Mir-based assay for gastro-entero-pancreatic neuroendocrine tumor diagnosis and prognosis
Patent Information
- Application Number
- EP2023762426
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-08-30
- Filing Date
- 2023-08-29
- Publication Date
- 2025-07-09
AI Technical Summary
Current diagnostic and prognostic methods for gastro-entero-pancreatic neuroendocrine tumors (GEP-NETs), particularly pancreatic neuroendocrine tumors (P-NETs, face challenges due to heterogeneous SSTR2 expression, limited prognostic value of PET/CT scans, and the need for personalized treatment strategies, necessitating the development of novel biomarkers for improved patient stratification and treatment efficacy.
A novel miRNA signature comprising hsa-miR-5096, hsa-let-7i-3p, and hsa-miR-4311 is identified, which correlates with 18F-FDG-PET status, predicting progression-free survival, overall survival, and tumor aggressiveness, and can be used to assess SSTR2 expression levels, thereby aiding in the diagnosis, prognosis, and treatment response prediction of GEP-NETs.
The miRNA signature provides accurate diagnostic and prognostic information, enhances the prediction of treatment response, and offers a means to stratify patients for Peptide Radionuclide Receptor Therapy (PRRT), improving the management of GEP-NETs by offering a minimally invasive, real-time assessment of disease progression and treatment efficacy.
Smart Images

Figure 00000069_0000 
Figure 00000069_0001 
Figure 00000069_0002
Abstract
Description
[0001] MIR-BASED ASSAY FOR GASTRO-ENTERO-PANCREATIC NEUROENDOCRINE TUMOR DIAGNOSIS AND PROGNOSIS
[0002] FIELD OF THE INVENTION
[0003] The present invention refers to the field of diagnosis, prognosis and treatment of gastro-entero- pancreatic neuroendocrine tumors (GEP-NET).
[0004] In particular, it refers to the use of miRNAs for the diagnosis, prognosis and treatment of pancreatic NETs.
[0005] BACKGROUND
[0006] Gastro-entero-pancreatic neuroendocrine tumors (GEP-NETs) are rare and heterogeneous malignancies arising from the diffuse neuroendocrine system. NET disease exhibits variable aggressiveness depending on the site of origin, grade, stage, and functionality1. Pancreatic NETs (P- NETs) represent less than 5% of all pancreatic cancers, although incidence and prevalence are rising2. P-NETs include tumors with a wide spectrum of clinical behaviors, thus often indolent and diagnosed in advanced stage3
[0007] Nowadays, P-NETs can be diagnosed earlier and updated therapeutic algorithms and guidelines have been proposed4’5,6’7’8’9. Recent important updates in the 5th edition (2019) of the World Health Organization (WHO) identify a novel G3 P-NET molecular subset, which includes well differentiated (WD) tumors with high proliferative index (> 20%)10 11.
[0008] Despite novel classification helps the stratification of patients, improving prognosis and response to treatment12, substantial differences in clinical behavior still remain, making personalized treatment challenging for advanced P-NET6 13
[0009] Molecular imaging with positron emission tomography / computed tomography (PET / CT) holds a crucial role in P-NETs management. Updated European Neuroendocrine Society (ENETS) consensus on Radiological, Nuclear Medicine & Hybrid Imaging recommended68Ga-DOTA- somatostatin analog-PET / CT for tumor staging, preoperative imaging, and re-staging. PET with68Ga-DOTA peptides reveals tissues over-expressing somatostatin receptors (SSTRs). SSTR2 is expressed in 50% to 100% of P-NETS14.
[0010] Although the sensitivity and specificity of SSTR2-specific68Ga-DOTATATE PET / CT imaging has been proven, its clinical utility is hampered by heterogeneous SSTR2 expression among patients. Patients with low SSTR2 expression are not eligible for SSTR2-based imaging or therapies15 16In addition, poorly differentiated NET, can no longer concentrate somatostatin analogs, likely because of SSTRs expression loss. Therefore, the capability to restore high levels of functional SSTR2 in NET patients would improve imaging, the assessment of tumor burden and the efficacy of SSTR2- targeting therapies.
[0011] In this context, high SSTR expression can be considered a crude predictor of response to treatment, making patients eligible for Peptide Receptor Radionuclide Therapy (PRRT), notwithstanding PET / CT scan with68Ga-DOTA peptides alone does not represent a prognostic parameter in terms of progression-free survival (PFS)17.
[0012] On the other hand,18F-FDG-PET / CT functional imaging is recommended for G3 and high G2 NETs, which generally display higher glucose metabolism and aggressiveness. This kind of lesion lacks SSTR2 overexpression and may fail to be detected by68Ga-DOTA-somatostatin analog- PET / CT17. Besides the diagnostic purpose of18F-FDG-PET / CT in revealing lesions with higher metabolism, its prognostic value for NETs, especially for P-NETs has been established18 19.18F- FDG positive lesions at PET / CT scan are associated with worse prognosis, aggressive tumor behavior and resistance to PRRT20. From this perspective, high glucose consumption seems associated with lower radiosensitivity. This could be related to the triggering of proliferative pathways and / or molecular alterations that could drive the tumor resistance to PRRT or relapse. Although PRRT extends PFS, about 15-30% of patients progress during treatment or six months to one year after PRRT21 23. Future optimization of PRRT will depend on improved pretreatment stratification and patient selection based on solid indicators of response24.
[0013] In view of the above, it is evident that there is an urgent unmet clinical need for novel prognostic and predictive biomarkers which can supplement grade, stage, and imaging to address more tailored treatments for P-NET patients, especially for the advanced stage ones3,25.
[0014] Blood biomarkers are simple to assess, minimally invasive, can be used for real-time and longitudinal measurements and are reproducible, quantitative and objective. Moreover, liquid markers overcome limitations of tissue specific information, providing a real-time snapshot of the whole disease. MiRNAs are useful markers to diagnose and monitor disease progression since they are stable, mostly encapsulated in exosomes and retrievable from body fluids.
[0015] The National Institute of Health (NIH) has established three broad categories of biomarkers based on clinical utility26. This includes type 0 markers, ‘indicators of the natural history of disease’, which correlate with diagnosis, prognosis, and outcome: both directly and indirectly. Type I ‘captures the effects of an intervention according to the specific mechanism of action of the drug’ and reflects the general efficacy of treatment through a defined mechanism of action. Type II markers are defined as surrogates for clinical endpoints, reflecting patient health, functionality, or survival.
[0016] A commercially available assay is the NETest that, up to now, represents the gold standard for NETs diagnosis. The NETest assay relies on the simultaneous detection of dozens of mRNA transcripts (n.53) in blood which can provide predictive information, such as clinical outcome, by means of highly complicated algorithms. Its principal clinical utility is to monitor disease progression and help prognostication27. More recently, the NETest was combined with grade and used as a PRRT predictive quotient (PPQ) to predict efficacy of PRRT treatment in NETs28,29. However, up to now, NETest outcome data are managed, analysed and interpreted by a single laboratory only worldwide.
[0017] No studies reported the relation of NETest with 18FDG-PET / CT, which represent a prognostic biomarker, especially for pancreatic disease. There are no commercial kits able to identify the 18FDG-PET / CT status in PanNET patients. Despite NETest has been reported to display high overall diagnostic accuracy in determining the either presence (rule-in) or absence (rule-out) of a disease (candidate "Type 0 " biomarker), few information is provided on its role in distinguishing NET from different sites of origin. It is well established that for certain NET diseases the primary tumor site of origin is unknown or difficult to determine, in addition PanNETs and SINETs display different prognosis and may benefits of differentiated treatments.
[0018] It has now been found a novel, liquid miRNA signature with diagnostic, prognostic and predictive features for the management of gastro-entero-pancreatic neuroendocrine tumors, in particular of pancreatic neuroendocrine tumors. In particular, said miRNA signature is a new accurate biomarker for functional imaging, metabolism and survival.
[0019] SUMMARY OF THE INVENTION
[0020] It has now been found that miRNAs hsa-miR-5096, hsa-let-7i-3p and hsa-miR-4311 have a robust correlation with 18F-FDG-PET status in P-NET patients (p <0 005). In particular, hsa-miR-5096 was found to: i) predict 6-month Progression Free Survival (6mo-PFS), and 12-month overall survival (12mo-OS) for patients treated with PRRT (p<0 001 and p<0 05, respectively); ii) identify 18F-FDG-PET positive P-NET patients with worse prognosis after PRRT (p<0 005); iii) anticorrelate with SSTR2 expression on P-NET tissue and with the maximum standardized uptake (SUVmax) of 68Ga-PET (p<0 05) and with SSTRs expression; iv) decrease SSTR2 levels when ectopically expressed in P-NET cells (p<0 01). Said miRNAs can therefore be advantageously used as biomarkers in a variety of diagnostic and prognostic applications regarding GEP-NET tumors which have been found to correlate to the expression levels of such miRNAs in the blood of a subject.
[0021] Advantageously, the miRNAs-signature of the invention can be easily assessed in potentially every hospital / laboratory equipped with basic instruments for molecular diagnosis (e.g. RT-PCR) that measure their relative abundance or use a more standardized solution, such as kit / assay / tool. The identification of said miRNAs as therapeutic targets also constitutes an independent track for products or for the design of novel therapeutic strategies. Therapies based on hsa-miR-5096-5p inhibition can indeed sensitize the tumor to SSTR-2 targeted therapies (i.e. PRRT).
[0022] It is an object of the invention the use of hsa-miR-5096, hsa-let-7i-3p and / or hsa-miR-4311 as biomarkers for diagnosing a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) in a subject and / or determining aggressiveness of a GEP-NET in a subject diagnosed with GEP-NET and / or predicting overall survival of a subject with a GEP-NET and / or predicting response to therapy in a subject with a GEP-NET.
[0023] In particular, it is an object of the invention the use of hsa-miR-5096, hsa-let-7i-3p and / or hsa-miR- 4311 as biomarkers for: determining the presence of a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET), in particular of a pancreatic neuroendocrine tumor (P-NET) or of a Small Intestine neuroendocrine tumor (SI-NET); diagnosing an ileal primary site of origin in a subject affected by Small Intestine NET (SI- NET); determining the presence of 18F-FDG-PET positive lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET);
[0024] - predicting 6-month progression-free survival (PFS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) who is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT);
[0025] - predicting 12-month overall survival (OS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) who is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT); - predicting 6 month progression-free survival (PFS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) who is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT) and is positive to18F-FDG-PET;
[0026] - predicting the presence of highly proliferating P-NET lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET);
[0027] - grading a pancreatic neuroendocrine tumor (P-NET);
[0028] - predicting tumor burden in a subject affected by a pancreatic neuroendocrine tumor (P- NET);
[0029] - predicting response to Peptide Radionuclide Receptor Therapy (PRRT) in a subject affected by a pancreatic neuroendocrine tumor (P-NET).
[0030] It is an object of the invention an in vitro method of diagnosing a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) in a subject and / or determining aggressiveness of a GEP-NET in a subject diagnosed with GEP-NET and / or predicting overall survival of a subject with a GEP-NET wherein the method comprises the step of determining the expression level of one or more miRNAs in a biological sample comprising blood previously obtained from said subject, wherein the miRNAs are selected from: hsa-miR-5096, hsa-let-7i-3p and hsa-miR-4311.
[0031] In particular, it is an object of the invention an in vitro method for: determining the presence of a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) in a subject, in particular of a pancreatic neuroendocrine tumor (P-NET) or a Small Intestine neuroendocrine tumor (SINET); diagnosing an ileal primary site of origin in a subject affected by Small Intestine NET (SINET); determining the presence of 18F-FDG-PET positive lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET);
[0032] - predicting 6-month progression-free survival (PFS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET), in particular who is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT);
[0033] - predicting 12-month overall survival (OS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET), in particular who is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT); - predicting 6-month progression-free survival (PFS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) who is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT) and is positive to18F-FDG-PET;
[0034] - predicting the presence of highly proliferating P-NET lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET);
[0035] - grading a pancreatic neuroendocrine tumor (P-NET);
[0036] - predicting tumor burden in a subject affected by a pancreatic neuroendocrine tumor (P- NET); and / or
[0037] - predicting response to Peptide Radionuclide Receptor Therapy (PRRT) in a subject affected by a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of hsa-miR-5096 and / or hsa-let-7i-3p and / or hsa-miR-4311 and / or combinations thereof in a biological sample comprising blood obtained from said subject.
[0038] Preferably the expression level of the one or more miRNAs is normalized in relation to the expression levels of one or more reference molecule, such as a miRNA, a RNA, a DNA or other biomolecule, in particular a molecule which does not change its amount in a subject with a GEP- NET with respect to a healthy subject.
[0039] Preferably, the method of the invention further comprises a step of determining a diagnostic or prognostic response by means of a comparison between the one or more miRNAs and a reference molecule. Said reference molecule can be any molecule which does not change its amount in a subject with a GEP-NET with respect to a healthy subject, for example it can be a miRNA, RNA, DNA or other biomolecule. Said response is preferably diagnosing a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) and / or determining aggressiveness of a GEP-NET and / or predicting overall survival of a subject with a GEP-NET.
[0040] In an embodiment, a cut-off is determined based on the chosen reference molecule and the response is determined if the normalized expression levels of the one or more miRNAs are below or above said cut-off.
[0041] Particular embodiments of the methods of the invention will be described below.
[0042] In all such methods, preferably the expression level of the one or more miRNAs is normalized in relation to the expression levels of one or more reference molecule, such as a miRNA, a RNA, a DNA or other biomolecule, in particular a molecule which does not change its amount in a subject with a GEP-NET with respect to a healthy subject. In a preferred embodiment, said reference molecule is a miRNA, more preferably it is hsa-miR-30d.
[0043] In all such methods, preferably, the method further comprises the step of determining a response by means of a comparison between the one or more miRNAs and a reference molecule. In some embodiments, a cut-off is determined based on the chosen reference molecule and the response is determined if the normalized expression levels of the one or more miRNAs are below or above said cut-off. The skilled person is able to choose a suitable reference molecule and consequently determine the relevant cut-off according to common general knowledge in the field.
[0044] A gastroenteropancreatic neuroendocrine tumor (GEP-NET) is a rare type of tumor that can grow in the pancreas or other areas of the gut, such as the stomach, small intestine, rectum, colon, or appendix. Preferably, the GEP-NET is selected from pancreatic neuroendocrine tumor (P-NET), small -intestine neuroendocrine tumor (SI-NETS), intestine neuroendocrine tumor, stomach neuroendocrine tumor.
[0045] In an embodiment, it is an object of the invention an in vitro method for diagnosing a gastro-entero- pancreatic neuroendocrine tumor (GEP-NET) in a subject in need thereof comprising the step of determining the expression of miRNAs hsa-miR-5096, hsa-let-7i-3p and / or hsa-miR-4311 in a biological sample comprising blood previously obtained from said subject. In particular the method can provide differential diagnosis of NETs of pancreatic origin (P-NETS) or of small-intestine origin (SI-NETS).
[0046] In particular, it is an object of the invention an in vitro method to diagnose the presence of a Small Intestine neuroendocrine tumor (SI-NET) in a subject comprising the step of determining the expression level of hsa-miR-5096 and / or hsa-let-7i-3p in a biological sample comprising blood previously obtained from said subject.
[0047] In a preferred embodiment, it is an object of the invention an in vitro method to diagnose the presence of a Small Intestine neuroendocrine tumor (SI-NET) in a subject comprising the following steps: a) determining the expression level of hsa-miR-5096 and / or hsa-let-7i-3p in a blood sample from the subject; b) normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a SI-NET with respect to a healthy subject; c) determining the presence of Small Intestine NET (SI-NET) when the normalized expression levels of hsa-miR-5096 or of a combination of hsa-miR-5096 and hsa-let-7i-3p are equal to or greater than a predetermined cut off value.
[0048] It is a further object of the invention an in vitro method for diagnosing an ileal primary site of origin in a subject affected by Small Intestine NET (SI-NET) comprising the step of determining the expression level of hsa-miR-5096 and / or hsa-let-7i-3p in a biological sample comprising blood previously obtained from said subject.
[0049] It is a further object of the invention a method for diagnosing an ileal primary site of origin in a subject affected by Small Intestine NET (SI-NET) comprising the following steps: a) determining the expression level of hsa-miR-5096 and / or hsa-let-7i-3p in a blood sample from the subject; b) normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a SI-NET with respect to a healthy subject; c) determining the presence of an ileal primary site of origin when the normalized expression level of each of the miRNAs or of a combination thereof is equal to or greater than a predetermined cut off value.
[0050] A further object of the invention is a method to distinguish 18F-FDG-PET positive from 18F-FDG- PET negative gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) patients, in particular P- NET patients, wherein 18F-FDG-PET negative tumors are characterized by less aggressive disease and better prognosis after Peptide Radionuclide Receptor Therapy (PRRT).
[0051] It is therefore an object of the invention an in vitro method to determine the presence of 18F-FDG- PET positive lesions in a subject affected by a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) , preferably a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of at least one of the following miRNAs: hsa-miR-5096, hsa-let- 7i-3p and hsa-miR-4311 in a biological sample comprising blood previously obtained from said subject, wherein the presence of 18F-FDG-PET positive lesions is an indication of an aggressive disease.
[0052] In a preferred embodiment, it is determined the expression level of both hsa-let-7i-3p and hsa-miR- 5096. In particular, it is an object of the invention a method to determine the presence of 18F-FDG-PET positive lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET) comprising the following steps: a) determining the expression level of at least one of the following miRNAs: hsa-miR-5096, hsa-let-7i-3p and hsa-miR-4311 in a blood sample from the subject; b) normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject ; c) determining the presence of at least one 18F-FDG-PET positive lesion when the normalized expression level of each of the miRNAs or of a combination thereof is equal to or greater than a predetermined cut off value.
[0053] In a preferred embodiment, said reference miRNA is hsa-miR-30d and said predetermined cut off value is:
[0054] 0.85 for hsa-miR-4311 ;
[0055] 70 for hsa-miR-5096;
[0056] 0.72 for hsa-miR-let7i-3p;
[0057] 0.65 for the combination of hsa-miR-4311 and hsa-let-7i-3p;
[0058] 33.55 for the combination of hsa-mir-5096 and hsa-let-7i-3p;
[0059] 14.9 for the combination of hsa-miR-4311 and hsa-mir-5096;
[0060] 29.6 for the combination of hsa-miR-4311, hsa-mir-5096 and hsa-let-7i-3p, wherein each cut-off value can vary of + / - 10%.
[0061] In a preferred embodiment, in step a) it is determined the expression level of both hsa-let-7i-3p and hsa-miR-5096.
[0062] It is a further object of the invention an in vitro method to predict 6 month progression-free survival (PFS) in a subject affected by a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET), preferably a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of at least one of the following miRNAs: hsa-miR-5096, hsa-let-7i-3p and hsa- miR-4311 in a biological sample comprising blood previously obtained from said subject. Preferably, the expression level of hsa-miR-5096 is determined.
[0063] In particular it is an object of the invention a method to predict 6 month progression-free survival (PFS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) comprising the following steps: a) determining the expression level of at least one of the following miRNAs: hsa-miR-5096, hsa-let-7i-3p and hsa-miR-4311 in a blood sample from said subject; b) normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject ; c) predicting a PFS of less than 6 months when the normalized expression level of each of the miRNAs or of a combination thereof is equal to or greater than a predetermined cut off value.
[0064] In a preferred embodiment, said reference miRNA is hsa-miR-30d and said predetermined cut off value is:
[0065] 70 for hsa-miR-5096;
[0066] 123.3 for the combination of hsa-mir-5096 and hsa-let-7i-3p;
[0067] 142.9 for the combination of hsa-miR-4311 and hsa-mir-5096;
[0068] 108.3 for the combination of hsa-miR-4311, hsa-mir-5096 and hsa-let-7i-3p, wherein each cut-off value can vary by + / - 10%.
[0069] In a preferred embodiment, in step a) it is determined the expression level of hsa-miR-5096.
[0070] Preferably, the subject is undergoing a therapy treatment targeting somatostatin receptors, more preferably a treatment with Peptide Radionuclide Receptor Therapy (PRRT).
[0071] In a preferred embodiment, the subject affected by a pancreatic neuroendocrine tumor (P-NET) is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT) and is positive to18F- FDG-PET.
[0072] It is a further object of the invention an in vitro method to predict 12-month overall survival (OS) in a subject affected by a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET), preferably a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of hsa-miR-5096 in a biological sample comprising blood previously obtained from said subject.
[0073] In particular, it is an object of the invention a method to predict 12-month overall survival (OS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) comprising the following steps: a) determining the expression level of hsa-miR-5096 in a blood sample from said subject; b) normalizing the expression level of hsa-miR-5096 to a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject; c) predicting an overall survival of less than 12 months when the normalized expression level of hsa-miR-5096 is equal to or greater than a predetermined cut off value.
[0074] In a preferred embodiment, said reference miRNA is hsa-miR-30d and said predetermined cut off value is 70+ / - 10%.
[0075] Preferably, the subject is undergoing a therapy treatment targeting somatostatin receptors, more preferably a treatment with Peptide Radionuclide Receptor Therapy (PRRT).
[0076] It is a further object of the invention an in vitro method for predicting the presence of one or more highly proliferating tumor lesions in a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) comprising the step of determining the expression level of at least one of the following miRNAs: hsa-let-7i-3p and hsa-miR-4311, preferably miR-4311, in a biological sample comprising blood obtained from said subject. Preferably, the tumor is a pancreatic neuroendocrine tumor (P-NET).
[0077] In particular, it is a further object of the invention a method for predicting the presence of one or more highly proliferating tumor lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET) comprising the following steps: a) determining the expression level of at least one of the following miRNAs: hsa-let-7i-3p and hsa-miR-4311 in a blood sample from said subject; b) normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject; c) determining the presence of a highly proliferating P-NET lesion when the normalized expression level of each of the miRNAs or of a combination thereof is equal to or greater than a predetermined cut off value.
[0078] In a preferred embodiment, said reference miRNA is hsa-miR-30d and the predetermined cut off value is:
[0079] 1.44 for hsa-miR-4311 ;
[0080] 1.31 for hsa-let-7i-3p;
[0081] 0.98 for the combination of hsa-miR-4311 and hsa-let-7i-3p; wherein each cut-off value can vary of + / - 10%.
[0082] In a preferred embodiment, in step a) the expression level of hsa-miR-4311 is determined.
[0083] It is a further object of the invention an in vitro method for grading a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET), in particular a pancreatic neuroendocrine tumor (P-NET), in the highest grade G3 comprising the step of determining the expression level of the combination of the following miRNAs: hsa-miR-5096, hsa-let-7i-3p and hsa-miR-4311 in a biological sample comprising blood previously obtained from a subject affected by a pancreatic neuroendocrine tumor.
[0084] In particular, it is an object of the invention a method for grading a pancreatic neuroendocrine tumor (P-NET) in the highest grade G3 comprising the following steps: a) determining the expression level of the combination of the following miRNAs: hsa-miR- 5096, hsa-let-7i-3p and hsa-miR-4311 in a blood sample from a subject affected by pancreatic neuroendocrine tumor; b) normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject; c) determining the presence of a G3 P-NET when the normalized expression level of the combination of miRNAs of step a) is equal to or greater than a predetermined cut off value.
[0085] In a preferred embodiment, said reference miRNA is hsa-miR-30d and the cut-off value is 57.1 + / - 10%.
[0086] It is a further object of the invention an in vitro method for determining tumor burden in a subject affected by a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET), preferably a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of at least one of the following miRNAs: hsa-let-7i-3p and hsa-miR-4311 in a biological sample comprising blood obtained from said subject.
[0087] In particular, it is an object of the invention a method for determining tumor burden in a subject affected by a pancreatic neuroendocrine tumor (P-NET) comprising the following steps: a) determining the expression level of at least one of the following miRNAs: hsa-let-7i-3p and hsa-miR-4311 in a blood sample from said subject; b) normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject; c) determining the presence of a high tumor burden when the normalized expression level of the combination of miRNAs of step a) is equal to or greater than a predetermined cut off value.
[0088] It is a further object of the invention an in vitro method to predict response to therapy in a subject affected by a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET), in particular a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of hsa- miR-5096, in a biological sample comprising blood previously obtained from said subject. It is a further object of the invention a method to predict response to Peptide Radionuclide Receptor Therapy (PRRT) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) comprising the following step: a) determining the expression level of hsa-miR-5096 in a blood sample from said subject; b) normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject ; c) predicting a positive response to Peptide Radionuclide Receptor Therapy (PRRT) when the normalized expression level of hsa-miR-5096 is lower than a predetermined cut off value.
[0089] In a preferred embodiment, said reference miRNA is hsa-miR-30d and the cut off value is 70 + / - 10%.
[0090] It is a further object of the invention an inhibitor of hsa-miR-5096 for use for the treatment of human cancers, preferably gastro-entero-pancreatic neuroendocrine tumors (GEP-NETs) and in particular pancreatic neuroendocrine tumors (P-NET).
[0091] It is also an object of the invention, a kit or a device for carrying out any of the methods above disclosed.
[0092] It is a further object of the invention a molecule targeting at least one miRNA selected from: hsa- miR-5096, hsa-let-7i-3p and hsa-miR-4311 for use in an in vivo method for diagnosing a gastro- entero-pancreatic neuroendocrine tumor (GEP-NET) and / or determining aggressiveness of a GEP- NET in a subject diagnosed with GEP-NET and / or predicting overall survival and / or response to therapy of a subject with a GEP-NET.
[0093] Preferably, said method is an imaging method, preferably performed on a tumoral portion of a human subject.
[0094] Preferably, said molecule is a probe, preferably a radiolabeled probe, able to selectively bind and recognize any of the above mentioned miRNAs, for example a probe at least partially complementary to the sequence of any of said miRNAs.
[0095] DETAILED DISCLOSURE OF THE INVENTION
[0096] Figures
[0097] Figure 1 Circulating exosomal hsa-miR-5096 overexpression can identify P-NETs from SI- NET patients (a) miR-5096 (indicated as miR-B) is significantly overexpressed in SI-NETs when compared to P-NET patients and Healthy Donors; (b) P2 (hsa-mir-5096*hsa-let-7i-3p; BC) is significantly overexpressed in SI-NETs when compared to P-NET patients and Healthy Donors. Figure 2 NGS analysis of circulating exosomal miRNAs in GEP-NETs revealed a metabolic signature in P-NET patients (a-g) Deregulated miRNAs and predictor between18F-FDG / PET positive and negative P-NETs: (a) hsa-miR-4311 (b) hsa-miR-5096 and (c) hsa-let-7i-3p and combined predictors (d) Pl (hsa-miR-4311* hsa-let-7i-3p), (e) P2 (hsa-mir-5096*hsa-let-7i-3p), (f) P3 (hsa-miR-4311* hsa-mir-5096), (g) P (hsa-miR-4311*hsa-mir-5096*hsa-let-7i-3p). Hsa-miR- 30d was selected from NGS profiling as an endogenous control. Results are presented as mean ± SD (*P<0 05; ****P<0- 00005).
[0098] Figure 3 Circulating miRNAs signature predicts18F-FDG / PET positivity in P-NET patients. Performances of the circulating signature in predicting18F-FDG / PET outcome in P-NET. (A) ROC curve of the single miRNAs (B) ROC curve of combined predictors, with significantly high AUCs. Pl (hsa-miR-4311* hsa-let-7i-3p), P2 (hsa-mir-5096*hsa-let-7i-3p), P3 (hsa-miR-4311* hsa-mir- 5096), P (hsa-miR-4311*hsa-mir-5096*hsa-let-7i-3p). miR-4311: hsa-miR-4311; miR-5096: hsa- miR-5096; miR-let7i: hsa-let-7i-3p.
[0099] Figure 4 Hsa-mir-5096 can predict 6-mo PFS and 12-mo OS in P-NET patients. Performances of circulating hsa-mir-5096 in predicting 6-mo PFS and 12-mo OS in P-NET patients treated with177Lu-DOTATATE. ROC curve analysis (a;b) of: (a) hsa-mir-5096 for 6-month PFS; (b) hsa-mir- 5096 for 12-month OS. (c) Time dependent AUC curve (95% C.I) for hsa-mir-5096 prediction of 3-24-month PFS. Kaplan-Meier analysis (d-e) of: (d) hsa-mir-5096 for 6-month PFS in P-NET patients; (e) hsa-mir-5096 for 12-month OS in P-NET patients.
[0100] Figure 5 Hsa-mir-5096 can predict 6-mo PFS and 12-mo OS in18F-FDG / PET positive P-NET patients. Performance of circulating hsa-mir-5096 in predicting 6-mo PFS and 12-mo OS in P-NET patients treated with177Lu-DOTATATE. ROC curve analysis (a;b): (a) hsa-mir-5096 for 6-month PFS in18F-FDG / PET positive patients; (b) hsa-mir-5096 for 12-month OS in18F-FDG / PET positive (+) subgroup. Kaplan-Meier analysis (c-d) of: (c) hsa-mir-5096 for 6-month PFS, in18F-FDG / PET- CT positive subgroup; (d) hsa-mir-5096 for 12-month OS, in18F-FDG / PET-CT positive subgroup.
[0101] Figure 6 Clinical parameters prediction by hsa-miR-4311 alone and in combination with hsa- let-7i-3p (Pl) and (hsa-let-7i-3p; hsa-mir-5096) (P). Hsa-miR-4311 correlation with clinical parameters in P-NETs: (a) ki-67 (%); (g) tumor burden. Pl correlation with clinical parameters: (b) ki-67 (%) and (f) tumor burden in P-NETs. P correlation with clinical parameters: (c-d) grading (WHO2017) and (e) PFS in P-NETs.
[0102] Figure 7 Hsa-miR-5096-5p overexpression inversely correlates with SSTR2 expression levels in P-NET patients, (a) correlative analysis of expression of circulating hsa-mir-5096 and68Ga-PET SUV max (log-scale) in plasma, (b) Illustrative diagram of overall analyzed areas in terms of SSTR2 expression: frankly positive (23%), heterogeneous (23%) and negative (54%) expression areas, (c) Aggregated analysis of co-occurrence of hsa-mir-5096 positive nuclei (%) in overall areas with high, low and negative SSTR2 expression, (d) SSTR2 expression in NT-3 cell lines, cultivated with growth factors, 72h post transfection with miRCURY LNA miR-5096 inhibitor and scramble control, (e) hsa-miR-5096 and SSTR2 basal expression level in high-grade BON-1 and QGP-1 cell line, (f) SSTR2 expression in QGP-1 cell lines, 72h post transfection with miRCURY LNA miR- 5096 inhibitor and scramble control, (g) representative immunofluorescence staining of SSTR2 in QGP-1 cells treated with miRCURY LNA miR-5096 inhibitor and scr. *p-value<0.05; **p- valueO.Ol; ***p-value<0,001; ****p-value<0.0001. ns stands for non-significant.
[0103] Figure 8 Hsa-miR-5096-5p overexpression down-modulates SSTR2 expression in NT-3 cell lines, (a) Schematic representation of hsa-mir-5096 binding sites and their relative position on SSTR2 3’UTR; (b) SSTR2 basal expression level in NT-3 cell lines cultivated with or w / o growth factors (EGF; bFGF); (c) hsa-miR-5096 basal expression level in NT-3 cell lines cultivated with or w / o growth factors (EGF; bFGF); (d) hsa-miR-5096 and (e) SSTR2 expression in NT-3 cell lines 72h post transfection with miRCURY LNA miR-5096 mimic and scramble control.
[0104] Figure 9 Inhibition of Hsa-miR-5096-5p binding on SSTR2 transcript up-regulates SSTR2 expression in NT-3 cell lines, (a) SSTR2 expression level in NT-3 cell lines 48h and 72h post transfection with Target Site Blockers (TSB1 or 2), scramble control and combination (TSB1 and 2; COMBO), data normalized via DCT on HPRT as housekeeping gene, (b) SSTR2 expression in NT- 3 cell lines 48h and 72h post transfection with Target Site Blockers (TSB1 and 2) alone and in combination (COMBO) normalized via dDCT on scramble control as reference.
[0105] Figure 10 Hsa-miR-5096-5p inhibition via Target Site Blockers upregulates SSTR2 expression in NT-3 cell lines as early post-transcriptional events, (a) SSTR2 expression level in NT-3 cell lines 6h, 18h and 24h post transfection with TSB combination (COMBO) and scramble control at 50 nM concentration. Data were normalized via DCT on HPRT as housekeeping gene, (b) SSTR2 relative increase in NT-3 cell lines at 6h, 18h and 24h post transfection with TSBs combination (COMBO) normalized via dDCT on scramble control as reference.
[0106] Figure 11. Age contribution to miR-signature and predictors expression level in plasma of PAN-NENs and Healthy Donors (cut-off: 54,5), according to 18F-FDG / PET. Age contribution to single miR expression level in plasma of PAN-NENs and Healthy Donors (a-c): (a) hsa-miR- 4311; (b) hsa-miR-5096; (c) hsa-let-7i-3p. Age contribution to single miR expression level in plasma of PAN-NENs and Healthy Donors, according to 18F-FDG / PET (e-g): (e) hsa-miR-4311, in 18F-FDG / PET positive and negative patients; (1) hsa-miR-5096, in 18F-FDG / PET positive and negative patients; (g) hsa-let-7i-3p, in 18F-FDG / PET positive and negative patients. Age contribution to predictors expression level in plasma of PAN-NENs and Healthy Donors, according to 18F-FDG / PET (m-p): (m) Pl (hsa-miR-4311* hsa-let-7i-3p), in 18F-FDG / PET positive and negative patients;; (h) P2 (hsa-mir-5096*hsa-let-7i-3p), in 18F-FDG / PET positive and negative patients;; (i) P3 (hsa-miR-4311* hsa-mir-5096), in 18F-FDG / PET positive and negative patients; (1) P (hsa-miR-4311*hsa-mir-5096*hsa-let-7i-3p), in 18F-FDG / PET positive and negative patients. Healthy Donors = HDs
[0107] Figure 12. Receiver Operating Characteristic (ROC) and Kaplan-Meier (KM) analysis of combined predictors (Pl, P2, P3 and P) for 6-months progression free survival (PFS) and 12- months overall survival (OS). The performance of circulating P2, P3 and P in predicting Progression Free Survival (PFS) outcome in PAN-NEN patients treated with 177Lu-DOTATATE (a-1). (a) Combined ROC curve of P2, P3 and P, with significantly high AUCs. Associated table reports AUC values, the identified cut-off and sensitivity and specificity percentages of proposed biomarkers, (b-1) Kaplan-Meier analysis (KM) for Progression Free Survival (PFS) of: (b) P2 (cutoff: 123-3); (c) P2 (cut-off: 123-3), according to 18F-FDG / PET-CT outcome; (d) P2 (cut-off: 123-3), in 18F-FDG / PET-CT positive patients, (e) P3 (cut-off: 142-9) (1) KM analysis of P3 (cutoff: 142-9), according to 18F-FDG / PET-CT outcome; (g) P3 (cut-off: 142-9), in 18F-FDG / PET- CT positive subgroup; (h) P (cut-off: 108-3); (I) P (cut-off: 108-3), according to 18F-FDG / PET-CT outcome; (1) P (cut-off: 108-3), in 18F-FDG / PET-CT positive subgroup.
[0108] Figure 13. Time dependent AUC curve for P, P2 and P3. Predictors P, P2 and P3 AUCs over time (range: 3-24 month) with 95% confidence interval (C.I.)
[0109] Figure 14. Hsa-miR-5096 overexpression inversely correlates with SSTR2 expression levels in PanNET patients, (a) correlative analysis of expression of circulating hsa-miR-5096 and 68Ga- PET SUVmax in plasma of PanNET patients (n=38 excluding 15 patients due to missing data on68Ga-PET SUVmax value; linear scale). Data comparison was conducted by means of Mann Whitney test (p: 0,04). (b) Correlation analysis (Spearman; p< 0,0169; r2: -0,4928) of 68Ga- PET / CT SUVmax and 18F-FDG-PET / CT positivity in patients displaying low and high levels of hsa-miR-5096 (cut-off:70) in plasma of PanNET patients, (c) Representative images of PanNET tumor heterogeneity: simultaneous detection of hsa-miR-5096 (DAB-BROWN) and SSTR2 protein (diffuse light gray) in FFPE tumor tissue through our miR-protein protocol, (d) AND-Tool automated analysis on PanNET FFPE samples (n=8). On the left, a screenshot of the AND-Tool graphical user interface (GUI). On the right, an example of analysis with at the top part an input ROI. In the central part, light-pink, dark-red, and white masks (white on black background), respectively. In the bottom part, segmented nuclei are grouped according to the different masks, (e) Illustrative diagram of overall analyzed pixels in terms of SSTR2 expression: frankly positive (27%), heterogeneous (22%) and negative (51%) expression areas; (I) Correlation analysis (Spearman; r=-0,4676; p<0,0001) of hsa-mir-5096 positive nuclei (%) and SSTR2 expression level in FFPE PanNET specimens.
[0110] Definitions
[0111] Within the meaning of the present invention, for “at least one” it is intended one, two or more from the subsequent list, i.e. also combinations thereof.
[0112] Within the meaning of the present invention, for “blood sample” it is intended to be a sample of whole blood, plasma or serum or sample derived from the processing of those. In this context for “whole blood” it is intended the body fluid that delivers necessary substances such as nutrients and oxygen to the cells and transports metabolic waste products away from those same cells; typically it is composed of blood cells suspended in blood plasma. For “plasma” it is intended to be the liquid component of blood that is freed from blood cells. For “serum” it is intended plasma from which the clotting proteins have been removed.
[0113] Within the meaning of the present invention, for “normalization" it is intended the expression of a differential value in terms of a standard value to adjust for effects which arise from technical variation due for example to sample handling, sample preparation and measurement rather than biological variation of miRNA concentration in a sample.
[0114] Within the meaning of the present invention, for 18F-FDG-PET it is intended positron emission tomography (PET) with 2-deoxy-2- [fluorine- 18] fluoro-D-glucose (18F-FDG), an analogue of glucose that provides valuable functional information based on the increased glucose uptake and glycolysis of cancer cells.
[0115] Within the meaning of the present invention, for 18F-FDG-PET positive lesion it is intended a lesion of cancer origin able to incorporate 18F-FDG and be visualized by PET imaging;
[0116] Within the meaning of the present invention, for Peptide Radionuclide Receptor Therapy (PRRT) it is intended a molecular targeted therapy used to treat neuroendocrine tumors (NET).
[0117] Y1 Within the meaning of the present invention, for overall survival (OS) it is intended the time which begins at diagnosis (or at the start of treatment) and up to the time of death of a subject.
[0118] Within the meaning of the present invention, for progression-free survival (PFS) it is intended the time from treatment initiation until disease progression.
[0119] Within the meaning of the present invention, for highly proliferating P-NET lesion it is intended a lesion which increases in size over time and express markers of active proliferation, such as ki-67, if assessed at the cellular level.
[0120] Within the meaning of the present invention, for tumor burden it is intended the number of cancer cells, the size of a tumor, or the amount of cancer in the body. For high tumor burden it is intended the presence of an elevated number of cancer cells or an large size of a tumor or a high amount of cancer in the body.
[0121] The miRNAs used in the methods of the invention are known and they have the following sequences (miRbase database, release version 22.1): hsa-miR-5096 - miRbase Accession number: MIMAT0020603;
[0122] Sequence: GUUUCACCAUGUUGGUCAGGC [SEQ ID N.I], hsa-let-7i-3p - miRbase Accession number: MIMAT0004585 Sequence: CUGCGCAAGCUACUGCCUUGCU [SEQ ID N.2], hsa-miR-4311 - miRbase Accession number: MIMAT0016863;
[0123] Sequence: GAAAGAGAGCUGAGUGUG [SEQ ID N.3], hsa-miR-30d-3p - miRbase Accession number: MIMAT0004551 Sequence: CUUUCAGUCAGAUGUUUGCUGC [SEQ ID N.4] hsa-miR-5096 and miR-5096 are herein used as synonyms. The same applies to the other mentioned miRNAs.
[0124] For miR-30d or hsa-miR-30d it is herein intended hsa-miR-30d-3p.
[0125] The method of the invention is carried out on a biological sample comprising blood obtained from said subject. In particular, it is carried out on a blood sample previously isolated from the subject.
[0126] In a preferred embodiment, the method is carried out on a plasma sample obtained by the whole blood sample for example through centrifugation.
[0127] Determination of the expression level of the miRNAs in a blood sample from a subject according to the methods of the invention can be carried out as explained below.
[0128] The blood sample previously obtained by a subject is collected in a collection sterile vessel containing ethylenediaminetetraacetic acid (EDTA) or similar chelating agents. Platelet free plasma is then generated from whole blood centrifugation or similar methods as known by the skilled in the art.
[0129] In a preferred embodiment, the expression level of the miRNAs is determined in an exosome- enriched fraction from plasma of said biological sample comprising blood.
[0130] For “exosome-enriched fraction from plasma” or “plasma exosome-enriched fraction” it is intended a plasma fraction which contains more exosomes than normal plasma. In particular, it is intended that plasma is processed to isolate and / or concentrate exosomes present into it.
[0131] Plasma exosome-enriched fraction can be isolated, typically from platelet free plasma, by means of known techniques such as: differential ultracentrifugation (dUC), ultrafiltration (UF), poly -Ethylene Glycol (PEG)-Based Precipitation, immunoaffmity capture, microfluidics, size-exclusion chromatography (SEC). See for example as a reference Sidhom K, Obi PO, Saleem A. A Review of Exosomal Isolation Methods: Is Size Exclusion Chromatography the Best Option? Int J Mol Sci. 2020 Sep 4;21(18):6466. doi: 10.3390 / ijms21186466. PMID: 32899828; PMCID: PMC7556044 for detailed description of the methods.
[0132] Kits and products for exosome isolation are commercially available, for example Exoquick™, SCBI, can be used. In an embodiment, one ml of plasma per sample is used for exosome-fraction enrichment via Exoquick™, SCBI.
[0133] Small RNAs, including miRNAs, contained in the exosome-enriched fraction can be isolated by means of known methods or commercial kits. For example, MiRNeasy serum / plasma kit - Qiagen Cat No. / ID: 217184 can be used.
[0134] Dosage of each specific miRNA can be performed by known methods. For example, quantitative PCR (RT / qPCR) can be used on frozen or fresh RNA samples on C1000 Touch Thermal Cycler (Bio rad™, Hercules, CA, USA) or similar thermal cycler using TaqMan™ MicroRNA Reverse Transcription Kit (Applied Biosystems™; Foster city, CA, USA. Cat No. / ID: 4366596) or similar technologies. C-DNAs can be obtained by TaqMan™ MicroRNA or alternative Reverse Transcription protocol for the single miRNAs or by multiplexing miRNA primers for the target miRNA. Target miRNAs can be also detected individually using universal Master Mix and TaqMan™ miRNA Assay or any validated miRNA specific probes, according to the manufacturer’s protocol (for example Applied Biosystems™, Foster city, CA, USA. Cat No. / ID: 4440040). RT / qPCR analysis can be conducted using Applied Biosystems™ 7500 Real-Time PCR Systems (Applied Biosystems™; Cat No. / ID: 4351104). See Dharmawardana, N., Ooi, E. H., Woods, C., & Hussey, D. (2019). Circulating microRNAs in head and neck cancer: a scoping review of methods. Clinical & Experimental Metastasis. doi:10.1007 / sl0585-019-09961-6 for exemplary detailed methods to obtain miRNAs from plasma specimens.
[0135] Determination of the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients of interest with respect to a healthy subject can be carried out according to the general knowledge in the field. The expression level of the reference molecule is determined in the same blood sample on which the expression level of the target miRNAs is determined. The reference molecule can be selected by the skilled person according to the common general knowledge in the field, in particular it can be selected among the miRNAs, RNAs, DNAs or other biomolecules which are known to not change their amount in a subject affected by a GEP tumor with respect to a healthy subject. In a preferred embodiment the reference molecule is a miRNA, such as the so called housekeeping miRNAs. Preferably, it is hsa-miR-30d.
[0136] Determination of the expression level of a reference miRNA, for example hsa-miR-30d, can be carried out as described in the above paragraphs. The expression level of the reference miRNA is determined in the same blood sample on which the expression level of the target miRNAs is determined.
[0137] Normalization of the expression levels of single target miRNAs on the expression of the reference molecule, such as housekeeping miRNA, can be carried out as known in the field.
[0138] For example, the fold enrichment is obtained by means of the 2-ACT method for the corresponding sample. According to said method for example the fold enrichment can be calculated according to the following formula: 2exp-[Ct(miRNAx)-Ct(miRNArel)]. “Predictors” (Pl, P2, P3 and P) are created as the product of fold enrichments of single miRNAs.
[0139] Based on the chosen reference molecule, cut-off values for each application can be calculated.
[0140] In a first aspect, the present invention provides a method for differential diagnosis of NETs of pancreatic origin (P-NETS) and of small-intestine origin (SI-NETS), as described above.
[0141] In an embodiment, the subject in need thereof is a subject diagnosed with GEP -NET or having at least one symptom of GEP -NET or having a familiar history or a known predisposition for GEP- NET.
[0142] In a second aspect, a method for diagnosing an ileal primary site of origin in a subject affected by Small Intestine NET (SI-NET) is provided, as described above. For ileal primary site of origin it is intended that the cancer arises from the ileum tissue, the final tract of the small intestine.
[0143] The diagnosis of an ileal primary site of origin through liquid biopsy is advantageous because it allows a better definition of the type of neuroendocrine cancer of the patient without the need for an invasive procedure.
[0144] In a third aspect, a method to distinguish 18F-FDG-PET positive from negative P-NET patients, the latter characterized by less aggressive disease and better prognosis after PRRT is provided, as disclosed above.
[0145] In particular, highest predictivity of 18F-FDG-PET positive lesions is reached by combination of hsa-let-7i-3p and hsa-miR-5096.
[0146] In a fourth aspect, the invention provides a method to predict 6 month progression-free survival (PFS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET), in particular who is undergoing a treatment targeting somatostatin receptors, more preferably a treatment with Peptide Radionuclide Receptor Therapy (PRRT), as described above.
[0147] In an embodiment, the subject affected by a pancreatic neuroendocrine tumor (P-NET) is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT) and is positive to18F- FDG-PET. In this embodiment, a normalized expression level of hsa-miR-5096 in the sample equal or greater than 70 identifies a subset of 18F-FDG-PET positive patients that progress even earlier than six months and do not benefit from PRRT treatment. Conversely, a normalized expression level of hsa-miR-5096 score lower than 70 identifies a subset of 18F-FDG-PET positive patients that benefit the most from PRRT treatment.
[0148] In particular, embodiments, the normalized expression level of hsa-miR-5096 or of the following combinations of miRNAs: hsa-mir-5096 and hsa-let-7i-3p, hsa-miR-4311 and hsa-mir-5096 and hsa-miR-4311, hsa-mir-5096 and hsa-let-7i-3p is evaluated. Expression levels above the indicated cut-offs indicate patients with shorter PFS, with significant AUCs. In particular, highest predictivity of 6-month PFS is provided by hsa-miR-5096 alone. Indeed, expression level of hsa-miR-5096 greater than 70 best predicts P-NET patients with shorter PFS within 6-month. hsa-miR-5096 can be used as a prognostic tool for monitoring PFS of patients up to 24 months since it maintains significant AUC values.
[0149] In a fifth aspect, it is provided a method to predict 12 month overall survival (OS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET), preferably who is undergoing a treatment targeting somatostatin receptors, more preferably a treatment with Peptide Radionuclide Receptor Therapy (PRRT), as disclosed above.
[0150] A normalized expression level of hsa-miR-5096 in the sample equal or greater than 70 best predicts P-NET patients with shorter OS with significant AUC.
[0151] In a sixth aspect, it is provided a method for predicting the presence of highly proliferating P-NET lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET), as defined above.
[0152] In an embodiment, a normalized expression level of single hsa-miR-4311 or hsa-let-7i-3p or of their combination above the identified cut-offs significantly correlates with higher ki-67 (%) in P-NET patients with significant AUCs (see Table 3 and Figure 6 a-b). Ki-67 is a known marker for proliferating cells and it is therefore an indicator of a highly proliferating tumor lesion. Expression level of hsa-miR-4311 greater than 1 ,44 best predicts P-NET with higher proliferating tumor.
[0153] In a seventh aspect, it is provided a method for grading a pancreatic neuroendocrine tumor (P-NET) in the highest grade G3, as defined above. The WHO classification categorizes NET as a NET (3) grade 1, NET grade 2, and NEC grade 3. The method of the invention allows to grade a P-NET tumor as a G3.
[0154] In an embodiment, a normalized expression level of combination of hsa-miR-4311, hsa-miR-5096 and hsa-let-7i-3p (also named predictor P) in the sample obtained from a patient affected by P-NET equal or greater that 57.1 predicts a G3 P-NET with significant AUC of 0,83 and 100% specificity and 65% sensitivity (Figure 6 c-e).
[0155] In an eighth aspect, is provided a method for predicting tumor burden in a subject affected by a pancreatic neuroendocrine tumor (P-NET), as defined above.
[0156] In an embodiment, normalized expression levels of hsa-miR-4311, alone or in combination with hsa-let-7i-3p in the sample obtained from a patient affected by P-NET above identified cut-offs indicate a high tumor burden compared to low tumor burden P-NET patients (Figure 6 f-g).
[0157] In a ninth aspect, it is provided a method to predict response to therapy in a subject affected by a pancreatic neuroendocrine tumor (P-NET), as defined above. In an embodiment, a positive response to therapy is predicted if hsa-miR-5096 normalized expression is below the cutoff value of 70. For positive response to therapy is intended for example that the subject that undergoes the treatment has a longer life expectation than if he would not be treated. Treatment can be for example with PRRT. In an embodiment, normalized expression level of hsa-miR-5096 in the sample greater than 70. predicts low Ga uptake (SUV max ) at68Ga-DOTA-PET / CT scan, identifying patients who will not benefit from PRRT.
[0158] It is a further object of the invention an inhibitor of hsa-miR-5096 for use for the treatment of Gastro-entero-pancreatic neuroendocrine tumors (GEP-NETs). Preferably, said inhibitor is for use for the treatment of aggressive pancreatic neuroendocrine tumor (P-NET). More preferably said P- NET has low to heterogenous expression of somatostatin receptor SSTR2. In a preferred embodiment, said inhibitor is able to inhibit the binding of hsa-miR-5096 on SSTR-2 transcript.
[0159] Within the context of the present invention, the term "inhibitor" means an agent capable of decreasing or blocking, completely or partially, the activity of the target miRNA, i.e. hsa-miR-5096. In particular, it means an agent capable of sufficiently decreasing the activity of hsa-miR-5096. In a particular embodiment, it means an agent capable of decreasing or blocking the interaction of hsa- miR-5096 with the somatostatin receptor SSTR-2 transcript or to decrease hsa-miR-5096 expression. In some embodiments, said inhibitor may act by directly binding hsa-miR-5096 or by binding hsa-miR-5096 binding sites on the SSTR-2 transcript.
[0160] SSTR-2 transcript is available on the GenBank database: NCBI Gene ID: 6752; GenBank Accession:NM_001050.03.
[0161] Said inhibitor can be an oligonucleotide comprising at least 5 nucleotides capable of binding to a hsa-miR-5096 by complementary base pairing, thereby decreasing or blocking the function of said miRNA. For “complementary base pairing” it is intended that some or all of the bases of said oligonucleotide pair with some or all of the bases of said miRNA target. In particular, said inhibitor can be able to pair at least 40% of its bases with the bases of the target miRNA; for example said inhibitor is able to pair at least 40%, 50%, 60%, 70%, 80%, 90% or 100% of its bases with the bases of the target miRNA.
[0162] In a preferred embodiment, the inhibitor is chosen between a locked-nucleic acid (LNA)-based oligonucleotide and an anti-miR.
[0163] In an embodiment, the inhibitor is an anti-miR wherein said anti-miR is an RNA oligonucleotide at least partially complementary to the target miRNA. In particular, it is sufficiently complementary to bind and at least partially block said target miRNA. Preferably, said anti-miR comprises between 5 and 27 nucleotides and it has at least 40% of the bases complementary with the bases of the target miRNA. Within the context of the present invention, the term "anti-miR" or "antagomir" means an oligonucleotide molecule that prevents the binding of other molecules to one or more specific miRNAs.
[0164] In a preferred embodiment, said inhibitor is an LNA-based oligonucleotide. Preferably, it comprises between 5 and 27 nucleotides and it comprises at least one locked nucleic acid. It can also comprise more than one locked nucleic acid. Said LNA-based oligonucleotide is at least partially complementary to the miRNA target, in particular it can be at least 40%, 50%, 60%, 70%, 80%, 90% or 100% complementary to the miRNA target.
[0165] Within the context of the present invention, the term "locked nucleic acid" or "LNA" means a nucleotide with the ribose ring blocked in an N-type conformation by a 2'-O, 4'-C bridge. LNAs are described for example in WO 99 / 14226, WO 00 / 56746, WO 00 / 56748, WO 01 / 25248, WO 02 / 28875, WO 03 / 006475 and WO 03 / 095467 and the references mentioned therein.
[0166] Within the context of the present invention, the term "LNA-based oligonucleotide" means an oligonucleotide comprising at least one locked nucleic acid (LNA), as defined above. This oligonucleotide is generally a small synthetic RNA at least partially complementary to the target miRNA, in particular sufficiently complementary to bind and block the target miRNA, including at least one locked nucleic acid.
[0167] LNA-based oligonucleotides are inhibitors of common use in the field and commercially available. For example, they are available from the following companies: QIAgen, Affymetrix, Perkin Elmer.
[0168] In a particular embodiment of the invention, said LNA-based oligonucleotide is an oligonucleotide, in particular an antisense oligonucleotide, with perfect sequence complementary to the miRNA target. Said LNA-based oligonucleotide can be 100% complementary to the miRNA target. For example, it can be an LNA-based oligonucleotide with perfect sequence complementary to the miRNA target of the type miRCURY LNA miRNA Power Inhibitor, commercially available from QIAgen.
[0169] The expert in the field is able to find an inhibitor suitable for use according to this invention according to the general knowledge in the field.
[0170] Indeed, it is well known in the field how to identify an agent able to inhibit the activity of a known miRNA. In particular, anti-miR and LNA-based oligonucleotides are commonly used to inhibit the activity of target miRNAs. A skilled person in the field can design or purchase anti-miR or LNA- based oligonucleotides able to inhibit the activity of hsa-miR-5096. In a preferred embodiment, said inhibitor is able to bind and inhibit at least one of the two following sequences on miR-5096:
[0171] 5’-UUUCAC-3’ (SSTR2_5096_1310)
[0172] 5 ’ -UUUC ACC-3 ’ (SSTR2_5096_l 025)
[0173] These sequences recognize the following sequences 5’-GUGAAAA-3’; 5’-GGUGAAA-3’ located on 4 sites at the 3’-UTR of the SSTR-2 gene at position 723-729 and 3001-3007 / 1008-1014 and 2290-2296, respectively.
[0174] In an embodiment, said inhibitor is an agent capable of decreasing or blocking the interaction of hsa-miR-5096 with the somatostatin receptor SSTR-2 transcript.
[0175] Such inhibitor can for example bind and block one or more of the binding sites of hsa-miR-5096 on the SSTR-2 transcript, preferably on the 3’-UTR of the SSTR-2 transcript. Preferably, it is able of binding and blocking at least two, preferably all, binding sites of hsa-miR-5096 on the SSTR-2 transcript.
[0176] In an embodiment, said binding sites of hsa-miR-5096 on the SSTR-2 transcript correspond to the sequences GUGAAAA; GGUGAAA located at the 3’-UTR of the SSTR-2 gene at positions 723- 729 and 3001-3007 / 1008-1014 and 2290-2296, respectively.
[0177] Preferably, the inhibitor targets all said 4 binding sites targeted by hsa-miR-5096 on the SSTR-2 transcript. In a preferred embodiment, said inhibitor is a Target Site Blocker (TSB), preferably a LNA Target Site Blocker (TSB), able to bind and block one or more of said binding sites of hsa- miR-5096 on the SSTR-2 transcript. For Target Site Blocker (TSB) it is intended a oligonucleotide, preferably a LNA antisense oligonucleotide, that binds to a target site of a miRNA on a mRNA, thereby preventing the miRNA from gaining access to that site on the mRNA.
[0178] Suitable LNA Target Site Blockers (TSB) are commercially available or can be manufactured according to the common knowledge in the field.
[0179] The inventors found out that the use of target site blockers aimed to shield specific sequences targeted by hsa-miR5096 on the SSTR-2 3’-UTR allowed SSTR-2 mRNA overexpression in NT-3 cells. Also, QGP-1 cells, chosen as model to revert SSTR2 expression in high grade PanNET cells treated with hsa-miR-5096-inhibitor showed a significant increase of SSTR2 transcripts mirrored by SSTR-2 upregulation at the protein level. Therefore, the delivery of inhibitors hindering hsa-miR- 5096 activity into PanNET cells translates into SSTR2 transcripts increased stability and higher SSTR2 amount on the cell membrane. The inhibitor for use as described in the present invention may be administered to a subject in need thereof in any form. In particular, it may be administered by conventional methods of administration of small RNAs.
[0180] In a preferred embodiment, the inhibitor is included in a delivery vehicle, such as a nanoparticle, able to deliver it into GEP-NET, in particular PanNET, cells.
[0181] In a preferred embodiment, it is administered encapsulated in nanoparticles, according to conventional methods in the field.
[0182] In another preferred embodiment, it is administered via specific armed cells (e.g B- lymphocytes)
[0183] The cells or nanoparticles can be modified in order to be able to bind to GEP-NET tumor cells, for example by decorating the particles with specific molecules (i.e. small molecules, peptides, antibodies). In an embodiment, the inhibitor is administered without the use of transfection agents.
[0184] In an alternative embodiment, it is administered in a pharmaceutical composition.
[0185] A pharmaceutical composition comprising at least one inhibitor of hsa-miR-5096 and at least one pharmaceutically acceptable vehicle and / or excipient for use for the treatment of Gastro-entero- pancreatic neuroendocrine tumors (GEP-NETs) is also an object of the invention. The inhibitor of hsa-miR-5096 can be as described above. In particular, an inhibitor able to inhibit the binding of hsa-miR-5096 on the SSTR-2 transcript. In particular, it can be an inhibitor able to bind and block one or more of the binding sites of hsa-miR-5096 on the SSTR-2 transcript, preferably it can be a LNA Target Site Blocker (TSB). In a preferred embodiment, said pharmaceutical composition comprises at least two inhibitors, such as two LNA TSBs, wherein at least a first inhibitor is able to target at least two of the binding sites of hsa-miR-5096 on the SSTR-2 transcript and at least a second inhibitor is able to target at least the other two binding sites of hsa-miR-5096 on the SSTR-2 transcript.
[0186] Suitable pharmaceutically acceptable excipients are those commonly known to the person skilled in the art for the preparation of compositions for parenteral, intradermal, subcutaneous, oral, transdermal, topical, transmucosal, and rectal administration.
[0187] By way of non-limiting example, said pharmaceutically acceptable excipients can consists of binders, diluents, lubricants, glidants, disintegrants, solubilizing (wetting) agents, stabilizers, colorants, anti-caking agents, emulsifiers, thickeners and gelling agents, coating agents, humectants, sequestrants, and sweeteners. The expert in the field will decide the effective timing of administration, depending on the patient's condition, the level of severity of the pathology, the patient's response and any other clinical parameters included in the general knowledge in the field.
[0188] According to the present invention, the inhibitor can be administered together with lipid molecules, such as cationic lipids that can facilitate its transport, according to the state of the art. A further method of administering such an inhibitor is by means of a suitable vector, known for the administration of RNA or DNA. A preferred vector is the adeno-associated vector (AAV), a viral vector well known for in vivo administration of DNA (Mingozzi F, High KA: Therapeutic in vivo gene transfer for genetic disease using AAV: progress and challenges. Nature reviews genetics. 2011 May;12(5):341).
[0189] Injection is a preferred route of administration. Injection can be systemic or directly at the tumor site. An expert in the field may decide to administer the inhibitor by any conventional route.
[0190] For general knowledge in the field, reference can be made to Remington's Pharmaceutical Sciences, latest edition.
[0191] It is a further object of the invention a molecule targeting at least one miRNA selected from: hsa- miR-5096, hsa-let-7i-3p and hsa-miR-4311 for use in an in vivo method for diagnosing a gastro- entero-pancreatic neuroendocrine tumor (GEP-NET) and / or determining aggressiveness of a GEP- NET in a subject diagnosed with GEP-NET and / or predicting overall survival and / or response to therapy of a subject with a GEP-NET.
[0192] Said method can be any imaging method commonly used in medical diagnostics, in particular commonly used for diagnosis of tumors, such as magnetic resonance imaging, computed tomography, positron emission tomography (PET) and radiography.
[0193] Indeed, it was found that hsa-miR-5096 is largely expressed by P-NET tumor cells and that the inverse correlation with SSTR-2 observed in blood mirrors an inverse correlation also at the tissue level. Therefore, detection of hsa-miR-5096, hsa-let-7i-3p and / or hsa-miR-4311 in tumoral tissue similarly to their in vitro detection in a blood sample, is advantageously helpful to determine tumor prognosis.
[0194] Said method can be advantageously performed in combination with PET-FDG, wherein fluorodeoxy glucose (FDG) is used as radioactive substance.
[0195] Imaging method can be carried out as known in the field. A molecule targeting at least one of the above miRNA can advantageously be a radiolabeled probe and it can be commercially obtained or manufactured according to common general knowledge in the field.
[0196] It is also an object of the invention, a kit useful for performing the methods above described.
[0197] The kit may for example contain one or more of the followings: agents and tools to obtain plasma exosome-enriched fraction from a blood sample previously isolated from a subject; agents and tools to isolate target miRNAs; agents and tools for the dosage of each specific miRNA, for example primers and probes specific for the target miRNAs and / or useful for RT-PCR. The agents can be polynucleotides or other molecules which specifically bind to or specifically hybridize to the target miRNAs. The agents include polynucleotides, such as probes and primers, e.g. sense and antisense PCR primers, having identity or complementarity to the target miRNAs;
[0198] - probes targeting at least one of the target miRNAs for use in an imaging method, such as a radiolabeled probe.
[0199] It is also an object of the invention, a device for carrying out the methods above disclosed.
[0200] Such device comprises agents and tools for carrying out each of the steps of each method.
[0201] For example it can be a device based on PCR amplification or able to directly recognize and quantify the target miRNAs.
[0202] The invention will be now illustrated by the following examples.
[0203] EXAMPLES
[0204] Materials & Methods
[0205] Patients’ characteristics
[0206] From October 2016 to September 2019, a cohort of 68 histologically or cytologically confirmed Gl, G2 and G3 GEP - NET patients (age >18 years, both genders) with RECIST based progressive disease (PD), has been enrolled in the clinical trials NCT02736500 (LUX) and NCT02489604 (LUNET).
[0207] According to inclusion criteria all included patients displayed appropriate hematological, liver and renal parameters (hemoglobin >= 10 g / dL; absolute neutrophil count (ANC) >= 1.5 x 109 / L; platelets >= 100 x 109 / L; bilirubin <1.5 X UNL (upper normal limit), ALT <2.5 X UNL (< 5 X UNL in presence of liver metastases), creatinine < 2 mg / dL). Eligible patients did not receive other treatments (e.g., chemo- or radiotherapy) from one month before to two months after the completion of 177Lu-DOTATATE cycles. Patients were naive from previous radionuclide treatments with radiopeptides (e.g.,inInpentetreotide,90Y-DOTATOC) or other radiopharmaceuticals (e.g.,131I-MIBG,131I). Patients' disease was measurable by means of conventional imaging (CT or MRI). From this cohort, a homogeneous subset of 24 GEP -NET patients were randomly selected according to18F - FDG / PET outcome (1218F - FDG / PET positive and 1218F - FDG / PET negative) for whole miRNome NGS profiling. In particular, 6 out of 24 GEP -NET from the training cohort were P-NET while 18 out of 24 were SI-NETs. Overall case series of 68 GEP -NET (3718F - FDG / PET positive and 3118F - FDG / PET negative) patients was considered as a validation set for RT / qPCR downstream validation. In particular, 30 out of 68 were SI-NETs and 38 out of 68 were P-NETs. All patients provided a signed informed consent for the blood withdrawal, prior to177Lu-DOTATATE PRRT and downstream genomic analysis. An additional cohort of 17 healthy donors was considered for blood withdrawal and subsequent molecular comparison with P-NET.
[0208] This study was approved by the local ethical committee (CEROM), approval no. 6711 / 5.1 / 2016, and performed according to Good Clinical Practice standards and the Declaration of Helsinki.
[0209] Statistical analysis of the population distribution is provided in Table 4. Statistical analysis of age contribution to miR-signature and predictors predictivity of P-NETs and Healthy Donors, according to18F-FDG / PET is described in Figure 11.
[0210] All statistical analyses were performed using Stata / SE version 15.1 for Windows (StataCorpLP, College Station, TX, USA). TimeROC R package was used to plot time-dependent AUC curve and 95% confidence interval.
[0211] Plasma specimen’s collection
[0212] Blood samples from the overall case series were collected by venipuncture at baseline, prior to177LU-DOTATATE PRRT. Blood was collected in a 3 mL K3-EDTA collection sterile vessel. Whole blood was centrifuged at 2500g for 10 minutes at room temperatures to obtain platelet free plasma. Plasma was carefully transferred into new 15 mL conical tubes (Falcon ™) for a second centrifugation at 2500* g for 10 min to remove further cellular debris. At least 1 ml of supernatant was collected and stored at -80°C until required.
[0213] Small - RNA exosome - enriched fraction precipitation Thawed, frozen plasma samples were precipitated using Exoquick™, SCBI according to the manufacturer’s protocol to obtain exosome-enriched fraction small-RNAs. Exoquick™, SCBI allows the precipitation of 20-100 nm vesicles and to extract their content. The pellet containing exosome-enriched fraction RNAs was resuspended in 200 ul of sterile PBS (IX). Qiazol™ was added to provide cryopreservation and lysis for exosome associated miRNA extraction.
[0214] Small RNAs, including miRNAs, were isolated with miRNeasy serum / plasma kit (Qiagen Cat No. / ID: 217184) according to the manufacturer’s protocol.
[0215] One ml of plasma per sample was used and RNA eluted in 56 ul of RNase-free water.
[0216] Whole miRnome Next Generation Sequencing (NGS) profiling and analysis
[0217] Specimens from 24 GEP -NET patients were selected according to18F - FDG / PET outcome (1218F - FDG / PET positive and 1218F - FDG / PET negative) for whole miRNome NGS profiling.
[0218] Small RNA transcripts were converted into barcoded cDNA libraries. Library preparation was created with the NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England BioLabs Inc., USA). Libraries were pooled in 24 samples and run on Illumina NextSeq 550 platform, 2X75 cycles (Illumina, USA). The obtained BCL Files were converted to FASTQ Files and data quality was assessed by FastQC software. Reads shorter than 14 nucleotides were discarded from the analysis; the remaining reads were trimmed from the adapter sequences using Cutadapt software (http: / / joumal.embnet.org / index.php / embnetjoumal / article / view / 200). The trimmed reads were mapped against the precursor miRNA sequences downloaded from miRBase (Release 21) by the Shrimp algorithm. A matrix of integer values called counting matrices was created. DESeq2 Bioconductor’s package was used to identify the expression of miRNAs in the different groups. Endogenous controls for RT / qPCR were selected from the NGS data by considering the following criteria for each raw data: at least 5 reads for each sample and a log2 standard deviation value < 16.
[0219] RT / qPCR
[0220] Candidate miRNAs emerged from whole miRnome NGS profiling were validated by quantitative PCR (RT / qPCR) on the same samples and on an independent case series (n. 68). C-DNAs from frozen and thawed RNA were obtained on C1000 Touch Thermal Cycler (Bio rad™, Hercules, CA, USA); using TaqMan™ MicroRNA Reverse Transcription Kit (Applied Biosystems™; Foster city, CA, USA. Cat No. / ID: 4366596), cycling conditions were set according to the manufacturer’s protocol. TaqMan™ MicroRNA Reverse Transcription protocol was optimized multiplexing the TaqMan® miRNA Assay’s primers for the following targets: hsa-miR-3133, hsa-miR-4311, hsa- miR-5096, hsa-let-7i-3p normalized with hsa-miR-30d as reference housekeeping miRNA (multiplexing group 1); hsa-miR-519c-3p, hsa-miR-582-3, hsa-miR-3614-5p, hsa-miR-1246 and miR-423-3p as reference housekeeping miRNA (multiplexing group 2).
[0221] Universal Master Mix without UNG and TaqMan™ miRNA Assay specific probes, for each target miRNA were used according to the manufacturer’s protocol (Applied Biosystems™, Foster city, CA, USA. Cat No. / ID: 4440040). RT / qPCR analysis was conducted using Applied Biosystems™ 7500 Real-Time PCR Systems (Applied Biosystems™; Cat No. / ID: 4351104).
[0222] Expression level of single target miRNAs was normalized to hsa-miR-30d and the fold enrichment was obtained by means of the 2-ACTmethod, for the corresponding sample. In addition, “predictors” (Pl, P2, P3 and P) were created as the product of fold enrichments (2-ACT) of single miRNAs, to improve single targets and prognostic power.
[0223] Statistical analysis
[0224] Categorical data were expressed as absolute numbers and percentage, while continuous variables were shown as median and range.18F - FDG / PET positive and negative miRNAs and predictors median expression level (2-ACT) were compared. Normality of distribution of continuous data was assessed through the Shapiro-Wilk test. Wilcoxon and Mann-Whitney test, chi-square test were applied. To evaluate relations among two continuous variables, Pearson's correlation coefficient was applied.
[0225] The Receiver Operating Characteristic (ROC) curve, which is defined as a plot of sensitivity vs 1- specificity, was performed as evaluation of the performance of some of three miR-signatures and their combination to predict PET positivity, 6-month PFS and 12-months OS. AUC (with 95% confidence - CI) was calculated as a common measure of accuracy and values range from 0.5 to 1.0: higher values are corresponding to a better performance of tested values. AUC values higher than 0.7 were considered as acceptable values.
[0226] OS was calculated as the time from date of start PRRT therapy to date of death or last follow-up visit, while PFS was calculated at 6 - month. Alive patients were censored at last visit while patients without disease progression were censored at last tumor evaluation. Kaplan Meier (KM) curves were used to estimate the survival function and the Log-rank test was used to compare different subgroups in terms of OS or PFS. Median OS and median PFS were calculated, and 95% confidence intervals (95%CI) were reported. Immuno-miRNA-ISH
[0227] Study protocol was amended to allow the collection of histologically confirmed Gl, G2 and G3 P- NET specimens in order to evaluate the hsa-miR-5096 and SSTR2 relative expression at the tissue level. A novel semi-automated combined IHC and miRNAs-ISH protocol was developed for the simultaneous detection of SSTR2 protein and hsa-miR-5096 miRNA expression.
[0228] MiRCURY LNA miRNA Detection probe for hsa-miR-5096, U6 small nuclear, positive control probe (Qiagen, Valencia, CA; Cat No. / ID: 99002-15) and the scramble negative control probe (Qiagen, Valencia, CA Cat No. / ID: 99004-15), were used. Each probe was labelled 5’3’DIG. Before starting, double-DIG-LNA probes were denatured by heating (90°C for 4 min) and then diluted to 50 nM in the ISH buffer (miRCURY LNA miRNA ISH Buffer Set-FFPE).
[0229] The first phase (tissue preparation, permeabilization and hybridization) has been performed in manual mode according to the miRCURY LNA miRNA detection probe protocol, while the second phase (signal detection) is automated using the OptiviewDAB Detection Kit (Ventana Medical Systems, Tucson, Arizona, USA) on Ventana BenchMark ULTRA (Ventana Medical Systems). The automated protocol has been set considering pre-treatment, hybridization and stringency washing steps. Automated detection includes endogenous peroxidase blocking, casein blocking (16 min), incubation (37°C for 1 h) with primary prediluted mouse anti-DIG antibody (Ventana Medical Systems), and signal detection with OptiviewDAB Detection Kit (Ventana Medical Systems), consisting of HQ Universal Linker incubation (for 12 min), HRP Multimer incubation (for 12 min), Optiview Amplification Kit detection steps (12 min each). The double staining for SSTR2 expression was performed straight forward on Ventana BenchMark ULTRA after cell conditioning with ULTRA CC1 (Ventana Medical Systems) for 24 min and casein blocking, using the antibody anti-SSTR2 (UMB1-C Terminal-abl34152-Abcam) in Ventana antibody diluent, incubated (37°C for 1 h), detected with Ultraview Universal Alkaline Phosphatase Red Detection Kit (Ventana Medical Systems).
[0230] Finally, slides were counterstained with Haematoxylin II (Ventana Medical Systems), washed in tap water with soap in order to eliminate the coverslip oil, dehydrated in the stove and and mounted with xylene and EUkITT mounting medium (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany). All the images (20 fields / sample) were acquired using a Red-Green-Blue (RGB) 24-bit camera, embedded in an optical widefield microscope equipped with a 20X objective.
[0231] AND-Tool software interface development To analyze the marker expression of the single nuclei in the histological samples, we designed a user-friendly freely available Graphical User Interface (GUI) requiring a minimal user interaction. The GUI has been named Analysis Nuclei DAB (AND)-Tool and it allows to automatically segment the nuclei and extract intensity / morphological features at the single-nuclei level. The AND-Tool was created using Matlab (The MathWorks, Inc., Massachusetts, USA). Source code, standalone execuTable version, documentation, and sample images are available for download from: https: / / sourceforge.net / p / andtool / .
[0232] First, all the acquired RGB images were corrected for uneven illumination by subtracting the background estimated with the standard ImageJ / Fiji rolling ball algorithm. Then, the RGB images were unmixed using the Colour Deconvolution ImageJ / Fiji plugin imposing the “FastRed-FastBlue- DAB” modality. The FastRed channel was used to subdivide the field of view into three distinguished types of regions of interest (ROIs, i.e., dark-red, light-pink and white ROIs) according to the local intensity and two fixed thresholds (hereafter named Thl and Th2, with Thl lower than Th2), manually defined from the user just once for all the images to be analyzed. The “dark-red” ROIs are those regions with intensity values of the FastRed channel between 0 and Thl; the “lightpink” ROIs, with intensity values between Thl and Th2; the “white” ROIs, with intensity values between Th2 and 255. Nuclei have been detected using the FastBlue and the DAB channels. To detect the nuclei, we used an intensity -based k-mean classifier automatically subdividing the single channels into three regions: white background, weak cytoplasmic signal, and nuclear signal. The standard watershed segmentation algorithm was then used to analyze the nuclear signal and split touching objects to proceed in a single-nuclei analysis. Objects with size not compliant with that of a nucleus were filtered out to compute the masks of the real nuclei.
[0233] Single-nuclei intensity / morphological features and region-based statistics were computed using the intensity maps created by subdividing the sample areas in dark-red, light-pink and white ROIs. Two types of nuclei have been considered: the ones positive for the DAB staining, and the ones positive for the FastBlue staining but not positive for DAB
[0234] Cell culture
[0235] Hsa-miR-5096 and SSTR2 expression were assessed in NT-3, BON-1 and QGP-1 cell lines30(RRID: CVCL__VG81; CVCL 3985; CVCL_3143). NT-3 cells were cultivated in RPMI medium supplemented with 10% FCS, penicillin / streptomycin, HEPES both with EGF (20 ng / mL; PreproTech, Rocky Hill, New Jersey), and FGF2 (10 ng / mL; PreproTech, Rocky Hill, New Jersey) and without growth factors (bFGF; EGF). NT-3 cells were cultivated in culture dishes coated with collagen type IV from Human Placenta (Sigma-Aldrich, Homefield Road, Haverhill, UK; Cat No. / ID: 27663). BON-1 and QGP-1 were cultivated in culture dishes in DMEM high glucose and RPMI medium respectively, supplemented with 10% FCS, 1% penicillin / streptomycin and L- glutammine, 15mM HEPES.
[0236] Hsa-miR-5096 mimic transfection
[0237] To evaluate SSTR2 downmodulation in NT-3 cell lines, 3 x 105cells were plated into 6-well dishes coated with collagen type IV from Human Placenta (Sigma-Aldrich, Homefield Road, Haverhill, UK; Cat No. / ID: 27663). After 24 hours, 15 and 30 pmol of hsa-miR-5096 miRCURY LNA miRNA Mimic and Scramble (Qiagen, Valencia, CA) were transfected using RNAiMAX transfection reagent (Invitrogen®, Carlsbad, CA, USA) according to the manufacturer’s instructions. Conversely, to evaluate SSTR2 up-modulation in NT-3 cell lines, 5 x io5cells were plated into 12-well dishes coated with collagen type IV from Human Placenta; while 1.75 and 2.5* IO5of BON-1 and QGP-1 were plated into standard 12-well dishes, respectively. Then, 100 nM pmol of hsa-miR-5096 miRCURY LNA miRNA Inhibitor and Scramble (Qiagen, Valencia, CA) were transfected using RNAiMAX transfection reagent (Invitrogen®, Carlsbad, CA, USA) according to the manufacturer’s instructions. Cells and culture medium were collected at 48h and 72h after transfection. A Fixed volume of 350 ul of Trizol® reagent has been added to dried pellets and miRNeasy Mini Kit 50 (Qiagen, Valencia, CA Cat No. / ID: 217004) was used for RNA extraction to quantify hsa-miR-5096 and SSTR2 RNA levels. Concurrently, the culture medium was collected, and the exosome-enriched fraction was precipitated using Exoquick™ protocol for cultured cells (SCBI Cat No. / ID: EXOTC50A-1). MiRNAs contained in the exosome-enriched fraction were extracted using miRNeasy serum / plasma kit (Qiagen, Valencia, CA; Cat No. / ID: 217184), according to the manufacturer’s protocol.
[0238] SSTR2 expression in NT-3 cell lines was assessed by RT / qPCR, after 24h and 72h mimic transfection. Expression values were expressed as (Ct) values normalized to the housekeeping gene HPRT (2ACTmethod) and then normalized to the corresponding scramble-control using the 2AACTmethod. Transfection efficacy and statistical significance were assessed by parametric t-test, comparing expression median value (+ / -SD).
[0239] P-NEN and non-NEN cell lines culturing
[0240] P-NEN (NT-3 and BON-1) and a non-NEN cell line (CAP AN-1). NT-3 were cultivated in RPMI medium supplemented with 10% FCS, penicillin / streptomycin, HEPES with EGF (20 ng / mL; PreproTech, Rocky Hill, New Jersey), and FGF2 (10 ng / mL; PreproTech, Rocky Hill, New Jersey) and without growth factors (bFGF; EGF). NT-3 cells were cultivated in culture dishes coated with collagen type IV from Human Placenta (Sigma-Aldrich, Homefield Road, Haverhill, UK; Cat No. / ID: 27663). BON-1, were cultivated in DMEM medium supplemented with 10% FCS, penicillin / streptomycin and L-glutamine while CAPAN-1 were cultivated in IMDM medium supplemented with 20% FCS, penicillin / streptomycin and L-glutamine.
[0241] SSTR2 expression assessment
[0242] SSTR2 transcript expression was assessed in P-NEN (NT-3 and BON-1) and a non-NEN cell line (CAPAN-1) by RT / q-PCR, using HPRT as reference house-keeping transcript.
[0243] Hsa-miR-5096 Target Site Blocker transfection P-NEN cell lines
[0244] To increase SSTR2 expression in P-NEN cell lines, 3 x 105 cells were plated into 6-well dishes (NT-3 cell lines only, were plated in dishes coated with collagen type IV from Human Placenta (Sigma-Aldrich, Homefield Road, Haverhill, UK; Cat No. / ID: 27663). After 24 hours, 50 and 75 nM of hsa-miR-5096 miRCURY LNA miRNA Power TSB ivr (15) - No Modification and Scramble control (Qiagen, Valencia, CA) were transfected using RNAiMAX transfection reagent (Invitrogen®, Carlsbad, CA, USA) according to the manufacturer’s instructions. Cells were collected 48h, 72h and 96h after transfection. The SSTR2 transcript displays 4 miR-B binding sites of two compatible sequences (SSTR2 5096 1310 and SSTR2 5096 1025) for miR-B. The TSB for each binding site (cat.n° YT0071270-FFA ; cat.n° YT0071263 respectively) was transfected either alone or in combination to shield and prevent miR-B binding to SSTR2 transcripts. TSBs in combination (50 nM) were transfected in NT-3 cell lines, cultivated with and without growth factors since the presence of growth factors significantly alters SSTR-2 expression. SSTR2 expression was also quantified at earlier times (6h,18h, and 24h) after transfection. A Fixed volume of 700 ul of Trizol® reagent has been added to cell dried pellets and miRNeasy Mini Kit 50 (Qiagen, Valencia, CA Cat No. / ID: 217004) was used for RNA extraction. SSTR2 expression was assessed at each time point and condition by RT / qPCR. Expression values were expressed as (Ct) values normalized to the housekeeping gene HPRT (2-ACT method) and then normalized to the corresponding scramble-control using the 2-AACT method. SSTR2 modulation and statistical significance were assessed by parametric t-test, comparing expression median value (+ / -SD).
[0245] Immunofluorescence To evaluate SSTR-2 protein expression after the inhibition of hsa-miR-5096 via miRCURY LNA, we performed immunofluorescence staining on QGP-1 cells grown and transfected on coverslip slides. QGP-1 cells were fixed for 10 minutes at 4° C with 10% Formalin, permeabilized with Tween-Triton 0.3% in PBS and blocked with 1% Bovine Serum (BSA) before incubation with the Human Somatostatin R2 / SSTR2 PE-conjugated Mouse IgG2A Antibody (Clone # 402038) for 2h at room temperature. Dapi staining was used to counterstain the nucleus. miRNA and protein in situ detection
[0246] A novel semi-automated miR-protein in situ staining protocol was developed for the simultaneous detection of hsa-miR-5096 and SSTR2 protein expression. MiRCURY LNA miRNA Detection probe for hsa-miR-5096, U6 small nuclear, positive control probe (Qiagen, Valencia, CA; Cat No. / ID: 99002-15) and the scramble negative control probe (Qiagen, Valencia, CA Cat No. / ID: 99004-15), were used. Each probe was labeled 5 ’3 ’DIG. Before starting, double-DIG-LNA probes were denatured by heating (90°C for 4 min) and then diluted to 50 nM in the ISH buffer (miRCURY LNA miRNA ISH Buffer Set-FFPE). The first phase (tissue preparation, permeabilization and hybridization) has been performed in manual mode according to the miRCURY LNA miRNA detection probe protocol, while the second phase (signal detection) is automated using the Ventana BenchMark ULTRA platform (Ventana Medical Systems, Tucson, Arizona, USA). The automated protocol includes endogenous peroxidase blocking, casein blocking (16 min), incubation (37°C for 1 h) with primary prediluted mouse anti-DIG antibody (Ventana Medical Systems), to reveal the miR signal detected with OptiviewDAB Detection Kit (Ventana Medical Systems), consisting of HQ Universal Linker incubation (for 12 min), HRP Multimer incubation (for 12 min), and amplified with the Optiview DAB Amplification Kit (12 min). The revelation of SSTR2 protein expression was performed straight forward on Ventana BenchMark ULTRA, after cell conditioning with ULTRA CC1 (Ventana Medical Systems) for 24 min and casein blocking, using the antibody anti-SSTR2 (UMB1-C Terminal-abl34152-Abcam) in Ventana antibody diluent, incubated (37°C for 1 h), detected with Ultraview Universal Alkaline Phosphatase Red Detection Kit (Ventana Medical Systems). Finally, slides were counterstained for 8 minutes with Haematoxylin II (Ventana Medical Systems) and for 8 minutes with Bluing Reagent (Ventana Medical Systems), washed in tap water with soap to remove the liquid coverslip, dehydrated in the stove and mounted with xylene and EUKITT mounting medium (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany). Specifically, this protocol reveals as first marker the miR in brown by using an anti-DIG antibody followed by the protein detection in red with the anti-SSTR2 antibody. Labeling with digoxigenin (DIG) allows miR- staining stability after double immunohistochemical rounds performed on the automated Ventana platforms. Additionally, our approach avoids antigen retrieval which typically occurs when immunohistochemistry is performed prior to ISH. For this purpose, we compared the results obtained from the single IHC for SSTR2 expression with those obtained with the miR-protein protocol and we assessed that there were no differences in terms of protein expression (Source Data not shown, see Availability of data and materials section for data repository). IHC whole slides images were acquired with the high-resolution slide scanner Aperio CS2 using the focus-ISH algorithm with a 40x magnification, which provides scanned images with the accuracy and resolution required for ISH.
[0247] AND-Tool software interface development
[0248] To analyze the marker expression of the single nuclei in the histological samples, we designed a user-friendly open-source Graphical User Interface (GUI) requiring a minimal user interaction. The GUI has been named Analysis Nuclei DAB (AND)-Tool and it allows to automatically segment the nuclei and extract intensity / morphological features at the single-nuclei level. The AND-Tool was created using Matlab (The MathWorks, Inc., Massachusetts, USA). Source code, standalone executable version, documentation, and sample images are available for download from: https: / / sourceforge.net / p / andtool / . First, all the acquired RGB images were corrected for uneven illumination by subtracting the background estimated with the standard ImageJ / Fiji rolling ball algorithm. Then, the RGB images were unmixed using the Color Deconvolution ImageJ / Fiji plugin imposing the “FastRed-FastBlue-DAB” modality (36). The FastRed channel was used to subdivide the field of view into three distinguished types of regions of interest (ROIs, i.e., “dark-red”, “lightpink” and “white” ROIs) according to the local intensity and two fixed thresholds (hereafter named Thl and Th2, with Thl lower than Th2), manually defined from the user just once for all the images to be analyzed. The “dark-red” ROIs are those regions with intensity values of the FastRed channel between 0 and Thl; the “light-pink” ROIs, with intensity values between Thl and Th2; the “white” ROIs, with intensity values between Th2 and 255. Nuclei have been detected using the FastBlue and the DAB channels. To detect the nuclei, we used an intensity-based k-mean classifier automatically subdividing the single channels into three regions: white background, weak cytoplasmic signal, and nuclear signal. The standard watershed segmentation algorithm was then used to analyze the nuclear signal and split touching objects to proceed in a single-nuclei analysis. Objects with size not compliant with that of a nucleus were filtered out to compute the masks of the real nuclei. Single-nuclei intensity / morphological features and region-based statistics were computed using the intensity maps created by subdividing the sample areas in dark-red, light-pink and white ROIs. Two types of nuclei have been considered: the ones positive for the DAB staining, and the ones positive for the FastBlue staining but not positive for DAB. AND-Tool software analysis considered 10 fields per sample. The software was designed to identify three different levels of SSTR2 expressing nuclei: high as “dark-red” mask (identified by the software in the intensity range 0-Thl, with the threshold Thl: 100); intermediate as “light-pink” mask (identified by the software in the intensity range Thl-Th2, with the threshold Th2: 190) and the negative areas as “white” mask (identified by the software in the intensity range Th2-255, with 255 being the maximum value of intensity in the 8-bit gray-level conversion). AND-Tool was able to contemporary recognize areas with miR positive nuclei as DAB channel positivity. Correlation analysis has been conducted plotting the average percentage of hsa-miR-5096 positive nuclei on overall analyzed cells in different SSTR2 expression areas. Spearman test was applied to determine r2 and p value.
[0249] Tables
[0250] Table 1. Single miRNAs and predictors (Pl, P2, P3, P) significant AUC values, sensitivity, and specificity of 18FDG / PET prediction in PAN-NEN patients. AUC: Area Under the Curve; Sens.(%); sensitivity percentage; Spec.(%): specificity percentage; C.I: Confidence interval.
[0251] Table 2. Hsa-miR-5096 significant AUC values, sensitivity and specificity of 6-month PFS and OS in PAN-NEN patients and in the and related for18FDG / PET positive subset predictions, treated with177LU-DOTATE PRRT. AUC: Area Under the Curve; Sens.(%): sensitivity percentage; Spec.(%): specificity percentage; C.I: Confidence interval. 18FDG / PET (+): 18FDG / PET positive PAN-NENs subgroup.
[0252] Table 3
[0253] Table 4 Demographic and clinical pathological al features according to 18FDG / PET outcome: PAN-NEN case series (n= 38) p-value from Fisher exact test for categorical variables and Wilcoxon Mann- Whitney for continuous variable
[0254] Table 5 Single miRNAs and combined predictors (Pl, P2, P3 and, P) expression values in P-NET18FDG / PET positive and negative patients and Healthy Donors (HDs). Kruskall-Wallis test was used to compare the three groups. Dunn test was used for post-hoc comparisons.
[0255] Table 6. AUC comparison of predictors (Pl, P2, P3 and P) for18FDG / PET positivity predictions.
[0256] Results
[0257] Patients’ characteristics
[0258] To evaluate the potential role of small-non-coding molecules, such as miRNAs as prognostic biomarkers of tumor glucose metabolism and aggressiveness, 24 histologically or cytologically confirmed Gl, G2 and G3 well-differentiated GEP - NET patients (WHO2017) were enrolled according to18F-FDG / PET outcome. 1218F-FDG / PET positive and 1218F-FDG / PET negative patients were considered as “training set” for whole miRNome NGS profiling. Six out of 24 GEP- NET from the training cohort were P-NETs, while 18 out of 24 were SI-NETs. Two independent cohorts (Gl, G2 and G3 well-differentiated GEP-NETs) of 30 SI-NETs and 38 P-NETs (see Table 4 for P-NET patients characteristics) were considered separately for RT / qPCR validation and downstream analysis.
[0259] Example 1
[0260] NGS analysis from liquid biopsy reveals circulating exosomal miRNA-signature associated with18F-FDG / PET outcome in P-NET patients.
[0261] Whole miRNome NGS profiling was performed on 24 GEP-NETs (1218F-FDG / PET positive and 1218F-FDG / PET negative). Principal compoNETts analysis (PCA) excluded one out of 24 samples due to poor number of reads. NGS analysis identified 2588 miRNAs. Of those, 2474 miRNAs displayed at least one read in one of the samples analyzed. The bioinformatic analysis revealed hsa- miR-1246, hsa-miR-4311 and hsa-miR-485-5p as differentially expressed miRNAs (Log2FC >=1; adj. p-value < 0,1) between18F-FDG / PET positive and negative GEP-NET patients (Figure 2 A). Then, we took into consideration the contribution of the primary tumor site of origin and 17 SI- NETs and 6 P-NETs were considered separately to assess if disease specific signatures exist. Interestingly, eight miRNAs (hsa-miR-1246; hsa-miR-5096; hsa-let-7i-3p; hsa-miR-3133; hsa-miR- 3614-5p; hsa-miR-483-5p; hsa-miR-519c-3p; hsa-miR-582-3p) emerged as differentially expressed between18F-FDG / PET positive and negative P-NET patients (Figure 2B). Conversely, no miRNA correlated with18F-FDG / PET status in the SI-NET subset. Altogether a group of 10 non redundant miRNAs were considered for further confirmatory experiments in plasma samples from 68 independent GEP-NET patients, (30 SI-NETs and 38 P-NETs) by RT / qPCR. Three circulating miRNAs (hsa-miR-4311, p < 0 001; hsa-miR-5096, p < 0 0001; hsa-let-7i-3p, p < 0 00001) significantly correlated with18F-FDG / PET status in the P-NET subset (Figure 2C-E). In addition, in order to achieve higher prognostic power single miRNAs were combined into four predictors (Pl, P2, P3 and P) as the product of fold enrichments (F.E) of each circulating miRNA. All predictors, Pl (hsa-miR-4311, hsa-let-7i-3p), P2 (hsa-mir-5096, hsa-let-7i-3p), P3 (hsa-miR-4311, hsa-mir- 5096) and P (hsa-miR-4311, hsa-mir-5096, hsa-let-7i-3p) significantly correlated with18F- FDG / PET positive status with P2 showing the highest significance (p<0- 00001) (Figure 2G). In addition, hsa-miR-5096, hsa-let-7i-3p, P2 and P emerged to be significantly increased in P-NET18F-FDG / PET positive patients as compared to healthy donors (p < 0 05) (Figure 2 D, E, G, I). Of note, the levels of hsa-let-7i-3p alone or in combination with both hsa-miR-4311 and hsa-mir-5096 in predictor P, were significantly lower in plasma of18F-FDG / PET negative patients as compared to healthy donors (p < 0 05) (Figure 2E, I). Statistical analysis, according to18F-FDG / PET excluded age contribution to miR-signature predictivity (Figure 11 and Table 4). Expression values for the three single miRNAs and combined predictors (Pl, P2, P3 and P) in P-NET18F-FDG / PET positive and negative patients and Healthy Donors (HDs) are reported in Table 5.
[0262] In brief, NGS whole miRNome profiling analysis and following RT / qPCR validation identified 3 miRNAs in the exosomal fraction of P-NET patients plasma associated with18F-FDG / PET positive outcome.
[0263] Example 2
[0264] Identified miRNAs as companion prognostic biomarkers for18F-FDG / PET in P-NET management (Type 0 - NIH classification) We evaluated the predictive power of single miRNAs and predictors in relation to18F-FDG / PET positivity. ROC analysis revealed that higher circulating expression levels of hsa-miR-4311 (AUC: 0-81; 95% CI: 0-66-0-94), hsa-miR-5096 (AUC: 0-82 95% CI: 0-69-0-95) and hsa-let-7i-3p (AUC: 0-95; 95% CI: 0-88-0-99) alone or combined into predictors can predict18F-FDG / PET positive outcome with AUCs between 0-81 and 0-95 (Figure 3a, b and Table 1). In particular, the combination of hsa-miR-5096 and hsa-let-7i-3p into predictor P2 (cut-off: 33-55) showed the highest predictivity (AUC: 0-95; 95% CI: 0-89-1 00) for18F-FDG / PET positive lesions. The statistical comparison among different predictors is shown in Table 6.
[0265] Example 3
[0266] Identified miRNAs as independent predictors of survival for P-NET management (Type II - NIH classification)
[0267] ROC analysis was performed to evaluate the predictivity of the miRNAs signature for 6-months progression free survival (PFS) and 12-months overall survival (OS).
[0268] ROC analysis of single miRNAs and their combination into predictors (Figure 12a) showed that hsa-miR-5096 best predicts 6-month PFS (AUC: 0-90; 95% CI: 0-76 - 1-00; Figure 4a) and 12- month OS (AUC: 0-89; 95% CI: 0-72-1 00; Figure 4b) in P-NET patients treated with 177Lu- DOTATATE based PRRT. Time dependent (range: 3 - 24 month) ROC curve analysis for PFS showed that hsa-miR-5096 maintains prognostic AUC values (>= 0-7) up to 24 months (Figure 4c), while values >= 0-7 were observed for predictors P, P2 and P3 in the first 12 months only (Figure 13). Furthermore, circulating hsa-miR-5096 expression level (cut-off: 70) stratified P-NET patients with poor prognosis from responders to PRRT for PFS (p < 0-001; Figure 4D) and for OS (p < 0-05; Figure 4e). Figure 12b-l reports KM analysis of 6-mo PFS for combined predictors.
[0269] Importantly, hsa-miR-5096 in18F-FDG / PET positive patients emerged to be an accurate predictor of PFS (AUC: 0-86; 95% CI: 0-68-1 00; Figure 5a). Specifically, an identified cut-off of 70 for hsa- miR-5096 resulted in 100% sensitivity and 68% specificity for 6-month PFS prediction in18F- FDG / PET positive patients, identifying a subset of18F-FDG / PET positive patients that progress even earlier and do not benefit from Lu-PRRT treatment (p< 0 01; Figure 5b). Finally, while hsa- mir-5096 represents an accurate predictor also for 12-mo OS in the18F-FDG / PET positive subset (AUC: 0-86; 95% CI: 0-63-1 00; Figure 5b), a cut-off of 70 could not significantly stratify18F- FDG / PET positive patients for 12-mo OS predictions (p:0-22; Figure 5d). Significant AUC values, sensitivity and specificity for 6-month PFS and OS in all and18F-FDG / PET positive P-NET patients are shown in Table 2. In summary, hsa-miR-5096 appeared to be an accurate and independent predictor of PFS and of OS in P-NET patients. Moreover, we candidate hsa-mir-5096 as a clinically relevant companion biomarker which can improve18F-FDG / PET predictive power for PRRT.
[0270] Example 4
[0271] Hsa-miR-5096 overexpression inversely correlated with SSTR2 expression levels
[0272] To further assess its clinical impact in P-NET management, the expression levels of the miRNAs of the signature were correlated with several clinicopathological features, including68Ga-DOTA-PET / CT maximum standardized uptake value (SUV max). Interestingly, increased expression levels of circulating hsa-miR-5096 (cut-off: 70) correlated with lower68Ga-DOTA-PET / CT SUVmax (p < 0 05) in P-NET patients (Figure 7a). Diagnostic imaging of SSTR2 expression with68Ga-DOTA- conjugated peptides is the base for the clinical management of P-NET patients to route them to PRRT. The observed inverse correlation of hsa-miR-5096 expression with SUVmax raised the hypothesis that a direct interference with the SSTR2 transcript may exist and result in a decreased amount of SSTR2 at the plasma membrane of tumor cells. To confirm this anti correlation, a semiautomated immune-miRNA-ISH approach coupled with a dedicated pipeline of analysis (AndTool software) was set up and applied to detect and quantify hsa-miR-5096 and SSTR2 expression simultaneously on FFPE tumor tissue slices. Nine independent P-NET FFPE tumor tissue specimens were first reviewed by an expert pathologist for SSTR2 expression level. Three were negative, four were frankly positive (100%; 3+) and two displayed SSTR2 heterogeneous expression. SSTR2 expression heterogeneity level affects68Ga-based prognostic imaging and the efficacy of targeted therapies. AndTool software analysis of 9 P-NET cases, considering 10 fields per sample, identified a total number of 154154 cells with an average value of 15186±7547 analyzed cells per sample. In particular, 54% of overall analyzed cells did not express SSTR2, while 46% displayed low / heterogeneous (23%) to high (23%) expression patterns (Figure 7b). Aggregated analysis of co-occurrence confirmed that 75% of nuclei in SSTR2 negative areas express high levels of hsa-miR-5096 in contrast with 37% within SSTR2 highly expressing areas. Importantly, areas with low / moderate SSTR2 expression, which also define P-NET patients eligible for PRRT, showed an intermediate frequency of 65% hsa-mir-5096 expressing nuclei (Figure 7c). Those results show that hsa-miR-5096 is largely expressed by P-NET tumor cells and that the inverse correlation with68GaSUVmax observed in blood mirrors an inverse correlation also at the tissue level.
[0273] Example 5 Hsa-miR-5096-5p modulates SSTR2 expression
[0274] In order to investigate the mechanism of action of hsa-miR-5096 on SSTR2 expression we performed bioinformatic analysis with on-line predictive softwares for miRNA targets. Target mining on TargetMiner, Targets canVert, miRDB and RefSeq revealed that the 3’-UTR of SSTR2 (NCBI Gene ID: 6752; GenBank Accession:NM_001050.03) harbors 4 binding sites for hsa-miR- 5096 (miRbase Accession: MIMAT0020603; Sequence: GUUUCACCAUGUUGGUCAGGC [SEQ ID N. 1]). In particular, two different sequences (GUGAAAA; GGUGAAA) are distributed on 4 sites at the 3’-UTR of the gene (723-729; 3001-3007 and 1008-1015; 2290-2260, respectively) and are predicted to be recognized by the CACUUU and CCACUUU sequences of hsa-miR-5096. The presence of the binding sites supported a possible regulation of expression via direct RNA interference in P-NET tumor cells (Figure 8a).
[0275] In order to test this hypothesis we performed in vitro experiments on the insulinoma NT-3 cell line, as a newly established preclinical model of well differentiated P-NET30. Importantly, the neuroendocrine phenotype and morphology as well as the proliferative rate and SSTRs expression in NT-3 cells can be modulated by growth factors (bFGF / EGF) in culture. As first, we assessed SSTR2 and hsa-miR-5096 expression level in NT-3 cells and found that they inversely correlated also in NT-3 cells (Figure 7b-c). In particular, SSTR2 expression was significantly enhanced (p< 0 005) in NT-3 cells, in a condition characterized by low proliferation rate (10-9 + / - 0-7 days), low ki-67 percentage (2 0 %) and absence of growth factors in the culture media30. Conversely, hsa- miR-5096 resulted to be significantly downregulated (p< 0 005) in these conditions (Figure 7c), confirming its negative correlation with SSTR2 expression and in agreement with our observations on P-NET tissue. In this perspective, hsa-miR-5096 seems to be part of a complex rewiring of gene expression to promote a metabolic switch and lineage differentiation in the insulinoma NT-3 cell line.
[0276] To further substantiate the putative role of hsa-miR-5096 as a post-transcriptional modulator of SSTR2 expression, functional RNA interference mediated by hsa-miR-5096 was assessed in NT-3 cells, cultivated in absence of bFGF and EGF and characterized by high SSTR2 and low hsa-miR- 5096 expression. As expected, the ectopic delivery of hsa-miR-5096 via miRCURY LNA transfection resulted in a significantly enhanced expression of hsa-miR-5096 compared to not- transfected and scramble mimic transfected NT-3 cells (pO OOOl; Figure 8d). Treatment of NT3 cells with scramble control significantly affected SSTR2 expression (p<0 005; Figure 8e). However, hsa-miR-5096 mimic overexpression further decreased SSTR2 mRNA level to 33% as compared to scramble treated cells at 72 hours after treatment (p<0 005; Figure 8e). These results suggest a direct mechanism where the SSTR2 3’-UTR can be actually targeted by hsa-miR-5096 reducing the stability and the dosage of SSTR2 transcripts.
[0277] In addition, we performed experiments using target site blockers aimed to shield specific sequences targeted by hsa-miR5096 on the SSTR-2 3’-UTR. Interestingly, the treatment with a single TSB targeting only two sites was unable to stabilize SSTR-2 transcript while the combination of 2 TSBs covering all 4 sites recognized by hsa-miR-5096 allowed SSTR-2 mRNA overexpression in NT-3 cells.
[0278] We previously reported that increased levels of hsa-miR-5096, via miRCURY LNA transfection, can downmodulate SSTR2 transcripts. Follow up experiments confirmed the role of hsa-miR-5096 as a druggable modulator of SSTR2 expression. Preliminary evidence in NT-3 cells shows that a combination of hsa-miR-5096 - miRCURY LNA miRNA Power TSBs designed to target all identified hsa-miR-5096 binding sites on SSTR-2 3’-UTR at 50nM promotes a significant increase of SSTR2 transcripts at 48h post transfection (p< 0,05; figure 9a-b ). BON-1, CAP AN-1 and NT-3 (cultured with growth-factors), which display lower levels of SSTR2, did not display significant SSTR2 transcript increase.
[0279] In addition, to assess the potential early activity of TSBs as an early event of transcriptional machinery. SSTR2 expression was quantified at 6h, 18h, and 24h in NT-3 cultivated in standard RPMI and in RPMI supplemented with growth factors. NT-3 cultivated in standard RPMI displayed a significant increase of SSTR-2 transcripts at 18h post transfection of TSBs in combination (50nM) (p<0,05; figure 10 a-b). In contrast, NT-3 cultivated with growth factors do not display SSTR2 significant increase.
[0280] In order to further demonstrate the direct involvement of hsa-miR-5096 in the regulation of SSTR- 2, NT-3 cells were treated with has-miR-5096-inhibitor while cultivated with growth-factors (SSTR2 low / hsa-miR-5096 high endogenous expression) and showed a significant increase in SSTR2 transcript quantity (+42%, p<0.005; Figure 7D).
[0281] To further substantiate the function of hsa-miR-5096 as putative post-transcriptional modulator of SSTR2 expression, its basal expression level was investigated also in preclinical models of highgrade PanNET: QGP-1 and BON-1 cells, characterized by high proliferation rate and high ki-67 percentage (about 80%). QGP-1 and BON-1 displayed significantly different amounts of SSTR2, inversely associated with significantly different hsa-miR-5096 amounts (p<0.001 and p<0.01, respectively; Figure 7E). Given their high amount of hsa-miR-5096, associated with low SSTR2 expression, QGP-1 cells were chosen as model to revert SSTR2 expression in high grade PanNET cells by hsa-miR-5096-inhibitor treatment. Importantly, QGP-1 treated cells showed a 39% significant increase of SSTR2 transcripts (p<0,01; Figure 7F) mirrored by SSTR-2 upregulation at the protein level as shown by immunofluorescence staining (Figure 7G).
[0282] Altogether these results suggest that the delivery of specific small non-coding molecules hindering hsa-miR-5096 activity into PanNET cells can translate into SSTR2 transcripts increased stability and higher SSTR2 amount on the cell membrane.
[0283] Example 6
[0284] Hsa-miR-5096 expression inversely correlates with SSTR2 expression in PanNET
[0285] To further assess its clinical impact in PanNET management, the expression levels of the miRNAs of the signature were correlated with several clinico-pathological features, including 68Ga DOTATOC PET / CT SUVmax.
[0286] Interestingly, increased expression levels of circulating hsa-miR-5096 (cut-off: 70) correlated with lower 68Ga-DOTATOC PET / CT SUVmax (Mann Whitney test, pvalue < 0.05) in PanNET patients (Figure 14a). According with previous observation, a negative association of 68Ga-DOTATOC PET / CT SUVmax and 18F-FDG-PET / CT positivity in patients displaying low and high levels of hsa-miR-5096 (cut-off:70; Spearman: p< 0,0169; r2: -0,4928); was observed (Figure 14B). Since 68Ga-DOTATOC PET / CT SUVmax mirrors SSTR2 expression level in PanNET patients, the observed inverse correlation suggested that hsa-miR-5096 may be involved in SSTR2 regulation also at the tissue level. To confirm this hypothesis, a semi-automated immune-miRNA-ISH approach coupled with a dedicated pipeline of analysis (AND-Tool software) was set up and applied to detect and quantify hsa-miR5096 and SSTR2 expression simultaneously on FFPE tumor tissue samples. Eight independent Gl, G2 (n.5) and G3 (n.3) PanNET FFPE tumor tissue specimens were first reviewed by an expert pathologist for SSTR2 expression level. Two were negative, four were frankly positive (100%; 3+) and two displayed SSTR2 heterogeneous expression (Figure 14C). AND-Tool software analysis of n=8 PanNET FFPE samples (Figure 14d), considering 10 ROIs (Regions Of Interest) per patient, 76 total ROIs (four ROIs dropout due to presence of a tissue folding in one case sample), resulted in the extraction of 197847672 pixels, corresponding to an average value of 15186 ± 7547 analyzed cells per sample. Using AND-Tool software we extracted Dark-red, Light-pink, and White masks for each ROIs separately. Subsequently, we applied a pixelbased analyses of Dark-Red (SSTR2 positive), Light-Pink (SSTR2 low) and White (SSTR2 negative) masks showing 27% Dark-Red pixels, corresponding to the amount of frankly positive cells; 22% of LightPink pixels, corresponding to the amount of low expressing cells; and 51% White pixels of negative expression areas (Figure 14e). Correlation analysis confirmed a significant inverse association between the number of hsa-miR-5096 positive cells and SSTR2 expression level on PanNET tissue (Spearman; r=-0,4676; p<0,0001; Figure 141). Importantly, areas with low / moderate SSTR2 expression, which also define patients eligible for PRRT, showed an intermediate frequency of hsa-miR-5096 positive nuclei.
[0287] These observations agree with a mechanistic model where hsa-miR-5096 expressing cells can contribute to tumor heterogeneity and mosaicism through a paracrine SSTR2 interference that could hinder PanNET targeting and ineffective responses to PRRT.
[0288] Those results show that hsa-miR-5096 is expressed by PanNET tumor cells and that, the inverse correlation between circulating hsa-miR-5096 levels and 68Ga-DOTATOC PET / CT SUVmax values, mirrors an interplay occurring also at the tissue level.
[0289] Discussion
[0290] Experiments focused on advanced, metastatic, and inoperable well-differentiated PanNETs, often routed to PRRT, targeting SSTRs with radiolabelled somatostatin analogues (SSAs). Nonetheless, while 68Ga-DOTATOC PET / CT SUVmax functional imaging is used to drive eligibility to PRRT and to predict its efficacy, the heterogeneous expression of SSTR2 in PanNETs affects PRRT sensitivity and accuracy (14). Indeed, despite 68GaDOTATOC PET / CT SUVmax helps to stratify PanNET patients, about 60% of patients do not respond to SSTR-based PRRT. Of note, PanNETs often display an increased glucose metabolism when compared to NETs from other sites of origin. Indeed. SINETs are reported to be low-metabolism neoplasms in which 18F-FDG-PET / CT showed lower prognostic power. On the other hand, aggressive behavior that correlates with 18F-FDG- PET / CT positivity and with poor PFS when treated with PRRT, suggesting a key role of glucose metabolism in the development of a PRRT refractory tumor phenotype (1, 17, 20, 25). Both functional imaging with 18F-FDG PET / CT and 68Ga-DOTATOC PET / CT have shown to be prognostic and predictive, but with some limitations, such as the difficulty of quantifying the uptake and a lack of standardization for the uptake from multiple lesions. In this framework, it is still of clinical relevance to i) better understand the biology of these tumors, investigating molecular mechanisms leading to a PRRT refractory phenotype; ii) improve prognostic and predictive algorithms and provide better stratification of PanNETs undergoing PRRT.
[0291] 18F-FDG / PET is considered a useful prognostic tool to assess increased glycolytic metabolism in a variety of neuroendocrine tumors, especially in P-NETs where18F-FDG / PET positivity is associated with tumor aggressiveness and worse prognosis1,2°’27. However,18F-FDG / PET predictive power for P-NET patients treated with PRRT is affected by the difficulty of combining data from multiple lesions in a meaningful, quantitative and objective way and active research on artificial intelligence and deep learning analysis of imaging results is trying to fill this gap3 I 33. The molecular bases of this resistance and of the heterogeneity in patients' response are not known and markers associated with both features are a clinical unmet need.
[0292] In 2007, US National Cancer Institute prioritized the development of novel circulating biomarkers as a key research goal, to facilitate early diagnosis, monitoring and management of NET disease34. In addition, in 2016 the multinational, multidisciplinary Delphi consensus stated that measurements based on single analytes lack sensitivity, specificity and provide minimal information about the proliferative, metabolic, and metastatic features of NETs which are critical mainstays of tumor evolution. For these reasons, the combination of in vivo spatial and functional imaging of the tumor with circulating transcripts (mRNAs and ncRNAs) should be preferred and will represent a key strategy for real-time disease monitoring and prognostication in the near future35.
[0293] The primary aim of our study was to find a multianalyte liquid biomarker for GEP-NET disease that correlates with18F-FDG / PET positive status. Indeed, the retrieval of a specific combination of circulating miRNAs above a certain threshold could better recapitulate the global metabolic features of the tumor thus improving prognosis prediction. In this framework, circulating biomarkers would constitute the best companion assay for18F-FDG / PET imaging analysis. Whole miRNome profiling from plasma of P-NET patients identified candidate miRNAs associated with18F-FDG / PET positive outcome, 3 of which (hsa-miR-4311 ; hsa-mir-5096; hsa-let-7i-3p) were confirmed by RT / qPCR. Our results suggest a role of the single miRNAs alone as well as combined into predictors as prognostic biomarkers for P-NET. In particular, increased exosomal plasmatic levels of P2 predictor (hsa-mir-5096; hsa-let-7i-3p) above 33-5 best predict18F-FDG / PET positivity (AUC: 0-95), thus representing a valid surrogate biomarker for tumor aggressive metabolism in P-NET patients. Indeed, P2 (cutoff: 33-5) reports 84% sensitivity and 100% specificity in predicting higher glucose uptake30,33, consistent with “type 0” markers of “natural history of disease”, which are defined to correlate with diagnosis, prognosis and / or clinical outcome in a direct or indirect way with the disease (NIH classification for biomarkers).
[0294] Up to now, circulating transcript based multianalyte biomarkers (e.g., NETest) do not report direct correlation with functional imaging, such as18F-FDG - PET / CT. In this scenario, the NETest currently represents the most accurate assay to differentiate P-NET stable disease from progressive disease, taking into consideration a complex signature of 51 circulating transcripts, with a reported AUC 0-855%27. However, the NETest does not consider neither the contribution of tumor metabolism nor a direct correlation with 18F-FDG-PET / CT status (26-29).
[0295] ROC curve analysis revealed that hsa-miR-5096 per se is an accurate biomarker for PFS and OS in P-NET patients treated with177Lu-DOTATATE based PRRT (AUC: 0-90). In this context, hsa-mir- 5096 assessment constitutes a low complexity and minimally invasive assay that does not require complex algorithms of analysis and interpretation. Importantly, KM survival analysis showed that circulating hsa-miR-5096 (cut-off: 70) per se distinguishes two distinct prognostic categories, regardless of18F-FDG- PET / CT outcome: patients that will progress earlier (hsa-miR-5096 > 70) and long-term survivors (hsa-miR-5096 < 70). In this sense, hsa-miR-5096 appeared to be an independent prognostic predictor of PFS with even higher accuracy (AUC 0.90). Importantly, hsa- miR-5096 expression (cut-off: 70) was observed to stratify18F-FDG / PET positive patients according to prognosis. In fact, patients with circulating hsa-miR-5096 level above 70 benefited the least from 177Lu-PRRT treatment. Conversely, hsa-miR-5096 score <70 and18F-FDG / PET positive status identifies a new category of patients which benefit the most from PRRT. Given its metrics, hsa-miR-5096 can represent both a candidate type 0 and type II biomarker, which are defined as surrogate for clinical endpoints and reflect patient health, functionality, or survival (NIH classification for biomarkers). Indeed, hsa-miR-5096 measurement in the peripheral blood can be used to assess disease progression and prognosis. Crucially, high hsa-miR-5096 levels in blood and tumor tissue associate with low SSTR2 expression in P-NET patients potentially affecting PRRT efficacy. Interestingly, circulating hsa-miR-5096 showed a mild inverse correlation with 68Ga- DOTATOC PET / CT SUVmax, and this negative correlation of 68Ga-DOTATOC PET / CT SUVmax associated with 18F-FDG-PET / CT positivity in patients displaying low and high levels of hsa-miR-5096 (cut-off:70; Figure 14B), identifies a subgroup of 18F-FDG-PET positive patients with higher density of SSTR2 receptors, similar to 18F-FDG-PET negative ones, this might help to address PRRT schedule preventing overtreatments and supporting the role of hsa-miR5096 as a companion biomarker for patients’ stratification. These observations were conducted considering a relatively limited sample size; thus we overcame this limitation, further confirming the inverse correlation of SSTR2 and hsa-miR-5096 also at the single cell level on PanNET tissue specimens. In this context, we set up the miR-Protein in situ protocol to detect on the same tissue section both markers, using a semi-automated and robust procedure which also allowed us to save valuable patient’s material. Of note, the novel miR-Protein detection and dedicated AND-Tool software of analysis provide the simultaneous detection of miRNAs and proteins, followed by standardized, operator independent measurements, turning qualitative in situ revelation into a quantitative analysis. Specifically, our novel staining workflow allows the automatization and avoids antigen degradation which typically occurs when immunohistochemistry is performed prior to ISH. In addition, the usage of DAB-brown staining, in contrast to typical blue used for ISH labeling, was crucial to ensure miRNA staining stability and to discriminate DAB-brown positive from negative nuclei (counterstained with hematoxylin) allowing ANDTool software-based analysis. We believe our results strongly sustain has-miR-5096 direct involvement in SSTR2 turnover into PanNET cells. Indeed, hsa-miR-5096 ectopic overexpression in PanNET insulinoma NT-3 cells led to a significant decrease of SSTR2 transcripts, while hsa-miR-5096 inhibition significantly boosted SSTR2 expression both in QGP-1 and NT-3 cells substantiating direct targeting and regulation in PanNETs characterized by SSTR2 low / hsa-miR-5096high phenotype. Notably, NT-3 cells treated with growth factors are characterized by increased ki-67%, hsa-miR-5096 induction and decreased SSTR2 level, consistent with a more aggressive phenotype and with data observed in patients. From this perspective hsa-miR-5096 seems to contribute to a metabolic switch leading to lineage differentiation in PanNET cells.
[0296] Tumor heterogeneity is one the main hurdles that modem oncology must deal with to overcome relapse of disease. For this reason, identifying the mechanisms that sustain tumor heterogeneity becomes crucial as revealed by novel single cell technologies, multi parametric immunohistochemistry (IHC) or similar approaches. Heterogeneity can be generated through genetic, epigenetic, and post-transcriptional mechanisms. Indeed, specific exosomal resident and circulating miRNAs might be associated with P-NET patients' response to PRRT suggesting the possibility that treatment failure and RNA interference for specific targets could be intimately linked. In particular, exosomes produced by a subset of tumor cells may condition the expression of specific targets in P-NET cells. Up to now, functional imaging with68Ga-DOTA-conjugated peptides is used to assess SSTRs expression in patients guiding them for eligibility to PRRT17. In the present study, we observed the negative association between hsa-miR-5096 and SSTR2 expression also at the single cell level, within areas with low to absent SSTR2 expression on an independent retrospective P-NET cohort. Our results show that hsa-mir-5096 can be expressed by tumor cells and shedded in biofluids via extracellular vesicles thereby suggesting that a paracrine modulation of SSTR2 expression may exist. Of note, our in-house developed, semi-automated novel immune-miRNA-ISH technique and related open-source pipeline of analysis (ANDtool) provide standardized, operator independent, simultaneous and quantitative measurements of proteins and miRNAs in tissue specimens. Indeed, ANDtool software can turn qualitative IHC / ISH analysis into quantitative measurements, and it can be used as companion software to improve pathologist evaluation workflow of FFPE biopsies. Future studies will be performed to assess its accuracy for prognostication. In addition, our results sustain that hsa-miR-5096 may not only represent a liquid surrogate marker for68Ga-DOTA-PET / CT SUVmax, but also, a key determinant of SSTR2 expression which can affect clinical response to PRRT in P-NET patients. Importantly, we found that SSTR2 3’-UTR contains multiple putative binding sites for hsa-miR-5096. Indeed, hsa-miR-5096 ectopic overexpression in P-NET insulinoma NT-3 cells led to significant decrease of SSTR2 transcripts suggesting direct targeting and regulation. Evidence suggests that hsa-miR- 5096 is involved in a metabolic switch and lineage differentiation in the insulinoma NT-3 cell line that can be modulated and triggered by the presence of specific growth factors. Notably, the aggressive phenotype developed by NT-3 cells treated with growth factors and characterized by increased ki-67% associated with increased hsa-miR-5096 expression and with SSTR2 downregulation, consistent with data observed in patients. In addition, the observation on high grade PanNET BON-1 and QGP-1 cell lines further supported the existence of a hsa-miR-5096- SSTR2 axis and the hsa-miR-5096 mediated interference on SSTR2 transcripts. Accordingly, hsa- miR-5096 inhibitor was more effective on QGP1 cells in triggering a significant SSTR2 upregulation since QGP-1 display higher levels of hsa-miR-5096 and lower SSTR-2 amounts compared to BON-1 cells.
[0297] Collectively, the results on P-NET patients and NT-3 cells in vitro confirm a role of hsa-miR-5096 as: i) surrogate prognostic marker of tumor aggressiveness and metabolism (type 0, NHI classification) with high association with18F-FDG-PET / CT status; ii) independent and accurate predictor of survival (type 0 and type II, NHI classification); iii) surrogate marker associated with low68Ga-DOTA-PET / CT signal and low SSTR2 expression; iv) companion diagnostics of18F- FDG-PET / CT able to identify a subset of patients (18F-FDG-PET / CT positive / hsa-miR-5096 > 70) which will not benefit of PRRT and would be better routed to alternative therapies. As we showed, hsa-miR-5096 does not act as a passive factor but it is more an active and key player in the P-NET microenvironment and ontology. High abundance of hsa-miR-5096 at tumor sites might push tumor cells to lose neuroendocrine differentiation through different mechanisms, including SSTR2 targeting and inhibition. Our findings support the hypothesis that paracrine delivery of miRNAs released by P-NET tumors via exosomes may sustain tumor heterogeneity and the development of a refractory phenotype and / or relapse to PRRT treatment.
[0298] To our knowledge NT3 cells are the only reported and validated available cell model for low grade P-NET studies and this constitutes a limitation of the present study and a general shortcoming in the P-NET arena. However, our observations in P-NET patients are backed up from the experiments performed in this cell line enforcing NT-3 value as a P-NET preclinical model.
[0299] Our study has led to a liquid, exosomal, easy to detect and robust miRNA signature with prognostic power in predicting P-NETs metabolic phenotypes, associated with glucose consumption, tumor aggressiveness and with PFS and OS in patients treated with PRRT. Our findings warrant further investigations into the role of the identified miRNAs and candidate hsa-miR-5096 as a potential target to potentiate PRRT treatment and efficacy in P-NET patients through the restoration of SSTR2 expression levels in neoplastic cells. Indeed we believe in the future it will be possible to interfere specifically with this hsa-miR5096 activity on SSTR2 transcript through the delivery of biomolecules that will shield hsa-miR-5096 binding sites on SSTR-2 3’-UTR thereby increasing its expression and susceptibility of tumor cells to PRRT. Alternatively, small molecules or small transcripts could interfere with SSTR-2 transcript stability by interacting directly with hsa-mir-5096 in tumor cells thereby preventing its interaction with its target sequences on the 3’-UTR of target genes. In addition, specific treatments resulting in the down regulation of hsa-miR-5096 expression in tumor cells or normal tissues could mimic the same regulatory effects on SSTR-2 expression.
[0300] References
[0301] 1 Andreasi V, Partelli S, Muffatti F, Manzoni MF, Capurso G, Falconi M. Update on gastroenteropancreatic neuroendocrine tumors. DigLiver Dis 2021; 53: 171-82.
[0302] 2 Dasari A, Shen C, Halperin D, et al. Trends in the incidence, prevalence, and survival outcomes in patients with neuroendocrine tumors in the United States. JAMA Oncol 2017; 3. DOI: 10.1001 / jamaoncol.2017.0589.
[0303] 3 Young K, Starling N, Sadanandam A. The molecular biology of pancreatic neuroendocrine tumors: Challenges and translational opportunities. Semin. Cancer Biol. 2020. D01:10.1016 / j.semcancer.2019.09.024.
[0304] 4 Hofland J, Kaltsas G, De Herder WW. Advances in the diagnosis and management of well- differentiated neuroendocrine tumors. Endocr. Rev. 2020. D01:10.1210 / endrev / bnz004.
[0305] 5 Howe JR, Merchant NB, Conrad C, et al. The North American Neuroendocrine Tumor Society Consensus Paper on the Surgical Management of Pancreatic Neuroendocrine Tumors. Pancreas 2020. DOE10.1097 / MP A.0000000000001454.
[0306] 6 Scarpa A, Chang DK, Nones K, et al. Whole-genome landscape of pancreatic neuroendocrine tumours. Nature 2017. D01:10.1038 / nature21063.
[0307] 7 Partelli S, Bartsch DK, Capdevila J, et al. ENETS Consensus Guidelines for the Standards of Care in Neuroendocrine Tumours: Surgery for Small Intestinal and Pancreatic Neuroendocrine Tumours. In: Neuroendocrinology. 2017. D01:10.1159 / 000464292. Scot AT, Howe JR. Evaluation and Management of Neuroendocrine Tumors of the Pancreas. Surg. Clin. North Am. 2019. D01:10.1016 / j.suc.2019.04.014.
[0308] Ahmed M. Gastrointestinal neuroendocrine tumors in 2020. World J. Gastrointest. Oncol.
[0309] 2020. DOI:10.4251 / wjgo.vl2.i8.791.
[0310] Nagtegaal ID, Odze RD, Klimstra D, et al. The 2019 WHO classification of tumours of the digestive system. Histopathology 2020; 76: 182-8.
[0311] Inzani F, Petrone G, Rindi G. The New World Health Organization Classification for Pancreatic Neuroendocrine Neoplasia. Endocrinol Metab Clin North Am 2018; 47: 463-70. Choe J, Kim KW, Kim HJ, et al. What Is New in the 2017 World Health Organization Classification and 8th American Joint Commitee on Cancer Staging System for Pancreatic Neuroendocrine tumors? Korean J Radiol 2019; 20: 5-17.
[0312] Mafficini A, Scarpa A. Genomic landscape of pancreatic neuroendocrine tumours: The International Cancer Genome Consortium. J Endocrinol 2018; 236: R161-7.
[0313] Guenter R, Aweda T, Carmona Matos DM, et al. Overexpression of somatostatin receptor type 2 in neuroendocrine tumors for improved Ga68-DOTATATE imaging and treatment. Surg (United States) 2020; 167: 189-96.
[0314] Bodei L, Ambrosini V, Herrmann K, Modlin I. Current concepts in68Ga-DOTATATE imaging of neuroendocrine tumors: Interpretation, biodistribution, dosimetry, and molecular strategies. JNuclMed 2017; 58: 1718-26.
[0315] Oberg KE, Reubi J, Kwekkeboom DJ, Krenning EP. Role of somatostatins in gastroenteropancreatic neuroendocrine tumor development and therapy. Gastroenterology 2010; 139: 742-753. el.
[0316] Sundin A, Arnold R, Baudin E, et al. ENETS Consensus Guidelines for the Standards of Care in Neuroendocrine Tumors: Radiological, Nuclear Medicine and Hybrid Imaging. In: Neuroendocrinology. 2017. D01:10.1159 / 000471879.
[0317] Kwee TC, Basu S, Saboury B, Ambrosini V, Torigian DA, Alavi A. A new dimension of FDG-PET interpretation: Assessment of tumor biology. Eur JNucl Med Mol Imaging 2011; 38: 1158-70.
[0318] Binderup T, Knigge U, Loft A, Federspiel B, Kjaer A. 18F-fluorodeoxy glucose positron emission tomography predicts survival of patients with neuroendocrine tumors. Clin Cancer Res 2010; 16: 978-85. Severi S, Nanni O, Bodei L, et al. Role of 18FDG PET / CT in patients treated with 177Lu- DOTATATE for advanced differentiated neuroendocrine tumours. Eur J Nucl Med Mol Imaging 2013. DOI:10.1007 / s00259-013-2369-z.
[0319] Bodei L, Kidd MS, Singh A, etal. PRRT genomic signature in blood for prediction of 177Lu-octreotate efficacy. Eur J Nucl Med Mol Imaging 2018. D01:10.1007 / s00259-018- 3967-6.
[0320] Baum RP, Kulkami HR, Singh A, et al. Results and adverse events of personalized peptide receptor radionuclide therapy with 90Yttrium and 177Lutetium in 1048 patients with neuroendocrine tumors. Oncotarget 2018; 9: 16932-50.
[0321] Kwekkeboom DJ, Kam BL, Van Essen M, et al. Somatostatin receptor-based imaging and therapy of gastroenteropancreatic neuroendocrine tumors. Endocr Relat Cancer 2010; 17. DOI: 10.1677 / ERC-09-0078.
[0322] Bodei L, Schoder H, Baum RP, et al. Molecular profiling of neuroendocrine tumours to predict response and toxicity to peptide receptor radionuclide therapy. Lancet Oncol 2020; 21: e431-43.
[0323] Bocchini M, Nicolini F, Severi S, et al. Biomarkers for Pancreatic Neuroendocrine tumors (PanNETs) Management — An Updated Review. Front. Oncol. 2020.
[0324] D01:10.3389 / fonc.2020.00831.
[0325] Frank R, Hargreaves R. Clinical biomarkers in drug discovery and development. Nat. Rev.
[0326] Drug Discov. 2003. D01: 10.1038 / nrdll30.
[0327] Oberg K, Califano A, Strosberg JR, et al. A meta-analysis of the accuracy of a neuroendocrine tumor mRNA genomic biomarker (NETest) in blood. Ann. Oncol. 2020. D01:10.1016 / j.annonc.2019.11.003.
[0328] Bodei L, Kidd M, Modlin IM, et al. Measurement of circulating transcripts and gene cluster analysis predicts and defines therapeutic efficacy of peptide receptor radionuclide therapy (PRRT) in neuroendocrine tumors. Eur J Nucl Med Mol Imaging 2016; 43.
[0329] D01:10.1007 / s00259-015-3250-z.
[0330] Malczewska A, Bodei L, Kidd M, Modlin IM. Blood mRNA Measurement (NETest) for Neuroendocrine Tumor Diagnosis of Image-Negative Liver Metastatic Disease. J Clin Endocrinol Metab 2018. D01:10.1210 / jc.2018-01804.
[0331] Benten D, Behrang Y, Unrau L, et al. Establishment of the first well-differentiated human pancreatic neuroendocrine tumor model. Mol Cancer Res 2018; 16: 496-507.
[0332] Gao Y, Gao H, Wang G, et al. A meta-analysis of Prognostic factor of Pancreatic neuroendocrine tumors. Sci Rep 2018; 8: 1-8. Gorris M, Hoogenboom SA, Wallace MB, van Hooft JE. Artificial intelligence for the management of pancreatic diseases. Dig Endosc 2020. DOI: 10. Il l 1 / den.13875. Luo Y, Chen X, Chen J, et al. Preoperative Prediction of Pancreatic Neuroendocrine tumors Grading Based on Enhanced Computed Tomography Imaging: Validation of Deep Learning with a Convolutional Neural Network. Neuroendocrinology 2020; 110: 338-50. Modlin IM, Moss SF, Chung DC, Jensen RT, Snyderwine E. Priorities for improving the management of gastroenteropancreatic neuroendocrine tumors. J. Natl. Cancer Inst. 2008. DOI:10.1093 / jnci / djn275. Oberg K, Krenning E, Sundin A, et al. A delphic consensus assessment: Imaging and biomarkers in gastroenteropancreatic neuroendocrine tumor disease management. Endocr Connect 2016; 5: 174-87. Landini G, Martinelli G, Piccinini F. Colour deconvolution: stain unmixing in histological imaging. Bioinformatics (2021) 37:1485-7.
Claims
CLAIMS1. An in vitro method for diagnosing a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) in a subject and / or determining aggressiveness of a GEP-NET in a subject diagnosed with GEP-NET and / or predicting overall survival of a subject with a GEP-NET wherein the method comprises the step of determining the expression level of one or more miRNAs in a biological sample comprising blood previously obtained from said subject, wherein the miRNAs are selected from: hsa-miR-5096, hsa-let-7i-3p and hsa-miR-4311.
2. The method according to claim 1 wherein the expression level of the one or more miRNAs is normalized in relation to the expression level of one or more reference molecules, such as a miRNA, a RNA, a DNA or other biomolecule, in particular a molecule which does not change its amount in a subject with a GEP-NET with respect to a healthy subject, preferably said reference molecule is a miRNA, more preferably it is hsa-miR-30d.
3. The method according to claim 1 or 2 further comprising the step of determining a diagnostic or prognostic response by means of comparison between the one or more miRNAs and a reference molecule.
4. The method according to anyone of claims 1-3 wherein the gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) is selected from pancreatic neuroendocrine tumor (P-NET), small-intestine neuroendocrine tumor (SI-NET), intestine neuroendocrine tumor, and stomach neuroendocrine tumor.
5. An in vitro method to diagnose the presence of a Small Intestine neuroendocrine tumor (SI-NET) in a subject comprising the step of determining the expression level of hsa-miR-5096 and / or hsa-let-7i-3p in a biological sample comprising blood previously obtained from said subject, preferably said method comprising the following steps: a. determining the expression level of hsa-miR-5096 and / or hsa-let-7i-3p in a blood sample from the subject; b. normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule whichdoes not change its amount in patients bearing a SI-NET with respect to a healthy subject; c. determining the presence of a Small Intestine NET (SI-NET) when the normalized expression levels of hsa-miR-5096 or of a combination of hsa-miR-5096 and hsa-let- 7i-3p are equal to or greater than a predetermined cut off value.
6. An in vitro method for diagnosing an ileal primary site of origin in a subject affected by Small Intestine NET (SI-NET) comprising the step of determining the expression level of hsa-miR-5096 and / or hsa-let-7i-3p in a biological sample comprising blood previously obtained from said subject, preferably said method comprising the following steps: a) determining the expression level of hsa-miR-5096 and / or hsa-let-7i-3p in a blood sample from the subject; b) normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a SI-NET with respect to a healthy subject; c) determining the presence of an ileal primary site of origin when the normalized expression level of each of the miRNAs or of a combination thereof is equal to or greater than a predetermined cut off value.
7. An in vitro method to determine the presence of 18F-FDG-PET positive lesions in a subject affected by a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) , preferably a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of at least one of the following miRNAs: hsa-miR- 5096, hsa-let-7i-3p and hsa-miR-4311 in a biological sample comprising blood previously obtained from said subject, wherein the presence of 18F-FDG-PET positive lesions is an indication of an aggressive disease, preferably said method is to determine the presence of 18F-FDG-PET positive lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET) and it comprises the following steps: a. determining the expression level of at least one of the following miRNAs: hsa-miR- 5096, hsa-let-7i-3p and hsa-miR-4311 in a blood sample from the subj ect;b. normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject ; c. determining the presence of at least one 18F-FDG-PET positive lesion when the normalized expression level of each of the miRNAs or a combination thereof is equal to or greater than a predetermined cut off value.
8. The method according to claim 7 wherein the expression level of hsa-mir-5096 and hsa-let-7i-3p and / or of hsa-miR-5096, hsa-let-7i-3p and hsa-miR-4311 is determined.
9. The method according to claim 7 or 8 wherein said reference miRNA is hsa-miR- 30d and said predetermined cut off value is:0.85 for hsa-miR-4311 ;70 for hsa-miR-5096;0.72 for hsa-miR-let7i-3p;0.65 for the combination of hsa-miR-4311 and hsa-let-7i-3p;33.55 for the combination of hsa-mir-5096 and hsa-let-7i-3p;14.9 for the combination of hsa-miR-4311 and hsa-mir-5096;29.6 for the combination of hsa-miR-4311, hsa-mir-5096 and hsa-let-7i-3p, wherein each cut-off value can vary of + / - 10%.
10. An in vitro method to predict 6-month progression-free survival (PFS) in a subject affected by a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET), preferably a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of at least one of the following miRNAs: hsa-miR-5096, hsa-let-7i- 3p and hsa-miR-4311 in a biological sample comprising blood previously obtained from said subject, preferably said method is to predict 6 month progression-free survival (PFS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) and it comprises the following steps: a. determining the expression level of at least one of the following miRNAs: hsa-miR- 5096, hsa-let-7i-3p and hsa-miR-4311 in a blood sample from said subject;b. normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject; c. predicting a PFS of less than 6 months when the normalized expression level of each of the miRNAs or of a combination thereof is equal to or greater than a predetermined cut off value.
11. The method according to claim 10 wherein the expression level of hsa-miR-5096 alone is determined.
12. The method according to claim 10 or 11 wherein said reference miRNA is hsa-miR- 30d and the predetermined cut off value is:70 for hsa-miR-5096;123.3 for the combination of hsa-mir-5096 and hsa-let-7i-3p;142.9 for the combination of hsa-miR-4311 and hsa-mir-5096;108.3 for the combination of hsa-miR-4311, hsa-mir-5096 and hsa-let-7i-3p, wherein each cut-off value can vary by + / - 10%.
13. The method according to any one of claims 10-12 wherein the subject is undergoing a therapy treatment targeting somatostatin receptors, preferably a treatment with Peptide Radionuclide Receptor Therapy (PRRT).
14. An in vitro method to predict 12-month overall survival (OS) in a subject affected by a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET), preferably a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of hsa-miR-5096 in a biological sample comprising blood previously obtained from said subject, preferably the method is to predict 12 month overall survival (OS) in a subject affected by a pancreatic neuroendocrine tumor (P- NET) and it comprises the following steps: a. determining the expression level of hsa-miR-5096 in a blood sample from said subject;b. normalizing the expression level of hsa-miR-5096 to a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P- NET with respect to a healthy subject; c. predicting an overall survival of less than 12 months when the normalized expression level of hsa-miR-5096 is equal to or greater than a predetermined cut off value.
15. The method according to claim 14 wherein said reference miRNA is hsa-miR-30d and the predetermined cut off value is 70 + / -10%.
16. An in vitro method for predicting the presence of one or more high proliferating tumor lesions in a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) comprising the step of determining the expression level of at least one of the following miRNAs: hsa-let-7i-3p and hsa-miR-4311 in a biological sample comprising blood previously obtained from said subject, preferably the method is for predicting the presence of one or more highly proliferating P-NET lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET) and it comprises the following steps: a. determining the expression level of at least one of the following miRNAs: hsa-let-7i- 3p and hsa-miR-4311 in a blood sample from said subject; b. normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject; c. determining the presence of a highly proliferating P-NET lesion when the normalized expression level of each of the miRNAs or of a combination thereof is equal to or greater than a predetermined cut off value.
17. The method according to claim 16 wherein said reference miRNA is hsa-miR-30d and the predetermined cut off value is:1.44 for hsa-miR-4311 ;1.31 for hsa-let-7i-3p;0.98 for the combination of hsa-miR-4311 and hsa-let-7i-3p;wherein each cut-off value can vary of + / - 10%.
18. An in vitro method for grading a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET), in particular a pancreatic neuroendocrine tumor (P-NET), in the highest grade G3 comprising the step of determining the expression level of the combination of the following miRNAs: hsa-miR-5096, hsa-let-7i-3p and hsa-miR-4311 in a biological sample comprising blood previously obtained from a subject affected by a GEP-NET tumor, preferably the method comprising the following steps: a. determining the expression level of the combination of the following miRNAs: hsa- miR-5096, hsa-let-7i-3p and hsa-miR-4311 in a blood sample from a subject affected by pancreatic neuroendocrine tumor; b. normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject; c. determining the presence of a G3 P-NET when the normalized expression level of the combination of miRNAs of step a) is equal to or greater than a predetermined cut off value, wherein preferably said reference miRNA is hsa-miR-30d and the cut-off value is 57.1 + / - 10%.
19. An in vitro method for determining tumor burden in a subject affected by a gastro- entero-pancreatic neuroendocrine tumor (GEP-NET), preferably a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of at least one of the following miRNAs: hsa-let-7i-3p and hsa-miR-4311 in a biological sample comprising blood obtained from said subject, preferably the method comprising the following steps: a. determining the expression level of at least one of the following miRNAs: hsa-let-7i- 3p and hsa-miR-4311 in a blood sample from said subject; b. normalizing the expression level of each miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject;c. determining the presence of a high tumor burden when the normalized expression level of the combination of miRNAs of step a) is equal to or greater than a predetermined cut off value.
20. An in vitro method to predict response to therapy in a subject affected by a gastro- entero-pancreatic neuroendocrine tumor (GEP-NET), in particular a pancreatic neuroendocrine tumor (P-NET), comprising the step of determining the expression level of hsa-miR-5096, in a biological sample comprising blood previously obtained from said subject, preferably the method comprising the following step: a) determining the expression level of hsa-miR-5096 in a blood sample from said subject; b) normalizing the expression level of the miRNA determined in step a) to the expression level of a reference miRNA, RNA, DNA or other biomolecule which does not change its amount in patients bearing a P-NET with respect to a healthy subject ; c) predicting a positive response to Peptide Radionuclide Receptor Therapy (PRRT) when the normalized expression level of hsa-miR-5096 is lower than a predetermined cut off value, wherein preferably said reference miRNA is hsa-miR-30d and the cut off value is 70 + / - 10%.
21. The method of anyone of claims 1-20 wherein the expression level of said miRNAs is determined in a exosome-enriched fraction from plasma of said biological sample comprising blood.
22. Use of hsa-miR-5096, hsa-let-7i-3p and / or hsa-miR-4311 as biomarkers for diagnosing a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) in a subject and / or for determining aggressiveness of a GEP-NET in a subject diagnosed with GEP-NET and / or for predicting overall survival of a subject with a GEP-NET and / or for predicting response to therapy in a subject with a GEP-NET, preferably as biomarkers for:■ determining the presence in a subject of a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET), in particular of a pancreaticneuroendocrine tumor (P-NET) or of a Small Intestine neuroendocrine tumor (SINET);■ diagnosing an ileal primary site of origin in a subject affected by Small Intestine NET (SINET) ;■ determining the presence of 18F-FDG-PET positive lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET);■ predicting 6 month progression-free survival (PFS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) who is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT);■ predicting 12 month overall survival (OS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) who is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT);■ predicting 6 month progression-free survival (PFS) in a subject affected by a pancreatic neuroendocrine tumor (P-NET) who is undergoing a treatment with Peptide Radionuclide Receptor Therapy (PRRT) and is positive to18F- FDG-PET;■ predicting the presence of highly proliferating P-NET lesions in a subject affected by a pancreatic neuroendocrine tumor (P-NET);■ grading a pancreatic neuroendocrine tumor (P-NET);■ predicting tumor burden in a subject affected by a pancreatic neuroendocrine tumor (P-NET); and / or■ predicting response to Peptide Radionuclide Receptor Therapy (PRRT) in a subject affected by a pancreatic neuroendocrine tumor (P-NET). An inhibitor of hsa-miR-5096 for use for the treatment of a cancer, preferably a gastro-entero- pancreatic neuroendocrine tumor (GEP-NET), more preferably a pancreatic neuroendocrine tumor (P-NET). The inhibitor for the use according to claim 23 wherein said inhibitor is an agent capable of decreasing or blocking the interaction of hsa-miR-5096 with the somatostatin receptor SSTR-2 transcript.The inhibitor for the use according to claim 23 or 24 wherein said inhibitor is an agent capable of binding and blocking one or more of the binding sites of hsa-miR-5096 on the SSTR-2 transcript, preferably it is a LNA Target Site Blocker (TSB). The inhibitor for the use according to any one of claims 23-25 wherein said inhibitor is able to bind and inhibit at least one of the two following sequences on miR-5096:5’-UUUCAC-3’,5’-UUUCACC-3’. The inhibitor for the use according to any one of claims 25-26, wherein said binding sites targeted by hsa-miR-5096 on the SSTR-2 transcript correspond to the sequences 5’- GUGAAAA-3’ and 5’-GGUGAAA-3’ located at the 3’-UTR of the SSTR-2 gene at positions 723-729 and 3001-3007 / 1008-1014 and 2290-2296, respectively. The inhibitor for the use according to any one of claims 23-27, wherein said inhibitor is able of binding and blocking at least two, preferably all, binding sites of hsa-miR-5096 on the SSTR-2 transcript. The inhibitor for the use according to any one of claims 23-28 wherein said inhibitor is included in a delivery vehicle, such as a nanoparticle, able to deliver it into GEP-NET cells. A pharmaceutical composition comprising the inhibitor of any one of claims 23-29 and at least one pharmaceutically acceptable vehicle and / or excipient for use for the treatment of a gastro- entero-pancreatic neuroendocrine tumor (GEP-NET). The pharmaceutical composition for the use according to claim 30 comprising at least two inhibitors, preferably LNA TSBs, wherein at least a first inhibitor is able to target at least two binding sites of hsa-miR-5096 on the SSTR-2 transcript and at least a second inhibitor is able to target at least two other binding sites of hsa-miR-5096 on the SSTR-2 transcript. A molecule targeting at least one miRNA selected from: hsa-miR-5096, hsa-let-7i-3p and hsa- miR-4311 for use in an in vivo method for diagnosing a gastro-entero-pancreatic neuroendocrine tumor (GEP-NET) and / or determining aggressiveness of a GEP-NET in a subject diagnosed with GEP-NET and / or predicting overall survival and / or response to therapy of a subject with a GEP-NET, preferably said method is an imaging method. The molecule for the use of claim 32 which is a radiolabeled probe able to selectively bind to and / or recognize any of said miRNAs.A kit or a device for carrying out any of the methods of claims 1-21 or 32-33, preferably said kit containing one or more of the followings: agents and / or tools to obtain plasma exosome-enriched fraction from a blood sample previously isolated from a subject; agents and / or tools to isolate target miRNAs; agents and / or tools for the dosage of each miRNA, for example primers and probes specific for the target miRNAs and / or useful for RT-PCR;- probes targeting at least one of said miRNAs for use in an imaging method of claim 32 or 33, such as a radiolabeled probe.