example, R X1 is H and R X2 is C 2 alkyl. For example, R X1 is H and R X2 is C 3 alkyl.

[0233] In some examples, R X1 is C 1-3 alkyl and R X2 is H. For example, R X1 is C 1 alkyl and R X2 is H. For example, R X1 is C 2 alkyl and R X2 is H. For example, R X1 is C 3 alkyl and R X2 is H.

[0234] In some examples, R X1 and R X2 are each H.

[0235] In some examples, at least one of R 1 , R 2 , R 4 , and R 5 is -R"MR'. In some examples, at most one of R 1 , R 2 , R 4 , and R 5 is -R"MR'. For example, at least one of R 1 , R 2 , and R 3 may be -R"MR', and / or at least one of R 4 and R 5 is -R"MR'. In certain examples, at least one M is -C(O)O-. In some examples, each M is -C(O)O-. In some examples, at least one M is -OC(O)-. In some examples, each M is -OC(O)-. In some examples, at least one M is -OC(O)O-. In some examples, each M is -OC(O)O-. In some examples, at least one M is - C(O)S-. In some examples, each M is -C(O)S-. In some examples, at least one M is -SC(O)-. In some examples, each M is -SC(O)-.

[0236] In some examples, at least one R" is C 3-7 alkyl. In some examples, each R" is C 2-5 alkyl. In some examples, at least one R" is C 3 alkyl. In certain examples, each R" is C 3 alkyl. In some examples, at least one R" is C 5 alkyl. In certain examples, each R" is C 5 alkyl. In some examples, at least one R" is C 6 alkyl. In certain examples, each R" is C 6 alkyl. In some examples, at least one R" is C 7 alkyl. In certain examples, each R" is C 7 alkyl. In some examples, at least one R" is C 8 alkyl. In certain examples, each R" is C 8 alkyl. In some examples, at least one R" is C 9 alkyl. In certain examples, each R" is C 9 alkyl. In some examples, at least one R" is C 10 alkyl. In certain examples, each R" is C 10 alkyl. In some examples, at least one R" is C 11 alkyl. In certain examples, each R" is C 11 alkyl.

[0237] In other examples, at least one R' is C 1-5 alkyl. In certain examples, each R' is C 1-5 alkyl. In certain examples, at least one R' is C 1 alkyl. In certain examples, each R' is C 1 alkyl. In some examples, at least one R' is C 2 alkyl. In certain examples, each R' is C 2 alkyl. In some examples, at least one R' is C 5 alkyl. In certain examples, each R' is C 5 alkyl. In some examples, at least one R' is C 6 alkyl. In certain examples, each R' is C 6 alkyl. In some examples, at least one R' is C 7 alkyl. In certain examples, each R' is C 7 alkyl. In some examples, at least one R' is C 8 alkyl. In certain examples, each R' is C 8 alkyl. In some examples, at least one R' is C 9 alkyl. In certain examples, each R' is C 9 alkyl.

[0238] In some examples, each R' is C 9 alkyl. In some examples, one R' is C 5-10 alkyl. In some examples, two R' are C 5-10 alkyl. In some examples, one R' is C 9 alkyl. In some examples, two R' are C 9 alkyl. In some examples, at least one R' is C 11-18 alkyl. In some examples, one R' is C 17 alkyl. In some examples, two R' are C 17 alkyl. In some examples, R 1 , R 2 , R 4 , and R 5 are each C 9 alkyl.

[0239] In some examples, at least one R' is C 10 alkyl. In certain examples, each R' is C 10 alkyl. In some examples, at least one R' is C 11-18 alkyl. In some examples, each R' is C 11-18 alkyl. In some examples, at least one R' is C 11 alkyl. In certain examples, each R' is C 11 alkyl. In some examples, at least one R' is C 12 alkyl. In certain examples, each R' is C 12 alkyl. In some examples, at least one R' is C 13 alkyl. In certain examples, each R' is C 13 alkyl. In some examples, at least one R' is C 14 alkyl. In certain examples, each R' is C 14 alkyl. In some examples, at least one R' is C 15 alkyl. In certain examples, each R' is C 15 alkyl. In some examples, at least one R' is C 16 alkyl. In certain examples, each R' is C 16 alkyl. In some examples, at least one R' is C 17 alkyl. In certain examples, each R' is C 17 alkyl. In some examples, at least one R' is C 18 alkyl. In certain examples, each R' is C 18 alkyl.

[0240] In some examples, at least one R' is a branched alkyl. In some examples, each R' is a branched alkyl. In some examples, at least one R' is a branched alkyl. In some examples, at least one R' is branched C 17 alkyl. In some examples, each R' is branched C 17 alkyl. In some examples, one R' is branched C 17 alkyl. In some examples, two R' are branched C 17 alkyl.

[0241] In some examples at least one of R 1 , R 2 , R 4 , and R 5 is C 5-10 alkyl. In some examples at least one of R 1 , R 2 , R 4 , and R 5 is C 10 alkyl. In some examples, at least R 1 and R 2 , and one of R 4 , and R 5 are C 5-10 alkyl. In some examples, one of R 1 and R 2 , and one of R 4 and R 5 are C 10 alkyl. In some examples at least one R 1 , R 2 , R 4 , and R 5 are each C 5-10 alkyl. In some examples, R 1 , R 2 , R 4 , and R 5 are each C 9 alkyl. In some examples, R 1 , R 2 , R 4 , and R 5 are each C 10 alkyl.

[0242] In some examples, R 1 and R 2 are each C 5-10 alkyl. In some examples, R 1 and R 2 are each C 8 alkyl. In some examples, R 1 and R 2 are each C 9 alkyl. In some examples, R 3 and R 4 are each C 5-10 alkyl. In some examples, R 3 and R 4 are each C 8 alkyl. In some examples, R 3 and R 4 are each C 9 alkyl.

[0243] In some examples, m1 is 1 and m2 is 0. In some examples, m1 is 0 and m2 is 1. In some examples, m1 is 0 and m2 are each 0. In some examples, m1 and m2 are each 1.

[0244] In some examples, M* is -O-. The compound of any one of the preceding claims, wherein M* is C 1 -C 6 alkyl. In some examples, M* is C 1 alkyl In some examples, M* is C 2 alkyl. In some examples, M* is C 3 alkyl. In some examples, M* is - ((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s -. In some examples, M* is - ((CH 2 ) t C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s -.

[0245] In some examples, W 1< and W 2< are each a bond. In some examples, W 1< and W 2< are each -O-. In some examples, W 1< and W 2< are each -N(R 6 )-. In some examples, W 1< is a bond and W 2< is -N(R 6 )-. In some examples, W 1< is -N(R 6 )- and W 2< is a bond. In some examples, at least one R 6 is H. In some examples, each R 6 is H. In some examples, at least one R 6 is C 1 alkyl. In some examples, each R 6 is C 1 alkyl. In some examples, at least one R 6 is C 2 alkyl. In some examples, each R 6 is C 2 alkyl.

[0246] In some examples wherein M* is -((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s -, p is 0, 1 or 2. In some examples, p is 0. In some examples, p is 1.

[0247] In some examples wherein M* is -((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s -, q is 0, 1 or 2. In some examples, q is 0. In some examples, q is 1.

[0248] In some examples wherein M* is -((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s -, r is 0, 1 or 2. In some examples, r is 0. In some examples, r is 1.

[0249] In some examples wherein M* is -((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s -, p, q, and r are each 0. In some examples, p and r are each 0 and q is 1.

[0250] In some examples wherein M* is -((CH 2 ) t C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s -, t is 0, 1 or 2. In some examples, t is 0. In some examples, t is 1.

[0251] In some examples wherein M* is -((CH 2 ) t C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s -, u is 0, 1, or 2. In some examples, u is 0. In some examples, u is 1.

[0252] In some examples wherein M* is -((CH 2 )C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s -, v is 0, 1, or 2. In some examples, v is 0. In some examples, v is 1.

[0253] In some examples wherein M* is -((CH 2 ) t C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s -, t, u, and v are each 0.

[0254] In some examples, s is 1, 2, or 3. In some examples, s is 1.

[0255] In some examples wherein M* is -((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s -, s is 1 and p, q, and r are each 0. In some examples, s is 1, p and r are each 0, and q is 1.

[0256] In some examples wherein M* is -((CH 2 ) t C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s -, s is 1 and t, u, and v are each 0.

[0257] In some examples wherein M* is -((CH 2 ) t C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s - and R 8 is CH(CH 2 ) o CN, o is 0. For example R 8 is CHCN, In some examples, o is 1. In some examples, o is 2.

[0258] In some examples wherein M* is -((CH 2 ) t C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s , R 8 is CH(CH 2 ) o CN and o is 0, 1, or 2. In some examples, R 8 is CHCN. In some examples, R 8 is CHCH 2 CN. In some examples, R 8 is CH(CH 2 ) 2 CN.

[0259] In some examples wherein M* is -((CH 2 ) t C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s , R 8 is CH(CH 2 ) o OH and o is 0, 1, or 2. In some examples, R 8 is CHCH 2 OH. In some examples, R 8 is CH(CH 2 ) 2 OH. In some examples, R 8 is CH(CH 2 ) 3 OH.

[0260] In some examples wherein M* is -((CH 2 ) t C(=R 8 )(CH 2 ) u C(=R 8 )(CH 2 ) v ) s , R 8 is CHX Hal< . In some examples, X Hal< is fluoromethyl, fluoroethyl, fluoropropyl, difluoromethyl, difluoroethyl, difluoropropyl, trifluoromethyl, trifluoroethyl, trifluoropropyl, chloromethyl, chloroethyl, chloropropyl, dichloromethyl, dichloroethyl, dichloropropyl, trichloromethyl, trichloroethyl, trichloropropyl, bromomethyl, bromoethyl, bromopropyl, dibromomethyl, dibromoethyl, dibromopropyl, tribromomethyl, tribromoethyl, tribromopropyl, iodomethyl, iodoethyl, iodopropyl, diiodomethyl, diiodoethyl, diiodopropyl, triiodomethyl, triiodoethyl, or triiodopropyl. In some examples X Hal< is trifluoromethyl.

[0261] In some examples wherein M* is -((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s -, R 7 is C 1 alkyl. In some examples, R 7 is C 2 alkyl. In some examples, R 7 is C 3 alkyl.

[0262] In some examples wherein M* is-((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s , R 7 is (CH 2 ) o CN and o is 0, 1, or 2. In some examples, R 7 is CN. In some examples, R 7 is CH 2 CN. In some examples, R 7 is (CH 2 ) 2 CN.

[0263] In some examples wherein M* is -((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s , R 7 is C 1-3 hydroxyalkyl. In some examples, R 7 is CH 2 OH. In some examples, R 7 is (CH 2 ) 2 OH. In some examples, R 7 is (CH 2 ) 3 OH.

[0264] In some examples wherein M* is -((CH 2 ) p CH(R 7 )(CH 2 ) q CH(R 7 )(CH 2 ) r ) s , R 7 is C 1-3 haloalkyl. For example, in some examples, R 7 is fluoromethyl, fluoroethyl, fluoropropyl, difluoromethyl, difluoroethyl, difluoropropyl, trifluoromethyl, trifluoroethyl, trifluoropropyl, chloromethyl, chloroethyl, chloropropyl, dichloromethyl, dichloroethyl, dichloropropyl, trichloromethyl, trichloroethyl, trichloropropyl, bromomethyl, bromoethyl, bromopropyl, dibromomethyl, dibromoethyl, dibromopropyl, tribromomethyl, tribromoethyl, tribromopropyl, iodomethyl, iodoethyl, iodopropyl, diiodomethyl, diiodoethyl, diiodopropyl, triiodomethyl, triiodoethyl, or triiodopropyl. In some examples R 7 is trifluoromethyl.

[0265] In some examples X 6 and X 7 are each-C(O)-. In some examples X 6 and X 7 are each -C(S)-.

[0266] In some examples, X 6 and X 7 are each -C((CH 2 ) w OH)- and w is 0, 1, or 2. In some examples, X 6 and X 7 are each-COH-. In some examples, X 6 and X 7 are each-C((CH 2 )OH)-. In some examples, X 6 and X 7 are each-C((CH 2 ) 2 OH)-.

[0267] In some examples, X 6 and X 7 are each -C(X Hal< )-. In some examples, X Hal< is fluoromethyl, fluoroethyl, fluoropropyl, difluoromethyl, difluoroethyl, difluoropropyl, trifluoromethyl, trifluoroethyl, trifluoropropyl, chloromethyl, chloroethyl, chloropropyl, dichloromethyl, dichloroethyl, dichloropropyl, trichloromethyl, trichloroethyl, trichloropropyl, bromomethyl, bromoethyl, bromopropyl, dibromomethyl, dibromoethyl, dibromopropyl, tribromomethyl, tribromoethyl, tribromopropyl, iodomethyl, iodoethyl, iodopropyl, diiodomethyl, diiodoethyl, diiodopropyl, triiodomethyl, triiodoethyl, or triiodopropyl. In some examples X Hal< is trifluoromethyl.

[0268] In another aspect, the disclosure provides a compound according to formula (Ie): or a salt or isomer thereof, wherein R 1 , R 2 , R 3 , and R 4 are independently selected from the group consisting of C 5-20 alkyl, C 5-20 alkenyl, -R"MR', -R*YR", -YR", and -R*OR"; R X1 is H or C 1-3 alkyl; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O) 2 -, -C(O)S-, -SC(O)-, an aryl group, and a heteroaryl group; X 1< , and X 2< are independently selected from the group consisting of a bond, -CH 2 -, -(CH 2 ) 2 -, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -(CH 2 ) n -C(O)-, -C(O)-(CH 2 ) n -,-(CH 2 ) n -C(O)O-, -OC(O)-(CH 2 ) n -, -(CH 2 ) n -OC(O)-, -C(O)O-(CH 2 ) n -, -CH(OH)-, -C(S)-, and -CH(SH)-; Q is -NR 9 -, or a bond; R 9 is H or C 1-3 alkyl; each Y is independently a C 3-6 carbocycle; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each R is independently selected from the group consisting of C 1-3 alkyl and a C 3-6 carbocycle; each R' is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, and H; each R" is independently selected from the group consisting of C 3-12 alkyl, C 3-12 alkenyl and -R*MR'; and n is an integer from 1-6.

[0269] In some examples, the compound is of any of formulae (Ie1)-(Ie6): or

[0270] In some examples, X 1< is -CH 2 -.

[0271] In some examples, X 2< is -C(O)-. In some examples, X 2< is -OC(O)-. In some examples, X 2< is -C(O)O-. In some examples, X 2< is -CH 2 OC(O)-. In some examples, X 2< is - CH 2 C(O)O-.

[0272] In some examples, R X1 is H. In some examples, R X1 is C 1 - 3 alkyl. In some examples, R X1 is C 1 alkyl.

[0273] In some examples, R 1 , R 2 , R 3 and R 4 are the same. In some examples, R 4 is different from R 1 , R 2 , and R 3 .

[0274] In some examples, R 4 is C 5-10 alkyl. In some examples, R 4 is C 8 alkyl. In some examples, R 4 is C 9 alkyl. In some examples, R 4 is C 10 alkyl. In some examples, R 4 is C 11-20 alkyl. In some examples, R 4 is C 13 alkyl. In some examples, R 4 is C 14 alkyl.

[0275] In some examples, R 1 is -R"MR'. In some examples, R 2 is -R"MR'. In some examples, R 3 is -R"MR'. In some examples, at least one of R 1 , R 2 and R 3 is -R"MR'. In some examples, wherein R 1 , R 2 and R 3 are each -R"MR'. In some examples, R 4 is -R"MR'.

[0276] In some examples, M is -C(O)O-. In some examples, M is -OC(O)-.

[0277] In some examples, at least one R" is C 3-7 alkyl. In some examples, at least one R" is C 4 alkyl. In some examples, at least one R" is C 1-5 alkyl. In some examples, at least one R" is C 4 alkyl. In some examples, each R" is C 3-7 alkyl. In some examples, each R" is C 4 alkyl.

[0278] In some examples, at least one R' is C 1-5 alkyl. In some examples, each R' is C 1-5 alkyl. In some examples, at least one R' is C 4 alkyl. In some examples, each R' is C 4 alkyl.

[0279] In some examples, at least one of R 1 , R 2 , and R 3 is C 5-10 alkyl. In some examples, at least one of R 1 , R 2 , and R 3 is C 10 alkyl. In some examples, at least one of R 1 , R 2 , and R 3 is C 9 alkyl. In some examples, at least one of R 1 , R 2 , and R 3 is C 8 alkyl. In some examples, at least one of R 1 , R 2 , and R 3 is C 7 alkyl. In some examples, at least one of R 1 , R 2 , and R 3 is C 6 alkyl. In some examples, at least one of R 1 , R 2 , and R 3 is C 5 alkyl.

[0280] In some examples, R 1 , R 2 , and R 3 are each C 5-10 alkyl. In some examples, R 1 , R 2 , and R 3 are each C 10 alkyl. In some examples, R 1 , R 2 , and R 3 are each C 9 alkyl. In some examples, R 1 , R 2 , and R 3 are each C 8 alkyl. In some examples, are each R 1 , R 2 , and R 3 is C 7 alkyl. In some examples, are each R 1 , R 2 , and R 3 is C 6 alkyl. In some examples, are each R 1 , R 2 , and R 3 is C 5 alkyl.

[0281] In some examples, Q is NR 9 . In some examples, R 9 is H. In some examples, Q is a bond.

[0282] As used herein, the term "alkyl" or "alkyl group" means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted. For example, the notation "C 1-24 alkyl" means an optionally substituted linear or branched, saturated hydrocarbon including 1-24 carbon atoms. An alkyl group described herein refers to both unsubstituted and substituted alkyl group unless otherwise specified.

[0283] As used herein, the term "alkenyl" or "alkenyl group" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted. The notation "C 2-24 alkenyl" means an optionally substituted linear or branched hydrocarbon including 2 to 24 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds. For example, C 18 alkenyl may include one or more double bonds. A C 18 alkenyl group including two double bonds may be a linoleyl group. An alkenyl group described herein refers to both unsubstituted and substituted unless otherwise specified.

[0284] As used herein, the term "carbocycle" or "carbocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, or twelve membered rings. The notation "C 3-6 carbocycle" means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1,2-dihydronaphthyl groups. Carbocycles described herein refers to both unsubstituted and substituted carbocycles unless otherwise specified. The term "cycloalkyl" as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond. Unless otherwise specified, carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles.

[0285] As used herein, the term "heterocycle" or "heterocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom. Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, or twelve membered rings. Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic. Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups. Heterocycles may be optionally substituted.

[0286] Affixing the suffix "-ene" to a group indicates the group is a divalent moiety, e.g., alkylene is the divalent moiety of alkyl, alkenylene is the divalent moiety of alkenyl, alkynylene is the divalent moiety of alkynyl, heteroalkylene is the divalent moiety of heteroalkyl, heteroalkenylene is the divalent moiety of heteroalkenyl, heteroalkynylene is the divalent moiety of heteroalkynyl, carbocyclylene is the divalent moiety of carbocyclyl, heterocyclylene is the divalent moiety of heterocyclyl, arylene is the divalent moiety of aryl, and heteroarylene is the divalent moiety of heteroaryl.

[0287] As used herein, a "biodegradable group" is a group that may facilitate faster metabolism of a lipid in a mammalian entity. A biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O) 2 -, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is a carbocyclic group including one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is a heterocyclic group including one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Aryl and heteroaryl groups may be optionally substituted. For example, each M, M b< , M c< , or M d< can be independently selected from the non-limiting group consisting of phenyl, oxazole, and thiazole. In the formulae above, each M, M b< , M c< , or M d< can be independently selected from the list of biodegradable groups above.

[0288] Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified. Optional substituents may be selected from the group consisting of, but are not limited to, a halogen atom (e.g., a chloride, bromide, fluoride, or iodide group), a carboxylic acid (e.g., -C(O)OH), an alcohol (e.g., a hydroxyl, -OH), an ester (e.g., -C(O)OR or -OC(O)R), an aldehyde (e.g.,-C(O)H), a carbonyl (e.g., -C(O)R, alternatively represented by C=O), an acyl halide (e.g.,-C(O)X, in which X is a halide selected from bromide, fluoride, chloride, and iodide), a carbonate (e.g., -OC(O)OR), an alkoxy (e.g., -OR), an acetal (e.g.,-C(OR) 2 Rʺʺ, in which each OR are alkoxy groups that can be the same or different and Rʺʺ is an alkyl or alkenyl group), a phosphate (e.g., P(O) 4 3-< ), a thiol (e.g., -SH), a sulfoxide (e.g., -S(O)R), a sulfinic acid (e.g., -S(O)OH), a sulfonic acid (e.g., -S(O) 2 OH), a thial (e.g., -C(S)H), a sulfate (e.g., S(O) a 2-< ), a sulfonyl (e.g., -S(O) 2 -), an amide (e.g., -C(O)NR 2 , or -N(R)C(O)R), an azido (e.g., -N 3 ), a nitro (e.g., -NO 2 ), a cyano (e.g., -CN), an isocyano (e.g., -NC), an acyloxy (e.g.,-OC(O)R), an amino (e.g., -NR 2 , -NRH, or -NH 2 ), a carbamoyl (e.g., -OC(O)NR 2 , -OC(O)NRH, or -OC(O)NH 2 ), a sulfonamide (e.g., -S(O) 2 NR 2 , -S(O) 2 NRH, -S(O) 2 NH 2 , -N(R)S(O) 2 R, -N(H)S(O) 2 R, -N(R)S(O)zH, or -N(H)S(O) 2 H), a cyclyl (e.g., carbocyclyl or heterocyclyl) group, an alkyl group, and an alkenyl group. In any of the preceding, R is an alkyl or alkenyl group, as defined herein. In some examples, the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein. For example, a C 5-20 alkyl group may be further substituted with one, two, three, four, five, six, or more substituents as described herein.

[0289] An amine moiety of a lipid according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Iel)-(Ie6), (II), (IIa), (III), and (IIIa) may be protonated at a physiological pH. Thus, a lipid may have a positive or partial positive charge at physiological pH. Such lipids may be referred to as cationic or ionizable (amino)lipids. Lipids may be zwitterionic, i.e., neutral molecules having both a positive and a negative charge.Nanoparticle compositions

[0290] The disclosure also features nanoparticle compositions comprising a lipid component comprising a compound according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa) as described herein. In some embodiments, the largest dimension of a nanoparticle composition is 1 µm or shorter (e.g., 1 µm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, or shorter), e.g., when measured by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy, or another method. Nanoparticle compositions include, for example, lipid nanoparticles (LNPs), liposomes, lipid vesicles, and lipoplexes. In some embodiments, nanoparticle compositions are vesicles including one or more lipid bilayers. In certain embodiments, a nanoparticle composition includes two or more concentric bilayers separated by aqueous compartments. Lipid bilayers may be functionalized and / or crosslinked to one another. Lipid bilayers may include one or more ligands, proteins, or channels.

[0291] Nanoparticle compositions comprise a lipid component including at least one lipid, such as a compound according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), as described herein. For example, in some examples, a nanoparticle composition may include a lipid component including one of Compounds 1 through 88, Compounds 17-1 through 17-13, Compounds 19-1 through 19-6, Compounds 20-1 through 20-25 and Compounds 21-1 through 21-6. Nanoparticle compositions may also include a variety of other components. For example, the lipid component of a nanoparticle composition may include one or more other lipids in addition to a lipid according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa).Cationic / ionizable lipids

[0292] A nanoparticle composition may include one or more cationic and / or ionizable lipids (e.g., lipids that may have a positive or partial positive charge at physiological pH) in addition to a lipid according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa). Cationic and / or ionizable lipids may be selected from the non-limiting group consisting of 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-y loxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-die n-1-yloxy]propan-1-amine (Octyl-CLinDMA (2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-die n-1-yloxy]propan-1-amine (Octyl-CLinDMA (2S)), (i.e., (12Z, 15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine), and (i.e., N,N-dimethyl-1-{(1S,2R)-2-octylcyclopropyl}heptadecan-8-amine).

[0293] In addition to these, a cationic lipid may also be a lipid including a cyclic amine group. Additional cationic and / or ionizable lipids that are suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633.PEG lipids

[0294] The lipid component of a nanoparticle composition may include one or more PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. A PEG lipid may be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.

[0295] In certain embodiments, a PEG lipid may be of Formula (VI): or a salt or isomer thereof, wherein: R 3PEG< is-OR O< ; R O< is hydrogen, C 1-6 alkyl or an oxygen protecting group; r is an integer between 1 and 100; R 5PEG< is C 10-40 alkyl, C 10-40 alkenyl, or C 10-40 alkynyl; and optionally one or more methylene groups of R 5PEG< are independently replaced with C 3-10 carbocyclylene, 4 to 10 membered heterocyclylene, C 6-10 arylene, 4 to 10 membered heteroarylene, -N(R N< )-, -O-, -S-, -C(O)-, -C(O)N(R N< )-, -NR N< C(O)-, -NR N< C(O)N(R N< )-, -C(O)O-, -OC(O)-, -OC(O)O-, - OC(O)N(R N< )-, -NR N< C(O)O-, -C(O)S-, -SC(O)-, -C(=NR N< )-, -C(=NR N< )N(R N< )-, - NR N< C(=NR N< )-, -NR N< C(=NR N< )N(R N< )-, -C(S)-, -C(S)N(R N< )-, -NR N< C(S)-, -NR N< C(S)N(R N< )-, -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O) 2 -, -S(O) 2 O-, -OS(O) 2 O-, -N(R N< )S(O)-, - S(O)N(R N< )-, -N(R N< )S(O)N(R N< )-, -OS(O)N(R N< )-, -N(R N< )S(O)O-, -S(O) 2 -, -N(R N< )S(O) 2 -, - S(O) 2 N(R N< )-, -N(R N< )S(O) 2 N(R N< )-, -OS(O) 2 N(R N< )-, or -N(R N< )S(O) 2 O-; and each instance of R N< is independently hydrogen, C 1-6 alkyl, or a nitrogen protecting group.

[0296] In certain embodiments, the compound of Formula (VI) is of Formula (VI-a): or a salt or isomer thereof.

[0297] In certain embodiments, a compound of Formula (VI) is of Formula (VI-b): or a salt or isomer thereof.

[0298] In certain embodiments, the compound of Formula (VI-b) is a compound having the formula: (PEG 1) or a salt or isomer thereof.

[0299] In some embodiments of the compositions provided herein, the PEG lipid is a PEG lipid described in International Patent Application No. PCT / US2016 / 000129, filed December 10, 2016.Structural lipids

[0300] The lipid component of a nanoparticle composition may include one or more structural lipids. Structural lipids can be selected from the group consisting of, but are not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and a corticosteroid (such as prednisolone, dexamethasone, prednisone, and hydrocortisone), or a combination thereof.Phospholipids

[0301] The lipid component of a nanoparticle composition may include one or more phospholipids, such as one or more (poly)unsaturated lipids. Phospholipids may assemble into one or more lipid bilayers. In general, phospholipids may include a phospholipid moiety and one or more fatty acid moieties. For example, a phospholipid may be a lipid according to formula (V) in which R p represents a phospholipid moiety and R 1 and R 2 represent fatty acid moieties with or without unsaturation that may be the same or different. A phospholipid moiety may be selected from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysond a sphingomyelin. A fatty acid moiety may be selected from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Non-natural species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid may be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group may undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions may be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye).

[0302] Phospholipids useful in the compositions and methods described herein may be selected from the non-limiting group consisting of 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin. In certain embodiments, a nanoparticle composition includes DSPC. In certain embodiments, a nanoparticle composition includes DOPE. In some embodiments, a nanoparticle composition includes both DSPC and DOPE.Adjuvants

[0303] In some embodiments, a nanoparticle composition that includes one or more lipids described herein may further include one or more adjuvants, e.g., Glucopyranosyl Lipid Adjuvant (GLA), CpG oligodeoxynucleotides (e.g., Class A or B), poly(I:C), aluminum hydroxide, and Pam3CSK4.Therapeutic agents

[0304] Nanoparticle compositions may include one or more therapeutic and / or prophylactic agents. The disclosure features methods of delivering a therapeutic and / or prophylactic agent to a mammalian cell or organ, producing a polypeptide of interest in a mammalian cell, and treating a disease or disorder in a mammal in need thereof comprising administering to a mammal and / or contacting a mammalian cell with a nanoparticle composition including a therapeutic and / or prophylactic agent.

[0305] Therapeutic and / or prophylactic agents include biologically active substances and are alternately referred to as "active agents." A therapeutic and / or prophylactic agent may be a substance that, once delivered to a cell or organ, brings about a desirable change in the cell, organ, or other bodily tissue or system. Such species may be useful in the treatment of one or more diseases, disorders, or conditions. In some embodiments, a therapeutic and / or prophylactic agent is a small molecule drug useful in the treatment of a particular disease, disorder, or condition. Examples of drugs useful in the nanoparticle compositions described herein include, but are not limited to, antineoplastic agents (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), antitumor agents (e.g., actinomycin D, vincristine, vinblastine, cytosine arabinoside, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogs, such as methotrexate and purine and pyrimidine analogs), anti-infective agents, local anesthetics (e.g., dibucaine and chlorpromazine), beta-adrenergic blockers (e.g., propranolol, timolol, and labetalol), antihypertensive agents (e.g., clonidine and hydralazine), anti-depressants (e.g., imipramine, amitriptyline, and doxepin), anti-convulsants (e.g., phenytoin), antihistamines (e.g., diphenhydramine, chlorpheniramine, and promethazine), antibiotic / antibacterial agents (e.g., gentamycin, ciprofloxacin, and cefoxitin), antifungal agents (e.g., miconazole, terconazole, econazole, isoconazole, butaconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), antiparasitic agents, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, antiglaucoma agents, vitamins, narcotics, and imaging agents.

[0306] In some embodiments, a therapeutic and / or prophylactic agent is a cytotoxin, a radioactive ion, a chemotherapeutic, a vaccine, a compound that elicits an immune response, and / or another therapeutic and / or prophylactic agent. A cytotoxin or cytotoxic agent includes any agent that may be detrimental to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracinedione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, e.g., maytansinol, rachelmycin (CC-1065), and analogs or homologs thereof. Radioactive ions include, but are not limited to iodine (e.g., iodine 125 or iodine 131), strontium 89, phosphorous, palladium, cesium, iridium, phosphate, cobalt, yttrium 90, samarium 153, and praseodymium. Vaccines include compounds and preparations that are capable of providing immunity against one or more conditions related to infectious diseases such as influenza, measles, human papillomavirus (HPV), rabies, meningitis, whooping cough, tetanus, plague, hepatitis, and tuberculosis and can include mRNAs encoding infectious disease derived antigens and / or epitopes. Vaccines also include compounds and preparations that direct an immune response against cancer cells and can include mRNAs encoding tumor cell derived antigens, epitopes, and / or neoepitopes. Compounds eliciting immune responses may include vaccines, corticosteroids (e.g., dexamethasone), and other species. In some examples, a vaccine and / or a compound capable of eliciting an immune response is administered intramuscularly via a composition including a compound according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa). Other therapeutic and / or prophylactic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa chlorambucil, rachelmycin (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine, vinblastine, taxol and maytansinoids).

[0307] In other embodiments, a therapeutic and / or prophylactic agent is a protein. Therapeutic proteins useful in the nanoparticles of the disclosure include, but are not limited to, gentamycin, amikacin, insulin, erythropoietin (EPO), granulocyte-colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), Factor VIR, luteinizing hormone-releasing hormone (LHRH) analogs, interferons, heparin, Hepatitis B surface antigen, typhoid vaccine, and cholera vaccine.Polynucleotides and Nucleic Acids

[0308] In some embodiments, a therapeutic and / or prophylactic agent is a polynucleotide or nucleic acid (e.g., ribonucleic acid or deoxyribonucleic acid). The term "polynucleotide," in its broadest sense, includes any compound and / or substance that is or can be incorporated into an oligonucleotide chain. Exemplary polynucleotides for use in accordance with the present disclosure include, but are not limited to, one or more of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger mRNA (mRNA), hybrids thereof, RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, miRNAs, antisense RNAs, ribozymes, catalytic DNA, RNAs that induce triple helix formation, aptamers, vectors, etc. In certain embodiments, a therapeutic and / or prophylactic agent is an RNA. RNAs useful in the compositions and methods described herein can be selected from the group consisting of, but are not limited to, shortmers, antagomirs, antisense, ribozymes, small interfering RNA (siRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and mixtures thereof. In certain embodiments, the RNA is an mRNA.

[0309] In certain embodiments, a therapeutic and / or prophylactic agent is an mRNA. An mRNA may encode any polypeptide of interest, including any naturally or non-naturally occurring or otherwise modified polypeptide. A polypeptide encoded by an mRNA may be of any size and may have any secondary structure or activity. In some embodiments, a polypeptide encoded by an mRNA may have a therapeutic effect when expressed in a cell.

[0310] In other embodiments, a therapeutic and / or prophylactic agent is an siRNA. An siRNA may be capable of selectively knocking down or down regulating expression of a gene of interest. For example, an siRNA could be selected to silence a gene associated with a particular disease, disorder, or condition upon administration to a subject in need thereof of a nanoparticle composition including the siRNA. An siRNA may comprise a sequence that is complementary to an mRNA sequence that encodes a gene or protein of interest. In some embodiments, the siRNA may be an immunomodulatory siRNA.

[0311] In some embodiments, a therapeutic and / or prophylactic agent is an shRNA or a vector or plasmid encoding the same. An shRNA may be produced inside a target cell upon delivery of an appropriate construct to the nucleus. Constructs and mechanisms relating to shRNA are well known in the relevant arts.

[0312] Nucleic acids and polynucleotides useful in or suitable for the compounds and methods of the disclosure typically include a first region of linked nucleosides encoding a polypeptide of interest (e.g., a coding region), a first flanking region located at the 5 -terminus of the first region (e.g., a 5'-UTR), a second flanking region located at the 3'-terminus of the first region (e.g., a 3'-UTR), at least one 5'-cap region, and a 3'-stabilizing region. In some embodiments, a nucleic acid or polynucleotide further includes a poly-A region or a Kozak sequence (e.g., in the 5'-UTR). In some cases, polynucleotides may contain one or more intronic nucleotide sequences capable of being excised from the polynucleotide. In some embodiments, a polynucleotide or nucleic acid (e.g., an mRNA) may include a 5' cap structure, a chain terminating nucleotide, a stem loop, a polyA sequence, and / or a polyadenylation signal. Any one of the regions of a nucleic acid may include one or more alternative components (e.g., an alternative nucleoside). For example, the 3'-stabilizing region may contain an alternative nucleoside such as an L-nucleoside, an inverted thymidine, or a 2'-O-methyl nucleoside and / or the coding region, 5'-UTR, 3'-UTR, or cap region may include an alternative nucleoside such as a 5-substituted uridine (e.g., 5-methoxyuridine), a 1-substituted pseudouridine (e.g., 1-methyl-pseudouridine or 1-ethyl-pseudouridine), and / or a 5-substituted cytidine (e.g., 5-methyl-cytidine).

[0313] Generally, the shortest length of a polynucleotide can be the length of the polynucleotide sequence that is sufficient to encode for a dipeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode for a tripeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode for a tetrapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode for a pentapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode for a hexapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode for a heptapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode for an octapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode for a nonapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode for a decapeptide.

[0314] Examples of dipeptides that the alternative polynucleotide sequences can encode for include, but are not limited to, carnosine and anserine.

[0315] In some cases, a polynucleotide is greater than 30 nucleotides in length. In another embodiment, the polynucleotide molecule is greater than 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 50 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5000 nucleotides, or greater than 5000 nucleotides.

[0316] Nucleic acids and polynucleotides may include one or more naturally occurring components, including any of the canonical nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine). In one embodiment, all or substantially all of the nucleotides comprising (a) the 5'-UTR, (b) the open reading frame (ORF), (c) the 3'-UTR, (d) the poly A tail, and any combination of (a, b, c, or d above) comprise naturally occurring canonical nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine).

[0317] Nucleic acids and polynucleotides may include one or more alternative components, as described herein, which impart useful properties including increased stability and / or the lack of a substantial induction of the innate immune response of a cell into which the polynucleotide is introduced. For example, an alternative polynucleotide or nucleic acid exhibits reduced degradation in a cell into which the polynucleotide or nucleic acid is introduced, relative to a corresponding unaltered polynucleotide or nucleic acid. These alternative species may enhance the efficiency of protein production, intracellular retention of the polynucleotides, and / or viability of contacted cells, as well as possess reduced immunogenicity.

[0318] Polynucleotides and nucleic acids may be naturally or non-naturally occurring. Polynucleotides and nucleic acids may include one or more modified (e.g., altered or alternative) nucleobases, nucleosides, nucleotides, or combinations thereof. The nucleic acids and polynucleotides useful in the nanoparticle compositions described herein can include any useful modification or alteration, such as to the nucleobase, the sugar, or the internucleoside linkage (e.g., to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone). In certain embodiments, alterations (e.g., one or more alterations) are present in each of the nucleobase, the sugar, and the internucleoside linkage. Alterations according to the present disclosure may be alterations of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), e.g., the substitution of the 2'-OH of the ribofuranosyl ring to 2'-H, threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs), or hybrids thereof. Additional alterations are described herein.

[0319] Polynucleotides and nucleic acids may or may not be uniformly altered along the entire length of the molecule. For example, one or more or all types of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may or may not be uniformly altered in a polynucleotide or nucleic acid, or in a given predetermined sequence region thereof. In some instances, all nucleotides X in a polynucleotide (or in a given sequence region thereof) are altered, wherein X may any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.

[0320] Different sugar alterations and / or internucleoside linkages (e.g., backbone structures) may exist at various positions in a polynucleotide. One of ordinary skill in the art will appreciate that the nucleotide analogs or other alteration(s) may be located at any position(s) of a polynucleotide such that the function of the polynucleotide is not substantially decreased. An alteration may also be a 5'- or 3'-terminal alteration. In some embodiments, the polynucleotide includes an alteration at the 3'-terminus. The polynucleotide may contain from about 1% to about 100% alternative nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of a canonical nucleotide (e.g., A, G, U, or C).

[0321] Polynucleotides may contain at a minimum zero and at maximum 100% alternative nucleotides, or any intervening percentage, such as at least 5% alternative nucleotides, at least 10% alternative nucleotides, at least 25% alternative nucleotides, at least 50% alternative nucleotides, at least 80% alternative nucleotides, or at least 90% alternative nucleotides. For example, polynucleotides may contain an alternative pyrimidine such as an alternative uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in a polynucleotide is replaced with an alternative uracil (e.g., a 5-substituted uracil). The alternative uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some instances, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the polynucleotide is replaced with an alternative cytosine (e.g., a 5-substituted cytosine). The alternative cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).

[0322] In some instances, nucleic acids do not substantially induce an innate immune response of a cell into which the polynucleotide (e.g., mRNA) is introduced. Features of an induced innate immune response include 1) increased expression of pro-inflammatory cytokines, 2) activation of intracellular PRRs (RIG-I, MDA5, etc., and / or 3) termination or reduction in protein translation.

[0323] The nucleic acids can optionally include other agents (e.g., RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, miRNAs, antisense RNAs, ribozymes, catalytic DNA, tRNA, RNAs that induce triple helix formation, aptamers, and vectors). In some embodiments, the nucleic acids may include one or more messenger RNAs (mRNAs) having one or more alternative nucleoside or nucleotides (i.e., alternative mRNA molecules).

[0324] In some embodiments, a nucleic acid (e.g. mRNA) molecule, formula, composition or method associated therewith comprises one or more polynucleotides comprising features as described in WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, WO2010088927, WO2010 / 037539, WO2004 / 004743, WO2005 / 016376, WO2006 / 024518, WO2007 / 095976, WO2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 095226, WO2011069586, WO2011026641, WO2011 / 144358, WO2012019780, WO2012013326, WO2012089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143699, WO2013143700, WO2013 / 120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO2014127917, WO2015 / 024669, WO2015 / 024668, WO2015 / 024667, WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015101415, WO2015101414, WO2015024667, WO2015062738, WO2015101416.

[0325] In some embodiments the agent that inhibits immune responses by the LNP comprises a miR binding site. In other embodiments the miR binding site is selected from miR 126, miR 155, and miR 142 3p. The miR binding site is incorporated into a mRNA in some embodiments. In other embodiments the miR binding site is separate from the mRNA.

[0326] In some embodiments the agent that inhibits immune responses by the LNP comprises an mRNA comprising a miR binding site. In various embodiments, the mRNA comprises, one, two, three or four miR binding sites, wherein at least one of the miR binding sites is a miR-126 binding site. In one embodiment, the mRNA, comprises at least two microRNA binding sites, wherein at least one of the microRNA binding sites is a miR-126 binding site. In one embodiment, the mRNA, e.g., mmRNA, comprises a miR-126 binding site and a second microRNA binding site for a miR selected from the group consisting of miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155, miR-16, miR-21, miR-223, miR-24 and miR-27. In another embodiment, the mRNA, comprises a miR-126 (e.g., miR-126-3p) binding site and a miR-142 (e.g., miR-142-3p) binding site. A miR referred to by number herein can refer to either of the two mature microRNAs originating from opposite arms of the same pre-miRNA (e.g., either the 3p or 5p microRNA). All miRs referred to by number herein are intended to include both the 3p and 5p arms / sequences. It has now been discovered that incorporation of at least one microRNA binding site for a microRNA expressed in immune cells (e.g., miR-126, miR-142, miR-155 and combinations thereof) into an mRNA construct can reduce or inhibit accelerated blood clearance (ABC) when the lipid-comprising compound or composition comprising the mRNA is administered to a subject. In one embodiment, the mechanism of action of the miRNA binding site(s) is a microRNA "sponge", wherein the miRNA binding site(s) in the construct or LNP "soaks up" microRNAs that bind to the binding site(s).Nucleobase Alternatives

[0327] The alternative nucleosides and nucleotides can include an alternative nucleobase. A nucleobase of a nucleic acid is an organic base such as a purine or pyrimidine or a derivative thereof. A nucleobase may be a canonical base (e.g., adenine, guanine, uracil, thymine, and cytosine). These nucleobases can be altered or wholly replaced to provide polynucleotide molecules having enhanced properties, e.g., increased stability such as resistance to nucleases. Non-canonical or modified bases may include, for example, one or more substitutions or modifications including but not limited to alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and / or thio substitutions; one or more fused or open rings; oxidation; and / or reduction.

[0328] Alternative nucleotide base pairing encompasses not only the standard adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and / or alternative nucleotides including non-standard or alternative bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures. One example of such non-standard base pairing is the base pairing between the alternative nucleotide inosine and adenine, cytosine, or uracil.

[0329] In some embodiments, the nucleobase is an alternative uracil. Exemplary nucleobases and nucleosides having an alternative uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil (s 2< U), 4-thio-uracil (s 4< U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5< U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m 3< U), 5-methoxy-uracil (mo 5< U), uracil 5-oxyacetic acid (cmo 5< U), uracil 5-oxyacetic acid methyl ester (mcmo 5< U), 5-carboxymethyl-uracil (cm 5< U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5< U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5< U), 5-methoxycarbonylmethyl-uracil (mcm 5< U), 5-methoxycarbonylmethyl-2-thio-uracil (mcm 5< s 2< U), 5-aminomethyl-2-thio-uracil (nm 5< s 2< U), 5-methylaminomethyl-uracil (mnm 5< U), 5-methylaminomethyl-2-thio-uracil (mnm 5< s 2< U), 5-methylaminomethyl-2-seleno-uracil (mnm 5< se 2< U), 5-carbamoylmethyl-uracil (ncm 5< U), 5-carboxymethylaminomethyl-uracil (cmnm 5< U), 5-carboxymethylaminomethyl-2-thio-uracil (cmnm 5< s 2< U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinomethyl-uracil (τm 5< U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil(τm 5< s 2< U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5< U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1< ψ), 1-ethyl-pseudouridine (Et 1< ψ), 5-methyl-2-thio-uracil (m 5< s 2< U), 1-methyl-4-thio-pseudouridine (m 1< s 4< ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3< ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5< D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp 3< U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3< ψ), 5-(isopentenylaminomethyl)uracil (inm 5< U), 5-(isopentenylaminomethyl)-2-thio-uracil (inm 5< s 2< U), 5,2'-O-dimethyl-uridine (m 5< Um), 2-thio-2'-O_methyl-uridine (s 2< Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm 5< Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm 5< Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm 5< Um), 3,2'-O-dimethyl-uridine (m 3< Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5< Um), 1-thio-uracil, deoxythymidine, 5-(2-carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, and 5-[3-(1-E-propenylamino)]uracil.

[0330] In some embodiments, the nucleobase is an alternative cytosine. Exemplary nucleobases and nucleosides having an alternative cytosine include 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine (ac4C), 5-formyl-cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytosine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), 5,2'-O-dimethyl-cytidine (m5Cm), N4-acetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (f5Cm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine.

[0331] In some embodiments, the nucleobase is an alternative adenine. Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-azaadenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.

[0332] In some embodiments, the nucleobase is an alternative guanine. Exemplary nucleobases and nucleosides having an alternative guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OHyW), undermodified hydroxywybutosine (OHyW*), 7-deaza-guanine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanine (preQ0), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2, N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine, and O-6-methyl-guanine.

[0333] The alternative nucleobase of a nucleotide can be independently a purine, a pyrimidine, a purine or pyrimidine analog. For example, the nucleobase can be an alternative to adenine, cytosine, guanine, uracil, or hypoxanthine. In another embodiment, the nucleobase can also include, for example, naturally-occurring and synthetic derivatives of a base, including pyrazolo[3,4-d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5 triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines, thiazolo[4,5-d]pyrimidines, pyrazin-2-ones, 1,2,4-triazine, pyridazine; or 1,3,5 triazine. When the nucleotides are depicted using the shorthand A, G, C, T or U, each letter refers to the representative base and / or derivatives thereof, e.g., A includes adenine or adenine analogs, e.g., 7-deaza adenine).Alterations on the Sugar

[0334] Nucleosides include a sugar molecule (e.g., a 5-carbon or 6-carbon sugar, such as pentose, ribose, arabinose, xylose, glucose, galactose, or a deoxy derivative thereof) in combination with a nucleobase, while nucleotides are nucleosides containing a nucleoside and a phosphate group or alternative group (e.g., boranophosphate, thiophosphate, selenophosphate, phosphonate, alkyl group, amidate, and glycerol). A nucleoside or nucleotide may be a canonical species, e.g., a nucleoside or nucleotide including a canonical nucleobase, sugar, and, in the case of nucleotides, a phosphate group, or may be an alternative nucleoside or nucleotide including one or more alternative components. For example, alternative nucleosides and nucleotides can be altered on the sugar of the nucleoside or nucleotide. In some embodiments, the alternative nucleosides or nucleotides include the structure: In each of the Formulae VI, VII, VIII, and IX, each of m and n is independently, an integer from 0 to 5, each of U and U' independently, is O, S, N(R U< ) nu , or C(R U< ) nu , wherein nu is an integer from 0 to 2 and each R U< is, independently, H, halo, or optionally substituted alkyl; each of R 1'< , R 2'< , R 1"< , R 2"< , R 1< , R 2< , R 3< , R 4< , and R 5< is, independently, if present, H, halo, hydroxy, thiol, optionally substituted alkyl, optionally substituted alkoxy, optionally substituted alkenyloxy, optionally substituted alkynyloxy, optionally substituted aminoalkoxy, optionally substituted alkoxyalkoxy, optionally substituted hydroxyalkoxy, optionally substituted amino, azido, optionally substituted aryl, optionally substituted aminoalkyl, optionally substituted aminoalkenyl, optionally substituted aminoalkynyl, or absent; wherein the combination of R 3< with one or more of R 1'< , R 1"< , R 2'< , R 2"< , or R 5< (e.g., the combination of R 1'< and R 3< , the combination of R 1"< and R 3< , the combination of R 2'< and R 3< , the combination of R 2"< and R 3< , or the combination of R 5< and R 3< ) can join together to form optionally substituted alkylene or optionally substituted heteroalkylene and, taken together with the carbons to which they are attached, provide an optionally substituted heterocyclyl (e.g., a bicyclic, tricyclic, or tetracyclic heterocyclyl); wherein the combination of R 5< with one or more of R 1'< , R 1"< , R 2'< , or R 2"< (e.g., the combination of R 1'< and R 5< , the combination of R 1"< and R 5< , the combination of R 2'< and R 5< , or the combination of R 2"< and R 5< ) can join together to form optionally substituted alkylene or optionally substituted heteroalkylene and, taken together with the carbons to which they are attached, provide an optionally substituted heterocyclyl (e.g., a bicyclic, tricyclic, or tetracyclic heterocyclyl); and wherein the combination of R 4< and one or more of R 1'< , R 1"< , R 2'< , R 2"< , R 3< , or R 5< can join together to form optionally substituted alkylene or optionally substituted heteroalkylene and, taken together with the carbons to which they are attached, provide an optionally substituted heterocyclyl (e.g., a bicyclic, tricyclic, or tetracyclic heterocyclyl); each of m' and m" is, independently, an integer from 0 to 3 (e.g., from 0 to 2, from 0 to 1, from 1 to 3, or from 1 to 2); each of Y 1< , Y 2< , and Y 3< , is, independently, O, S, Se, -NR N1< -, optionally substituted alkylene, or optionally substituted heteroalkylene, wherein R N1< is H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, or absent; each Y 4< is, independently, H, hydroxy, thiol, boranyl, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted alkenyloxy, optionally substituted alkynyloxy, optionally substituted thioalkoxy, optionally substituted alkoxyalkoxy, or optionally substituted amino; each Y 5< is, independently, O, S, Se, optionally substituted alkylene (e.g., methylene), or optionally substituted heteroalkylene; and B is a nucleobase, either modified or unmodified.In some embodiments, the 2'-hydroxy group (OH) can be modified or replaced with a number of different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, azido, halo (e.g., fluoro), optionally substituted C 1-6 alkyl (e.g., methyl); optionally substituted C 1-6 alkoxy (e.g., methoxy or ethoxy); optionally substituted C 6-10 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 6-10 aryl-C 1-6 alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), - O(CH 2 CH 2 O) n CH 2 CH 2 OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20); "locked" nucleic acids (LNA) in which the 2'-hydroxy is connected by a C 1-6 alkylene or C 1-6 heteroalkylene bridge to the 4'-carbon of the same ribose sugar, where exemplary bridges included methylene, propylene, ether, or amino bridges; aminoalkyl, as defined herein; aminoalkoxy, as defined herein; amino as defined herein; and amino acid, as defined herein.

[0335] Generally, RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen. Exemplary, non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (that also has a phosphoramidate backbone)); multicyclic forms (e.g., tricyclo and "unlocked" forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is replace with α-L-threofuranosyl-(3'→2')), and peptide nucleic acid (PNA, where 2-amino-ethyl-glycine linkages replace the ribose and phosphodiester backbone).

[0336] In some embodiments, the sugar group contains one or more carbons that possess the opposite stereochemical configuration of the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides containing, e.g., arabinose or L-ribose, as the sugar.

[0337] In some embodiments, the polynucleotide includes at least one nucleoside wherein the sugar is L-ribose, 2'-O-methyl-ribose, 2'-fluoro-ribose, arabinose, hexitol, an LNA, or a PNA.Alterations on the Internucleoside Linkage

[0338] Alternative nucleotides can be altered on the internucleoside linkage (e.g., phosphate backbone). Herein, in the context of the polynucleotide backbone, the phrases "phosphate" and "phosphodiester" are used interchangeably. Backbone phosphate groups can be altered by replacing one or more of the oxygen atoms with a different substituent.

[0339] The alternative nucleotides can include the wholesale replacement of an unaltered phosphate moiety with another internucleoside linkage as described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be altered by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).

[0340] The alternative nucleosides and nucleotides can include the replacement of one or more of the non-bridging oxygens with a borane moiety (BH 3 ), sulfur (thio), methyl, ethyl, and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., the alpha (α), beta (β) or gamma (γ) position) can be replaced with a sulfur (thio) and a methoxy.

[0341] The replacement of one or more of the oxygen atoms at the α position of the phosphate moiety (e.g., α-thio phosphate) is provided to confer stability (such as against exonucleases and endonucleases) to RNA and DNA through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment.

[0342] Other internucleoside linkages that may be employed according to the present disclosure, including internucleoside linkages which do not contain a phosphorous atom, are described herein.Internal ribosome entry sites

[0343] Polynucleotides may contain an internal ribosome entry site (IRES). An IRES may act as the sole ribosome binding site, or may serve as one of multiple ribosome binding sites of an mRNA. A polynucleotide containing more than one functional ribosome binding site may encode several peptides or polypeptides that are translated independently by the ribosomes (e.g., multicistronic mRNA). When polynucleotides are provided with an IRES, further optionally provided is a second translatable region. Examples of IRES sequences that can be used according to the present disclosure include without limitation, those from picornaviruses (e.g., FMDV), pest viruses (CFFV), polio viruses (PV), encephalomyocarditis viruses (ECMV), foot-and-mouth disease viruses (FMDV), hepatitis C viruses (HCV), classical swine fever viruses (CSFV), murine leukemia virus (MLV), simian immune deficiency viruses (SIV) or cricket paralysis viruses (CrPV).5'-cap structure

[0344] A polynucleotide (e.g., an mRNA) may include a 5'-cap structure. The 5'-cap structure of a polynucleotide is involved in nuclear export and increasing polynucleotide stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for polynucleotide stability in the cell and translation competency through the association of CBP with poly-A binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5'-proximal introns removal during mRNA splicing.

[0345] Endogenous polynucleotide molecules may be 5'-end capped generating a 5'-ppp-5'-triphosphate linkage between a terminal guanosine cap residue and the 5'-terminal transcribed sense nucleotide of the polynucleotide. This 5'-guanylate cap may then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and / or anteterminal transcribed nucleotides of the 5' end of the polynucleotide may optionally also be 2'-O-methylated. 5'-decapping through hydrolysis and cleavage of the guanylate cap structure may target a polynucleotide molecule, such as an mRNA molecule, for degradation.

[0346] Alterations to polynucleotides may generate a non-hydrolyzable cap structure preventing decapping and thus increasing polynucleotide half-life. Because cap structure hydrolysis requires cleavage of 5'-ppp-5' phosphorodiester linkages, alternative nucleotides may be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) may be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5'-ppp-5' cap. Additional alternative guanosine nucleotides may be used such as α-methyl-phosphonate and seleno-phosphate nucleotides.

[0347] Additional alterations include, but are not limited to, 2'-O-methylation of the ribose sugars of 5'-terminal and / or 5'-anteterminal nucleotides of the polynucleotide (as mentioned above) on the 2'-hydroxy group of the sugar. Multiple distinct 5'-cap structures can be used to generate the 5'-cap of a polynucleotide, such as an mRNA molecule.

[0348] 5'-Cap structures include those described in International Patent Publication Nos. WO2008127688, WO 2008016473, and WO 2011015347.

[0349] Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e., endogenous, wild-type, or physiological) 5'-caps in their chemical structure, while retaining cap function. Cap analogs may be chemically (i.e., non-enzymatically) or enzymatically synthesized and / linked to a polynucleotide.

[0350] For example, the Anti-Reverse Cap Analog (ARCA) cap contains two guanosines linked by a 5'-5'-triphosphate group, wherein one guanosine contains an N7-methyl group as well as a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m'G-3'mppp-G, which may equivalently be designated 3' O-Me-m7G(5')ppp(5')G). The 3'-O atom of the other, unaltered, guanosine becomes linked to the 5'-terminal nucleotide of the capped polynucleotide (e.g., an mRNA). The N7- and 3'-O-methlyated guanosine provides the terminal moiety of the capped polynucleotide (e.g., mRNA).

[0351] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m 7< Gm-ppp-G).

[0352] A cap may be a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog may be modified at different phosphate positions with a boranophosphate group or a phophoroselenoate group such as the dinucleotide cap analogs described in US Patent No. 8,519,110.

[0353] Alternatively, a cap analog may be a N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analogs include a N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and a N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analog (see, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21:4570-4574). In other instances, a cap analog useful in the polynucleotides of the present disclosure is a 4-chloro / bromophenoxyethyl analog.

[0354] While cap analogs allow for the concomitant capping of a polynucleotide in an in vitro transcription reaction, up to 20% of transcripts remain uncapped. This, as well as the structural differences of a cap analog from endogenous 5'-cap structures of polynucleotides produced by the endogenous, cellular transcription machinery, may lead to reduced translational competency and reduced cellular stability.

[0355] Alternative polynucleotides may also be capped post-transcriptionally, using enzymes, in order to generate more authentic 5'-cap structures. As used herein, the phrase "more authentic" refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a "more authentic" feature is better representative of an endogenous, wild-type, natural or physiological cellular function, and / or structure as compared to synthetic features or analogs of the prior art, or which outperforms the corresponding endogenous, wild-type, natural, or physiological feature in one or more respects. Non-limiting examples of more authentic 5'-cap structures useful in the polynucleotides of the present disclosure are those which, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5'-endonucleases, and / or reduced 5'-decapping, as compared to synthetic 5'-cap structures known in the art (or to a wild-type, natural or physiological 5'-cap structure). For example, recombinant Vaccinia Virus Capping Enzyme and recombinant 2'-O-methyltransferase enzyme can create a canonical 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide wherein the cap guanosine contains an N7-methylation and the 5'-terminal nucleotide of the polynucleotide contains a 2'-O-methyl. Such a structure is termed the Cap1 structure. This cap results in a higher translational-competency, cellular stability, and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5'cap analog structures known in the art. Other exemplary cap structures include 7mG(5')ppp(5')N,pN2p (Cap 0), 7mG(5')ppp(5')NlmpNp (Cap 1), 7mG(5')-ppp(5')NlmpN2mp (Cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (Cap 4).

[0356] Because the alternative polynucleotides may be capped post-transcriptionally, and because this process is more efficient, nearly 100% of the alternative polynucleotides may be capped. This is in contrast to ~80% when a cap analog is linked to an polynucleotide in the course of an in vitro transcription reaction.

[0357] 5'-terminal caps may include endogenous caps or cap analogs. A 5'-terminal cap may include a guanosine analog. Useful guanosine analogs include inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0358] In some cases, a polynucleotide contains a modified 5'-cap. A modification on the 5'-cap may increase the stability of polynucleotide, increase the half-life of the polynucleotide, and could increase the polynucleotide translational efficiency. The modified 5'-cap may include, but is not limited to, one or more of the following modifications: modification at the 2'- and / or 3'-position of a capped guanosine triphosphate (GTP), a replacement of the sugar ring oxygen (that produced the carbocyclic ring) with a methylene moiety (CH 2 ), a modification at the triphosphate bridge moiety of the cap structure, or a modification at the nucleobase (G) moiety.5'-UTRs

[0359] A 5'-UTR may be provided as a flanking region to polynucleotides (e.g., mRNAs). A 5'-UTR may be homologous or heterologous to the coding region found in a polynucleotide. Multiple 5'-UTRs may be included in the flanking region and may be the same or of different sequences. Any portion of the flanking regions, including none, may be codon optimized and any may independently contain one or more different structural or chemical alterations, before and / or after codon optimization.

[0360] Shown in Table 21 in US Provisional Application No 61 / 775,509, and in Table 21 and in Table 22 in US Provisional Application No. 61 / 829,372 is a listing of the start and stop site of alternative polynucleotides (e.g., mRNA). In Table 21 each 5'-UTR (5'-UTR-005 to 5'-UTR 68511) is identified by its start and stop site relative to its native or wild type (homologous) transcript (ENST; the identifier used in the ENSEMBL database).

[0361] To alter one or more properties of a polynucleotide (e.g., mRNA), 5'-UTRs which are heterologous to the coding region of an alternative polynucleotide (e.g., mRNA) may be engineered. The polynucleotides (e.g., mRNA) may then be administered to cells, tissue or organisms and outcomes such as protein level, localization, and / or half-life may be measured to evaluate the beneficial effects the heterologous 5'-UTR may have on the alternative polynucleotides (mRNA). Variants of the 5'-UTRs may be utilized wherein one or more nucleotides are added or removed to the termini, including A, T, C or G. 5'-UTRs may also be codon-optimized, or altered in any manner described herein.5'-UTRs, 3'-UTRs, and Translation Enhancer Elements (TEEs)

[0362] The 5'-UTR of a polynucleotides (e.g., mRNA) may include at least one translation enhancer element. The term "translational enhancer element" refers to sequences that increase the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE may be located between the transcription promoter and the start codon. The polynucleotides (e.g., mRNA) with at least one TEE in the 5'-UTR may include a cap at the 5'-UTR. Further, at least one TEE may be located in the 5'-UTR of polynucleotides (e.g., mRNA) undergoing cap-dependent or cap-independent translation.

[0363] In one aspect, TEEs are conserved elements in the UTR which can promote translational activity of a polynucleotide such as, but not limited to, cap-dependent or cap-independent translation. The conservation of these sequences has been previously shown by Panek et al. (Nucleic Acids Research, 2013, 1-10) across 14 species including humans.

[0364] In one non-limiting example, the TEEs known may be in the 5'-leader of the Gtx homeodomain protein (Chappell et al., Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004).

[0365] In another non-limiting example, TEEs are disclosed in US Patent Publication Nos. 2009 / 0226470 and 2013 / 0177581, International Patent Publication Nos. WO2009 / 075886, WO2012 / 009644, and WO1999 / 024595, US Patent Nos. 6,310,197 and 6,849,405.

[0366] In yet another non-limiting example, the TEE may be an internal ribosome entry site (IRES), HCV-IRES or an IRES element such as, but not limited to, those described in US Patent No. 7,468,275, US Patent Publication Nos. 2007 / 0048776 and 2011 / 0124100 and International Patent Publication Nos. WO2007 / 025008 and WO2001 / 055369. The IRES elements may include, but are not limited to, the Gtx sequences (e.g., Gtx9-nt, Gtx8-nt, Gtx7-nt) described by Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005) and in US Patent Publication Nos. 2007 / 0048776 and 2011 / 0124100 and International Patent Publication No. WO2007 / 025008.

[0367] "Translational enhancer polynucleotides" are polynucleotides which include one or more of the specific TEE exemplified herein and / or disclosed in the art (see e.g., U.S. Patent Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, U.S. Patent Publication Nos. 20090 / 226470, 2007 / 0048776, 2011 / 0124100, 2009 / 0093049, 2013 / 0177581, International Patent Publication Nos. WO2009 / 075886, WO2007 / 025008, WO2012 / 009644, WO2001 / 055371, WO1999 / 024595, and European Patent Nos. 2610341 and 2610340) or their variants, homologs or functional derivatives. One or multiple copies of a specific TEE can be present in a polynucleotide (e.g., mRNA). The TEEs in the translational enhancer polynucleotides can be organized in one or more sequence segments. A sequence segment can harbor one or more of the specific TEEs exemplified herein, with each TEE being present in one or more copies. When multiple sequence segments are present in a translational enhancer polynucleotide, they can be homogenous or heterogeneous. Thus, the multiple sequence segments in a translational enhancer polynucleotide can harbor identical or different types of the specific TEEs exemplified herein, identical or different number of copies of each of the specific TEEs, and / or identical or different organization of the TEEs within each sequence segment.

[0368] A polynucleotide (e.g., mRNA) may include at least one TEE that is described in International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886, WO2007 / 025008, WO1999 / 024595, European Patent Publication Nos. 2610341 and 2610340, US Patent Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, and US Patent Publication Nos. 2009 / 0226470, 2011 / 0124100, 2007 / 0048776, 2009 / 0093049, and 2013 / 0177581. The TEE may be located in the 5'-UTR of the polynucleotides (e.g., mRNA).

[0369] A polynucleotide (e.g., mRNA) may include at least one TEE that has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identity with the TEEs described in US Patent Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581 and 2011 / 0124100, International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886 and WO2007 / 025008, European Patent Publication Nos. 2610341 and 2610340, US Patent Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395.

[0370] The 5'-UTR of a polynucleotide (e.g., mRNA) may include at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 or more than 60 TEE sequences. The TEE sequences in the 5'-UTR of a polynucleotide (e.g., mRNA) may be the same or different TEE sequences. The TEE sequences may be in a pattern such as ABABAB, AABBAABBAABB, or ABCABCABC, or variants thereof, repeated once, twice, or more than three times. In these patterns, each letter, A, B, or C represent a different TEE sequence at the nucleotide level.

[0371] In some cases, the 5'-UTR may include a spacer to separate two TEE sequences. As a non-limiting example, the spacer may be a 15 nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 5'-UTR may include a TEE sequence-spacer module repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in the 5'-UTR.

[0372] In other instances, the spacer separating two TEE sequences may include other sequences known in the art which may regulate the translation of the polynucleotides (e.g., mRNA) of the present disclosure such as, but not limited to, miR sequences (e.g., miR binding sites and miR seeds). As a non-limiting example, each spacer used to separate two TEE sequences may include a different miR sequence or component of a miR sequence (e.g., miR seed sequence).

[0373] In some instances, the TEE in the 5'-UTR of a polynucleotide (e.g., mRNA) may include at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or more than 99% of the TEE sequences disclosed in US Patent Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581 and 2011 / 0124100, International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886 and WO2007 / 025008, European Patent Publication Nos. 2610341 and 2610340, and US Patent Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395. In another embodiment, the TEE in the 5'-UTR of the polynucleotides (e.g., mRNA) of the present disclosure may include a 5-30 nucleotide fragment, a 5-25 nucleotide fragment, a 5-20 nucleotide fragment, a 5-15 nucleotide fragment, a 5-10 nucleotide fragment of the TEE sequences disclosed in US Patent Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581 and 2011 / 0124100, International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886 and WO2007 / 025008, European Patent Publication Nos. 2610341 and 2610340, and US Patent Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395.

[0374] In certain cases, the TEE in the 5'-UTR of the polynucleotides (e.g., mRNA) of the present disclosure may include at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or more than 99% of the TEE sequences disclosed in Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), in Supplemental Table 1 and in Supplemental Table 2 disclosed by Wellensiek et al (Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013; DOI:10.1038 / NMETH.2522). In another embodiment, the TEE in the 5'-UTR of the polynucleotides (e.g., mRNA) of the present disclosure may include a 5-30 nucleotide fragment, a 5-25 nucleotide fragment, a 5-20 nucleotide fragment, a 5-15 nucleotide fragment, a 5-10 nucleotide fragment of the TEE sequences disclosed in Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), in Supplemental Table 1 and in Supplemental Table 2 disclosed by Wellensiek et al (Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013; DOI:10.1038 / NMETH.2522).

[0375] In some cases, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) is an IRES sequence such as, but not limited to, those described in US Patent No. 7,468,275 and International Patent Publication No. WO2001 / 055369.

[0376] In some instances, the TEEs used in the 5'-UTR of a polynucleotide (e.g., mRNA) may be identified by the methods described in US Patent Publication Nos. 2007 / 0048776 and 2011 / 0124100 and International Patent Publication Nos. WO2007 / 025008 and WO2012 / 009644.

[0377] In some cases, the TEEs used in the 5'-UTR of a polynucleotide (e.g., mRNA) of the present disclosure may be a transcription regulatory element described in US Patent Nos. 7,456,273 and 7,183,395, US Patent Publication No. 2009 / 0093049, and International Publication No. WO2001 / 055371. The transcription regulatory elements may be identified by methods known in the art, such as, but not limited to, the methods described in US Patent Nos. 7,456,273 and 7,183,395, US Patent Publication No. 2009 / 0093049, and International Publication No. WO2001 / 055371.

[0378] In yet other instances, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) is a polynucleotide or portion thereof as described in US Patent Nos. 7,456,273 and 7,183,395, US Patent Publication No. 2009 / 0093049, and International Publication No. WO2001 / 055371.

[0379] The 5'-UTR including at least one TEE described herein may be incorporated in a monocistronic sequence such as, but not limited to, a vector system or a polynucleotide vector. As a non-limiting example, the vector systems and polynucleotide vectors may include those described in US Patent Nos. 7,456,273 and 7,183,395, US Patent Publication Nos. 2007 / 0048776, 2009 / 0093049 and 2011 / 0124100, and International Patent Publication Nos. WO2007 / 025008 and WO2001 / 055371.

[0380] The TEEs described herein may be located in the 5'-UTR and / or the 3'-UTR of the polynucleotides (e.g., mRNA). The TEEs located in the 3'-UTR may be the same and / or different than the TEEs located in and / or described for incorporation in the 5'-UTR.

[0381] In some cases, the 3'-UTR of a polynucleotide (e.g., mRNA) may include at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 or more than 60 TEE sequences. The TEE sequences in the 3'-UTR of the polynucleotides (e.g., mRNA) of the present disclosure may be the same or different TEE sequences. The TEE sequences may be in a pattern such as ABABAB, AABBAABBAABB, or ABCABCABC, or variants thereof, repeated once, twice, or more than three times. In these patterns, each letter, A, B, or C represent a different TEE sequence at the nucleotide level.

[0382] In one instance, the 3'-UTR may include a spacer to separate two TEE sequences. As a non-limiting example, the spacer may be a 15 nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 3'-UTR may include a TEE sequence-spacer module repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in the 3'-UTR.

[0383] In other cases, the spacer separating two TEE sequences may include other sequences known in the art which may regulate the translation of the polynucleotides (e.g., mRNA) of the present disclosure such as, but not limited to, miR sequences described herein (e.g., miR binding sites and miR seeds). As a non-limiting example, each spacer used to separate two TEE sequences may include a different miR sequence or component of a miR sequence (e.g., miR seed sequence).

[0384] In yet other cases, the incorporation of a miR sequence and / or a TEE sequence changes the shape of the stem loop region which may increase and / or decrease translation. (see e.g., Kedde et al. A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-22 accessibility. Nature Cell Biology. 2010).Stem Loops

[0385] Polynucleotides (e.g., mRNAs) may include a stem loop such as, but not limited to, a histone stem loop. The stem loop may be a nucleotide sequence that is about 25 or about 26 nucleotides in length such as, but not limited to, those as described in International Patent Publication No. WO2013 / 103659. The histone stem loop may be located 3'-relative to the coding region (e.g., at the 3'-terminus of the coding region). As a non-limiting example, the stem loop may be located at the 3'-end of a polynucleotide described herein. In some cases, a polynucleotide (e.g., an mRNA) includes more than one stem loop (e.g., two stem loops). Examples of stem loop sequences are described in International Patent Publication Nos. WO2012 / 019780 and WO201502667. In some instances, a polynucleotide includes the stem loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In others, a polynucleotide includes the stem loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).

[0386] A stem loop may be located in a second terminal region of a polynucleotide. As a non-limiting example, the stem loop may be located within an untranslated region (e.g., 3'-UTR) in a second terminal region.

[0387] In some cases, a polynucleotide such as, but not limited to mRNA, which includes the histone stem loop may be stabilized by the addition of a 3'-stabilizing region (e.g., a 3'-stabilizing region including at least one chain terminating nucleoside). Not wishing to be bound by theory, the addition of at least one chain terminating nucleoside may slow the degradation of a polynucleotide and thus can increase the half-life of the polynucleotide.

[0388] In other cases, a polynucleotide such as, but not limited to mRNA, which includes the histone stem loop may be stabilized by an alteration to the 3'-region of the polynucleotide that can prevent and / or inhibit the addition of oligio(U) (see e.g., International Patent Publication No. WO2013 / 103659).

[0389] In yet other cases, a polynucleotide such as, but not limited to mRNA, which includes the histone stem loop may be stabilized by the addition of an oligonucleotide that terminates in a 3'-deoxynucleoside, 2',3'-dideoxynucleoside 3'-O-methylnucleosides, 3'-O-ethylnucleosides, 3'-arabinosides, and other alternative nucleosides known in the art and / or described herein.

[0390] In some instances, the polynucleotides of the present disclosure may include a histone stem loop, a poly-A region, and / or a 5'-cap structure. The histone stem loop may be before and / or after the poly-A region. The polynucleotides including the histone stem loop and a poly-A region sequence may include a chain terminating nucleoside described herein.

[0391] In other instances, the polynucleotides of the present disclosure may include a histone stem loop and a 5'-cap structure. The 5'-cap structure may include, but is not limited to, those described herein and / or known in the art.

[0392] In some cases, the conserved stem loop region may include a miR sequence described herein. As a non-limiting example, the stem loop region may include the seed sequence of a miR sequence described herein. In another non-limiting example, the stem loop region may include a miR-122 seed sequence.

[0393] In certain instances, the conserved stem loop region may include a miR sequence described herein and may also include a TEE sequence.

[0394] In some cases, the incorporation of a miR sequence and / or a TEE sequence changes the shape of the stem loop region which may increase and / or decrease translation. (see e.g., Kedde et al. A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-22 accessibility. Nature Cell Biology. 2010).

[0395] Polynucleotides may include at least one histone stem-loop and a poly-A region or polyadenylation signal. Non-limiting examples of polynucleotide sequences encoding for at least one histone stem-loop and a poly-A region or a polyadenylation signal are described in International Patent Publication No. WO2013 / 120497, WO2013 / 120629, WO2013 / 120500, WO2013 / 120627, WO2013 / 120498, WO2013 / 120626, WO2013 / 120499 and WO2013 / 120628. In certain cases, the polynucleotide encoding for a histone stem loop and a poly-A region or a polyadenylation signal may code for a pathogen antigen or fragment thereof such as the polynucleotide sequences described in International Patent Publication No WO2013 / 120499 and WO2013 / 120628. In other cases, the polynucleotide encoding for a histone stem loop and a poly-A region or a polyadenylation signal may code for a therapeutic protein such as the polynucleotide sequences described in International Patent Publication No WO2013 / 120497 and WO2013 / 120629. In some cases, the polynucleotide encoding for a histone stem loop and a poly-A region or a polyadenylation signal may code for a tumor antigen or fragment thereof such as the polynucleotide sequences described in International Patent Publication No WO2013 / 120500 and WO2013 / 120627. In other cases, the polynucleotide encoding for a histone stem loop and a poly-A region or a polyadenylation signal may code for a allergenic antigen or an autoimmune self-antigen such as the polynucleotide sequences described in International Patent Publication No WO2013 / 120498 and WO2013 / 120626.Poly-A Regions

[0396] A polynucleotide or nucleic acid (e.g., an mRNA) may include a polyA sequence and / or polyadenylation signal. A polyA sequence may be comprised entirely or mostly of adenine nucleotides or analogs or derivatives thereof. A polyA sequence may be a tail located adjacent to a 3' untranslated region of a nucleic acid.

[0397] During RNA processing, a long chain of adenosine nucleotides (poly-A region) is normally added to messenger RNA (mRNA) molecules to increase the stability of the molecule. Immediately after transcription, the 3'-end of the transcript is cleaved to free a 3'-hydroxy. Then poly-A polymerase adds a chain of adenosine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A region that is between 100 and 250 residues long.

[0398] Unique poly-A region lengths may provide certain advantages to the alternative polynucleotides of the present disclosure.

[0399] Generally, the length of a poly-A region of polynucleotides of the present disclosure is at least 30 nucleotides in length. In another embodiment, the poly-A region is at least 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 70 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1700 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 1900 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides.

[0400] In some instances, the poly-A region may be 80 nucleotides, 120 nucleotides, 160 nucleotides in length on an alternative polynucleotide molecule described herein.

[0401] In other instances, the poly-A region may be 20, 40, 80, 100, 120, 140 or 160 nucleotides in length on an alternative polynucleotide molecule described herein.

[0402] In some cases, the poly-A region is designed relative to the length of the overall alternative polynucleotide. This design may be based on the length of the coding region of the alternative polynucleotide, the length of a particular feature or region of the alternative polynucleotide (such as mRNA), or based on the length of the ultimate product expressed from the alternative polynucleotide. When relative to any feature of the alternative polynucleotide (e.g., other than the mRNA portion which includes the poly-A region) the poly-A region may be 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% greater in length than the additional feature. The poly-A region may also be designed as a fraction of the alternative polynucleotide to which it belongs. In this context, the poly-A region may be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct or the total length of the construct minus the poly-A region.

[0403] In certain cases, engineered binding sites and / or the conjugation of polynucleotides (e.g., mRNA) for poly-A binding protein may be used to enhance expression. The engineered binding sites may be sensor sequences which can operate as binding sites for ligands of the local microenvironment of the polynucleotides (e.g., mRNA). As a non-limiting example, the polynucleotides (e.g., mRNA) may include at least one engineered binding site to alter the binding affinity of poly-A binding protein (PABP) and analogs thereof. The incorporation of at least one engineered binding site may increase the binding affinity of the PABP and analogs thereof.

[0404] Additionally, multiple distinct polynucleotides (e.g., mRNA) may be linked together to the PABP (poly-A binding protein) through the 3'-end using alternative nucleotides at the 3'-terminus of the poly-A region. Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12 hours, 24 hours, 48 hours, 72 hours, and day 7 post-transfection. As a non-limiting example, the transfection experiments may be used to evaluate the effect on PABP or analogs thereof binding affinity as a result of the addition of at least one engineered binding site.

[0405] In certain cases, a poly-A region may be used to modulate translation initiation. While not wishing to be bound by theory, the poly-A region recruits PABP which in turn can interact with translation initiation complex and thus may be essential for protein synthesis.

[0406] In some cases, a poly-A region may also be used in the present disclosure to protect against 3'-5'-exonuclease digestion.

[0407] In some instances, a polynucleotide (e.g., mRNA) may include a polyA-G Quartet. The G-quartet is a cyclic hydrogen bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of the poly-A region. The resultant polynucleotides (e.g., mRNA) may be assayed for stability, protein production and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production equivalent to at least 75% of that seen using a poly-A region of 120 nucleotides alone.

[0408] In some cases, a polynucleotide (e.g., mRNA) may include a poly-A region and may be stabilized by the addition of a 3'-stabilizing region. The polynucleotides (e.g., mRNA) with a poly-A region may further include a 5'-cap structure.

[0409] In other cases, a polynucleotide (e.g., mRNA) may include a poly-A-G Quartet. The polynucleotides (e.g., mRNA) with a poly-A-G Quartet may further include a 5'-cap structure.

[0410] In some cases, the 3'-stabilizing region which may be used to stabilize a polynucleotide (e.g., mRNA) including a poly-A region or poly-A-G Quartet may be, but is not limited to, those described in International Patent Publication No. WO2013 / 103659. In other cases, the 3'-stabilizing region which may be used with the polynucleotides of the present disclosure include a chain termination nucleoside such as 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, such as 2',3'- dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'- dideoxyguanosine, 2',3'-dideoxythymine, a 2'-deoxynucleoside, or an O-methylnucleoside.

[0411] In other cases, a polynucleotide such as, but not limited to mRNA, which includes a polyA region or a poly-A-G Quartet may be stabilized by an alteration to the 3'-region of the polynucleotide that can prevent and / or inhibit the addition of oligio(U) (see e.g., International Patent Publication No. WO2013 / 103659).

[0412] In yet other instances, a polynucleotide such as, but not limited to mRNA, which includes a poly-A region or a poly-A-G Quartet may be stabilized by the addition of an oligonucleotide that terminates in a 3'-deoxynucleoside, 2',3'-dideoxynucleoside 3'-O-methylnucleosides, 3'-O-ethylnucleosides, 3'-arabinosides, and other alternative nucleosides known in the art and / or described herein.Chain terminating nucleosides

[0413] A nucleic acid may include a chain terminating nucleoside. For example, a chain terminating nucleoside may include those nucleosides deoxygenated at the 2' and / or 3' positions of their sugar group. Such species may include 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, and 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, and 2',3'-dideoxythymine.Other components

[0414] A nanoparticle composition may include one or more components in addition to those described in the preceding sections. For example, a nanoparticle composition may include one or more small hydrophobic molecules such as a vitamin (e.g., vitamin A or vitamin E) or a sterol.

[0415] Nanoparticle compositions may also include one or more permeability enhancer molecules, carbohydrates, polymers, surface altering agents, or other components. A permeability enhancer molecule may be a molecule described by U.S. patent application publication No. 2005 / 0222064, for example. Carbohydrates may include simple sugars (e.g., glucose) and polysaccharides (e.g., glycogen and derivatives and analogs thereof).

[0416] A polymer may be included in and / or used to encapsulate or partially encapsulate a nanoparticle composition. A polymer may be biodegradable and / or biocompatible. A polymer may be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. For example, a polymer may include poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic acid-co-glycolic acid) (PLGA), poly(L-lactic acid-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co-D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacralate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethyleneglycol, poly-L-glutamic acid, poly(hydroxy acids), polyanhydrides, polyorthoesters, poly(ester amides), polyamides, poly(ester ethers), polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates such as poly(ethylene terephthalate), polyvinyl alcohols (PVA), polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone (PVP), polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitro celluloses, hydroxypropylcellulose, carboxymethylcellulose, polymers of acrylic acids, such as poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate), poly(butyl(meth)acrylate), poly(isobutyl(meth)acrylate), poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate), poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) and copolymers and mixtures thereof, polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate, polyoxymethylene, poloxamers, polyoxamines, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), trimethylene carbonate, poly(N-acryloylmorpholine) (PAcM), poly(2-methyl-2-oxazoline) (PMOX), poly(2-ethyl-2-oxazoline) (PEOZ), and polyglycerol.

[0417] Surface altering agents may include, but are not limited to, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol, and poloxamer), mucolytic agents (e.g., acetylcysteine, mugwort, bromelain, papain, clerodendrum, bromhexine, carbocisteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin β4, dornase alfa, neltenexine, and erdosteine), and DNases (e.g., rhDNase). A surface altering agent may be disposed within a nanoparticle and / or on the surface of a nanoparticle composition (e.g., by coating, adsorption, covalent linkage, or other process).

[0418] A nanoparticle composition may also comprise one or more functionalized lipids. For example, a lipid may be functionalized with an alkyne group that, when exposed to an azide under appropriate reaction conditions, may undergo a cycloaddition reaction. In particular, a lipid bilayer may be functionalized in this fashion with one or more groups useful in facilitating membrane permeation, cellular recognition, or imaging. The surface of a nanoparticle composition may also be conjugated with one or more useful antibodies. Functional groups and conjugates useful in targeted cell delivery, imaging, and membrane permeation are well known in the art.

[0419] In addition to these components, nanoparticle compositions may include any substance useful in pharmaceutical compositions. For example, the nanoparticle composition may include one or more pharmaceutically acceptable excipients or accessory ingredients such as, but not limited to, one or more solvents, dispersion media, diluents, dispersion aids, suspension aids, granulating aids, disintegrants, fillers, glidants, liquid vehicles, binders, surface active agents, isotonic agents, thickening or emulsifying agents, buffering agents, lubricating agents, oils, preservatives, and other species. Excipients such as waxes, butters, coloring agents, coating agents, flavorings, and perfuming agents may also be included. Pharmaceutically acceptable excipients are well known in the art (see for example Remington's The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, MD, 2006).

[0420] Examples of diluents may include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, and / or combinations thereof. Granulating and dispersing agents may be selected from the non-limiting list consisting of potato starch, corn starch, tapioca starch, sodium starch glycolate, clays, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, cation-exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinylpyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethyl cellulose, cross-linked sodium carboxymethyl cellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (VEEGUM ®< ), sodium lauryl sulfate, quaternary ammonium compounds, and / or combinations thereof.

[0421] Surface active agents and / or emulsifiers may include, but are not limited to, natural emulsifiers (e.g. acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g. bentonite [aluminum silicate] and VEEGUM ®< [magnesium aluminum silicate]), long chain amino acid derivatives, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g. carboxy polymethylene, polyacrylic acid, acrylic acid polymer, and carboxyvinyl polymer), carrageenan, cellulosic derivatives (e.g. carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxyethylene sorbitan monolaurate [TWEEN ®< 20], polyoxyethylene sorbitan [TWEEN ®< 60], polyoxyethylene sorbitan monooleate [TWEEN ®< 80], sorbitan monopalmitate [SPAN ®< 40], sorbitan monostearate [SPAN ®< 60], sorbitan tristearate [SPAN ®< 65], glyceryl monooleate, sorbitan monooleate [SPAN ®< 80]), polyoxyethylene esters (e.g. polyoxyethylene monostearate [MYRJ ®< 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and SOLUTOL ®< ), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g. CREMOPHOR ®< ), polyoxyethylene ethers, (e.g. polyoxyethylene lauryl ether [BRIJ ®< 30]), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, PLURONIC ®< F 68, POLOXAMER ®< 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, and / or combinations thereof.

[0422] A binding agent may be starch (e.g. cornstarch and starch paste); gelatin; sugars (e.g. sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); natural and synthetic gums (e.g. acacia, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, mucilage of isapol husks, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (VEEGUM ®< ), and larch arabogalactan); alginates; polyethylene oxide; polyethylene glycol; inorganic calcium salts; silicic acid; polymethacrylates; waxes; water; alcohol; and combinations thereof, or any other suitable binding agent.

[0423] Examples of preservatives may include, but are not limited to, antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and / or other preservatives. Examples of antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, acorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and / or sodium sulfite. Examples of chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and / or trisodium edetate. Examples of antimicrobial preservatives include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and / or thimerosal. Examples of antifungal preservatives include, but are not limited to, butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and / or sorbic acid. Examples of alcohol preservatives include, but are not limited to, ethanol, polyethylene glycol, benzyl alcohol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and / or phenylethyl alcohol. Examples of acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroascorbic acid, ascorbic acid, sorbic acid, and / or phytic acid. Other preservatives include, but are not limited to, tocopherol, tocopherol acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, GLYDANT PLUS ®< , PHENONIP ®< , methylparaben, GERMALL ®< 115, GERMABEN ®< II, NEOLONE ™< , KATHON ™< , and / or EUXYL ®< .

[0424] Examples of buffering agents include, but are not limited to, citrate buffer solutions, acetate buffer solutions, phosphate buffer solutions, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, d-gluconic acid, calcium glycerophosphate, calcium lactate, calcium lactobionate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, amino-sulfonate buffers (e.g. HEPES), magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, and / or combinations thereof. Lubricating agents may selected from the non-limiting group consisting of magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behenate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and combinations thereof.

[0425] Examples of oils include, but are not limited to, almond, apricot kernel, avocado, babassu, bergamot, black current seed, borage, cade, camomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cotton seed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd, grape seed, hazel nut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litsea cubeba, macademia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange, orange roughy, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood, sasquana, savoury, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut, and wheat germ oils as well as butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, simethicone, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and / or combinations thereof.Formulations

[0426] Nanoparticle compositions may include a lipid component and one or more additional components, such as a therapeutic and / or prophylactic agent. A nanoparticle composition may be designed for one or more specific applications or targets. The elements of a nanoparticle composition may be selected based on a particular application or target, and / or based on the efficacy, toxicity, expense, ease of use, availability, or other feature of one or more elements. Similarly, the particular formulation of a nanoparticle composition may be selected for a particular application or target according to, for example, the efficacy and toxicity of particular combinations of elements.

[0427] The lipid component of a nanoparticle composition may include, for example, a lipid according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), a phospholipid (such as an unsaturated lipid, e.g., DOPE or DSPC), a PEG lipid, and a structural lipid. The elements of the lipid component may be provided in specific fractions.

[0428] In some examples, the lipid component of a nanoparticle composition includes a lipid according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), a phospholipid, a PEG lipid, and a structural lipid. In certain examples, the lipid component of the nanoparticle composition includes about 30 mol % to about 60 mol % compound according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), about 0 mol % to about 30 mol % phospholipid, about 18.5 mol % to about 48.5 mol % structural lipid, and about 0 mol % to about 10 mol % of PEG lipid, provided that the total mol % does not exceed 100%. In some examples, the lipid component of the nanoparticle composition includes about 35 mol % to about 55 mol % compound according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), about 5 mol % to about 25 mol % phospholipid, about 30 mol % to about 40 mol % structural lipid, and about 0 mol % to about 10 mol % of PEG lipid. In certain examples, the lipid component includes about 50 mol % said compound, about 10 mol % phospholipid, about 38.5 mol % structural lipid, and about 1.5 mol % of PEG lipid. In other examples, the lipid component includes about 40 mol % said compound, about 20 mol % phospholipid, about 38.5 mol % structural lipid, and about 1.5 mol % of PEG lipid. In some examples, the phospholipid may be DOPE or DSPC. In other examples, the PEG lipid may be PEG-DMG or a PEG lipid according to one of formulae (VI), (VI-a), or (VI-b), and / or the structural lipid may be cholesterol.

[0429] Nanoparticle compositions may be designed for one or more specific applications or targets. For example, a nanoparticle composition may be designed to deliver a therapeutic and / or prophylactic agent such as an RNA to a particular cell, tissue, organ, or system or group thereof in a mammal's body. Physiochemical properties of nanoparticle compositions may be altered in order to increase selectivity for particular bodily targets. For instance, particle sizes may be adjusted based on the fenestration sizes of different organs. The therapeutic and / or prophylactic agent included in a nanoparticle composition may also be selected based on the desired delivery target or targets. For example, a therapeutic and / or prophylactic agent may be selected for a particular indication, condition, disease, or disorder and / or for delivery to a particular cell, tissue, organ, or system or group thereof (e.g., localized or specific delivery). In certain embodiments, a nanoparticle composition may include an mRNA encoding a polypeptide of interest capable of being translated within a cell to produce the polypeptide of interest. Such a composition may be designed to be specifically delivered to a particular organ. In certain embodiments, a composition may be designed to be specifically delivered to a mammalian liver.

[0430] The amount of a therapeutic and / or prophylactic agent in a nanoparticle composition may depend on the size, composition, desired target and / or application, or other properties of the nanoparticle composition as well as on the properties of the therapeutic and / or prophylactic agent. For example, the amount of an RNA useful in a nanoparticle composition may depend on the size, sequence, and other characteristics of the RNA. The relative amounts of a therapeutic and / or prophylactic agent and other elements (e.g., lipids) in a nanoparticle composition may also vary. In some embodiments, the wt / wt ratio of the lipid component to a therapeutic and / or prophylactic agent in a nanoparticle composition may be from about 5:1 to about 60:1, such as 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt / wt ratio of the lipid component to a therapeutic and / or prophylactic agent may be from about 10:1 to about 40:1. In certain embodiments, the wt / wt ratio is about 20:1. The amount of a therapeutic and / or prophylactic agent in a nanoparticle composition may, for example, be measured using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy).

[0431] In some embodiments, a nanoparticle composition includes one or more RNAs, and the one or more RNAs, lipids, and amounts thereof may be selected to provide a specific N:P ratio. The N:P ratio of the composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in an RNA. In general, a lower N:P ratio is preferred. The one or more RNA, lipids, and amounts thereof may be selected to provide an N:P ratio from about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N:P ratio may be from about 2:1 to about 8:1. In other embodiments, the N:P ratio is from about 5:1 to about 8:1. For example, the N:P ratio may be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. For example, the N:P ratio may be about 5.67:1.Physical properties

[0432] The characteristics of a nanoparticle composition may depend on the components thereof. For example, a nanoparticle composition including cholesterol as a structural lipid may have different characteristics than a nanoparticle composition that includes a different structural lipid. Similarly, the characteristics of a nanoparticle composition may depend on the absolute or relative amounts of its components. For instance, a nanoparticle composition including a higher molar fraction of a phospholipid may have different characteristics than a nanoparticle composition including a lower molar fraction of a phospholipid. Characteristics may also vary depending on the method and conditions of preparation of the nanoparticle composition.

[0433] Nanoparticle compositions may be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) may be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) may be used to measure zeta potentials. Dynamic light scattering may also be utilized to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) may also be used to measure multiple characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential.

[0434] The mean size of a nanoparticle composition may be between 10s of nm and 100s of nm. For example, the mean size may be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the mean size of a nanoparticle composition may be from about 50 nm to about 100 nm, from about 50 nm to about 90 nm, from about 50 nm to about 80 nm, from about 50 nm to about 70 nm, from about 50 nm to about 60 nm, from about 60 nm to about 100 nm, from about 60 nm to about 90 nm, from about 60 nm to about 80 nm, from about 60 nm to about 70 nm, from about 70 nm to about 100 nm, from about 70 nm to about 90 nm, from about 70 nm to about 80 nm, from about 80 nm to about 100 nm, from about 80 nm to about 90 nm, or from about 90 nm to about 100 nm. In certain embodiments, the mean size of a nanoparticle composition may be from about 70 nm to about 100 nm. In some embodiments, the mean size may be about 80 nm. In other embodiments, the mean size may be about 100 nm.

[0435] A nanoparticle composition may be relatively homogenous. A polydispersity index may be used to indicate the homogeneity of a nanoparticle composition, e.g., the particle size distribution of the nanoparticle compositions. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. A nanoparticle composition may have a polydispersity index from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of a nanoparticle composition may be from about 0.10 to about 0.20.

[0436] The zeta potential of a nanoparticle composition may be used to indicate the electrokinetic potential of the composition. For example, the zeta potential may describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low charges, positive or negative, are generally desirable, as more highly charged species may interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of a nanoparticle composition may be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about -10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV.

[0437] The efficiency of encapsulation of a therapeutic and / or prophylactic agent describes the amount of therapeutic and / or prophylactic agent that is encapsulated or otherwise associated with a nanoparticle composition after preparation, relative to the initial amount provided. The encapsulation efficiency is desirably high (e.g., close to 100%). The encapsulation efficiency may be measured, for example, by comparing the amount of therapeutic and / or prophylactic agent in a solution containing the nanoparticle composition before and after breaking up the nanoparticle composition with one or more organic solvents or detergents. Fluorescence may be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in a solution. For the nanoparticle compositions described herein, the encapsulation efficiency of a therapeutic and / or prophylactic agent may be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0438] A nanoparticle composition may optionally comprise one or more coatings. For example, a nanoparticle composition may be formulated in a capsule, film, or tablet having a coating. A capsule, film, or tablet including a composition described herein may have any useful size, tensile strength, hardness, or density.Pharmaceutical compositions

[0439] Nanoparticle compositions may be formulated in whole or in part as pharmaceutical compositions. Pharmaceutical compositions may include one or more nanoparticle compositions. For example, a pharmaceutical composition may include one or more nanoparticle compositions including one or more different therapeutic and / or prophylactic agents. Pharmaceutical compositions may further include one or more pharmaceutically acceptable excipients or accessory ingredients such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and agents are available, for example, in Remington's The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, MD, 2006. Conventional excipients and accessory ingredients may be used in any pharmaceutical composition, except insofar as any conventional excipient or accessory ingredient may be incompatible with one or more components of a nanoparticle composition. An excipient or accessory ingredient may be incompatible with a component of a nanoparticle composition if its combination with the component may result in any undesirable biological effect or otherwise deleterious effect.

[0440] In some embodiments, one or more excipients or accessory ingredients may make up greater than 50% of the total mass or volume of a pharmaceutical composition including a nanoparticle composition. For example, the one or more excipients or accessory ingredients may make up 50%, 60%, 70%, 80%, 90%, or more of a pharmaceutical convention. In some embodiments, a pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, an excipient is approved for use in humans and for veterinary use. In some embodiments, an excipient is approved by United States Food and Drug Administration. In some embodiments, an excipient is pharmaceutical grade. In some embodiments, an excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.

[0441] Relative amounts of the one or more nanoparticle compositions, the one or more pharmaceutically acceptable excipients, and / or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, a pharmaceutical composition may comprise between 0.1% and 100% (wt / wt) of one or more nanoparticle compositions.

[0442] In certain embodiments, the nanoparticle compositions and / or pharmaceutical compositions of the disclosure are refrigerated or frozen for storage and / or shipment (e.g., being stored at a temperature of 4 °C or lower, such as a temperature between about -150 °C and about 0 °C or between about -80 °C and about -20 °C (e.g., about -5 °C, -10 °C, -15 °C, -20 °C, -25 °C, -30 °C, -40 °C, -50 °C, -60 °C, -70 °C, -80 °C, -90 °C, -130 °C or -150 °C). For example, the pharmaceutical composition comprising a compound of any of Formulae (I)-(IV) is a solution that is refrigerated for storage and / or shipment at, for example, about -20 °C, -30 °C, - 40 °C, -50 °C, -60 °C, -70 °C, or -80 °C. In certain examples, the disclosure also relates to a method of increasing stability of the nanoparticle compositions and / or pharmaceutical compositions comprising a compound of any of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa) by storing the nanoparticle compositions and / or pharmaceutical compositions at a temperature of 4 °C or lower, such as a temperature between about -150 °C and about 0 °C or between about -80 °C and about -20 °C, e.g., about -5 °C, -10 °C, -15 °C, -20 °C, -25 °C, -30 °C, -40 °C, -50 °C, -60 °C, -70 °C, -80 °C, -90 °C, -130 °C or -150 °C). For example, the nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months, e.g., at a temperature of 4 °C or lower (e.g., between about 4 °C and -20 °C). In one example, the formulation is stabilized for at least 4 weeks at about 4 °C. In certain examples, the pharmaceutical composition of the disclosure comprises a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of Tris, an acetate (e.g., sodium acetate), an citrate (e.g., sodium citrate), saline, PBS, and sucrose. In certain examples, the pharmaceutical composition of the disclosure has a pH value between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9 or 8.0, or between 7.5 and 8 or between 7 and 7.8). For example, a pharmaceutical composition of the disclosure comprises a nanoparticle composition disclosed herein, Tris, saline and sucrose, and has a pH of about 7.5-8, which is suitable for storage and / or shipment at, for example, about -20 °C. For example, a pharmaceutical composition of the disclosure comprises a nanoparticle composition disclosed herein and PBS and has a pH of about 7-7.8, suitable for storage and / or shipment at, for example, about 4 °C or lower. "Stability," "stabilized," and "stable" in the context of the present disclosure refers to the resistance of nanoparticle compositions and / or pharmaceutical compositions disclosed herein to chemical or physical changes (e.g., degradation, particle size change, aggregation, change in encapsulation, etc.) under given manufacturing, preparation, transportation, storage and / or in-use conditions, e.g., when stress is applied such as shear force, freeze / thaw stress, etc.

[0443] Nanoparticle compositions and / or pharmaceutical compositions including one or more nanoparticle compositions may be administered to any patient or subject, including those patients or subjects that may benefit from a therapeutic effect provided by the delivery of a therapeutic and / or prophylactic agent to one or more particular cells, tissues, organs, or systems or groups thereof, such as the renal system. Although the descriptions provided herein of nanoparticle compositions and pharmaceutical compositions including nanoparticle compositions are principally directed to compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other mammal. Modification of compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the compositions is contemplated include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, hoses, sheep, cats, dogs, mice, and / or rats.

[0444] A pharmaceutical composition including one or more nanoparticle compositions may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if desirable or necessary, dividing, shaping, and / or packaging the product into a desired single- or multi-dose unit.

[0445] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a "unit dose" is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient (e.g., nanoparticle composition). The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

[0446] Pharmaceutical compositions may be prepared in a variety of forms suitable for a variety of routes and methods of administration. For example, pharmaceutical compositions may be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and other forms.

[0447] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and / or elixirs. In addition to active ingredients, liquid dosage forms may comprise inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, oral compositions can include additional therapeutic and / or prophylactic agents, additional agents such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and / or perfuming agents. In certain embodiments for parenteral administration, compositions are mixed with solubilizing agents such as Cremophor ®< , alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and / or combinations thereof.

[0448] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing agents, wetting agents, and / or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions, and / or emulsions in nontoxic parenterally acceptable diluents and / or solvents, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P., and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injectables.

[0449] Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, and / or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0450] In order to prolong the effect of an active ingredient, it is often desirable to slow the absorption of the active ingredient from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle. Injectable depot forms are made by forming microencapsulated matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues.

[0451] Compositions for rectal or vaginal administration are typically suppositories which can be prepared by mixing compositions with suitable non-irritating excipients such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active ingredient.

[0452] Solid dosage forms for oral administration include capsules, tablets, pills, films, powders, and granules. In such solid dosage forms, an active ingredient is mixed with at least one inert, pharmaceutically acceptable excipient such as sodium citrate or dicalcium phosphate and / or fillers or extenders (e.g. starches, lactose, sucrose, glucose, mannitol, and silicic acid), binders (e.g. carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia), humectants (e.g. glycerol), disintegrating agents (e.g. agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate), solution retarding agents (e.g. paraffin), absorption accelerators (e.g. quaternary ammonium compounds), wetting agents (e.g. cetyl alcohol and glycerol monostearate), absorbents (e.g. kaolin and bentonite clay, silicates), and lubricants (e.g. talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate), and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may comprise buffering agents.

[0453] Solid compositions of a similar type may be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. Solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally comprise opacifying agents and can be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. Solid compositions of a similar type may be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.

[0454] Dosage forms for topical and / or transdermal administration of a composition may include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and / or patches. Generally, an active ingredient is admixed under sterile conditions with a pharmaceutically acceptable excipient and / or any needed preservatives and / or buffers as may be required. Additionally, the present disclosure contemplates the use of transdermal patches, which often have the added advantage of providing controlled delivery of a compound to the body. Such dosage forms may be prepared, for example, by dissolving and / or dispensing the compound in the proper medium. Alternatively or additionally, rate may be controlled by either providing a rate controlling membrane and / or by dispersing the compound in a polymer matrix and / or gel.

[0455] Suitable devices for use in delivering intradermal pharmaceutical compositions described herein include short needle devices such as those described in U.S. Patents 4,886,499; 5,190,521; 5,328,483; 5,527,288; 4,270,537; 5,015,235; 5,141,496; and 5,417,662. Intradermal compositions may be administered by devices which limit the effective penetration length of a needle into the skin, such as those described in PCT publication WO 99 / 34850 and functional equivalents thereof. Jet injection devices which deliver liquid compositions to the dermis via a liquid jet injector and / or via a needle which pierces the stratum corneum and produces a jet which reaches the dermis are suitable. Jet injection devices are described, for example, in U.S. Patents 5,480,381; 5,599,302; 5,334,144; 5,993,412; 5,649,912; 5,569,189; 5,704,911; 5,383,851; 5,893,397; 5,466,220; 5,339,163; 5,312,335; 5,503,627; 5,064,413; 5,520,639; 4,596,556; 4,790,824; 4,941,880; 4,940,460; and PCT publications WO 97 / 37705 and WO 97 / 13537. Ballistic powder / particle delivery devices which use compressed gas to accelerate vaccine in powder form through the outer layers of the skin to the dermis are suitable. Alternatively or additionally, conventional syringes may be used in the classical mantoux method of intradermal administration.

[0456] Formulations suitable for topical administration include, but are not limited to, liquid and / or semi liquid preparations such as liniments, lotions, oil in water and / or water in oil emulsions such as creams, ointments and / or pastes, and / or solutions and / or suspensions. Topically-administrable formulations may, for example, comprise from about 1% to about 10% (wt / wt) active ingredient, although the concentration of active ingredient may be as high as the solubility limit of the active ingredient in the solvent. Formulations for topical administration may further comprise one or more of the additional ingredients described herein.

[0457] A pharmaceutical composition may be prepared, packaged, and / or sold in a formulation suitable for pulmonary administration via the buccal cavity. Such a formulation may comprise dry particles which comprise the active ingredient. Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder and / or using a self propelling solvent / powder dispensing container such as a device comprising the active ingredient dissolved and / or suspended in a low-boiling propellant in a sealed container. Dry powder compositions may include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.

[0458] Low boiling propellants generally include liquid propellants having a boiling point of below 65 °F at atmospheric pressure. Generally the propellant may constitute 50% to 99.9% (wt / wt) of the composition, and active ingredient may constitute 0.1% to 20% (wt / wt) of the composition. A propellant may further comprise additional ingredients such as a liquid nonionic and / or solid anionic surfactant and / or a solid diluent (which may have a particle size of the same order as particles comprising the active ingredient).

[0459] Pharmaceutical compositions formulated for pulmonary delivery may provide an active ingredient in the form of droplets of a solution and / or suspension. Such formulations may be prepared, packaged, and / or sold as aqueous and / or dilute alcoholic solutions and / or suspensions, optionally sterile, comprising active ingredient, and may conveniently be administered using any nebulization and / or atomization device. Such formulations may further comprise one or more additional ingredients including, but not limited to, a flavoring agent such as saccharin sodium, a volatile oil, a buffering agent, a surface active agent, and / or a preservative such as methylhydroxybenzoate. Droplets provided by this route of administration may have an average diameter in the range from about 1 nm to about 200 nm.

[0460] Formulations described herein as being useful for pulmonary delivery are useful for intranasal delivery of a pharmaceutical composition. Another formulation suitable for intranasal administration is a coarse powder comprising the active ingredient and having an average particle from about 0.2 µm to 500 µm. Such a formulation is administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passage from a container of the powder held close to the nose.

[0461] Formulations suitable for nasal administration may, for example, comprise from about as little as 0.1% (wt / wt) and as much as 100% (wt / wt) of active ingredient, and may comprise one or more of the additional ingredients described herein. A pharmaceutical composition may be prepared, packaged, and / or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets and / or lozenges made using conventional methods, and may, for example, 0.1% to 20% (wt / wt) active ingredient, the balance comprising an orally dissolvable and / or degradable composition and, optionally, one or more of the additional ingredients described herein. Alternately, formulations suitable for buccal administration may comprise a powder and / or an aerosolized and / or atomized solution and / or suspension comprising active ingredient. Such powdered, aerosolized, and / or aerosolized formulations, when dispersed, may have an average particle and / or droplet size in the range from about 0.1 nm to about 200 nm, and may further comprise one or more of any additional ingredients described herein.

[0462] A pharmaceutical composition may be prepared, packaged, and / or sold in a formulation suitable for ophthalmic administration. Such formulations may, for example, be in the form of eye drops including, for example, a 0.1 / 1.0% (wt / wt) solution and / or suspension of the active ingredient in an aqueous or oily liquid excipient. Such drops may further comprise buffering agents, salts, and / or one or more other of any additional ingredients described herein. Other ophthalmically-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form and / or in a liposomal preparation. Ear drops and / or eye drops are contemplated as being within the scope of this present disclosure.Methods of producing polypeptides in cells

[0463] The present disclosure provides methods of producing a polypeptide of interest in a mammalian cell. Methods of producing polypeptides involve contacting a cell with a nanoparticle composition including an mRNA encoding the polypeptide of interest. Upon contacting the cell with the nanoparticle composition, the mRNA may be taken up and translated in the cell to produce the polypeptide of interest.

[0464] In general, the step of contacting a mammalian cell with a nanoparticle composition including an mRNA encoding a polypeptide of interest may be performed in vivo, ex vivo, in culture, or in vitro. The amount of nanoparticle composition contacted with a cell, and / or the amount of mRNA therein, may depend on the type of cell or tissue being contacted, the means of administration, the physiochemical characteristics of the nanoparticle composition and the mRNA (e.g., size, charge, and chemical composition) therein, and other factors. In general, an effective amount of the nanoparticle composition will allow for efficient polypeptide production in the cell. Metrics for efficiency may include polypeptide translation (indicated by polypeptide expression), level of mRNA degradation, and immune response indicators.

[0465] The step of contacting a nanoparticle composition including an mRNA with a cell may involve or cause transfection. A phospholipid including in the lipid component of a nanoparticle composition may facilitate transfection and / or increase transfection efficiency, for example, by interacting and / or fusing with a cellular or intracellular membrane. Transfection may allow for the translation of the mRNA within the cell.

[0466] In some embodiments, the nanoparticle compositions described herein may be used therapeutically. For example, an mRNA included in a nanoparticle composition may encode a therapeutic polypeptide (e.g., in a translatable region) and produce the therapeutic polypeptide upon contacting and / or entry (e.g., transfection) into a cell. In other embodiments, an mRNA included in a nanoparticle composition may encode a polypeptide that may improve or increase the immunity of a subject. For example, an mRNA may encode a granulocyte-colony stimulating factor or trastuzumab.

[0467] In certain embodiments, an mRNA included in a nanoparticle composition may encode a recombinant polypeptide that may replace one or more polypeptides that may be substantially absent in a cell contacted with the nanoparticle composition. The one or more substantially absent polypeptides may be lacking due to a genetic mutation of the encoding gene or a regulatory pathway thereof. Alternatively, a recombinant polypeptide produced by translation of the mRNA may antagonize the activity of an endogenous protein present in, on the surface of, or secreted from the cell. An antagonistic recombinant polypeptide may be desirable to combat deleterious effects caused by activities of the endogenous protein, such as altered activities or localization caused by mutation. In another alternative, a recombinant polypeptide produced by translation of the mRNA may indirectly or directly antagonize the activity of a biological moiety present in, on the surface of, or secreted from the cell. Antagonized biological moieties may include, but are not limited to, lipids (e.g., cholesterol), lipoproteins (e.g., low density lipoprotein), nucleic acids, carbohydrates, and small molecule toxins. Recombinant polypeptides produced by translation of the mRNA may be engineered for localization within the cell, such as within a specific compartment such as the nucleus, or may be engineered for secretion from the cell or for translocation to the plasma membrane of the cell.

[0468] In some embodiments, contacting a cell with a nanoparticle composition including an mRNA may reduce the innate immune response of a cell to an exogenous nucleic acid. A cell may be contacted with a first nanoparticle composition including a first amount of a first exogenous mRNA including a translatable region and the level of the innate immune response of the cell to the first exogenous mRNA may be determined. Subsequently, the cell may be contacted with a second composition including a second amount of the first exogenous mRNA, the second amount being a lesser amount of the first exogenous mRNA compared to the first amount. Alternatively, the second composition may include a first amount of a second exogenous mRNA that is different from the first exogenous mRNA. The steps of contacting the cell with the first and second compositions may be repeated one or more times. Additionally, efficiency of polypeptide production (e.g., translation) in the cell may be optionally determined, and the cell may be re-contacted with the first and / or second composition repeatedly until a target protein production efficiency is achieved.

[0469] In some examples, a method of producing a polypeptide of interest in a mammalian cell involves contacting the cell with a nanoparticle composition including (i) a lipid component including a phospholipid, a structural lipid, a PEG lipid, and a compound of one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), as described herein; and (ii) an mRNA encoding the polypeptide of interest, whereby the mRNA is capable of being translated in the cell to produce the polypeptide of interest.Methods of delivering therapeutic agents to cells and organs

[0470] The present disclosure provides methods of delivering a therapeutic and / or prophylactic agent to a mammalian cell or organ. Delivery of a therapeutic and / or prophylactic agent to a cell involves administering a nanoparticle composition including the therapeutic and / or prophylactic agent to a subject, where administration of the composition involves contacting the cell with the composition. For example, a protein, cytotoxic agent, radioactive ion, chemotherapeutic agent, or nucleic acid (such as an RNA, e.g., mRNA) may be delivered to a cell or organ. In the instance that a therapeutic and / or prophylactic agent is an mRNA, upon contacting a cell with the nanoparticle composition, a translatable mRNA may be translated in the cell to produce a polypeptide of interest. However, mRNAs that are substantially not translatable may also be delivered to cells. Substantially non-translatable mRNAs may be useful as vaccines and / or may sequester translational components of a cell to reduce expression of other species in the cell.

[0471] In some embodiments, a nanoparticle composition may target a particular type or class of cells (e.g., cells of a particular organ or system thereof). For example, a nanoparticle composition including a therapeutic and / or prophylactic agent of interest may be specifically delivered to a mammalian liver, kidney, spleen, femur, or lung. Specific delivery to a particular class of cells, an organ, or a system or group thereof implies that a higher proportion of nanoparticle compositions including a therapeutic and / or prophylactic agent are delivered to the destination (e.g., tissue) of interest relative to other destinations, e.g., upon administration of a nanoparticle composition to a mammal. In some embodiments, specific delivery may result in a greater than 2 fold, 5 fold, 10 fold, 15 fold, or 20 fold increase in the amount of therapeutic and / or prophylactic agent per 1 g of tissue of the targeted destination (e.g., tissue of interest, such as a liver) as compared to another destination (e.g., the spleen). In certain embodiments, the tissue of interest is selected from the group consisting of a liver, kidney, a lung, a spleen, a femur, vascular endothelium in vessels (e.g., intra-coronary or intra-femoral) or kidney, and tumor tissue (e.g., via intratumoral injection).

[0472] As another example of targeted or specific delivery, an mRNA that encodes a protein-binding partner (e.g., an antibody or functional fragment thereof, a scaffold protein, or a peptide) or a receptor on a cell surface may be included in a nanoparticle composition. An mRNA may additionally or instead be used to direct the synthesis and extracellular localization of lipids, carbohydrates, or other biological moieties. Alternatively, other therapeutic and / or prophylactic agents or elements (e.g., lipids or ligands) of a nanoparticle composition may be selected based on their affinity for particular receptors (e.g., low density lipoprotein receptors) such that a nanoparticle composition may more readily interact with a target cell population including the receptors. For example, ligands may include, but are not limited to, members of a specific binding pair, antibodies, monoclonal antibodies, Fv fragments, single chain Fv (scFv) fragments, Fab' fragments, F(ab')2 fragments, single domain antibodies, camelized antibodies and fragments thereof, humanized antibodies and fragments thereof, and multivalent versions thereof; multivalent binding reagents including mono- or bi-specific antibodies such as disulfide stabilized Fv fragments, scFv tandems, diabodies, tridobdies, or tetrabodies; and aptamers, receptors, and fusion proteins.

[0473] In some embodiments, a ligand may be a surface-bound antibody, which can permit tuning of cell targeting specificity. This is especially useful since highly specific antibodies can be raised against an epitope of interest for the desired targeting site. In one embodiment, multiple antibodies are expressed on the surface of a cell, and each antibody can have a different specificity for a desired target. Such approaches can increase the avidity and specificity of targeting interactions.

[0474] A ligand can be selected, e.g., by a person skilled in the biological arts, based on the desired localization or function of the cell. For example an estrogen receptor ligand, such as tamoxifen, can target cells to estrogen-dependent breast cancer cells that have an increased number of estrogen receptors on the cell surface. Other non-limiting examples of ligand / receptor interactions include CCR1 (e.g., for treatment of inflamed joint tissues or brain in rheumatoid arthritis, and / or multiple sclerosis), CCR7, CCR8 (e.g., targeting to lymph node tissue), CCR6, CCR9,CCR10 (e.g., to target to intestinal tissue), CCR4, CCR10 (e.g., for targeting to skin), CXCR4 (e.g., for general enhanced transmigration), HCELL (e.g., for treatment of inflammation and inflammatory disorders, bone marrow), Alpha4beta7 (e.g., for intestinal mucosa targeting), and VLA-4NCAM-1 (e.g., targeting to endothelium). In general, any receptor involved in targeting (e.g., cancer metastasis) can be harnessed for use in the methods and compositions described herein.

[0475] Targeted cells may include, but are not limited to, hepatocytes, epithelial cells, hematopoietic cells, epithelial cells, endothelial cells, lung cells, bone cells, stem cells, mesenchymal cells, neural cells, cardiac cells, adipocytes, vascular smooth muscle cells, cardiomyocytes, skeletal muscle cells, beta cells, pituitary cells, synovial lining cells, ovarian cells, testicular cells, fibroblasts, B cells, T cells, reticulocytes, leukocytes, granulocytes, and tumor cells.

[0476] In certain embodiments, a nanoparticle composition may target hepatocytes. Apolipoproteins such as apolipoprotein E (apoE) have been shown to associate with neutral or near neutral lipid-containing nanoparticle compositions in the body, and are known to associate with receptors such as low-density lipoprotein receptors (LDLRs) found on the surface of hepatocytes. See, e.g., Akinc, A. et al., Mol. Ther. 2010, 18, 1357-1364 and Dong, Y. et al., PNAS 2014, 111, 3955-3960. Thus, a nanoparticle composition including a lipid component with a neutral or near neutral charge that is administered to a subject may acquire apoE in a subject's body and may subsequently deliver a therapeutic and / or prophylactic agent (e.g., an RNA) to hepatocytes including LDLRs in a targeted manner.

[0477] In certain examples, cell uptake of a compound of one of formulae (I), (Ia1)-(Ia6), (Ib), (II), (IIa), (III), (IIIa), and (IV)as described herein or a nanoparticle composition comprising the compound may be dependent on levels and / or activities of LDLRs, or cell uptake of the nanoparticle composition is LDLR-dependent. For example, if the cell is LDLR-deficient (e.g., having an aberrant LDLR activity and / or an abnormally low level of LDLRs), the cell uptake of the compound or nanoparticle composition may decrease as compared to the uptake by a normal cell.

[0478] In certain examples, cell uptake of a compound of one of formulae (I), (Ia1)-(Ia6), (Ib), (II), (IIa), (III), (IIIa), and (IV) as described herein or a nanoparticle composition comprising the compound may be independent on levels and / or activities of LDLRs, or cell uptake of the nanoparticle composition is LDLR-independent. For example, if the cell is LDLR-deficient (e.g., having an aberrant LDLR activity and / or an abnormally low level of LDLRs), the cell uptake of the compound or nanoparticle composition is substantively the same as the uptake by a normal cell.

[0479] In certain examples, cell uptake of a compound of one of formulae (I), (Ia1)-(Ia6), (Ib), (II), (IIa), (III), (IIIa), and (IV)= as described herein or a nanoparticle composition comprising the compound may be dependent on levels and / or activities of apoE, or cell uptake of the nanoparticle composition is apoE-dependent. For example, if the cell is apoE-deficient (e.g., having an aberrant apoE activity and / or an abnormally low level of apoE), the cell uptake of the compound or nanoparticle composition may decrease as compared to the uptake by a normal cell.

[0480] In certain examples, cell uptake of a compound of one of formulae (I), (Ia1)-(Ia6), (Ib), (II), (IIa), (III), (IIIa), and (IV) as described herein or a nanoparticle composition comprising the compound may be independent on levels and / or activities of apoE, or cell uptake of the nanoparticle composition is apoE-independent. For example, if the cell is apoE-deficient (e.g., having an aberrant apoE activity and / or an abnormally low level of apoE), the cell uptake of the compound or nanoparticle composition is substantively the same as the uptake by a normal cell.

[0481] In certain examples, cell uptake of the compound or nanoparticle composition disclosed herein may be both LDLR-dependent and apoE-dependent.

[0482] In certain examples, cell uptake of the compound or nanoparticle composition disclosed herein may be dependent on the interaction of LDLR and apoE. For example, if the interaction of LDLR and apoE is abnormal (e.g., leading to an abnormally low level of downstream signaling), the cell uptake of the compound or nanoparticle composition may decrease as compared to the uptake by a normal cell.

[0483] In certain examples, cell uptake of the compound or nanoparticle composition disclosed herein may be both LDLR-independent and apoE-independent.

[0484] In certain examples, cell uptake of the compound or nanoparticle composition disclosed herein may be independent on the interaction of LDLR and apoE. For example, if the interaction of LDLR and apoE is abnormal (e.g., leading to an abnormally low level of downstream signaling), the cell uptake of the compound or nanoparticle composition is substantively the same as the uptake by a normal cell.

[0485] In certain examples, the apoE is apoE3.

[0486] In some examples, a method of delivering a therapeutic and / or prophylactic agent to a mammalian cell involves administering to a subject a nanoparticle composition including (i) a lipid component including a phospholipid, a structural lipid, a PEG lipid, and a compound of one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), as described herein; and (ii) a therapeutic and / or prophylactic agent (e.g., an mRNA), where administering involves contacting the cell with the nanoparticle composition, whereby the therapeutic and / or prophylactic agent is delivered to the cell.

[0487] In further examples, a method of specifically delivering a therapeutic and / or prophylactic agent to a mammalian organ involves administering to a mammal a nanoparticle composition including (i) a lipid component including a phospholipid, a structural lipid, a PEG lipid, and a compound of one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), as described herein; and (ii) a therapeutic and / or prophylactic agent (e.g., an mRNA), where administering involves contacting the mammalian organ with the nanoparticle composition, whereby the therapeutic and / or prophylactic agent is delivered to the organ.

[0488] In certain examples, the delivery efficiency of the therapeutic and / or prophylactic agent is LDLR-independent or apoE-independent, or both. In certain examples, the delivery efficiency of the therapeutic and / or prophylactic agent is LDLR-dependent or apoE-dependent, or both. In certain examples, the delivery efficiency of the therapeutic and / or prophylactic agent is independent of LDLR-apoE interaction. In certain examples, the delivery efficiency of the therapeutic and / or prophylactic agent is dependent on LDLR-apoE interaction.Methods of treating diseases and disorders

[0489] Nanoparticle compositions may be useful for treating a disease, disorder, or condition. In particular, such compositions may be useful in treating a disease, disorder, or condition characterized by missing or aberrant protein or polypeptide activity. For example, a nanoparticle composition comprising an mRNA encoding a missing or aberrant polypeptide may be administered or delivered to a cell. Subsequent translation of the mRNA may produce the polypeptide, thereby reducing or eliminating an issue caused by the absence of or aberrant activity caused by the polypeptide. Because translation may occur rapidly, the methods and compositions may be useful in the treatment of acute diseases, disorders, or conditions such as sepsis, stroke, and myocardial infarction. A therapeutic and / or prophylactic agent included in a nanoparticle composition may also be capable of altering the rate of transcription of a given species, thereby affecting gene expression.

[0490] Diseases, disorders, and / or conditions characterized by dysfunctional or aberrant protein or polypeptide activity for which a composition may be administered include, but are not limited to, rare diseases, infectious diseases (as both vaccines and therapeutics), cancer and proliferative diseases, genetic diseases (e.g., cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardio- and reno-vascular diseases, and metabolic diseases. Multiple diseases, disorders, and / or conditions may be characterized by missing (or substantially diminished such that proper protein function does not occur) protein activity. Such proteins may not be present, or they may be essentially non-functional. A specific example of a dysfunctional protein is the missense mutation variants of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which produce a dysfunctional protein variant of CFTR protein, which causes cystic fibrosis. The present disclosure provides a method for treating such diseases, disorders, and / or conditions in a subject by administering a nanoparticle composition including an RNA and a lipid component including a lipid according to one of formulae (I), (Ia1)-(Ia10), (Ib), (Ic), (Id), (Id1)-(Id10), (Ie), (Ie1)-(Ie6), (II), (IIa), (III), and (IIIa), a phospholipid (optionally unsaturated), a PEG lipid, and a structural lipid, wherein the RNA may be an mRNA encoding a polypeptide that antagonizes or otherwise overcomes an aberrant protein activity present in the cell of the subject.

[0491] In some examples, a method of treating a disease or disorder in a mammal in need involves administering to the mammal a therapeutically effective amount of a nanoparticle composition including (i) a lipid component including a phospholipid, a structural lipid, a PEG lipid, and a compound of formula (I), (Ia1)-(Ia8), (Ib), (Ic), (Id), (II), (IIa), (III), or (IIIa), as described herein; and (ii) a therapeutic and / or prophylactic agent (e.g., an mRNA).

[0492] The disclosure provides methods involving administering nanoparticle compositions including one or more therapeutic and / or prophylactic agents and pharmaceutical compositions including the same. The terms therapeutic and prophylactic can be used interchangeably herein with respect to features and embodiments of the present disclosure. Therapeutic compositions, or imaging, diagnostic, or prophylactic compositions thereof, may be administered to a subject using any reasonable amount and any route of administration effective for preventing, treating, diagnosing, or imaging a disease, disorder, and / or condition and / or any other purpose. The specific amount administered to a given subject may vary depending on the species, age, and general condition of the subject; the purpose of the administration; the particular composition; the mode of administration; and the like. Compositions in accordance with the present disclosure may be formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of a composition of the present disclosure will be decided by an attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or otherwise appropriate dose level (e.g., for imaging) for any particular patient will depend upon a variety of factors including the severity and identify of a disorder being treated, if any; the one or more therapeutic and / or prophylactic agents employed; the specific composition employed; the age, body weight, general health, sex, and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific pharmaceutical composition employed; the duration of the treatment; drugs used in combination or coincidental with the specific pharmaceutical composition employed; and like factors well known in the medical arts.

[0493] A nanoparticle composition including one or more therapeutic and / or prophylactic agents may be administered by any route. In some embodiments, compositions, including prophylactic, diagnostic, or imaging compositions including one or more nanoparticle compositions described herein, are administered by one or more of a variety of routes, including oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, trans- or intra-dermal, interdermal, rectal, intravaginal, intraperitoneal, intraocular, subretinal, intravitreal, topical (e.g. by powders, ointments, creams, gels, lotions, and / or drops), mucosal, nasal, buccal, enteral, vitreal, intratumoral, sublingual, intranasal; by intratracheal instillation, bronchial instillation, and / or inhalation; as an oral spray and / or powder, nasal spray, and / or aerosol, and / or through a portal vein catheter. In some embodiments, a composition may be administered intravenously, intramuscularly, intradermally, intra-arterially, intratumorally, subcutaneously, intraocular, subretinal, intravitreal, or by inhalation. However, the present disclosure encompasses the delivery or administration of compositions by any appropriate route taking into consideration likely advances in the sciences of drug delivery. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the nanoparticle composition including one or more therapeutic and / or prophylactic agents (e.g., its stability in various bodily environments such as the bloodstream and gastrointestinal tract), the condition of the patient (e.g., whether the patient is able to tolerate particular routes of administration), etc.

[0494] In certain embodiments, compositions in accordance with the present disclosure may be administered at dosage levels sufficient to deliver from about 0.0001 mg / kg to about 10 mg / kg, from about 0.001 mg / kg to about 10 mg / kg, from about 0.005 mg / kg to about 10 mg / kg, from about 0.01 mg / kg to about 10 mg / kg, from about 0.05 mg / kg to about 10 mg / kg, from about 0.1 mg / kg to about 10 mg / kg, from about 1 mg / kg to about 10 mg / kg, from about 2 mg / kg to about 10 mg / kg, from about 5 mg / kg to about 10 mg / kg, from about 0.0001 mg / kg to about 5 mg / kg, from about 0.001 mg / kg to about 5 mg / kg, from about 0.005 mg / kg to about 5 mg / kg, from about 0.01 mg / kg to about 5 mg / kg, from about 0.05 mg / kg to about 5 mg / kg, from about 0.1 mg / kg to about 5 mg / kg, from about 1 mg / kg to about 5 mg / kg, from about 2 mg / kg to about 5 mg / kg, from about 0.0001 mg / kg to about 2.5 mg / kg, from about 0.001 mg / kg to about 2.5 mg / kg, from about 0.005 mg / kg to about 2.5 mg / kg, from about 0.01 mg / kg to about 2.5 mg / kg, from about 0.05 mg / kg to about 2.5 mg / kg, from about 0.1 mg / kg to about 2.5 mg / kg, from about 1 mg / kg to about 2.5 mg / kg, from about 2 mg / kg to about 2.5 mg / kg, from about 0.0001 mg / kg to about 1 mg / kg, from about 0.001 mg / kg to about 1 mg / kg, from about 0.005 mg / kg to about 1 mg / kg, from about 0.01 mg / kg to about 1 mg / kg, from about 0.05 mg / kg to about 1 mg / kg, from about 0.1 mg / kg to about 1 mg / kg, from about 0.0001 mg / kg to about 0.25 mg / kg, from about 0.001 mg / kg to about 0.25 mg / kg, from about 0.005 mg / kg to about 0.25 mg / kg, from about 0.01 mg / kg to about 0.25 mg / kg, from about 0.05 mg / kg to about 0.25 mg / kg, or from about 0.1 mg / kg to about 0.25 mg / kg of a therapeutic and / or prophylactic agent (e.g., an mRNA) in a given dose, where a dose of 1 mg / kg (mpk) provides 1 mg of a therapeutic and / or prophylactic agent per 1 kg of subject body weight. In certain embodiments, a dose of about 0.001 mg / kg to about 10 mg / kg of a therapeutic and / or prophylactic agent (e.g., mRNA) of a nanoparticle composition may be administered. In other embodiments, a dose of about 0.005 mg / kg to about 2.5 mg / kg of a therapeutic and / or prophylactic agent may be administered. In certain embodiments, a dose of about 0.1 mg / kg to about 1 mg / kg may be administered. In other embodiments, a dose of about 0.05 mg / kg to about 0.25 mg / kg may be administered. A dose may be administered one or more times per day, in the same or a different amount, to obtain a desired level of mRNA expression and / or therapeutic, diagnostic, prophylactic, or imaging effect. The desired dosage may be delivered, for example, three times a day, two times a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). In some embodiments, a single dose may be administered, for example, prior to or after a surgical procedure or in the instance of an acute disease, disorder, or condition.

[0495] Nanoparticle compositions including one or more therapeutic and / or prophylactic agents may be used in combination with one or more other therapeutic, prophylactic, diagnostic, or imaging agents. By "in combination with," it is not intended to imply that the agents must be administered at the same time and / or formulated for delivery together, although these methods of delivery are within the scope of the present disclosure. For example, one or more nanoparticle compositions including one or more different therapeutic and / or prophylactic agents may be administered in combination. Compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and / or on a time schedule determined for that agent. In some embodiments, the present disclosure encompasses the delivery of compositions, or imaging, diagnostic, or prophylactic compositions thereof in combination with agents that improve their bioavailability, reduce and / or modify their metabolism, inhibit their excretion, and / or modify their distribution within the body.

[0496] It will further be appreciated that therapeutically, prophylactically, diagnostically, or imaging active agents utilized in combination may be administered together in a single composition or administered separately in different compositions. In general, it is expected that agents utilized in combination will be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels utilized in combination may be lower than those utilized individually.

[0497] The particular combination of therapies (therapeutics or procedures) to employ in a combination regimen will take into account compatibility of the desired therapeutics and / or procedures and the desired therapeutic effect to be achieved. It will also be appreciated that the therapies employed may achieve a desired effect for the same disorder (for example, a composition useful for treating cancer may be administered concurrently with a chemotherapeutic agent), or they may achieve different effects (e.g., control of any adverse effects, such as infusion related reactions).

[0498] A nanoparticle composition may be used in combination with an agent to increase the effectiveness and / or therapeutic window of the composition. Such an agent may be, for example, an anti-inflammatory compound, a steroid (e.g., a corticosteroid), a statin, an estradiol, a BTK inhibitor, an S1P1 agonist, a glucocorticoid receptor modulator (GRM), or an anti-histamine. In some embodiments, a nanoparticle composition may be used in combination with dexamethasone, methotrexate, acetaminophen, an H1 receptor blocker, or an H2 receptor blocker. In certain embodiments, a method of treating a subject in need thereof or of delivering a therapeutic and / or prophylactic agent to a subject (e.g., a mammal) may involve pre-treating the subject with one or more agents prior to administering a nanoparticle composition. For example, a subject may be pre-treated with a useful amount (e.g., 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, or any other useful amount) of dexamethasone, methotrexate, acetaminophen, an H1 receptor blocker, or an H2 receptor blocker. Pre-treatment may occur 24 or fewer hours (e.g., 24 hours, 20 hours, 16 hours, 12 hours, 8 hours, 4 hours, 2 hours, 1 hour, 50 minutes, 40 minutes, 30 minutes, 20 minutes, or 10 minutes) before administration of the nanoparticle composition and may occur one, two, or more times in, for example, increasing dosage amounts.

[0499] In any method or use described herein, in certain embodiments, the subject in need thereof is LDLR-deficient or apoE-deficient or both. In certain embodiments, the subject in need thereof is not LDLR-deficient or has normal LDLR levels and / or activities. In certain embodiments, the subject in need thereof is not apoE-deficient or has normal apoE levels and / or activities. In certain embodiments, the subject in need thereof has an abnormal interaction of LDLR and apoE. In certain embodiments, the subject in need thereof has a normal interaction of LDLR and apoE.

[0500] About, Approximately: As used herein, the terms "approximately" and "about," as applied to one or more values of interest, refer to a value that is similar to a stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). For example, when used in the context of an amount of a given compound in a lipid component of a nanoparticle composition, "about" may mean + / - 10% of the recited value. For instance, a nanoparticle composition including a lipid component having about 40% of a given compound may include 30-50% of the compound.

[0501] Compound: As used herein, the term "compound," is meant to include all isomers and isotopes of the structure depicted. "Isotopes" refers to atoms having the same atomic number but different mass numbers resulting from a different number of neutrons in the nuclei. For example, isotopes of hydrogen include tritium and deuterium. Further, a compound, salt, or complex of the present disclosure can be prepared in combination with solvent or water molecules to form solvates and hydrates by routine methods.

[0502] Contacting: As used herein, the term "contacting" means establishing a physical connection between two or more entities. For example, contacting a mammalian cell with a nanoparticle composition means that the mammalian cell and a nanoparticle are made to share a physical connection. Methods of contacting cells with external entities both in vivo and ex vivo are well known in the biological arts. For example, contacting a nanoparticle composition and a mammalian cell disposed within a mammal may be performed by varied routes of administration (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and may involve varied amounts of nanoparticle compositions. Moreover, more than one mammalian cell may be contacted by a nanoparticle composition.

[0503] Delivering: As used herein, the term "delivering" means providing an entity to a destination. For example, delivering a therapeutic and / or prophylactic agent to a subject may involve administering a nanoparticle composition including the therapeutic and / or prophylactic agent to the subject (e.g., by an intravenous, intramuscular, intradermal, or subcutaneous route). Administration of a nanoparticle composition to a mammal or mammalian cell may involve contacting one or more cells with the nanoparticle composition.

[0504] Enhanced delivery: As used herein, the term "enhanced delivery" means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a therapeutic and / or prophylactic agent by a nanoparticle to a target tissue of interest (e.g., mammalian liver) compared to the level of delivery of a therapeutic and / or prophylactic agent by a control nanoparticle to a target tissue of interest (e.g., MC3, KC2, or DLinDMA). The level of delivery of a nanoparticle to a particular tissue may be measured by comparing the amount of protein produced in a tissue to the weight of said tissue, comparing the amount of therapeutic and / or prophylactic agent in a tissue to the weight of said tissue, comparing the amount of protein produced in a tissue to the amount of total protein in said tissue, or comparing the amount of therapeutic and / or prophylactic agent in a tissue to the amount of total therapeutic and / or prophylactic agent in said tissue. It will be understood that the enhanced delivery of a nanoparticle to a target tissue need not be determined in a subject being treated, it may be determined in a surrogate such as an animal model (e.g., a rat model).

[0505] Specific delivery: As used herein, the term "specific delivery," "specifically deliver," or "specifically delivering" means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a therapeutic and / or prophylactic agent by a nanoparticle to a target tissue of interest (e.g., mammalian liver) compared to an off-target tissue (e.g., mammalian spleen). The level of delivery of a nanoparticle to a particular tissue may be measured by comparing the amount of protein produced in a tissue to the weight of said tissue, comparing the amount of therapeutic and / or prophylactic agent in a tissue to the weight of said tissue, comparing the amount of protein produced in a tissue to the amount of total protein in said tissue, or comparing the amount of therapeutic and / or prophylactic agent in a tissue to the amount of total therapeutic and / or prophylactic agent in said tissue. For example, for renovascular targeting, a therapeutic and / or prophylactic agent is specifically provided to a mammalian kidney as compared to the liver and spleen if 1.5, 2-fold, 3-fold, 5-fold, 10-fold, 15 fold, or 20 fold more therapeutic and / or prophylactic agent per 1 g of tissue is delivered to a kidney compared to that delivered to the liver or spleen following systemic administration of the therapeutic and / or prophylactic agent. It will be understood that the ability of a nanoparticle to specifically deliver to a target tissue need not be determined in a subject being treated, it may be determined in a surrogate such as an animal model (e.g., a rat model).

[0506] Encapsulation efficiency: As used herein, "encapsulation efficiency" refers to the amount of a therapeutic and / or prophylactic agent that becomes part of a nanoparticle composition, relative to the initial total amount of therapeutic and / or prophylactic agent used in the preparation of a nanoparticle composition. For example, if 97 mg of therapeutic and / or prophylactic agent are encapsulated in a nanoparticle composition out of a total 100 mg of therapeutic and / or prophylactic agent initially provided to the composition, the encapsulation efficiency may be given as 97%. As used herein, "encapsulation" may refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement.

[0507] Expression: As used herein, "expression" of a nucleic acid sequence refers to translation of an mRNA into a polypeptide or protein and / or post-translational modification of a polypeptide or protein.

[0508] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).

[0509] In vivo: As used herein, the term "in vivo" refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).

[0510] Ex vivo: As used herein, the term "ex vivo" refers to events that occur outside of an organism (e.g., animal, plant, or microbe or cell or tissue thereof). Ex vivo events may take place in an environment minimally altered from a natural (e.g., in vivo) environment.

[0511] Isomer: As used herein, the term "isomer" means any geometric isomer, tautomer, zwitterion, stereoisomer, enantiomer, or diastereomer of a compound. Compounds may include one or more chiral centers and / or double bonds and may thus exist as stereoisomers, such as double-bond isomers (i.e., geometric E / Z isomers) or diastereomers (e.g., enantiomers (i.e., (+) or (-)) or cis / trans isomers). The present disclosure encompasses any and all isomers of the compounds described herein, including stereomerically pure forms (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and stereoisomeric mixtures, e.g., racemates. Enantiomeric and stereomeric mixtures of compounds and means of resolving them into their component enantiomers or stereoisomers are well-known.

[0512] Lipid component: As used herein, a "lipid component" is that component of a nanoparticle composition that includes one or more lipids. For example, the lipid component may include one or more cationic / ionizable, PEGylated, structural, or other lipids, such as phospholipids.

[0513] Linker: As used herein, a "linker" is a moiety connecting two moieties, for example, the connection between two nucleosides of a cap species. A linker may include one or more groups including but not limited to phosphate groups (e.g., phosphates, boranophosphates, thiophosphates, selenophosphates, and phosphonates), alkyl groups, amidates, or glycerols. For example, two nucleosides of a cap analog may be linked at their 5' positions by a triphosphate group or by a chain including two phosphate moieties and a boranophosphate moiety.

[0514] Methods of administration: As used herein, "methods of administration" may include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject. A method of administration may be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body.

[0515] Modified: As used herein, "modified" means non-natural. For example, an RNA may be a modified RNA. That is, an RNA may include one or more nucleobases, nucleosides, nucleotides, or linkers that are non-naturally occurring. A "modified" species may also be referred to herein as an "altered" species. Species may be modified or altered chemically, structurally, or functionally. For example, a modified nucleobase species may include one or more substitutions that are not naturally occurring.

[0516] N:P ratio: As used herein, the "N:P ratio" is the molar ratio of ionizable (in the physiological pH range) nitrogen atoms in a lipid to phosphate groups in an RNA, e.g., in a nanoparticle composition including a lipid component and an RNA.

[0517] Nanoparticle composition: As used herein, a "nanoparticle composition" is a composition comprising one or more lipids. Nanoparticle compositions are typically sized on the order of micrometers or smaller and may include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a nanoparticle composition may be a liposome having a lipid bilayer with a diameter of 500 nm or less.

[0518] Naturally occurring: As used herein, "naturally occurring" means existing in nature without artificial aid.

[0519] Patient: As used herein, "patient" refers to a subject who may seek or be in need of treatment, requires treatment, is receiving treatment, will receive treatment, or a subject who is under care by a trained professional for a particular disease or condition.

[0520] PEG lipid: As used herein, a "PEG lipid" or "PEGylated lipid" refers to a lipid comprising a polyethylene glycol component.

[0521] Pharmaceutically acceptable: The phrase "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0522] Pharmaceutically acceptable excipient: The phrase "pharmaceutically acceptable excipient," as used herein, refers to any ingredient other than the compounds described herein (for example, a vehicle capable of suspending, complexing, or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient. Excipients may include, for example: anti-adherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspending or dispersing agents, sweeteners, and waters of h...

Claims

1. A compound is selected from:

2. A nanoparticle composition comprising a lipid component comprising a compound according to claim 1.

3. The nanoparticle composition of claim 2, wherein the lipid component further comprises a PEG lipid of Formula (VI): or a salt or isomer thereof, wherein: R3PEG is-ORO; RO is hydrogen, C1-5 alkyl or an oxygen protecting group; r is an integer between 1 and 100; R5PEG is C10-40 alkyl, C10-40 alkenyl, or C10-40 alkynyl; and optionally one or more methylene groups of R5PEG are independently replaced with C3-10 carbocyclylene, 4 to 10 membered heterocyclylene, C6-10 arylene, 4 to 10 membered heteroarylene, -N(RN)-, -O-, -S-, -C(O)-, -C(O)N(RN)-, -NRNC(O)-, -NRNC(O)N(RN)-, -C(O)O-, -OC(O)-, -OC(O)O-, - OC(O)N(RN)-, -NRNC(O)O-, -C(O)S-, -SC(O)-, -C(=NRN)-, -C(=NRN)N(RN)-, - NRNC(=NRN)-, -NRNC(=NRN)N(RN)-, -C(S)-, -C(S)N(RN)-, -NRNC(S)-, -NRNC(S)N(RN)-, -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(RN)S(O)-, - S(O)N(RN)-, -N(RN)S(O)N(RN)-, -OS(O)N(RN)-, -N(RN)S(O)O-, -S(O)2-, -N(RN)S(O)2-, - S(O)2N(RN)-, -N(RN)S(O)2N(RN)-, -OS(O)2N(RN)-, or -N(RN)S(O)2O-; and each instance of RN is independently hydrogen, C1-6 alkyl, or a nitrogen protecting group.

4. The nanoparticle composition of claim 2 or claim 3, for use in a method of treating a disease or disorder in a mammal in need thereof, the method comprising administering to the mammal a therapeutically effective amount of the nanoparticle composition.