ESTROGEN RECEPTOR GAMMA (ERRG) Inhibitors for Use in the Treatment of Pancreatitis

DE602021040943T2Active Publication Date: 2025-10-22NOVMETAPHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
DE602021040943
Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-06-22
Filing Date
2021-06-22
Publication Date
2025-10-22
Estimated Expiration
2041-06-22

AI Technical Summary

Technical Problem

Current treatments for pancreatitis, particularly acute pancreatitis, are inadequate, with high morbidity and mortality rates due to the lack of approved drugs, and existing models fail to effectively target the underlying pathophysiology of the disease.

Method used

The use of aryl ethene compounds, specifically ERRγ inhibitors such as DMRC200434, DMRC2001000, DMRC200699, and DMRC200996, to prevent the premature activation of pancreatic digestive enzymes by inhibiting ERRγ, thereby reducing pancreatic autodigestion and inflammation.

Benefits of technology

These compounds effectively reduce serum amylase and lipase levels, minimize pancreatic tissue damage, and improve survival rates in animal models of acute pancreatitis, offering a promising therapeutic approach for pancreatitis.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

STATEMENT OF GOVERNMENT INTEREST

[0001] A study described in this application was supported by a grant of the Daegu-Gyeongbuk / Osong Medical Cluster R&D Project funded by the Ministry of Science and ICT, the Ministry of Trade, Industry and Energy, the Ministry of Health & Welfare, Republic of Korea (Grant Number : HI19C0760).FIELD

[0002] This disclosure includes methods and compositions for the treatment of acute pancreatitis. The disclosure concerns the use of a molecule to reduce or prevent the secretion of pancreatic digestive enzymes within the pancreas. This molecule serves to prevent mitochondrial dysfunction and autophagic dysfunction in pancreatic acinar cells which leads to prevention of immature activation of pancreatic digestive enzymes and autodigestion of the pancreas. The disclosure is also concerned with methods of treating a mammal suffering from pancreatitis through the administration of this molecule.BACKGROUND

[0003] In mammals, the pancreas, a large gland structurally similar to the salivary gland, contains acinar cells, responsible for digestive enzyme production, and ductal cells, which secrete large amounts of sodium bicarbonate solution. The physiological function of the pancreatic acinar cell is to synthesize, transport, store, and secrete digestive enzymes. This is accomplished through coordinated and sequential actions of the endoplasmic reticulum (ER), Golgi apparatus, the endolysosomal system, storage and secretory organelles, as well as the mitochondria. The combined secretion product is termed as "pancreatic juice'; this liquid flows through the pancreatic duct into the duodenum. The precise composition of pancreatic juice appears to be influenced by the types of compounds (carbohydrate, lipid, protein, and / or nucleic acid) in the chyme.

[0004] Pancreatic juice consists of various proteases (trypsin, chymotrypsin, carboxypolypeptidase), nucleases (RNase and DNase), pancreatic amylase, and lipases (pancreatic lipase, cholesterol esterase and phospholipase). Many of these enzymes are initially synthesized by the acinar cells in an inactive form as zymogens, e.g., trypsin is synthesized as trypsinogen. These enzymes are activated in a cascade manner, wherein, initially, trypsin is activated through proteolytic cleavage by the enzyme enterokinase. Trypsinogen can also be autoactivated by trypsin. Trypsin, in turn, activates both chymotypsinogen and procarboxypolypeptidase to form their active protease counterparts. The enzymes are normally activated only when they enter the intestinal mucosa in order to prevent autodigestion of the pancreas. As an in-built counter-mechanism to prevent premature activation, the acinar cells additionally secrete a trypsin inhibitor. This inhibitor prevents premature activation of the proteolytic enzymes within the secretory cells and in the ducts of the pancreas. Subsequently, inhibition of trypsin activity also prevents activation of the other proteases.

[0005] Pancreatitis is a serious medical condition involving an inflammation of the pancreas and can occur when an excess amount of trypsin saturates the supply of trypsin inhibitor. Trypsin accumulation in the pancreatic acinar cells can be caused by underproduction of trypsin inhibitor, or the overabundance of trypsin production. In acute or chronic pancreatitis, this precipitates into inflammation which manifests itself in the release and activation of pancreatic enzymes within the organ, thus leading to initiation of pancreatic autodigestion. In many cases of acute pancreatitis, the condition can lead to death. Genetic factors, gallstones, and alcohol abuse are among the major factors that have been associated with the development of pancreatitis. The current paradigm is that pancreatitis is initiated by acinar cell injury, leading to parenchymal necrosis and inflammation, which are the main pathologic features of the disease. It is understood and extensively documented, both scientifically as well as clinically, that chronic pancreatitis (CP) results from repetitive bouts of acute pancreatitis (AP), or can develop without prior AP.

[0006] AP is a leading cause for gastrointestinal-related complications in humans, the primary etiologic factor being development of gallstones. Although AP is most commonly mild to moderate in severity, the fatality rate is significantly high (approximately, 1 out of 3) in patients owing to persistent multi-organ dysfunction. Additionally, several studies have demonstrated that patients with hereditary pancreatitis carry mutations in genes encoding for digestive enzymes. However, these patients have been reported to develop recurrent attacks and falls in a high risk group of developing CP rather than severe AP.

[0007] As mentioned earlier, AP is believed to be initiated from the damaged pancreatic acinar cells. Digestive enzymes are synthesized, stored and exported from the pancreatic acinar cells upon appropriate stimulus. The synthesis of these enzymes begin in the endoplasmic reticulum and ends with the secretion of proteins which are temporarily stored in zymogen granules. ATP, produced by the mitochondria, is utilized by distinct pancreatic organelles to transport and modify these unprocessed proteins in a sequential manner through several vesicular compartments. As with several other cellular processes, the autophagy-lysosomal-endosomal pathways acts as a checkpoint to maintain acinar cell homeostasis by removing damaged / dysfunctional organelles and recycling cell constituents to be reutilized as source substrate and energy.

[0008] In an attempt to investigate and delineate the step-by-step initiation, progression and treatment of this disease, several non-invasive models of experimental acute pancreatitis have been developed. Among them, caerulein (a cholecystokinin-pancreozymin analogue) has been extensively used to successfully induce acute pancreatitis in mammals. Caerulein-induced acute pancreatitis model can be generated by intravenous, subcutaneous or intraperitoneal injection routes in experimental animals. Additionally, caerulein has been successfully used to understand the molecular pathogenesis of pancreatitis in various in vitro models. The structural changes of acinar cells observed in human acute pancreatitis exhibit significant similarities to caerulein-induced acute pancreatitis in mouse. In particular, specific changes to intracellular organelles in the acinar cells were similar in both human and caerulein-induced acute pancreatitis.

[0009] In addition to the caerulein-induced AP model, various compounds have been infused into the pancreatic duct to induce acute pancreatitis. Following duodenotomy, retrograde injection of bile salts into the pancreatic duct at the ampulla has been demonstrated to induce severe acute pancreatitis. The pressure or the concentration of bile salt used in this model is a critical determinant of the severity of the disease. Bile salt-induced acute severe pancreatitis develops within 2-24 h and is characterized by the development of oedema, necrosis of the pancreas and haemorrhage. One of the best standardized compounds used to develop acute pancreatitis is sodium taurocholate. Infusion of 1-5% solution induces acute haemorrhagic pancreatitis with significant mortality rates within a 72 hour period. This model is appropriate for studies of systemic issues underlying pancreatitis.

[0010] Despite extensive research (experimental and clinical) and significant progress has been made to unraveled the disease pathophysiology associated with pancreatitis, along with some potentially promising therapeutic approaches, no drugs have been approved by the Food and Drug Administration for treatment of AP or CP, and morbidity remains high, thus underlining the unmet need to identify potential therapeutic targets for drug targeting.

[0011] The nuclear receptor (NR) superfamily represents a large group of ligand dependent transcription factors. The nuclear receptor family is uniquely differently from other classes of receptors in their ability to directly interact with and control the expression of genomic DNA. As a consequence, nuclear receptors play key roles in both embryonic development and adult metabolic homeostasis. The estrogen-related receptors (ERRs) were the first orphan members of the superfamily of nuclear receptors to be identified, and the subfamily is now known to contain three related isoforms, ERRα (also known as NR3B1, Esrra, ERRa), β (also known as NR3B2, Esrr, ERRb), and γ (also known as NR3B3, Esrrg, ERRg). Although named after the estrogen receptors due to their structural homology, the ERRs are not activated by estrogens (ligand for estrogen receptors) or any known natural compounds. ERRs play an important role in the transcriptional control of metabolic genes involved in the generation and utilization of cellular energy and thus plays a critical role in key facets of organ development as well as cellular homeostasis. ERRs are primarily expressed in the heart, skeletal muscle, brain, kidney, pancreas, placenta, and liver and are predicted to have significant differences in their synthetic ligand binding preferences.

[0012] Recent findings in various mammalian experimental models show that ERRg, as a downstream mediator of multiple extracellular signals, plays a key role in coordinating endocrine and metabolic signals, resulting in changes in glucose, alcohol, lipid, and iron metabolism. Therefore, dysregulation of ERRg contributes to the pathogenesis of metabolic diseases such as hyperglycemia, insulin resistance, and alcoholic liver injury. Interestingly, ERRg has been shown to be involved in the pathogenesis of bacterial infection. These findings indicate the importance of ERRg in the endocrine and metabolic control of metabolism, and suggest that ERRg may be a promising therapeutic target for several diseases.

[0013] US Application Nos. 16 / 313,360 (US Application Publication No. 2019 / 0167820 A1) and 16 / 677,596 (Application Publication No. 20200078476 A1) disclose novel aryl ethane derivatives as estrogen-related receptor gamma (ERRg) inhibitors. WO2016138472 discloses the treatment of pancreatitis using Calcium signalling inhibitors.

[0014] The disclosure is based on the new finding that certain compounds with ERRg inhibiting activity may be useful in the treatment of pancreatitis and acute inflammation conditions.SUMMARY

[0015] The invention is defined by the appended claims.

[0016] According to one embodiment, the compounds defined in claim 1 are selected from the following compounds:

[0017] These compounds are referred to herein as the compound(s) of Chemical Formula 1.

[0018] In one aspect, the pancreatitis is acute pancreatitis. In other aspect, the pancreatitis is chronic pancreatitis. In other embodiments, the pancreatitis may be hemorrhagic pancreatitis, necrotizing pancreatitis, or hemorrhagic-necrotizing pancreatitis.

[0019] In still another aspect, the subject is a mammal, in particular human.BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific have embodiments presented herein.

[0021] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.FIGS. 1A and 1B show differential regulation of ERRa and ERRg in mouse pancreas by Caerulein. FIG. 1A shows ERRa or ERRg mRNA expression levels from indicated mouse pancreas (n=4 per group) 16 hr after Caerulein challenge (50ug / kg i.p., hourly injection, 6x), determined by real-time quantitative PCR (RT-qPCR) upon and expressed as fold change compared to the levels of expression in mice treated with saline (n=3). FIG. 1B shows the results of immunoblotting of pancreas tissue extracts, wherein the pancreas tissue extracts were subjected to SDS-PAGE and immunoblotted by anti-ERRa or anti-ERRg antibodies.

[0022] FIGS. 2A and 2B shows enhancement of serum amylase and lipase secretion in mice by Caerulein. Amylase level (FIG. 2A) or Lipase level (FIG. 2B) were measured in mice serum challenged with Caerulein or saline.

[0023] FIG. 3 shows a differential effect of ERRg inverse agonists on Caerulein-induced ERRg protein level in pancreatic acinar cells. Pancreatic acinar cells were isolated from mouse and stimulated with Caerulein (10 nM) for 16 hr in the absence or presence of indicated molecules. Protein extracts from these cells were subjected to SDS-PAGE and immunoblotted by anti-ERRg antibody.

[0024] FIGS. 4A, 4B, 4C, and 4D show the activity of DMRC200434 molecule that rescues mice from Caerulein-induced acute pancreatitis. Mice were intraperitoneally injected with Caerulein in the absence or presence of compound DMRC200434 (20 mg / kg). Serum amylase (FIG. 4A), lipase levels (FIG. 4B) of these treated mice were indicated. Trypsin activity (FIG. 4C) in the pancreatic tissues of these treated mice were indicated. Hematoxylin-Eosin staining (FIG. 4D) was performed in the tissue sections of these treated mice as indicated.

[0025] FIGS. 5A, 5B, and 5C show the activity of compound DMRC200434 molecule that rescues mice from Sodium Taurocholate-induced acute pancreatitis. Mice were intraperitoneally injected with Sodium taurocholate in the absence or presence of compound DMRC200434 (20 mg / kg). Serum amylase (FIG. 5A) and lipase levels (FIG. 5B) of these treated mice were indicated. Hematoxylin-Eosin staining (FIG. 5C) was performed in the tissue sections of these treated mice as indicated.DETAILED DESCRIPTION OF EMBODIMENTS

[0026] In an embodiment, the compound of Chemical Formula 1 can be any of the following compounds: Compound 18a (=DMRC200434) (E)-5-(4-hydroxyphenyl)-5-(4-(4-isopropylpiperazin-1-yl)phenyl)-4-phenylpent-4-en-1-ol Compound 18k (=DMRC2001000) (E)-5-(5-hydroxyphenyl)-5-(4-(4-isopropylpiperazin-1-yl)phenyl)-4-phenylpent-4-en-1-ol Compound 22i (DMRC200699) (E)-5-(4-hydroxyphenyl)-5-(4-(N-cyclopropylpiperidin-4-yl)phenyl)-4-phenylpent-4-en-1-ol Compound 22r (DMRC200996) (E)-5-(5-hydroxyphenyl)-5-(4-(N-cyclopropylpiperidin-4-yl)phenyl)-4-phenylpent-4-en-1-ol

[0027] The pharmaceutical composition comprises a compound as described above, or a pharmaceutically acceptable salt thereof, or a solvate thereof, as an active ingredient. The pharmaceutical composition may include a pharmaceutically acceptable carrier, excipient, or additive, known in the art.Methods of Use

[0028] The references to methods or uses for treating pancreatitis are to be interpreted as references to pharmaceutical compositions for use in those methods.

[0029] In general, the disclosure relates to methods or uses for treating pancreatitis, in particular acute pancreatitis, which comprises administering aryl ethene compounds of Chemical Formula 1 or a pharmaceutically acceptable salt, or a pharmaceutical composition thereof.

[0030] The methods of treatment according to an embodiment comprise administering a therapeutically effective amount of a compound of Chemical Formula 1, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, to a patient in need thereof. Individual embodiments include methods of treating pancreatitis by administering a therapeutically effective amount of a compound of Chemical Formula 1, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, to a patient in need thereof.

[0031] As used herein, "pancreatitis" may include a chronic pancreatitis or acute pancreatitis. The term "acute pancreatitis" as used herein may include severe acute pancreatitis that may be associated with organ failure and / or local complications such as necrosis, abscess, or pseudocyst as well as mild acute pancreatitis that may be associated with minimal organ dysfunction and an uneventful recovery and lacks the features of severe acute pancreatitis..

[0032] As used herein, "treat" or "treatment" in reference to a disorder means: (1) to ameliorate the disorder or one or more of the biological manifestations of the disorder, (2) to interfere with (a): one or more points in the biological cascade that leads to or is responsible for the disorder, or (b): one or more of the biological manifestations of the disorder, (3) to alleviate one or more of the symptoms or effects associated with the disorder, or (4) to slow the progression of the disorder or one or more of the biological manifestations of the disorder.

[0033] The term "treatment" of a disorder may include prevention or prophylaxis of the disorder. The term "prevention" refers to a prophylactic administration of a drug to substantially diminish the likelihood or severity of a disorder or biological manifestation thereof, or to delay the onset of such disorder or biological manifestation thereof.

[0034] The term "effective amount" as used herein in reference to a compound of Chemical Formula 1, or a pharmaceutically acceptable salt thereof, or other pharmaceutically active agent means an amount of the compound sufficient to treat the patient's condition within the scope of sound medical judgment. An effective amount of a compound will vary with the particular compound chosen (for example, the potency, efficacy, and half-life of the compound will be considered); the route of administration chosen; the disorder being treated; the severity of the disorder being treated; the age, size, weight, and physical condition of the patient being treated; the medical history of the patient to be treated; the duration of the treatment; the nature of concurrent therapy; the desired therapeutic effect; and like factors, but can nevertheless be routinely determined by the skilled artisan.

[0035] The term "patient" or "subject" as used herein refers to a human or other mammal. In one embodiment, "patient" refers to a human.

[0036] An embodiment of the disclosure further provides a method for the treatment of pancreatitis, which method comprises administering to a patient in need thereof an effective amount of a compound of Chemical Formula 1, a pharmaceutically acceptable salt thereof, or a solvate thereof. In an embodiment, the pancreatitis is acute pancreatitis. In an embodiment, the pancreatitis is chronic pancreatitis. In other embodiments, the pancreatitis may be hemorrhagic pancreatitis, necrotizing pancreatitis, or hemorrhagic-necrotizing pancreatitis.

[0037] In one embodiment there is provided a method for the treatment of pancreatitis, which method comprises administering to a patient in need thereof a therapeutically effective amount of a compound of Chemical Formula 1, a pharmaceutically acceptable salt thereof, or a solvate thereof. The pancreatitis may be acute pancreatitis, chronic pancreatitis, hemorrhagic pancreatitis, necrotizing pancreatitis, or hemorrhagic-necrotizing pancreatitis.

[0038] In one embodiment there is provided a method for the treatment of pancreatitis, which method comprises administering to a patient in need thereof a therapeutically effective amount of (E)-5-(4-hydroxyphenyl)-5-(4-(4-isopropylpiperazin-1-yl)phenyl)-4-phenylpent-4-en-1-ol (Compound DMRC200344 or 18a) or a pharmaceutically acceptable salt thereof or a solvate thereof. The pancreatitis may be acute pancreatitis, chronic pancreatitis, hemorrhagic pancreatitis, necrotizing pancreatitis, or hemorrhagic-necrotizing pancreatitis.

[0039] In another embodiment there is provided a method for the treatment of pancreatitis, which method comprises administering to a patient in need thereof a therapeutically effective amount of (E)-5-(5-hydroxyphenyl)-5-(4-(4-isopropylpiperazin-1-yl)phenyl)-4-phenylpent-4-en-1-ol (Compound DMRC2001000 or 18k), a pharmaceutically acceptable salt thereof, or a solvate thereof. The pancreatitis may be acute pancreatitis, chronic pancreatitis, hemorrhagic pancreatitis, necrotizing pancreatitis, or hemorrhagic-necrotizing pancreatitis.

[0040] In another embodiment there is provided a method for the treatment of pancreatitis, which method comprises administering to a patient in need thereof a therapeutically effective amount of (E)-5-(4-hydroxyphenyl)-5-(4-(N-cyclopropylpiperidin-4-yl)phenyl)-4-phenylpent-4-en-1-ol (Compound DMRC200699 or 22i), a pharmaceutically acceptable salt thereof, or a solvate thereof. The pancreatitis may be acute pancreatitis, chronic pancreatitis, hemorrhagic pancreatitis, necrotizing pancreatitis, or hemorrhagic-necrotizing pancreatitis.

[0041] In another embodiment there is provided a method for the treatment of pancreatitis, which method comprises administering to a patient in need thereof a therapeutically effective amount of (E)-5-(5-hydroxyphenyl)-5-(4-(N-cyclopropylpiperidin-4-yl)phenyl)-4-phenylpent-4-en-1-ol (Compound DMRC200699 or 22r), a pharmaceutically acceptable salt thereof, or a solvate. The pancreatitis may be acute pancreatitis, chronic pancreatitis, hemorrhagic pancreatitis, necrotizing pancreatitis, or hemorrhagic-necrotizing pancreatitis.

[0042] In one embodiment there is provided a compound of Chemical Formula 1, a pharmaceutically acceptable salt thereof, or a solvate thereof for use in the treatment of acute pancreatitis.

[0043] In some embodiments, the present disclosure relates to a method for treating one or more symptoms of pancreatitis in patients by administering a therapeutically effective amount of a compound of chemical formula 1 to treat one or more symptoms of pancreatitis. The symptoms of pancreatitis may be abdominal pain, back pain, swollen abdomen, nausea, vomiting, fever, rapid pulse, or a combination of two or more thereof.

[0044] In an aspect, the compound of chemical formula 1 can be administered at a dose ranging from about 0.01 mg / kg to about 1,000 mg / kg, about 0.01 mg / kg to about 500 mg / kg, about 0.01 mg to about 100 mg / kg, about 0.05 mg / kg to 500 mg / kg, about 0.05 mg / kg to 100 mg / kg, about 0.01 mg / kg to about 200 mg / kg, about 0.01 mg / kg to 100 mg / kg, about 0.1 mg / kg to 500 mg / kg, about 0.1 mg / kg to 200 mg / kg, about 0.1 mg / kg to about 100 mg / kg, about 0.1 mg / kg to about 50 mg / kg, or about 0.1 mg / kg to about 10 mg / kg.Compositions

[0045] The pharmaceutical composition, which may be prepared by admixture, suitably at ambient temperature and atmospheric pressure, is usually adapted for oral, parenteral or rectal administration and, as such, may be in the form of tablets, capsules, oral liquid preparations, powders, granules, lozenges, reconstitutable powders, injectable or infusible solutions or suspensions or suppositories.

[0046] Suitable pharmaceutically acceptable excipient or carrier will vary depending upon the particular dosage form chosen. In addition, suitable pharmaceutically acceptable excipient or carrier may be chosen for a particular function that they may serve in the composition. For example, certain pharmaceutically acceptable excipient or carrier may be chosen for their ability to facilitate the production of uniform dosage forms. Certain pharmaceutically acceptable excipient or carrier may be chosen for their ability to facilitate the production of stable dosage forms. Certain pharmaceutically acceptable excipient or carrier may be chosen for their ability to facilitate the carrying or transporting of the compound or compounds of formula 1 or pharmaceutically acceptable salts thereof once administered to the patient from one organ, or portion of the body, to another organ, or portion of the body. Certain pharmaceutically acceptable excipient or carrier may be chosen for their ability to enhance patient compliance.

[0047] Suitable pharmaceutically acceptable excipient or carrier includes the following types of excipients or carriers: diluents, fillers, binders, disintegrants, lubricants, glidants, granulating agents, coating agents, wetting agents, solvents, co-solvents, suspending agents, emulsifiers, sweetners, flavouring agents, flavour-masking agents, colouring agents, anti-caking agents, humectants, chelating agents, plasticisers, viscosity increasing agents, antioxidants, preservatives, stabilisers, surfactants, and buffering agents. The skilled artisan will appreciate that certain pharmaceutically acceptable excipients may serve more than one function and may serve alternative functions depending on how much of the excipient is present in the formulation and what other excipients are present in the formulation.

[0048] Skilled artisans possess the knowledge and skill in the art to enable them to select suitable pharmaceutically acceptable excipient or carrier in appropriate amounts.

[0049] The pharmaceutical composition according to an embodiment is prepared using techniques and methods known to those skilled in the art.

[0050] The pharmaceutical composition according to an embodiment, which may be prepared by admixture, suitably at ambient temperature and atmospheric pressure, is usually adapted for oral, parenteral or rectal administration and, as such, may be in the form of tablets, capsules, oral liquid preparations, powders, granules, lozenges, reconstitutable powders, injectable or infusible solutions or suspensions or suppositories.

[0051] The pharmaceutical composition may contain from 0.1% to 99% by weight, of the active material, depending on the method of administration. The dose of the compound used in the treatment of the aforementioned conditions or disorders will vary in the usual way with the seriousness of the conditions or disorders, the weight of the subject, and other similar factors. However, as a general guide suitable unit doses may be 0.05 to 5000 mg, 1.0 to 500 mg or 1.0 to 200 mg and such unit doses may be administered more than once a day, for example two or three times a day. Such therapy may extend for a number of weeks, months or years.

[0052] In one embodiment, the pharmaceutical composition is formulated into injectable or infusible solutions, or reconstitutable powders.

[0053] In one embodiment, the pharmaceutical composition is adapted for oral formulation.

[0054] Tablets and capsules for oral administration may be in unit dose form, and may contain conventional excipients, such as binding agents (e.g. pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g. lactose, microcrystalline cellulose or calcium hydrogen phosphate); tabletting lubricants (e.g. magnesium stearate, talc or silica); disintegrants (e.g. potato starch or sodium starch glycollate); and acceptable wetting agents (e.g. sodium lauryl sulphate). The tablets may be coated according to methods well known in normal pharmaceutical practice.

[0055] Oral liquid preparations may be in the form of, for example, aqueous or oily suspension, solutions, emulsions, syrups or elixirs, or may be in the form of a dry product for reconstitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents (e.g. sorbitol syrup, cellulose derivatives or hydrogenated edible fats), emulsifying agents (e.g. lecithin or acacia), non-aqueous vehicles (which may include edible oils e.g. almond oil, oily esters, ethyl alcohol or fractionated vegetable oils), preservatives (e.g. methyl or propyl-p-hydroxybenzoates or sorbic acid), and, if desired, conventional flavorings or colorants, buffer salts and sweetening agents as appropriate. Preparations for oral administration may be suitably formulated to give controlled release of the active compound.

[0056] For parenteral administration, fluid unit dosage forms are prepared utilizing a compound of the invention or pharmaceutically acceptable salt thereof and a sterile vehicle. Formulations for injection may be presented in unit dosage form e.g. in ampoules or in multi-dose, utilizing a compound of the invention or pharmaceutically acceptable salt thereof and a sterile vehicle, optionally with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g. sterile pyrogen-free water, before use. The compound, depending on the vehicle and concentration used, can be either suspended or dissolved in the vehicle. In preparing solutions, the compound can be dissolved for injection and filter sterilized before filling into a suitable vial or ampoule and sealing. Advantageously, adjuvants such as a local anaesthetic, preservatives and buffering agents are dissolved in the vehicle. To enhance the stability, the composition can be frozen after filling into the vial and the water removed under vacuum. Parenteral suspensions are prepared in substantially the same manner, except that the compound is suspended in the vehicle instead of being dissolved, and sterilization cannot be accomplished by filtration. The compound can be sterilized by exposure to ethylene oxide before suspension in a sterile vehicle. Advantageously, a surfactant or wetting agent is included in the composition to facilitate uniform distribution of the compound.

[0057] Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or coloring agents. Drops may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, stabilizing agents, solubilizing agents or suspending agents. They may also contain a preservative.

[0058] The pharmaceutical composition may also be formulated in rectal compositions such as suppositories or retention enemas, e.g. containing conventional suppository bases such as cocoa butter or other glycerides.

[0059] The pharmaceutical composition may also be formulated as depot preparations. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds of the invention may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

[0060] For intranasal administration, the compounds of formula (I) may be formulated as solutions for administration via a suitable metered or unitary dose device or alternatively as a powder mix with a suitable carrier for administration using a suitable delivery device. Thus compounds of formula (I) may be formulated for oral, buccal, parenteral, topical (including ophthalmic and nasal), depot or rectal administration or in a form suitable for administration by inhalation or insufflation (either through the mouth or nose).

[0061] The pharmaceutical composition may be formulated for topical administration in the form of ointments, creams, gels, lotions, pessaries, aerosols or drops (e.g. eye, ear or nose drops). Ointments and creams may, for example, be formulated with an aqueous or oily base with the addition of suitable thickening and / or gelling agents. Ointments for administration to the eye may be manufactured in a sterile manner using sterilized components.

[0062] An aspect of the disclosure provides for a pharmaceutical composition for use in the treatment of pancreatitis which comprises a compound of formula 1, a pharmaceutically acceptable salt thereof, or a solvate thereof, and one or more pharmaceutically acceptable excipient or carrier. In an embodiment, the pancreatitis is acute pancreatitis. In one embodiment, the pancreatitis is chronic pancreatitis. In other embodiments, the pancreatitis may be hemorrhagic pancreatitis, necrotizing pancreatitis, or hemorrhagic-necrotizing pancreatitis.Reference Preparation Example

[0063] The compound of chemical formula 1 can be prepared by following the procedure described in US Application No. 16 / 313,360.Reference Preparation Example 1: Preparation of (E)-5-(4-(2-(aziridin-1-yl)ethoxy)phenyl)-5-(4-bromophenyl)-4-phenylpent-4-en-1-ol hydrochloride salt (Compound 18t)

[0064] By employing the following reaction scheme, compound 18t was prepared: Step 1: Preparation of methyl 5-(4-(pivaloyloxy)phenyl)pent-4-ynoate (C-1)

[0065] 4-lodophenyl pivalate (2 g, 6.6 mmol), copper (I) chloride (0.13 g, 0.66 mmol), bis(triphenylphosphine)palladium (II) dichloride (PdCl 2 (PPh 3 ) 2 , 0.23 g, 0.33 mmol), and methyl pent-4-ynoate (0.74 g, 0.66 mmol) were dissolved in trimethylamine (15 mL), and the reaction was carried out at 50° C. for 12 hours. The reaction solution was concentrated under reduced pressure, and 1.1 g of the desired compound C-1 (58%) was obtained using column chromatography.Step 2: Preparation of (E)-tert-butyl 3-(4-(5-methoxy-5-oxo-2-phenyl-1-(4-(pivaloyloxy)phenyl)pent-1-en-1-yl)phenyl)azetidin-1-carboxylate (C-2)

[0066] tert-Butyl 3-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaboran-2-yl)phenyl)azetidin-1-carboxylate (0.27 g, 0.75 mmol), compound C-1 (0.14 g, 0.5 mmol), and iodobenzene (84 µL, 0.75 mmol) were dissolved in DMF (8 mL) and water (4 mL), 0.025 M PdCl 2 (PhCN) 2 (0.2 mL, 5 µmol) was added thereto, and heating was performed at 45° C. for 10 minutes. Cesium carbonate (0.24 g, 0.75 mmol) was added thereto, and heating was performed at 45° C. for 12 hours. When the reaction was completed, brine and ethyl acetate was further added to the reaction solution, and an organic layer was extracted. The organic layer was dried with anhydrous Na 2 SO 4 and filtered. The solvent was distilled under reduced pressure to obtain a residue, which was purified using column chromatography, thereby obtaining 81 mg of the desired compound C-2 (27%).Step 3: Preparation of tert-butyl (E)-3-(4-(5-hydroxy-1-(4-hydroxyphenyl)-2-phenylpent-1-en-1-yl)phenyl)azetidine-1-carboxylate (18t)

[0067] Compound C-2 (0.021 mmol) was added to tetrahydrofuran (2 mL), the temperature was lowered to 0 °C., and 1 M lithium aluminum hydride, diisobutylaluminum hydride, or lithium borohydride (0.024 mL, 0.024 mmol) was added thereto. The temperature was raised to room temperature, and stirring was performed for 1 hour. Water and ethyl acetate were further added to the reaction solution and an organic layer was extracted. The organic layer was dried with anhydrous Na 2 SO 4 and filtered. The solvent was distilled under reduced pressure to obtain a residue, which was purified using column chromatography and then dissolved in methanol: dichloromethane (1:1), the temperature was lowered to 0°C., a 1M aqueous HCl solution was slowly added thereto, and distillation under reduced pressure was performed, thereby obtaining 24 mg of the desired compound 18t (78%).Reference Preparation Examples 2-3

[0068] Compounds 18a and 18t were prepared using the process of Reference Preparation Example 1. Identification data of the thus-prepared compounds 18a and 18t is shown in the following Table 1. Table 1 Exampl eCmpd No. RIdentification data118t 1< H-NMR (CD 3 OD, 400MHz) δ 7.18-7.10 (m, 5H), 7.05 (d, J = 8.4 Hz, 2H), 6.98 (d, J = 8.2 Hz, 2H), 6.88 (d, J = 8.2 Hz, 2H), 6.79 (d, J = 8.4 Hz, 2H), 4.25 (t, J = 8.4 Hz, 2H), 3.81 (t, J = 6.6 Hz, 2H), 3.66 (m, 1H), 3.43 (t, J = 6.8 Hz, 2H), 2.55 (m, 2H), 1.57 (m, 2H), 1.45 (5, 9H). MS (ESI) m / z: 386 [M+H] +< .218a 1< H-NMR(CD 3 OD, 400MHz) δ 7.14-7.07 (m, 5H), 7.02 (d, J = 8.0 Hz, 2H), 6.78 (m, 4H), 6.69 (d, J = 8.3 Hz, 2H), 3.76 (m, 2H), 3.52 (m, 3H), 3.41 (t, J = 6.4 Hz, 2H), 3.23 (m, 2H), 2.96 (m, 2H), 2.51 (m, 2H), 1.53 (m, 2H), 1.39 (d, J = 6.5 Hz, 6H). MS (ESI) m / z: 457 [M+H] +< ,318k 1< H-NMR(CD 3 OD, 400MHz) δ 7.19-7.09 (m, 6H), 6.81 (d, J = 8.7 Hz, 2H), 6.69 (m, 4H), 6.63 (m, 1H), 3.76 (m, 2H), 3.53 (m, 3H), 3.40 (t, J = 5.6 Hz, 2H), 3.21 (m, 2H), 2.91 (m, 2H), 2.50 (m, 2H), 1.53 (m, 2H), 1.38 (d, J = 6.6 Hz, 6H). MS (ESD m / z: 457 [M+H] +< . Reference Preparation Example 4:Preparation of (E)-4-(5-hydroxy-1-(4-(1-isopropylazetidin-3-yl)phenyl)-2-phenylpent-1-en-1-yl)phenol (Compound 22a)

[0069] By employing the following reaction scheme, compound 22a was prepared: Step 1: Preparation of methyl (E)-5-(4-(1-isopropylazetidin-3-yl)phenyl)-4-phenyl-5-(4-(pivaloyloxy)phenyl)pent-4-enoate (E-2)

[0070] Compound E-1 (0.03 g, 0.06 mmol), acetone (0.14 mL, 1.9 mmol), and sodium triacetoxyborohydride (NaBH(OAc) 3 , 41 mg, 0.19 mmol) were added to dichloroethane (3 mL), and stirred at room temperature for 1 hour. Water and ethyl acetate were further added to the reaction solution and an organic layer was extracted. The organic layer was dried with anhydrous Na 2 SO 4 and filtered. The solvent was distilled under reduced pressure to obtain a residue, which was purified using column chromatography, thereby obtaining 18 mg of the desired compound E-2 (54%).Step 2: Preparation of (E)-4-(5-hydroxy-1-(4-(1-isopropylazetidin-3-yl)phenyl)-2-phenylpent-1-en-1-yl)phenol (22a)

[0071] 4 mg of the desired compound 22a (27%) was obtained by the same process as step 3 of Example 4, using compound E-2.Reference Preparation Examples 5-6

[0072] Compounds 22i and 22r e were prepared, using the process of Reference Preparation Example 4. Identification data of the thus-prepared compounds 22i and 22r is shown in the following Table 2. Table 3 Exampl eCmpd No. RIdentification data422a 1< H-NMR(CD 3 OD, 400MHz) δ 7.17-7.08 (m, 5H), 7.08-7.02 (m, 4H), 6.94 (d, J = 8.2 Hz, 2H), 6.78 (d, J = 8.5 Hz, 2H), 4.358 (t, J = 8.3 Hz, 2H), 4.21 (m, 1H), 4.10 (t, J = 9.8 Hz, 2H), 3.98 (m, 1H), 3.43 (t, J = 7.5 Hz, 2H), 2.55 (m, 2H), 1.56 (m, 2H), 1.24 (d, J = 6.4 Hz, 6H). MS (ESI) m / z: 428 [M+H] +< .522i 1H-NMR(CD3OD, 400MHz) δ 7.15-7.06 (m, 5H), 7.01 (d, J = 8.4 Hz, 2H), 6.90 (d, J = 8.2 Hz, 2H), 6.84 (d, J = 8.2 Hz, 2H), 6.75 (d, J = 8.5 Hz, 2H), 3.68 (m, 2H), 3.41 (t, J = 6.6 Hz, 2H), 3.24 (m, 2H), 2.79 (m, 2H), 2.52 (m, 2H), 2.02 (m, 2H), 1.78 (m, 2H), 1.54 (m, 2H), 0.97 (m, 4H). MS (ESI) m / z: 454 [M+H]+.622r 1< H-NMR(CD 3 OD, 400MHz) δ 7.21-7.10 (m, 7H), 6.90 (m, 4H), 6.72 (d, J = 7.9 Hz, 2H), 3.71 (m, 2H), 3.43 (t, J = 6.8 Hz, 2H), 3.27 (m. 2H), 2.80 (m, 2H), 2.52 (m, 2H), 2.01 (m, 2H), 1.79 (m, 2H), 1.52 (m, 2H), 0.98 (m, 4H), MS (ESI) m / z: 454 [M+H] +< .

[0073] Compounds 18a (DMRC200434), Compound 18k (DMRC2001000), Compound22i (DMRC200699), and Compound 22r (DMRC200996), which were used in the Biological Examples, have the following structure.

[0074] A reference compound GSK5182 has the following structure: Biological Example 1 (A) Materials and Methods

[0075] Materials: Caerulein (C9026) and Taurolithocholic acid 3-sulfate disodium salt (TLCS; T0512) was purchased from Sigma. Animal models: Eight to ten-week male C57BL / 6 mice (Jackson Lab) were used according to an animal protocol approved by the Institutional Animal Care and Use Committee of Kyungpook National University. 1. Caerulein-induced model of Pancreatitis

[0076] Acute pancreatitis (AP) was induced by intraperitoneal injections of caerulein at 50 µg / kg / h given 6 times. As an ERRg antagonist, Compound DMRC 200434 (20 mg / kg) was dissolved in a solution of 5% - DMSO: 95% - 20% PEG400(Saline) and was injected at two points - at 24 hours prior to, and at the start of the Caerulein treatment - and animals were sacrificed 16 hours after the last injection of Caerulein.2. Intraductal Bile Acid Infusion Model of Pancreatitis

[0077] Pancreatitis was induced by retrograde infusion of the bile acid TLCS (1%) dissolved in saline into the distal common bile duct and pancreatic duct. Mice were anesthetized with a ketamine (120 mg / kg) / xylazine (12 mg / kg) mixture (Butler Schein, Chicago, IL). A ventral incision was made to reveal the abdominal cavity. The duodenum was flipped to reveal its distal side and held in place by ligatures. The bile duct was identified, and a 30-gauge needle was inserted through the antimesenteric aspect of the duodenum to cannulate the biliopancreatic duct. TLCS was infused at 10 µl / min for 5 min using a P33 perfusion pump (Harvard Apparatus, Holliston, MA). The exterior wound was closed using 7-mm wound clips, and a single injection of buprenorphine (0.075 mg / kg) was given immediately after the surgery. Normal saline-infused animals served as shams. Animals were allowed to recover on a heating pad for 90 min after the procedure. Mice were euthanized 24 h after induction.

[0078] Upon completion of experiments with above-mentioned animal models (1) and (2), pancreas tissue were snap frozen in liquid nitrogen and stored at -80°C for analysis of trypsin activity, for protein analysis by Western blots and for gene expression analysis by RT-qPCR. Pancreas were dissected and fixed in 10% neutral-buffered formalin and embedded in paraffin. Five-µm sections were prepared and stained with hematoxylin and eosin (H&E). Pancreas injury was determined by measuring serum amylase (K711-100, Biovision), serum lipase (MAK046, Sigma) and pancreatic tissue trypsin activity (Biovision) was determined using commercially available kit.Mouse primary acinar cell culture and treatment.

[0079] Primary acinar cells were isolated from mice as described previously (Isolation and Culture of Mouse Primary Pancreatic Acinar Cells. Johann Gout, Roxane M. Pommier, David F. Vincent, Bastien Kaniewski, Sylvie Martel, Ulrich Valcourt, Laurent Bartholin. J Vis Exp. 2013 (78): 50514).Western Blotting.

[0080] Cells were lysed in cell lysis buffer (Cell Signaling Technology, 9803) supplemented with protease inhibitor (Thermo Fisher Scientific, A32953) and phosphatase inhibitor (PhosSTOP ™< , Sigma Aldrich, 04906837001). Proteins were separated on 4-20% MINI-PROTEAN ®< TGX Precast Protein Gels by SDS PAGE electrophoresis and transferred to onto PVDF membranes (IPVH00010, EMD Millipore). Membranes were blocked in 5% BSA (Blotting-Grade Blocker, BioRad, 1706404) dissolved in TBS-T for 1 h and incubated overnight at 4 °C with primary antibody for ERRA (PP-H5844-00, R&D Systems) and ERRG (PP-H6812-00, R&D Systems). Membranes were washed three times with TBS-T and incubated with secondary antibodies for 1 h at room temperature: anti-mouse IgG, HRP-linked (Cell Signaling Technology, 7076). Images were obtained by Chemiluminescence buffer ECL (GE Healthcare) using a CHEMIDOC ™< (GE Healthcare).Quantitative reverse-transcription PCR (RT-qPCR)

[0081] Total RNA was extracted using TRIZOL ®< (Thermo Fisher Scientific) and, and then reversed transcribed using RevertAid ™< First Strand cDNA Synthesis Kit (K1622Thermo Fisher Scientific) with oligo-dT primers. Quantitative PCR was performed with SYBR ®< Green Supermix (Bio-rad) on the ABI Prism 7300 sequence detection system (Applied Biosystems). The reaction conditions were as follows: pre-denaturation at 95 °C for 10 minutes and 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 60 s, and extending at 72 °C for 1 minutes. The quantity of mRNA was calculated using the ΔCt method and normalized by the 36b4 (also known as Rplp0) house-keeping gene. Sequences for qPCR primers are as follows: Esrra-forward: 5'- TACGGTGTGGCATCCTGTGA (SEQ ID NO: 1) Esrra-reverse: 5'- CTCCCCTGGATGGTCCTCTT (SEQ ID NO: 2) Esrrg-forward: 5'- GCCCAGCCACGAATGAAT (SEQ ID NO: 3) Esrrg-reverse: 5'- GCAGGCCTGGCAGGATTT (SEQ ID NO: 4) 36b4-forward: 5'- ACCTCCTTCTTCCAGGCTTT (SEQ ID NO: 5) 36b4-reverse: 5'- CTCCAGTCTTTATCAGCTGC (SEQ ID NO: 6) (B) Results: Upregulation of Esrrg in Caerulein-treated mouse pancreas.

[0082] In contrast to Esrra mRNA expression pattern, Esrrg mRNA expression was highly increased in the pancreas of caerulein-challenged mouse when compared to control treatment (Fig. 1A). Immunoblotting confirmed that ERRG protein was highly increased upon caerulein-challenge in mouse pancreas (Fig. 1B). To analyze and confirm the extent of pancreatic injury upon caerulein-challenge, the inventors analyzed serum amylase and lipase levels in these animals. The inventors found that Caerulein treatment led to a dramatic upregulation in the amylase (Fig. 2A) and lipase (Fig. 2B) levels in the serum samples of these mice. These results indicated that pancreatic injury induced by caerulein can preferentially upregulated ERRG when compared to ERRA.Reduction of Caerulein-induced ERRG protein level in mouse pancreatic acinar cells.

[0083] Next, the inventors analyzed the toxicity of these compounds in vivo (Table 3). Table 3 shows biochemical properties of Compounds 18a (DMRC200434), 18k (DMRC2001000), 22i (DMRC200699), and 22r (DMRC200996), and reference compound GSK5182.

[0084] To test the effectiveness of the compound of Chemical Formula 1 (DMRC200434, DMRC2001000, DMRC200699, and DMRC200996), and reference compound GSK5182 in vitro, the inventors isolated, harvested and cultured primary acinar cells from mouse and treated them with Caerulein for 16 hours in the absence or presence of these compounds (Fig. 3). Caerulein treatment led to marked increase in ERRG protein level in mouse primary acinar cells as demonstrated by immunoblotting. It was found the compound of Chemical Formula 1 which has ERRG antagonistic activity, showed activity. In particular Compound DMRC200434 showed strongest inhibitory effect on caerulein-induced ERRG protein level at a very low dose. This result indicated that DMRC200434 can be a potential candidate to inhibit ERRG during pancreatic injury.Preventive Effects on pancreatic injury-induced pancreatitis.

[0085] Next, the inventors analyzed the efficacy of the compound of Chemical Formula 1 in vivo using two different animal models of acute pancreatitis. Compound DMRC200434 was employed as compound of Chemical Formula 1. They pretreated mice with a single dose of DMRC200434, 24 hours prior to Caerulein challenge. An additional dose of DMRC200434 was administered to the animals at the beginning of Caerulein challenge. Upon completion of the experimental timeline, these animals were sacrificed and serum and pancreas tissue samples were collected and analyzed. The inventors found that when compared to Caerulein-challenge alone, mice treated with Caerulein in the presence of DMRC200434 showed a dramatic reduction in serum amylase (Fig. 4A), serum lipase (Fig. 4B) and tissue trypsin activity (Fig. 4C). The inventors further found that the pancreatic histopathology was dramatically improved in DMRC200434-treated mice, when compared to Caerulein-challenged mice alone (Fig. 4D). These results indicated that compound of Chemical Formula 1 (in particular DMRC200434) can protect against and ameliorate Caerulein-induced acute pancreatitis in vivo.

[0086] Additionally, the inventors assessed the efficacy of compound of Chemical Formula 1 using a different animal model of acute pancreatitis, viz., biliary pancreatitis which is a leading cause of acute pancreatitis in humans. The reflux of bile into the pancreatic duct is considered to be the cause of pancreatitis and this phenomenon was mimicked experimentally by challenging mice with TLCS. To that end, the inventors pretreated mice with a single dose of DMRC200434, 24 hours prior to TLCS challenge. An additional dose of DMRC200434 was administered to the animals at the beginning of TLCS challenge. Upon completion of the experimental timeline, these animals were sacrificed and serum and pancreas tissue samples were collected and analyzed. The inventors found that when compared to TLCS-challenge alone, mice treated with TLCS in the presence of DMRC200434 showed a dramatic reduction in serum amylase (Fig. 5A), serum lipase (Fig. 5B). The inventors further observed that the pancreatic histopathology was dramatically improved in DMRC200434-treated mice, when compared to TLCS-challenged mice alone (Fig. 5C).

[0087] These results indicated that compound of Chemical Formula 1, which shows an ERRg antagonistic activity can protect against TLCS-induced acute pancreatitis in vivo and ameliorate pancreatic pathology in this condition. In particular DMRC200434 showed strongest activity for preventing and / or treating pancreatitis.

Claims

1. A pharmaceutical composition for use in treating and / or preventing pancreatitis in a subject in need thereof or for use in treating one or more symptoms of pancreatitis in a subject suffering from pancreatitis, said pharmaceutical composition comprising, as an active ingredient, a compound selected from the following compounds: or a pharmaceutically acceptable salt thereof, or a solvate thereof.

2. The composition for the use of claim 1, wherein the compound is (E)-5-(4-hydroxyphenyl)-5-(4-(4-isopropylpiperazin-1-yl)phenyl)-4-phenylpent-4-en-1-ol of the following chemical formula: or a pharmaceutically acceptable salt, or a solvate thereof.

3. The composition for the use of claim 1 or claim 2, wherein the composition further comprises a pharmaceutically acceptable carrier, excipient or additive.

4. The composition for the use of any one of claims 1 to 3, wherein the pancreatitis is acute pancreatitis.

5. The composition for the use of any one of claims 1 to 3, wherein the pancreatitis is chronic pancreatitis.

6. The composition for the use of any one of claims 1 to 3, wherein the pancreatitis is hemorrhagic pancreatitis, necrotizing pancreatitis, or hemorrhagic-necrotizing pancreatitis.

7. The composition for the use of any one of claims 1 to 6, wherein the subject is a mammal.

8. The composition for the use of claim 7, wherein the mammal is human.