Upf1 expression constructs

EP4601709A1Pending Publication Date: 2025-08-20MEIRAGTX NEURO II LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023790742
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-11
Filing Date
2023-10-11
Publication Date
2025-08-20

AI Technical Summary

Technical Problem

Current treatments for neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are inadequate, as they fail to effectively address the underlying RNA metabolism abnormalities that contribute to these conditions, particularly the toxicity associated with proteins like TDP-43 and FUS/TLS.

Method used

Development of improved expression constructs for the UPF1 gene, including specific promoters, coding sequences, and regulatory elements, which are integrated into viral vectors like AAV for targeted gene therapy to enhance UPF1 expression in neurons, thereby reducing toxicity associated with TDP-43, C9orf72, and FUS/TLS proteins.

Benefits of technology

The enhanced UPF1 expression constructs demonstrate significant protection against neuronal death in models of TDP-43 and C9orf72 toxicity, indicating potential therapeutic benefits for ALS and FTD by improving motor neuron survival and reducing disease progression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000095_0000
    Figure 00000095_0000
  • Figure 00000096_0000
    Figure 00000096_0000
  • Figure 00000097_0000
    Figure 00000097_0000
Patent Text Reader

Abstract

Provided herein are improved expression constructs for the expression of UPF1 and vectors comprising such constructs. Also provided are methods of treating neurogenerative diseases, including, but not limited to, amyotrophic lateral sclerosis (ALS).
Need to check novelty before this filing date? Find Prior Art

Description

Docket No.162027.49376 UPF1 EXPRESSION CONSTRUCTS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit under 35 U.S.C. § 119(e) of the earlier filing date of U.S. Provisional Patent Application Serial No.60 / 621,307, filed October 11, 2022, which is hereby incorporated by reference in its entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (162027-49376-SeqList.xml; Size: 122,000 bytes; and Date of Creation: October 2, 2023) is herein incorporated by reference in its entirety. FIELD

[0003] The present disclosure relates generally to the field of molecular biology and medicine. More particularly, the methods and compositions herein are useful for treating neurodegenerative diseases. BACKGROUND

[0004] RNA metabolism is important for the function and maintenance of neurons and other cell types. RNA binding proteins regulate all aspects of RNA metabolism, including transcription, splicing, transport, translation, and degradation. In keeping with the essential nature of RNA metabolism, deficiencies or abnormalities in RNA binding proteins underlie the neurodegenerative disorders amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).

[0005] The UPF1 (up frameshift 1) gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon- exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. UPF1 is a RNA helicase involved in NMD. UPF1 was identified through an unbiased screen for proteins that could prevent cell death in a yeast model of ALS / FTD. See Ju et al., A yeast model of FUS / TLS-dependent cytotoxicity. PLoS Biol. 2011 Apr;9(4):e1001052. UPF1Docket No.162027.49376 overexpression has been shown to protect against neurodegeneration in animal models of ALS involving TDP-43 and FUS toxicity. See Jackson et al., Preservation of forelimb function by UPF1 gene therapy in a rat model of TDP-43-induced motor paralysis. Gene Ther. 2015 Jan;22(1):20-8.

[0006] Accordingly, UPF1 expression constructs with for the treatment of neurogenerative diseases in animals, including humans, are urgently needed. SUMMARY

[0007] Provided herein are improved expression constructs for the expression of UPF1, vectors comprising such constructs, and methods of using such constructs and vectors.

[0008] In one aspect, provided is an expression construct comprising: (a) a promoter; (b) a sequence encoding UPF1, operatively linked to the promoter; and (c) a polyadenylation signal.

[0009] In some embodiments, the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs:3-17. In some embodiments, the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs:3-17. In some embodiments, the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs:3-17. In some embodiments, the promoter comprises a sequence selected from the group consisting of SEQ ID NOs:3-17. In some embodiments, the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs:5-7. In some embodiments, the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs:5-7. In some embodiments, the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs:5-7. In some embodiments, the promoter comprises a sequence selected from the group consisting of SEQ ID NOs:5-7. In some embodiments, the promoter comprises a sequence that is at least 80% identical to SEQ ID NO:7. In some embodiments, the promoter comprises a sequence that is at least 90% identical SEQ ID NO:7. In some embodiments, the promoter comprises the promoter comprises a sequence that is at least 95% identical to SEQ ID NO:7. In one embodiment, the promoter comprises SEQ ID NO:7.

[0010] In some embodiments, the sequence encoding the UPF1 protein is codon-optimized. In some embodiments, the sequence encoding UPF1 comprises a sequence that is at least 80% identical to any one of SEQ ID NOs:19-22. In some embodiments, the sequence encoding 2 150336825.1Docket No.162027.49376 UPF1 comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:19-22. In some embodiments, the sequence encoding UPF1 comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:19-22. In some embodiments, the sequence encoding UPF1 comprises a sequence selected from the group consisting of any one of SEQ ID NOs:19- 22. In some embodiments, the sequence encoding UPF1 comprises a sequence that is at least 80% identical to SEQ ID NO:21. In some embodiments, the sequence encoding UPF1 comprises a sequence that is at least 90% identical to SEQ ID NO:21. In some embodiments, the sequence encoding UPF1 comprises a sequence that is at least 95% identical to SEQ ID NO:21. In one embodiment, the sequence encoding UPF1 comprises SEQ ID NO:21.

[0011] In some embodiments, the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 80% identical to SEQ ID NO:38. In some embodiments, the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 90% identical to identical to SEQ ID NO:38. In some embodiments, the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 95% identical to identical to SEQ ID NO:38. In one embodiment, the sequence encoding UPF1 encodes a protein comprising SEQ ID NO:38.

[0012] In some embodiments, the expression construct further comprises a 5ʹ untranslated region (UTR). In some embodiments, the 5ʹ UTR comprises a sequence that is at least 90% identical to SEQ ID NO:18. In some embodiments, the 5ʹ UTR comprises a sequence that is at least 95% identical to SEQ ID NO:18. In one embodiment, the 5ʹ UTR comprises SEQ ID NO:18.

[0013] In some embodiments, the expression construct further comprises a posttranscriptional regulatory element. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 80% identical to any one of SEQ ID NOs:23-26. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:23-26. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:23-26. In some embodiments, the posttranscriptional regulatory element comprises any one of SEQ ID NOs:23-26. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:24 or SEQ ID NO:25. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:24 or SEQ ID NO:25. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:24 or SEQ ID NO:25. In some embodiments, wherein the posttranscriptional regulatory element comprises SEQ ID NO:24 or SEQ ID 3 150336825.1Docket No.162027.49376 NO:25. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:24. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:24. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:24. In one embodiment, the posttranscriptional regulatory element comprises SEQ ID NO:24.

[0014] In some embodiments, the expression construct further comprises an miRNA binding site (miRBS) that is at least 80% identical to SEQ ID NO:27. In some embodiments, the expression construct comprises an miRBS that is at least 90% identical to SEQ ID NO:27. In some embodiments, the expression construct comprises an miRBS that is at least 95% identical to SEQ ID NO:27. In one embodiment, the expression construct comprises SEQ ID NO:27.

[0015] In some embodiments, the polyadenylation signal comprises a sequence that is at least 80% identical to any one of SEQ ID NOs:28-30. In some embodiments, the polyadenylation signal comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:28-30. In some embodiments, the polyadenylation signal comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:28-30. In some embodiments, the polyadenylation signal comprises any one of SEQ ID NOs:28-30. In some embodiments, the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:29. In some embodiments, the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:29. In some embodiments, the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:29. In one embodiment, the polyadenylation signal comprises SEQ ID NO:29.

[0016] In one aspect, provided is a vector comprising an expression construct disclosed herein. In one embodiment, the vector is a viral vector. In one embodiment, the vector is an AAV vector. In one aspect, provided is a vector comprising a nucleic acid sequence comprising (i) an expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITRs). In one embodiment, the nucleic acid sequence comprises a 5ʹ ITR and a 3ʹ ITR. In one embodiment, the 5ʹ ITR and the 3ʹ ITR are derived from adeno-associated virus (AAV) serotype AAV2. In some embodiments, the sequence of the 5ʹ ITR is at least 80% identical to any one of SEQ ID NOs:1, 54, or 55. In some embodiments, the sequence of the 5ʹ ITR is at least 90% identical to any one of SEQ ID NOs:1, 54, or 55. In some embodiments, the sequence of the 5ʹ ITR is at least 95% identical to any one of SEQ ID NOs:1, 54, or 55. In some embodiments, the sequence of the 5ʹ ITR comprises any one of SEQ ID NOs:1, 54, or 55. In 4 150336825.1Docket No.162027.49376 some embodiments, the sequence of the 3ʹ ITR is at least 80% identical to SEQ ID NO:2 or SEQ ID NO:56. In some embodiments, the sequence of the 3ʹ ITR is at least 90% identical to SEQ ID NO:2 or SEQ ID NO:56. In some embodiments, the sequence of the 3ʹ ITR is at least 95% identical to SEQ ID NO:2 or SEQ ID NO:56. In some embodiments, the sequence of the 3ʹ ITR comprises SEQ ID NO:2 or SEQ ID NO:56. In one embodiment, the 5ʹ ITR comprises SEQ ID NO:1 and the 3ʹ ITR comprises SEQ ID NO:2. In some embodiments, provided is a vector comprising an expression construct, wherein the vector comprises a sequence that is 80% identical to any one of SEQ ID NOs:32-37. In some embodiments, the vector comprises a sequence that is 90% identical to any one of SEQ ID NOs:32-37. In some embodiments, the vector comprises a sequence that is 95% identical to any one of SEQ ID NOs:32-37. In some embodiments, the vector comprises any one of SEQ ID NOs:32-37. In some embodiments, the vector comprises a sequence that is 80% identical to SEQ ID NO:34. In some embodiments, the vector comprises a sequence that is 90% identical to SEQ ID NO:34. In some embodiments, the vector comprises a sequence that is 95% identical to SEQ ID NO:34. In one embodiment, the vector comprises SEQ ID NO:34. In some embodiments, the vector comprises a capsid from, or derived from, AAV7m8, AAV9, AAV2-retro, or AAVrh.10. In some embodiments, the vector comprises a capsid comprising capsid proteins from, or derived from, both AAV2- retro and AAVrh.10.

[0017] In one aspect, provided is a cell comprising an expression construct or a vector disclosed herein.

[0018] In one aspect, provided is a pharmaceutical composition comprising (i) an expression construct or a vector disclosed herein and (ii) a pharmaceutically acceptable carrier.

[0019] In one aspect, provided is a method for reducing transactive response DNA binding protein 43 (TDP43) toxicity in a subject in need thereof, the method comprising administering to the subject a vector or a pharmaceutical composition disclosed herein. In one aspect, provided is a method for reducing C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject a vector or a pharmaceutical composition disclosed herein. In one aspect, provided is a method for reducing fused in sarcoma / translocated in liposarcoma (FUS / TLS) toxicity in a subject in need thereof, the method comprising administering to the subject a vector or a pharmaceutical composition disclosed herein. In one aspect, provided is a method of treating a neurogenerative disease in a subject in need thereof, the method comprising administering to the subject a vector or a pharmaceutical composition disclosed herein. In some embodiments, the neurogenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar dementia, Alzheimer’s 5 150336825.1Docket No.162027.49376 disease (sporadic and familial), dementia with Lewy’s bodies with or without Alzheimer’s disease, Down syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson’s disease with and without dementia, Parkinson’s disease with LRKK2 mutation, Perry syndrome with DCTN1 mutation, ALS Parkinsonism–dementia complex of Guam, Huntington’s disease, and myopathy. In one aspect, the neurodegenerative diseases is amyotrophic lateral sclerosis (ALS). In one aspect, the neurodegenerative diseases is FTD. In one aspect, provided is a method for treating a neurogenerative disease associated with TDP43 toxicity in a subject in need thereof, the method comprising administering to the subject a vector or a pharmaceutical composition disclosed herein. In one aspect, provided is a method for treating a neurogenerative disease associated with C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject a vector or a pharmaceutical composition disclosed herein. In one aspect, provided is a method for treating a neurogenerative disease associated with FUS / TLS toxicity in a subject in need thereof, the method comprising administering to the subject a vector or a pharmaceutical composition disclosed herein. In one aspect, provided is a method for treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof, the method comprising administering to the subject a vector or a pharmaceutical composition disclosed herein. In some embodiments, the subject is a human. In some embodiments, the vector or the pharmaceutical composition is administered by intra-cisternal administration.

[0020] In some embodiments, provided is a vector or a pharmaceutical composition described herein for use in a method of reducing transactive response DNA binding protein 43 (TDP43) toxicity in a subject in need thereof. In some embodiments, provided is the vector or the pharmaceutical composition described herein for use in a method of reducing C9orf72 toxicity in a subject in need thereof. In some embodiments, provided is a vector or a pharmaceutical composition described herein for use in a method of reducing fused in sarcoma / translocated in liposarcoma (FUS / TLS) toxicity in a subject in need thereof. In some embodiments, provided is a vector or a pharmaceutical composition described herein for use in a method of treating a neurogenerative disease in a subject in need thereof. In some embodiments, the neurogenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar dementia, Alzheimer’s disease (sporadic and familial), dementia with Lewy’s bodies with or without Alzheimer’s disease, Down syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson’s disease with and without dementia, Parkinson’s disease with LRKK2 mutation, Perry syndrome with DCTN1 mutation, ALS Parkinsonism–dementia complex of Guam, Huntington’s disease, and 6 150336825.1Docket No.162027.49376 myopathy. In some embodiments, the disease is amyotrophic lateral sclerosis (ALS). In some embodiments, provided is a vector or a pharmaceutical composition described herein for use in a method of treating a neurogenerative disease associated with TDP43 toxicity in a subject in need thereof. In some embodiments, provided is a vector or a pharmaceutical composition described herein for use in a method of treating a neurogenerative disease associated with C9orf72 toxicity in a subject in need thereof. In some embodiments, provided is a vector or a pharmaceutical composition described herein for use in a method of treating a neurogenerative disease associated with FUS / TLS toxicity in a subject in need thereof. In some embodiments, the subject is a human.

[0021] In some embodiments, the vector or the pharmaceutical composition is administered by intra-cisternal administration.

[0022] In some embodiments, provided is the use of a vector or a pharmaceutical composition described herein for the manufacture of a medicament for reducing transactive response DNA binding protein 43 (TDP43) toxicity in a subject in need thereof. In some embodiments, provided is the use of a vector or a pharmaceutical composition described herein for the manufacture of a medicament for reducing C9orf72 toxicity in a subject in need thereof. In some embodiments, provided is the use of a vector or a pharmaceutical composition described herein for the manufacture of a medicament for reducing fused in sarcoma / translocated in liposarcoma (FUS / TLS) toxicity in a subject in need thereof. In some embodiments, provided is the use of a vector or a pharmaceutical composition described herein for the manufacture of a medicament for treating a neurogenerative disease in a subject in need thereof. In some embodiments, the neurogenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar dementia, Alzheimer’s disease (sporadic and familial), dementia with Lewy’s bodies with or without Alzheimer’s disease, Down syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson’s disease with and without dementia, Parkinson’s disease with LRKK2 mutation, Perry syndrome with DCTN1 mutation, ALS Parkinsonism–dementia complex of Guam, Huntington’s disease, and myopathy. In some embodiments, the neurogenerative disease is amyotrophic lateral sclerosis (ALS).

[0023] In some embodiments, provided is the use of a vector or a pharmaceutical composition described herein for the manufacture of a medicament for treating a neurogenerative disease associated with TDP43 toxicity in a subject in need thereof. 7 150336825.1Docket No.162027.49376

[0024] In some embodiments, provided is the use of a vector or a pharmaceutical composition described herein for the manufacture of a medicament for treating a neurogenerative disease associated with C9orf72 toxicity in a subject in need thereof.

[0025] In some embodiments, provided is the use of a vector or a pharmaceutical composition described herein for the manufacture of a medicament for treating a neurogenerative disease associated with FUS / TLS toxicity in a subject in need thereof. In some embodiments, the subject is a human. In some embodiments, the vector or the pharmaceutical composition is administered by intra-cisternal administration. BRIEF DESCRIPTION OF THE FIGURES

[0026] Figs. 1A and 1B illustrate the expression construct optimization process. Fig. 1A. Head-to-head comparison of UPF1 expression levels with different UPF1 construct variants. Western blot data were quantified and plotted relative to the endogenous level. UPF1 expressing constructs were expressed in Neuro2A (N2A) cells for two days by chemical transfection and analyzed by Western blotting. Pop-out frame: y-axis re-plotted to display a subset of samples. “Endo”: endogenous UPF1 expression level from an EGFP-transfected control well. Mean ± s.d., n = 3 experiments. Fig. 1B illustrates that the CMVe-JeT (MD)- MVMi promoter (right bars) was more potent than the CAG promoter (left bars) even in the context of other cis-regulatory elements. See Table 1 for more details on the expression constructs shown Figs.1A and 1B.

[0027] Figs.2A, 2B, 2C, 2D, 2E, and 2F illustrate the survival of TDP43M337ViNeurons expressing UPF1 variants at different dose concentrations. TDP43M337ViNeurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged by semi-automated microscopy. Custom scripts were used to identify neuronal soma and assign a unique identifier to each cell. Neuronal loss was indicated by dissolution or rounding of the cell body, dendritic beading, or loss of fluorescence. The time to death for each cell was used to create cumulative hazard plots displaying the risk of death overtime for neurons in each population. Each line summarizes experiments pooled from 6 technical replicates of at least 4 biological replicates. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 for the cumulative hazard ratio relative to V2-GFP in TDP43 mutant iNeurons. TDP43M337ViNeurons exhibited significant toxicity (*** M337V:V2-GFP-250 vs. WT:V2-GFP-250, p<0.17x10-8), while UPF1 expression by AAV9 transduction reduces the risk of death for all UPF1 variants at different dose concentrations (V2-GFP-250 vs. V1-RKW-250, ***HR=0.54, p=0.0009; Fig.2A vs. V3- MeiraA-50, ***HR=0.33, p=0.0007 and vs. V3-MeriaA-250, *HR=0.54, p=0.0115; Fig. 2B 8 150336825.1Docket No.162027.49376 vs. V4-MeiraB-50, *HR=0.62, p=0.0460 and vs. V4-MeiraB-100, **HR=0.39, p=0.0011; Fig. 2C vs. V5-UPF1_11-50, ***HR=0.16, p=0.0003 and vs. V5-UPF1_11-100, *HR=56, p=0.0386 and vs. V5-UPF1_11-250, **HR=0.36, p=-0.0010; Fig. 2D vs. V6-UPF1_6-50, ***HR=0.29, p=0.0007; Fig. 2E vs. V7-UPF1_11h-250,**HR=0.43, p=0.0073; Fig. 2F vs. V8-UPF1_11i-50, *HR=0.51, p=0.0217). N = number of cells per group, pooled from 6 technical replicates and at least 4 biological replicates. Each line summarizes experiments with an UPF1 variant at a dose concentration and identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250) K. Fig.2A Endpoints from top to bottom: GFP negative control (TDP43 M337V); V3-MeiraA-100 ; V3-MeiraA-250; V1-RKW positive control; GFP healthy control (WT TDP43); V3-MeiraA-50. Fig.2B Endpoints from top to bottom: GFP negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1- RKW positive control; GFP healthy control (WT TDP43); V4-MeiraA-100. Fig.2C. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V1-RKW positive control; V5- UPF1_11-100; GFP healthy control (WT TDP43); V5-UPF1_11-250; V5-UPF1_11-50. Fig. 2D. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT TDP43); V6-UPF1_6- 50. Fig. 2E. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V7- UPF1_11h-50; V7-UPF1_11h-100; V1-RKW positive control; GFP healthy control (WT TDP43); V7-UPF1_11h-250. Fig. 2F. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8- UPF1_11i-50; GFP healthy control (WT TDP43).

[0028] Figs. 3A, 3B, 3C, 3D, 3E, and 3F illustrate the survival of C9orf72 iNeurons expressing UPF1 variants at different dose concentration. C9orf72 iNeurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged by semi-automated microscopy. Custom scripts were used to identify neuronal soma and assign a unique ID to each cell. Neuronal loss was indicated by dissolution or rounding of the cell body, dendritic beading, or loss of fluorescence. The time to death for each cell was used to create cumulative hazard plots displaying the risk of death overtime for neurons in each population. Each line summarizes experiments pooled from 6 technical replicates of at least 4 biological replicates. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 for the cumulative hazard ratio relative to V2-GFP C9 mutant iNeurons. C9orf72 iNeurons exhibited significant toxicity (*** C9:V2-GFP-250 vs. WT:V2-GFP-250, p<0.0001), while UPF1 expression by AAV9 transduction reduces the risk of death for all UPF1 variants, at different dose concentrations, except for one (V2-GFP-250 vs. V1-RKW-250, **HR=0.49, 9 150336825.1Docket No.162027.49376 p=0.0004; Fig. 3A vs. V3-MeiraA-50, **HR=0.43, p=0.0097 and vs. V3-MeriaA-100, *HR=0.52, p=0.0447 and vs. V3-MeiraA-250, **HR=0.35, p=0.0078; Fig.3B vs. V4-MeiraB- 50, **HR=0.36, p=0.0056 and vs. V4-MeiraB-250, *HR=0.46, p=0.0273; Fig. 3C vs. V5- UPF1_11-50, ***HR=0.35, p=0.0010 and vs. V5-UPF1_11-100, **HR=0.37, p=0.0012; Fig. 3D vs. V6-UPF1_6-50, ***HR=0.28, p=0.0002 and vs. V6-UPF_6-100, ***HR=0.33, p=0.0006; Fig. 3E vs. V7-UPF1_11h-50,n.s.HR=0.61, p=0.0073; Fig. 3F vs. V8-UPF1_11i- 50, **HR=0.35, p=0.0012). N = number of cells per group, pooled from 6 technical replicates and at least 4 biological replicates. Each line summarizes experiments with a UPF1 variant at a dose concentration and indentified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50,100 or 250)K. Fig.3A Endpoints from top to bottom: GFP negative control (C9orf72); V3-MeiraA-100; V1-RKW positive control; V3-MeiraA-50; V3- MeiraA-250; GFP healthy control (WT). Fig.3B Endpoints from top to bottom: GFP negative control (C9orf72); V4-MeiraB-100; V1-RKW positive control; V4-MeiraB-250; V4-MeiraB- 50; GFP healthy control (WT). Fig.3C Endpoints from top to bottom: GFP negative control (C9orf72); V5-UPF1_11-250; V1-RKW positive control; V5-UPF1_11-100; V5-UPF1_11-50; GFP healthy control (WT). Fig. 3D Endpoints from top to bottom: GFP negative control (C9orf72); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT); V6-UPF1_6-50. Fig.3E Endpoints from top to bottom: GFP negative control (C9orf72); V7-UPF1_11h-100; V7-UPF1_11h-250; V7-UPF1_11h-50; V1-RKW positive control; GFP healthy control (WT). Fig.3F Endpoints from top to bottom: GFP negative control (C9orf72); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT).

[0029] Figs. 4A and 4B illustrate the expression of UPF1 variants in patient-derived C9orf72 iPSNs. Fold enrichment of exogenous UPF1 RNA levels in C9Orf72 iPSNs after transduction of each of the UPF1 variant constructs was compared to non-transduced cells, as measured by qRT-PCR. All experiments were conduct with AAV2retro unless specified. Figs. 4A and 4B graphs represent two independent repeats of the experiment. n = 4 for each condition in each experiment. NT: non-transduced. C9:C9Orf72. WT: wildtype. ns: not significant. iPSN: induced pluripotent stem cell (iPSC) derived neurons.

[0030] Fig.5. illustrates the expression of UPF1 variants increases motor neuron survival in an FUS-ALS knock-in mouse model. Number of ChAT-positive motor neurons (MNs) at lumbar level 4 and 5 at P180 in FUS-ALS knock-in mice (MN-P517L / ∆14) were treated at P1 with intracerebroventricular (ICV) injections of AAV2retro to express UPF1 variant constructs (V1, V3-9) were counted and normalized to MNs count in C14 (WT) mice expressing GFP 10 150336825.1Docket No.162027.49376 control.n.s.V9: Meira C, n=4, p=0.0738; **V3: Meira A, n=4, p=0.0023; *V4: Meira B, n=3, p=0.0285; ***V1: RKW, n=5, p=0.0010; *V5: UPF1_11, n=5, p=0.0178; **V6: UPF1_6, n=4, p=0.0050; **V7: UPF1_11h, n=3, p=0.0055; **V8: UPF1_11i, n=4, p=0.0055, using One- Way ANOVA with Fisher’s LSD post-hoc test. Data are shown as mean ± s.d. DETAILED DESCRIPTION

[0031] Provided herein are improved expression constructs for the expression of UPF1, vectors comprising such constructs, and methods of using such constructs and vectors. In embodiments, the expression constructs disclosed herein show enhanced UPF1 expression, thus allowing lower MOIs (multiplicity of infection) of virus to be used clinically. In some embodiments, the expression constructs disclosed herein exhibit a decreased size, which allows for improved AAV genome packaging and manufacturing efficiency.

[0032] Expression constructs

[0033] In one aspect, provided herein is an expression construct comprising: (a) a promoter; (b) a sequence encoding UPF1, operatively linked to the promoter; and (c) a polyadenylation signal.

[0034] As used herein, “operatively linked” refers to a first molecule joined to a second molecule, wherein the molecules are so arranged that the first molecule affects the function of the second molecule. The two molecules may or may not be part of a single contiguous molecule and may or may not be adjacent. For example, a promoter is operatively linked to a transcribable polynucleotide molecule if the promoter modulates transcription of the transcribable polynucleotide molecule of interest in a cell. Additionally, two portions of a transcription regulatory element are operatively linked to one another if they are joined such that the transcription-activating functionality of one portion is not adversely affected by the presence of the other portion. Two transcription regulatory elements may be operatively linked to one another by way of a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operatively linked to one another with no intervening nucleotides present.

[0035] In one aspect, provided is an expression construct comprising: (a) a promoter; (b) a 5ʹ untranslated region (UTR); (c) a sequence encoding UPF1, operatively linked to the promoter; 11 150336825.1Docket No.162027.49376 (d) a posttranscriptional regulatory element; (e) a miRNA binding site (miRBS); and / or (f) a polyadenylation signal.

[0036] In one aspect, provided is an expression construct comprising: (a) a promoter; (b) a 5ʹ UTR; (c) a sequence encoding UPF1, operatively linked to the promoter; and (d) a polyadenylation signal.

[0037] In one aspect, provided is an expression construct comprising: (a) a promoter; (b) a sequence encoding UPF1, operatively linked to the promoter; (c) a posttranscriptional regulatory element; and (d) a polyadenylation signal.

[0038] In one aspect, provided is an expression construct comprising from 5ʹ to 3ʹ: (a) a promoter; (b) a 5ʹ UTR; (c) a sequence encoding UPF1, operatively linked to the promoter; (d) a posttranscriptional regulatory element; (e) a miRBS; and / or (f) a polyadenylation signal.

[0039] As used herein, the term “from 5ʹ to 3ʹ” refers to the order of the specific genetic elements in a nucleic sequence. In some embodiments, the specific genetic elements are linked to one another by way of a linker nucleic acid (e.g., an intervening non-coding nucleic acid). In some embodiments, the specific genetic elements are linked to one another with no intervening nucleotides present. In some embodiments, some of the specific genetic elements are linked to one another by way of a linker nucleic acid, while other are linked to one another with no intervening nucleotides present.

[0040] In some embodiments, the expression construct comprises a promoter sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 3-17. In some embodiments, the expression construct comprises a promoter sequence comprising any one of SEQ ID NOs: 3-17. In some embodiments, the expression construct comprises a promoter sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 12 150336825.1Docket No.162027.49376 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:5-7. In some embodiments, the expression construct comprises a promoter sequence comprising any one of SEQ ID NOs: 5-7. In some embodiments, the expression construct comprises a promoter sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:7.

[0041] In some embodiments, the expression construct comprises a sequence encoding UPF1 that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:19-22. In some embodiments, the expression construct comprises any one of SEQ ID NOs:19-22.

[0042] In some embodiments, the expression construct comprises a sequence encoding UPF1 that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:21. In some embodiments, the expression construct comprises SEQ ID NO:21.

[0043] In some embodiments, the expression construct comprises a sequence encoding UPF1, wherein the sequence encodes a UPF1 protein comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:38 or SEQ ID NO:39. In some embodiments, the expression construct comprises a sequence encoding UPF1, wherein the sequence encodes a UPF1 protein comprising SEQ ID NO:38 or SEQ ID NO:39.

[0044] In some embodiments, the expression construct comprises a sequence encoding UPF1, wherein the sequence encodes a UPF1 protein comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:38. In some embodiments, the expression construct comprises a sequence encoding UPF1, wherein the sequence encodes a UPF1 protein comprising SEQ ID NO:38.

[0045] In some embodiments, the expression construct comprises a 5ʹ UTR and a 3ʹ UTR. In some embodiments, the expression construct comprises a 5ʹ UTR comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:18. In some embodiments, the expression construct comprises a 5ʹ UTR comprising SEQ ID NO:18. 13 150336825.1Docket No.162027.49376

[0046] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:40-53. In some embodiments, the expression construct comprises any one of SEQ ID NOs:40-53.

[0047] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:42. In some embodiments, the expression construct comprises SEQ ID NO:42.

[0048] In some embodiments, the expression construct comprises a 3ʹ UTR comprising a polyadenylation signal and optionally one or more of a posttranscriptional regulatory element and a miRBS.

[0049] In some embodiments, the expression construct comprises a posttranscriptional regulatory element. In some embodiments, the expression construct comprises a posttranscriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:23-26. In some embodiments, the expression construct comprises a posttranscriptional regulatory element comprising any one of SEQ ID NOs:23-26.

[0050] In some embodiments, the expression construct comprises a posttranscriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:24 or SEQ ID NO:25. In some embodiments, the expression construct comprises a posttranscriptional regulatory element comprising SEQ ID NO:24 or SEQ ID NO:25.

[0051] In some embodiments, the expression construct comprises a posttranscriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:24. In some embodiments, the expression construct comprises a posttranscriptional regulatory element comprising SEQ ID NO:24.

[0052] In some embodiments, the expression construct comprises an miRBS that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:27. In some embodiments, the expression construct comprises SEQ ID NO:27. 14 150336825.1Docket No.162027.49376

[0053] In some embodiments, the expression construct comprises a polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:28-30. In some embodiments, the expression construct comprises a polyadenylation signal comprising any one of SEQ ID NOs:28-30.

[0054] In some embodiments, the expression construct comprises a polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:29. In some embodiments, the expression construct comprises a polyadenylation signal comprising SEQ ID NO:29.

[0055] In one embodiment, provided is an expression construct comprising from 5ʹ to 3ʹ: (a) a promoter comprising SEQ ID NO:5; (b) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:21; (c) a posttranscriptional regulatory element comprising SEQ ID NO:25; and (d) a polyadenylation signal comprising SEQ ID NO:28.

[0056] In one embodiment, provided is an expression construct comprising from 5ʹ to 3ʹ: (a) a promoter comprising SEQ ID NO:5; (b) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:20; (c) a posttranscriptional regulatory element comprising SEQ ID NO:25; and (d) a polyadenylation signal comprising SEQ ID NO:28.

[0057] In one embodiment, provided is an expression construct comprising from 5ʹ to 3ʹ: (a) a promoter comprising SEQ ID NO:7; (b) a 5ʹ UTR comprising SEQ ID NO:18; (c) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:21; (d) a posttranscriptional regulatory element comprising SEQ ID NO:24; and (e) a polyadenylation signal comprising SEQ ID NO:29.

[0058] In one embodiment, provided is an expression construct comprising from 5ʹ to 3ʹ: (a) a promoter comprising SEQ ID NO:6; (b) a 5ʹ UTR comprising SEQ ID NO:18; (c) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:21; 15 150336825.1Docket No.162027.49376 (d) a posttranscriptional regulatory element comprising SEQ ID NO:24; (e) an miRBS comprising SEQ ID NO:27; and (f) a polyadenylation signal comprising SEQ ID NO:30.

[0059] In one embodiment, provided is an expression construct comprising from 5ʹ to 3ʹ: (a) a promoter comprising SEQ ID NO:7; (b) a 5ʹ UTR comprising SEQ ID NO:18; (c) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:21; (d) a posttranscriptional regulatory element comprising SEQ ID NO:24; and (e) a polyadenylation signal comprising SEQ ID NO:29.

[0060] In one embodiment, provided is an expression construct comprising from 5ʹ to 3ʹ: (a) a promoter comprising SEQ ID NO:7; (b) a 5ʹ UTR comprising SEQ ID NO:18; (c) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:19; (d) a posttranscriptional regulatory element comprising SEQ ID NO:24; and (e) a polyadenylation signal comprising SEQ ID NO:29.

[0061] Provided herein are expression constructs comprising the elements recited in Tables 1, 2, 6, and 7.

[0062] Vectors

[0063] In one aspect, provided are recombinant vectors and their use for the introduction of a transgene or an expression construct into a cell. In some embodiments, the recombinant vectors comprise recombinant DNA (or RNA) constructs. In addition to the UPF1 coding sequence, the DNA constructs include additional DNA elements, for example, including DNA segments that provide for the replication of the DNA in a host cell and expression of the target gene in target cells at appropriate levels. The ordinarily skilled artisan appreciates that expression control sequences (promoters, enhancers, and the like) are selected based on their ability to promote expression of the target gene in the target cell.

[0064] “Vector,” as used herein, means a vehicle that comprises a polynucleotide to be delivered into a host cell, either in vitro or in vivo. Non-limiting examples of vectors include a recombinant plasmid, yeast artificial chromosome (YAC), mini chromosome, DNA mini- circle, or a virus (including virus derived sequences). A vector may also refer to a virion comprising a nucleic acid to be delivered into a host cell, either in vitro, ex vivo, or in vivo. In 16 150336825.1Docket No.162027.49376 some embodiments, a vector refers to a virion comprising a recombinant viral genome, wherein the viral genome comprises one or more ITRs and a transgene.

[0065] In one embodiment, the recombinant vector is a viral vector or a combination of multiple viral vectors. In one aspect, provided is a vector comprising any of the expression constructs disclosed herein.

[0066] Viral vectors

[0067] Viral vectors for the expression of a target gene in a target cell, tissue, or organism are known in the art and include, for example, an AAV vector, adenovirus vector, lentivirus vector, retrovirus vector, poxvirus vector, baculovirus vector, herpes simplex virus vector, vaccinia virus vector, or a synthetic virus vector (e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and / or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule).

[0068] AAV vectors

[0069] Adeno-associated viruses (AAV) are small, single-stranded DNA viruses which require helper virus to facilitate efficient replication. The 4.7 kb genome of AAV is characterized by two inverted terminal repeats (ITR) and two open reading frames which encode the Rep proteins and Cap proteins, respectively. The Rep reading frame encodes four proteins of molecular weight 78 kD, 68 kD, 52 kD, and 40 kD. These proteins function mainly in regulating AAV replication and rescue and integration of the AAV into a host cell's chromosomes. The Cap reading frame encodes three structural proteins of molecular weight 85 kD (VP1), 72 kD (VP2), and 61 kD (VP3), which form the virion capsid. More than 80% of total proteins in AAV virion comprise VP3. Flanking the rep and cap open reading frames at the 5′ and 3′ ends are about 145 bp long inverted terminal repeats (ITRs). The two ITRs are the only cis elements essential for AAV replication, rescue, packaging, and integration of the AAV genome. The entire rep and cap domains can be excised and replaced with a therapeutic or reporter transgene.

[0070] Recombinant adeno-associated virus “rAAV” vectors include any vector derived from any adeno-associated virus serotype. rAAV vectors can have one or more of the AAV wild-type genes deleted in whole or in part, preferably the Rep and / or Cap genes, but retain functional flanking ITR sequences.

[0071] In some embodiments, the viral vector is an rAAV virion, which comprises an rAAV genome and one or more capsid proteins. In some embodiments, the rAAV genome comprises an expression construct disclosed herein. 17 150336825.1Docket No.162027.49376

[0072] In some embodiments, the viral vector disclosed herein comprises a nucleic acid comprising an AAV 5′ ITR and 3′ ITR located 5′ and 3′ of the sequence encoding UPF1 (and the associated 5ʹ an 3ʹ UTRs), respectively. However, in certain embodiments, it may be desirable for the nucleic acid to contain the 5′ ITR and 3′ ITR sequences arranged in tandem, e.g., 5′ to 3′ or a head-to-tail, or in another alternative configuration. In still other embodiments, it may be desirable for the nucleic acid to contain multiple copies of the ITRs or to have 5′ ITRs (or conversely, 3′ ITRs) located both 5′ and 3′ to the sequence encoding UPF1. The ITRs sequences may be located immediately upstream and / or downstream of the heterologous molecule, or there may be intervening sequences. The ITRs need not be the wild-type nucleotide sequences, and may be altered (e.g., by the insertion, deletion, or substitution of nucleotides) so long as the sequences provide for functional rescue, replication, and packaging. The ITRs may be selected from AAV2, or from among the other AAV serotypes, as described herein.

[0073] In some embodiments, provided is a vector comprising a nucleic acid sequence comprising (i) an expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITR). In one embodiment, the nucleic acid sequence comprises a 5ʹ ITR and a 3ʹ ITR. In one embodiment, the 5ʹ ITR and a 3ʹ ITR are derived from adeno-associated virus (AAV) serotype AAV2.

[0074] In one embodiment, the 5′ ITR sequence comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:1, 54, or 55. In one embodiment, the 5′ ITR sequence comprises any one of SEQ ID NOs:1, 54, or 55.

[0075] In one embodiment, the 3′ ITR sequence comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:2 or SEQ ID NO:56. In one embodiment, the 3′ ITR sequence comprises SEQ ID NO:2 or SEQ ID NO:56.

[0076] Provided herein is a vector comprising a nucleic acid sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:32-37. Provided herein is a vector comprising a nucleic acid sequence any one of SEQ ID NOs:32-37. Provided herein is a vector comprising a nucleic acid sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 18 150336825.1Docket No.162027.49376 98%, or at least 99% identical to SEQ ID NO:34. Provided herein is a vector comprising a nucleic acid sequence comprising SEQ ID NO:34.

[0077] In some embodiments, the viral vector is an AAV vector, such as an AAV1 (i.e., an AAV containing AAV1 ITRs and AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 ITRs and AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 ITRs and AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 ITRs and AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 ITRs and AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 ITRs and AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 ITRs and AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 ITRs and AAV8 capsid proteins), AAV9 (i.e., an AAV containing AAV9 ITRs and AAV9 capsid proteins), AAVrh74 (i.e., an AAV containing AAVrh74 ITRs and AAVrh74 capsid proteins), AAVrh.8 (i.e., an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid proteins), or AAVrh.10 (i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid proteins).

[0078] In some embodiments, the viral vector is a pseudotyped AAV vector, containing ITRs from one AAV serotype and capsid proteins from a different AAV serotype. In some embodiments, the pseudotyped AAV is AAV2 / 9 (i.e., an AAV containing AAV2 ITRs and AAV9 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 10 (i.e., an AAV containing AAV2 ITRs and AAV10 capsid proteins).

[0079] In some embodiments, the pseudotyped AAV is AAV2 / 7m8 (i.e., an AAV containing AAV2 ITRs and AAV7m8 capsid proteins).

[0080] In some embodiments, the AAV vector contains a recombinant capsid protein, such as a capsid protein containing a chimera of one or more of capsid proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh74, AAVrh.8, or AAVrh.10. In embodiments, the capsid is a variant AAV capsid such as the AAV2 variant rAAV2-retro (SEQ ID NO:44 from WO 2017 / 218842, incorporated herein by reference in its entirety).

[0081] In some embodiments, the AAV vector contains two or more capsid proteins selected from different serotypes. In some embodiments, the AAV vector contains rAAV2- retro and AAVrh.10 capsid proteins. In some embodiments, the AAV vector contains rAAV2- retro and AAVrh.10 capsid proteins respectively, in a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50. In some embodiments, the AAV vector contains AAVrh.10 and rAAV2-retro capsid proteins, respectively, in a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50. 19 150336825.1Docket No.162027.49376

[0082] In some embodiments, a mixture of (1) AAV vectors comprising rAAV2-retro and (2) AAV vectors comprising AAVrh.10 is used. In some embodiments, a ratio of the (1) AAV vectors comprising rAAV2-retro and (2) AAV vectors comprising AAVrh.10, respectively, of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50 is used. In some embodiments, a ratio of the (1) AAV vectors comprising AAVrh.10 and (2) AAV vectors comprising rAAV2-retro, respectively, of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50 is used.

[0083] Other viral vectors

[0084] Other viral vectors include adenoviral (AV) vectors, for example, those based on human adenovirus type 2 and human adenovirus type 5 that have been made replication defective through deletions in the E1 and E3 regions. The transcriptional cassette can be inserted into the E1 region, yielding a recombinant E1 / E3-deleted AV vector. Adenoviral vectors also include helper-dependent high-capacity adenoviral vectors (also known as high- capacity, “gutless” or “gutted” vectors), which do not contain viral coding sequences. These vectors contain the cis-acting elements needed for viral DNA replication and packaging, mainly the inverted terminal repeat sequences (ITR) and the packaging signal (CY). These helper- dependent AV vector genomes have the potential to carry from a few hundred base pairs up to approximately 36 kb of foreign DNA.

[0085] Alternatively, other systems such as lentiviral vectors can be used. Lentiviral-based systems can transduce nondividing as well as dividing cells making them useful for applications targeting, for examples, the nondividing cells of the CNS. Lentiviral vectors are derived from the human immunodeficiency virus and, like that virus, integrate into the host genome providing the potential for very long-term gene expression.

[0086] Polynucleotides, including plasmids, YACs, minichromosomes and minicircles, carrying the target gene containing the expression cassette can also be introduced into a cell or organism by nonviral vector systems using, for example, cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) polymer and polyethylenimine (PEI) polymer systems can also be used to deliver the vector to cells. Other methods for delivering the vector to cells includes hydrodynamic injection and electroporation and use of ultrasound, both for cell culture and for organisms. For a review of viral and non-viral delivery systems for gene delivery see Nayerossadat, N. et al. (Adv Biomed Res. 2012; 1:27) incorporated herein by reference in its entirety.

[0087] rAAV virion production 20 150336825.1Docket No.162027.49376

[0088] The rAAV virions disclosed herein may be constructed and produced using the materials and methods described herein, as well as those known to those of skill in the art. Such engineering methods used to construct any embodiment of this disclosure are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, “Molecular Cloning. A Laboratory Manual”, 2d ed., Cold Spring Harbor Laboratory, New York (1989), and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989); and International Patent Publication No. WO 95 / 13598. Further, methods suitable for producing a rAAV cassette in an adenoviral capsid have been described in U.S. Pat. Nos. 5,856,152 and 5,871,982.

[0089] Briefly, in order to package the rAAV genome into a rAAV virion, a host cell is used that contains sequences necessary to express AAV rep and AAV cap or functional fragments thereof as well as helper genes essential for AAV production. The AAV rep and cap sequences are obtained from an AAV source as identified herein. The AAV rep and cap sequences may be introduced into the host cell in any manner known to one in the art, including, without limitation, transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection, and protoplast fusion. In one embodiment, the rep and cap sequences may be transfected into the host cell by one or more nucleic acid molecules and exist stably in the cell as an episome. In another embodiment, the rep and cap sequences are stably integrated into the genome of the cell. Another embodiment has the rep and cap sequences transiently expressed in the host cell. For example, a useful nucleic acid molecule for such transfection comprises, from 5′ to 3′, a promoter, an optional spacer interposed between the promoter and the start site of the rep gene sequence, an AAV rep gene sequence, and an AAV cap gene sequence.

[0090] The rep and cap sequences, along with their expression control sequences, may be supplied on a single vector, or each sequence may be supplied on its own vector. Preferably, the rep and cap sequences are supplied on the same vector. Alternatively, the rep and cap sequences may be supplied on a vector that contains other DNA sequences that are to be introduced into the host cells. Preferably, the promoter used in this construct may be any suitable constitutive, inducible or native promoters known to one of skill in the art. The molecule providing the rep and cap proteins may be in any form which transfers these components to the host cell. Desirably, this molecule is in the form of a plasmid, which may contain other non-viral sequences, such as those for marker genes. This molecule does not contain the AAV ITRs and generally does not contain the AAV packaging sequences. To avoid 21 150336825.1Docket No.162027.49376 the occurrence of homologous recombination, other virus sequences, particularly those of adenovirus, are avoided in this plasmid. This plasmid is desirably constructed so that it may be stably transfected into a cell.

[0091] Although the molecule providing rep and cap may be transiently transfected into the host cell, it is preferred that the host cell be stably transformed with sequences necessary to express functional rep / cap proteins in the host cell, e.g., as an episome or by integration into the chromosome of the host cell. Depending upon the promoter controlling expression of such stably transfected host cell, the rep / cap proteins may be transiently expressed (e.g., through use of an inducible promoter).

[0092] The methods employed for constructing embodiments of this disclosure are conventional genetic engineering or recombinant engineering techniques such as those described in the references above. For example, the rAAV may be produced utilizing a triple transfection method using either the calcium phosphate method (Clontech) or Effectene reagent (Qiagen, Valencia, Calif.), according to manufacturer’s instructions. See, also, Herzog et al, 1999, Nature Medic., 5(1):56-63, for the method used in the following examples, employing the plasmid with the transgene, a helper plasmid containing AAV rep and cap, and a plasmid supplying adenovirus helper functions of E2A, E4Orf6 and VA. While this specification provides illustrative examples of specific constructs, using the information provided herein, one of skill in the art may select and design other suitable constructs, using a choice of spacers, promoters, and other elements, including at least one translational start and stop signal, and the optional addition of polyadenylation sites.

[0093] The rAAV virions are then produced by culturing a host cell containing a rAAV virus as described herein which contains a rAAV genome to be packaged into a rAAV virion, an AAV rep sequence and an AAV cap sequence under the control of regulatory sequences directing expression thereof. Suitable viral helper genes, e.g., adenovirus E2A, E4Orf6 and VA, among other possible helper genes, may be provided to the culture in a variety of ways known to the art, preferably on a separate plasmid. Thereafter, the recombinant AAV virion which directs expression of the UPF1 transgene is isolated from the cell or cell culture in the absence of contaminating helper virus or wildtype AAV.

[0094] Expression of the UPF1 transgene may be measured in ways known in the art. For example, a target cell may be infected in vitro, and the number of copies of the transgene in the cell monitored by Southern blotting or quantitative polymerase chain reaction (PCR). The level of RNA expression may be monitored by Northern blotting or quantitative reverse transcriptase (RT)-PCR; and the level of protein expression may be monitored by Western blotting, 22 150336825.1Docket No.162027.49376 immunohistochemistry, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) or by the specific methods detailed below in the Examples.

[0095] Pharmaceutical composition

[0096] Provided herein are pharmaceutical compositions comprising any of the vectors disclosed herein and a pharmaceutically acceptable excipient.

[0097] In some embodiments, the rAAV comprising the gene encoding UPF1 is assessed for contamination by conventional methods and then formulated into a pharmaceutical composition suitable for storage and / or administration to a patient.

[0098] Formulations of the vectors disclosed herein involve the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels.

[0099] The vector of the disclosure can be formulated into pharmaceutical compositions. These compositions may comprise, in addition to the vector, a pharmaceutically and / or physiologically acceptable excipient, carrier, buffer, stabilizer, antioxidants, preservative, or other additives well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may be determined by the skilled person according to the route of administration. The pharmaceutical composition is typically in liquid form. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Additional carriers are provided in International Patent Publication No. WO 00 / 15822, incorporated herein by reference in its entirety. Physiological saline solution, magnesium chloride, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included. In some cases, a surfactant, such as pluronic acid (PF68) 0.001% may be used. In some cases, Ringer's Injection, Lactated Ringer's Injection, or Hartmann's solution is used. Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included, as required.

[0100] For delayed release, the vector may be included in a pharmaceutical composition which is formulated for slow release, such as in microcapsules formed from biocompatible polymers or in liposomal carrier systems according to methods known in the art.

[0101] If the vector is to be stored long-term, it may be frozen in the presence of glycerol. 23 150336825.1Docket No.162027.49376

[0102] Methods of treatment

[0103] Provided herein are methods of treating a disease in a subject in need thereof using expression constructs, vectors, and pharmaceutical compositions disclosed herein.

[0104] In some embodiments, the subject is a mammal. The term “mammal” as used herein is intended to include, but is not limited to, humans, laboratory animals, domestic pets, and farm animals. Mammals, include, but are not limited to, a human or non-human mammal, such as a bovine, equine, canine, ovine, or feline, etc. Individuals and patients are also subjects herein.

[0105] The terms “treat,” “treated,” “treating,” or “treatment” as used herein refer to therapeutic treatment, wherein the object is to slow down (lessen) an undesired physiological condition, disorder or disease, or to obtain beneficial or desired clinical results. For the purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of the condition, disorder or disease; stabilization (i.e., not worsening) of the state of the condition, disorder or disease; delay in onset or slowing of the progression of the condition, disorder or disease; amelioration of one or more symptoms of the condition, disorder or disease state; and remission (whether partial or total), or enhancement or improvement of the condition, disorder or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.

[0106] The terms “prevent”, “prevention”, and the like refer to acting prior to overt disease or disorder onset, to prevent the disease or disorder from developing or to minimize the extent of the disease or disorder or slow its course of development.

[0107] Disclosed herein are methods for treating neurological diseases, such as amyotrophic lateral sclerosis, frontotemporal lobar dementia, other dementias associated with TDP43 and / or FUS / TLS inclusions, including, but not limited to, Alzheimer’s disease (sporadic and familial), dementia with Lewy’s bodies with or without Alzheimer’s disease, Down syndrome, hippocampal sclerosis dementia, familial British dementia), Parkinsonism (including, but not limited to, Parkinson’s disease with and without dementia, Parkinson’s disease with LRKK2 mutation, Perry syndrome with DCTN1 mutation, ALS Parkinsonism–dementia complex of Guam), polyglutamine diseases like Huntington’s disease, and myopathies.

[0108] ALS is a progressive neurodegenerative disease distinguished by a specific loss of motor neurons in the brain, brain stem, and spinal cord. Initial symptoms of loss of motor neuron activity, including distal muscle weakness and wasting, increased muscle tone with 24 150336825.1Docket No.162027.49376 hyperreflexia, and diaphragmatic and / or bulbar weakness are first noticed at an average age of 55. Death occurs from respiratory failure at an average of 4 years after disease onset. ALS exists as both inherited and random forms. While most forms of ALS are sporadic and idiopathic (sALS), about 10% of cases are inherited in a Mendelian fashion and are designated familial ALS (fALS). The present disclosure provides compositions and methods useful in treating ALS.

[0109] Using genetic analysis, several genes that cause fALS have been identified. The first mutations were identified in SOD1, which encodes the ubiquitously expressed copper / zinc superoxide dismutase. These variants are involved in about 20% of fALS cases worldwide (Rosen et al., Nature 362:59-62 (1993)). Other genes involved in fALS include genes coding for alsin (ALS2), vesicle associated membrane protein B (VAPB) (Nishimura et al., Am. J. Hum. Genet.75:822-831 (2004)), senataxin (SETX) (Chen et al., Am. J. Hum. Genet.74:1128- 1135 (2004)), TAR-DNA-binding protein (TDP-43) (Sreedharan et al., Science 319:1668-1672 (2008)), fused in sarcoma or translocated in liposarcoma (FUS / TLS) (Kwiatkowski et al., Science 323:1205-1208 (2009); Vance et al., Science 323:1208-1211 (2009)), and optineurin (OPTN) (Maruyama et al., Nature 465:223-226 (2010)). FUS / TLS is a nucleic acid binding protein that, when mutated, can cause a subset of fALS and can also increase risk for the sporadic disease. Although FUS / TLS is normally located predominantly in the nucleus, pathogenic mutant forms of FUS / TLS traffic to, and form inclusions in, the cytoplasm of affected spinal motor neurons or glia.

[0110] An intronic GGGGCC repeat expansion in C9ORF72 is a common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). The repeat expansion reduces C9ORF72 expression and C9ORF72-associated activities, triggering neurodegeneration through two mechanisms. First, glutamate receptors accumulate on motor neurons (MNs) and spinal motor neurons in vivo, leading to glutamate-induced excitotoxicity due to neuronal hyperexcitability. Second, clearance of dipeptide repeat proteins generated from the expansion is impaired, enhancing their neurotoxicity. Thus, cooperativity between gain- and loss-of-function mechanisms leads to neurodegeneration. Provided herein are expression constructs and vectors that may rescue, or compensate for, defects associated with a (GGGGCC)nrepeat expansion in the C9ORF72 gene.

[0111] Provided herein is a method of treating a neurological disease including, but not limited to ALS or frontotemporal dementia, the method comprising administering to a subject in need thereof an expression construct, a vector, or a pharmaceutical composition disclosed herein. In some embodiments, provided is a vector, an expression construct, or a 25 150336825.1Docket No.162027.49376 pharmaceutical composition described herein for use in a method treating a neurological disease including, but not limited to ALS or frontotemporal dementia in a subject in need thereof. In some embodiments, provided is the use of a vector, an expression construct, or a pharmaceutical composition described herein in the manufacture of a medicament for treating a neurological disease including, but not limited to ALS or frontotemporal dementia in a subject in need thereof.

[0112] Provided herein is a method of treating a subject suffering from a neurological disease including, but not limited to ALS or frontotemporal dementia, the method comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein.

[0113] Provided herein is a method of preventing a neurological disease including, but not limited to ALS or frontotemporal dementia, the method comprising administering to a subject in need thereof an expression construct, a vector, or a pharmaceutical composition disclosed herein. In some embodiments, provided is a vector, an expression construct, or a pharmaceutical composition described herein for use in a method preventing a neurological disease including, but not limited to ALS or frontotemporal dementia in a subject in need thereof. In some embodiments, provided is the use of a vector, an expression construct, or a pharmaceutical composition described herein in the manufacture of a medicament for preventing a neurological disease including, but not limited to ALS or frontotemporal dementia in a subject in need thereof.

[0114] In some embodiments, treatment refers to partial or complete alleviation, amelioration, relief, inhibition, delaying onset, reducing severity and / or incidence of neurological impairment in a patient suffering from or susceptible to ALS or FTD. As used herein, the term “neurological impairment” includes various symptoms associated with impairment of the central nervous system (e.g., the brain and spinal cord). Symptoms of neurological impairment may include, for example, developmental delay, progressive cognitive impairment, hearing loss, impaired speech development, deficits in motor skills, hyperactivity, aggressiveness and / or sleep disturbances, among others.

[0115] In some embodiments, treatment refers to decreased toxicity of various cells or tissues. In some embodiments, treatment refers to decreased neuronal toxicity due to FUS / TLS or TDP-43 in brain target tissues, spinal cord neurons, and / or peripheral target tissues. In certain embodiments, toxicity is decreased by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more as compared to a control. In some embodiments, toxicity is decreased by at least 1-fold, 2-fold, 26 150336825.1Docket No.162027.49376 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold as compared to a control. In some embodiments, toxicity is measured by tests known to those of ordinary skill in the art including, but not limited to, neuroimaging methods (e.g., CT scans, MRI, functional MRI, etc.)

[0116] In certain embodiments, treatment according to the present disclosure results in a reduction (e.g., about a 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, 97.5%, 99% or more reduction) or a complete elimination of the presence, or alternatively the accumulation, of one or more pathological, clinical, or biological markers that are associated with ALS. For example, in some embodiments, upon administration to a subject, a pharmaceutical composition described herein demonstrates or achieves a reduction in muscle loss, muscle twitching, muscle weakness, spasticity, abnormal tendon reflexes, Babinski sign, breathing problems, facial weakness, slurred speech, loss of perception, loss of reasoning, loss of judgment, and / or loss of imagination.

[0117] In some embodiments, treatment refers to increased survival (e.g., survival time). For example, treatment can result in an increased life expectancy of a patient. In some embodiments, treatment results in an increased life expectancy of a patient by more than about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, about 150%, about 155%, about 160%, about 165%, about 170%, about 175%, about 180%, about 185%, about 190%, about 195%, about 200% or more, as compared to the average life expectancy of one or more control individuals with ALS without treatment. In some embodiments, treatment results in an increased life expectancy of a patient by more than about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, about 10 years or more, as compared to the average life expectancy of one or more control individuals with ALS without treatment. In some embodiments, treatment results in long term survival of a patient. As used herein, the term “long term survival” refers to a survival time or life expectancy longer than about 40 years, 45 years, 50 years, 55 years, 60 years, or longer.

[0118] In embodiments, the subject has the potential to develop a neurological disease including, but not limited to ALS. In some instances, a subject to be treated is genetically predisposed to developing ALS. For example, a subject to be treated has a mutation in a SOD1 27 150336825.1Docket No.162027.49376 gene, ALS2 gene, VAPB gene, SETX gene, TDP-43 gene, FUS / TLS gene, C9orf72 gene, and / or OPTN gene.

[0119] Provided herein is a method of treating ALS, the method comprising administering to a subject in need thereof an expression construct, a vector, or a pharmaceutical composition disclosed herein, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS / TLS gene. In some embodiments, provided is an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of treating a neurological disease including, but not limited to ALS or one or more symptoms of ALS in a subject in need thereof, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS / TLS gene. In some embodiments, provided is the use of an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for treating a neurological disease including, but not limited to ALS or one or more symptoms of ALS in a subject in need thereof, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS / TLS gene. In embodiments, the subject in need of the methods disclosed herein (including administration of the vectors or pharmaceutical compositions disclosed herein) does not have a mutation in the SOD1 gene.

[0120] Provided herein is a method of reducing TDP43 toxicity in a subject in need thereof, the method comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein. In some embodiments, provided is an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of reducing TDP43 toxicity in a subject in need thereof. In some embodiments, provided is the use of an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for reducing TDP43 toxicity in a subject in need thereof.

[0121] Provided herein is a method of reducing FUS / TLS toxicity in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or a pharmaceutical composition disclosed herein. In some embodiments, provided is an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of reducing FUS / TLS toxicity in a subject in need thereof. In some embodiments, provided is the use of an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for reducing FUS / TLS toxicity in a subject in need thereof.

[0122] Provided herein is a method of reducing C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein. In some embodiments, provided is an 28 150336825.1Docket No.162027.49376 expression construct, a vector, or a pharmaceutical composition described herein for use in a method of reducing C9orf72 toxicity in a subject in need thereof. In some embodiments, provided is the use of an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for reducing C9orf72 toxicity in a subject in need thereof.

[0123] Provided herein is a method of preventing or delaying the onset or progression of a neurological disease (including neurological diseases disclosed herein such as ALS or FTD), the method comprising administering to a subject in need thereof an expression construct, a vector, or a pharmaceutical composition disclosed herein, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS / TLS gene. In embodiments, the subject does not have a mutation in the SOD1 gene. In some embodiments, provided is an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of preventing or delaying the onset or progression of a neurological disease (including neurological diseases disclosed herein such as ALS or FTD) in a subject in need thereof. In some embodiments, provided is the use of an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for preventing or delaying the onset or progression of a neurological disease (including neurological diseases disclosed herein such as ALS or FTD) in a subject in need thereof.

[0124] Provided herein is a method of preventing or delaying the onset or progression of TDP43 toxicity in a subject in need thereof, the method comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein. In some embodiments, provided is an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of preventing or delaying the onset or progression of TDP43 toxicity in a subject in need thereof. In some embodiments, provided is the use of an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for preventing or delaying the onset or progression of TDP43 toxicity in a subject in need thereof.

[0125] Provided herein is a method of preventing or delaying the onset or progression of FUS / TLS toxicity in a subject in need thereof, the method comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein. In some embodiments, provided is an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of preventing or delaying the onset or progression of FUS / TLS toxicity in a subject in need thereof. In some embodiments, provided is the use of an expression construct, a vector, or a pharmaceutical composition described 29 150336825.1Docket No.162027.49376 herein in the manufacture of a medicament for preventing or delaying the onset or progression of FUS / TLS toxicity in a subject in need thereof.

[0126] Provided herein is a method of preventing or delaying the onset or progression of C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein. In some embodiments, provided is an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of preventing or delaying the onset or progression of C9orf72 toxicity in a subject in need thereof. In some embodiments, provided is the use of an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for preventing or delaying the onset or progression of C9orf72 toxicity in a subject in need thereof.

[0127] Combination Therapy

[0128] In some embodiments, the expression construct or vector described herein is administered to a subject in combination with one or more additional therapies to treat a neurological disease including, but not limited to ALS or one or more symptoms of ALS. In some embodiments, provided is an expression construct or a vector described herein for use in a method of treating a neurological disease including, but not limited to ALS or one or more symptoms of ALS in a subject in need thereof. In some embodiments, provided is the use of an expression construct or a vector described herein in the manufacture of a medicament for treating a neurological disease including, but not limited to ALS or one or more symptoms of ALS in a subject in need thereof. For example, the expression construct or vector can be administered in combination with riluzole (Rilutek®, Sanofi-Aventis, Bridgewater, N.J.), baclofen, diazepam, trihexyphenidyl, amitriptyline, or sodium phenylbutyrate / taurursodiol (Relyvrio®).

[0129] In some embodiments, combined administration of the expression construct or vector and a second agent results in an improvement in ALS or a symptom thereof to an extent that is greater than one produced by either the expression construct or vector or the second agent alone. The difference between the combined effect and the effect of each agent alone can be a statistically significant difference.

[0130] In some embodiments, combined administration of the expression construct or vector and a second agent allows administration of the second agent at a reduced dose, at a reduced number of doses, and / or at a reduced frequency of dosage compared to a standard dosing regimen approved for the second agent. For example, approved standard regimen for 30 150336825.1Docket No.162027.49376 Rilutek® is 50 mg every 12 hours. Accordingly, for administration in combination with the expression construct or vector, a therapeutically effective amount of Rilutek® can be a dosage of less than about 50 mg and / or a frequency of greater than about every 12 hours.

[0131] In some embodiments, an immunosuppressant agent known to the skilled artisan can be administered to a subject in combination with the expression construct or vector described herein. Exemplary immunosuppressant agents include, without limitation, cyclosporine, FK506, rapamycin, CTLA4-Ig, anti-TNF agents (such as etanercept), daclizumab (e.g., Zenapax™), anti-CD2 agents, anti-CD4 agents, and anti-CD40 agents.

[0132] Routes and methods of administration

[0133] Methods of administration include, but are not limited to, intra-cisternamagna, intracerebroventricular, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intrathecal, intravaginal, transdermal, rectal, by inhalation, or topical, particularly to the ears, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner.

[0134] In some instances, the expression constructs or vectors disclosed herein can effectively cross the blood brain barrier and enter the brain. In other instances, expression construct or vector disclosed herein can be delivered using techniques designed to permit or to enhance the ability of the formulation to cross the blood-brain barrier. Such techniques are known in the art (e.g., WO 89 / 10134; Cloughesy et al., J. Neurooncol.26:125-132 (1995); and Begley, J. Pharm. Pharmacol.48:136-146 (1996)). Components of a formulation can also be modified (e.g., chemically) using methods known in the art to facilitate their entry into the central nervous system (CNS). For example, physical methods of transporting compositions across the blood-brain barrier include, but are not limited to, circumventing the blood-brain barrier entirely, or by creating openings in the blood-brain barrier. Circumvention methods include, but are not limited to, direct injection into the brain (see e.g., Papanastassiou et al., Gene Therapy 9: 398-406 (2002)) and implanting a delivery device in the brain (see e.g., Gill et al., Nature Med. 9: 589-595 (2003); and Gliadel Wafers™, Guildford Pharmaceutical). Methods of creating openings in the barrier include, but are not limited to, ultrasound (see e.g., U.S. Patent Publication No. 2002 / 0038086), osmotic pressure (e.g., by administration of hypertonic mannitol (Neuwelt, E. A., Implication of the Blood-Brain Barrier and its Manipulation, Vols 1 & 2, Plenum Press, N.Y. (1989))), permeabilization by, e.g., bradykinin or permeabilizer A-7 (see, e.g., U.S. Pat. Nos. 5,112,596, 5,268,164, 5,506,206, and 5,686,416), and transfection of neurons that straddle the blood-brain barrier with expression 31 150336825.1Docket No.162027.49376 constructs and vectors containing genes encoding UPF1 (see, e.g., U.S. Patent Publ. No. 20030083299).

[0135] Lipid-based methods can also be used to transport an expression construct or vector disclosed herein across the blood-brain barrier. Exemplary, nonlimiting methods include encapsulating an expression construct or vector in liposomes that are coupled to a targeting agent (e.g., an antibody that binds to receptors on vascular endothelium of the blood-brain barrier (see, e.g., U.S. Patent Publ. No. 20020025313). In certain other embodiments, a targeting agent is coated in low-density lipoprotein particles (see, e.g., U.S. Patent Publ. No. 20040204354) or apolipoprotein E (see, e.g., U.S. Patent Publ. No.20040131692).

[0136] In some embodiments, the expression construct or vector described herein is delivered to the CNS of a subject, e.g., by administering into the cerebrospinal fluid (CSF) of a subject in need of treatment. As used herein, intrathecal administration (also referred to as intrathecal injection) refers to an injection into the spinal canal (intrathecal space surrounding the spinal cord). Various techniques may be used including, without limitation, lateral cerebroventricular injection through a burr hole or cisternal or lumbar puncture or the like. Exemplary methods are described in Lazorthes et al., Adv. Tech. Stand. Neurosurg. 18:143- 192 (1991), and Omaya, Cancer Drug Deliv.1:169-179 (1984).

[0137] In some instances, the expression construct or vector described herein is administered locally. This can be achieved, for example, by local infusion during surgery, topical application (e.g., in a cream or lotion), by injection, by means of a catheter, by means of a suppository or enema, or by means of an implant, said implant being of a porous, non- porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. In some situations, the expression construct or vector described herein is introduced into the central nervous system, circulatory system or gastrointestinal tract by any suitable route, including intraventricular injection, intrathecal injection, paraspinal injection, epidural injection, enema, and by injection adjacent to a peripheral nerve.

[0138] The compositions described herein can be administered as single administrations or as multiple administrations. Such compositions can be administered at regular intervals, depending on the nature, severity and extent of the subject's condition (e.g., ALS). In some embodiments, a therapeutically effective amount of the expression construct or vector is administered intrathecally periodically at regular intervals (e.g., once every year, once every six months, once every five months, once every three months, bimonthly (once every two months), monthly (once every month), biweekly (once every two weeks), or weekly). 32 150336825.1Docket No.162027.49376

[0139] The amount of the expression construct or vector described herein that is effective for treating disease can be determined using standard clinical techniques known to those with skill in the art. In addition, in vitro or in vivo assays can optionally be employed to help identify optimal dosage ranges. The precise dose to be employed can also depend on the route of administration, the condition, the seriousness of the condition being treated, as well as various physical factors related to the individual being treated, and can be decided according to the judgment of a health-care practitioner.

[0140] An effective amount of an rAAV carrying a nucleic acid sequence encoding UPF1 under the control of the promoter may, for example, range between about 1×109to about 1 x 1014rAAV genome particles (vg) / kg body weight. A “genome particle” is defined herein as an AAV capsid that contains a single stranded DNA molecule that can be quantified with a sequence specific method (such as qPCR or ddPCR). In some embodiments, the rAAV is administered at about 1×1012to about 1 x 1013rAAV vg / kg body weight. In some embodiments, the rAAV is administered at about 5 x 1011to about 5 x 1012to vg / mL of cerebrospinal fluid (CSF) volume. In some embodiments, the rAAV is administered at about 7.5 x 1013to 7.5 x 1014vg total per patient.

[0141] In some embodiments, the rAAV is administered to an animal at about 1 ×1011to about 1 x 1014rAAV genome particles (vg) / kg body weight.

[0142] In some embodiments, the rAAV genome particles are provided in a volume of between about 20 uL to about 50 mL. In some embodiments, the rAAV genome particles are provided in a volume of between about 30 uL to about 30 mL. In some embodiments, the rAAV genome particles are provided in a volume of about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 200, about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1000 uL. In some embodiments, the rAAV genome particles are provided in a volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about or 50 mL.

[0143] Still other dosages in these ranges may be selected by the attending physician. It is to be understood that for any particular subject, specific dosage regimens can be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the expression construct of vector and that dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed disclosure. 33 150336825.1Docket No.162027.49376

[0144] The expression construct or vector disclosed herein can also be advantageously provided to a cell ex vivo, followed by administration of the living cell to the subject. Methods for treating disease by implanting a cell that has been modified to express a recombinant protein are also well known. See, for example, U.S. Pat. No.5,399,346, disclosing methods for introducing a nucleic acid into a primary human cell for introduction into a human. Although use of human cells for ex vivo therapy is preferred in some embodiments, other cells such as bacterial cells may be implanted in a subject's vasculature, continuously releasing a therapeutic agent. See, for example, U.S. Pat. Nos.4,309,776 and 5,704,910.

[0145] Articles of manufacture and kits

[0146] Also provided are kits or articles of manufacture for use in the methods described herein. In aspects, the kits comprise the compositions described herein (e.g., compositions for delivery of a UPF1 encoding transgene) in suitable packaging. Suitable packaging for compositions (such as ocular compositions for injection) described herein are known in the art, and include, for example, vials (such as sealed vials), vessels, ampules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may further be sterilized and / or sealed.

[0147] Also provided are kits comprising the compositions described herein. These kits may further comprise instruction(s) on methods of using the composition, such as uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for performing the administration of the composition or performing any methods described herein. For example, in some embodiments, the kit comprises an rAAV for the expression of a UPF1 encoding transgene in target cells, a pharmaceutically acceptable carrier suitable for injection, and one or more of: a buffer, a diluent, a filter, a needle, a syringe, and a package insert with instructions for performing the injections.

[0148] All methods described herein are performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. In regard to any of the methods provided, the steps of the method may occur simultaneously or sequentially. When the steps of the method occur sequentially, the steps may occur in any order, unless noted otherwise. 34 150336825.1Docket No.162027.49376

[0149] In cases in which a method comprises a combination of steps, each and every combination or sub-combination of the steps is encompassed within the scope of the disclosure, unless otherwise noted herein.

[0150] It is to be understood that this invention is not limited to the particular molecules, compositions, methodologies, or protocols described, as these may vary. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention. It is further to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features. For example, where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention, or a particular claim, that feature can also be used, to the extent possible, in combination with and / or in the context of other particular aspects and embodiments of the invention, and in the invention generally.

[0151] All other referenced patents and applications are incorporated herein by reference in their entirety. Furthermore, where a definition or use of a term in a reference, which is incorporated by reference herein is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.

[0152] To facilitate a better understanding of the present invention, the following examples of specific embodiments are given. The following examples should not be read to limit or define the entire scope of the invention. 35 150336825.1Docket No.162027.49376 EXAMPLES

[0153] Example 1: AAV vector engineering and screening

[0154] Enhanced UPF1 expression constructs were designed by rationally optimizing cis- regulatory elements including: (1) Enhancer (size optimization, tissue specificity, potency), (2) promoter (size optimization, tissue specificity, potency), (3) 5’ UTR (translational regulatory motifs, mRNA stabilizing motifs), (4) UPF1 coding sequence (codon optimization), (5) posttranscriptional regulatory element (translational efficiency, mRNA stability, tissue de- targeting motifs, mRNA translocation enhancement), and (6) polyadenylation signal sequence (RNA stability enhancement). Vector “RK” (Fig. 1B), which has been used in Jackson et al, 2015, was used as a control.

[0155] Vector development

[0156] DNA fragments consisting of enhancer / promoter combinations and cis-regulatory elements such as 5’ UTRs and posttranscriptional regulatory elements (including WPRE) and polyA sequences, were synthesized (VectorBuilder or GenScript). In addition to the wild-type UPF1 codon set, two additional codon sets were synthesized: “opti” and “co2”. The “opti” codon set was optimized based on the Codon Adaptation Index (CAI) with a human codon usage table. The “co2” codon set was optimized based on minimizing the presence of CpGs and sequences predicted to activate host immunity through Toll-like receptor 9 (TLR9) signaling. The enhancer / promoters, other cis-regulatory elements, and UPF1 coding sequences, were cloned in various combinations (Table 1) into AAV expression vectors, with the goal of minimizing construct size and increasing vector potency. See Tables 2 and 6-8 for sequences. SEQ ID NO:49 was not assigned to a sequence. 36 150336825.1Docket No.162027.49376 Table 1. Composition of expression constructs. UTR = untranslated region. PolyA = polyadenylation. WPRE = Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element. Wt = wild-type. The CAG promoter is a synthetic promoter comprising the cytomegalovirus (CMV) early enhancer element, the chicken beta actin promoter, the first exon and the first intron of chicken beta-actin gene, and the splice acceptor of the rabbit beta-globin gene. Construct V1 was used in Jackson et al., 2015. Altern: Alternative. Add: Additional. PTR: Posttranscription regulatory. Const: ConstructDocket No.162027.4937638 150336825.1Docket No.162027.4937639 150336825.1Docket No.162027.49376 Table 2. Overview of sequences for selected expression constructs. The sequences for theDocket No.162027.49376

[0157] Cell culture and transfections

[0158] Low passage HEK293 (ATCC) and N2A (ATCC) cells were routinely cultured in Opti-MEM™ with GlutaMAX™ formulation (Gibco) supplemented with 5% fetal bovine serum (FBS) and penicillin / streptomycin (Gibco). Cells were seeded at an average density of 1 x 105cells per well of a 24-well plate for 60-90% confluence at time of transfection. Approximately 24 hr after plating, cells were transfected using TurboFect Transfection Reagent (Thermo Fisher) according to the manufacturer’s instructions. Typically, 1.5 μg DNA of the UPF1 reporter constructs were transfected per well. The pcDNA3.1-EGFP plasmid was transfected as the control. After 48 hr, cells were mechanically collected, pelleted by centrifugation at 300 x g for 5 min, and the pellets were stored at -80 °C.

[0159] Western blotting

[0160] For Western blotting experiments, pellets were thawed on ice and then lysed using CST lysis buffer (Cell Signaling Technology) supplemented with protease inhibitor (Thermo Fisher) and universal nuclease for cell lysis (Pierce). Soluble protein was extracted by high- speed centrifugation and the concentration was determined by BCA (bicinchoninic acid) assay 41 150336825.1Docket No.162027.49376 (Thermo Fisher) against a bovine serum albumin (BSA) standard curve (Thermo Fisher). The concentration of each sample was adjusted to the same target concentration using phosphate buffered saline (“PBS”), pH 7.2-7.4.

[0161] Samples were diluted into lithium dodecyl sulfate (LDS) buffer supplemented with 100 mM dithiothreitol (DTT) in preparation for reducing SDS-PAGE. Samples were boiled for 10 min at 95 °C and allowed to cool to room temperature (RT). Each sample was then loaded at identical final protein concentration onto 4-15% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad) in Tris-Glycine-SDS ("TGS") buffer and run at 150 V for 45-60 min based on migration of a pre-stained ladder (VWR, #102971-126). Transfers onto nitrocellulose membranes were completed using the high molecular weight protocol of the Bio-Rad Trans- Blot Turbo Transfer System (instrument settings: 1.3 A, 21 V, 12 min), with the apparatus pre- cooled to 4 °C.

[0162] Nitrocellulose membranes were cut based on band size (124 kDa and 42 kDa for UPF1 and actin, respectively) and blocked in pre-made buffer (Licor, #103749-018) for 1 hr at RT. Slices were then incubated in solutions of Rb α UPF1 monoclonal antibody (Abcam, #ab133564, 1:10,000 dilution) or Ms α β-actin monoclonal antibody (VWR, #102673-370, 1:10,000 dilution) overnight at 4 °C in pre-made antibody buffer (Licor, #103761-208). The next day, blots were washed three times with PBS-T and were then incubated in Donkey infrared secondary antibodies (Licor) for 1 hr, protected from light. After three PBS-T washes followed by a final wash in PBS, blots were scanned on a Licor Odyssey CLx.

[0163] Raw data were exported into Microsoft Excel. Intensity data from the UPF1 band were normalized to the β-actin control band of the corresponding sample, and this UPF1 / actin ratio for each sample was normalized to the ratio for the EGFP transfection control (which represents the endogenous UPF1 protein level), thereby providing the UPF1 overexpression level relative to the transfection control. Results were plotted in GraphPad Prism 9.

[0164] Results

[0165] Protein expression levels quantified from Western blotting for the various optimized UPF1 expression constructs after transfection in Neuro2A (N2A) cells or HEK293T, respectively. As shown in Tables 1 and 3 and Fig.1, optimization of cis-regulatory elements (e.g., promoter, UTRs) within the UPF1 expression construct substantially reduced AAV vector size while improving expression potency. 42 150336825.1Docket No.162027.49376 Table 3. Relative UPF1 expression as determined Western blotting in HEK and in N2A cells. To compare between different Western blot experiments, a scoring system was developed in which the top expressing construct was assigned a score of 4. The lower expressing constructs were scaled down accordingly to the lowest score of 1. The assigned scores from each experiment were then averaged to give the final shown in the table. N.D. = not determined.43 150336825.1Docket No.162027.49376

[0166] Example 2: UPF1 expression constructs protect Induced Neurons (iNeurons) against TDP-43 toxicity

[0167] The iNeuron model can be used as a model system for neurodegenerative diseases. First, the ability of UPF1 expression constructs to protect against TDP-43 toxicity was examined. Briefly, iPSC-derived neural progenitor cells (NPCs) with WT phenotype or isogenic disease mutation M337V for TDP43 were plated and differentiated into motor neurons. The neurons were transduced with AAV9 containing optimized UPF1 constructs at different dose levels with MOIs of 50, 100 or 250K and then monitored for survival.

[0168] iNeuron differentiation and transduction

[0169] Day 0. Induced pluripotent stem cells (iPSCs) were washed in PBS and incubated in prewarmed accutase (Sigma A6964) at 37 °C for 8 min. Four volumes of E8 media were added to the plate, and the cells were collected and pelleted at 200 x g for 5 min. The media was aspirated, and the pellet was resuspended in 1 ml of fresh E8 media. Cells were counted using a hemocytometer, diluted, plated at a density of 20,000 cells / ml in E8 media with ROCK inhibitor (Y-27632) and incubated at 37 °C overnight. Day 1. Media was changed to N-2 media (1x N-2 Supplement (Gibco 17502-048), 1x NEAA Supplement (Gibco 11140-050), 10 ng / ml BDNF (Peprotech 450-02), 10 ng / ml N-T3 (Peprotech 450-03), 0.2 µg / ml laminin (Sigma L2020), 2 mg / ml doxycycline (Sigma D3447) in E8 media). Day 2. Media was changed to transition media (1x N2 Supplement, 1x NEAA Supplement, 10 ng / ml BDNF, 10 ng / ml N-T3, 0.2 µg / ml laminin, 2 mg / ml doxycycline in half E8 media, half DMEM / F12 (Gibco 11320-033)). Day 3. Media was changed into B-27™ media (1x B-27™ Supplement (Gibco 17504-044), 1x GlutaMAX™ Supplement (Gibco 35050-061), 10 ng / ml BDNF, 10 ng / ml N-T3, 0.2 µg / ml laminin, 2 mg / ml doxycycline, and 1x Culture One (Gibco A33202-01) in Neurobasal-A (Gibco 12349-015)). Day 6. Cells were transduced with AAV9 at MOI of 50K, 100K or 250K. Cells were retained in the same media for the remainder of the experiment. 44 150336825.1Docket No.162027.49376

[0170] Longitudinal fluorescence microscopy and image analysis

[0171] Automated longitudinal fluorescence microscopy began on Day 14 for 10 days. Briefly, images were acquired by an inverted Nikon Ti microscope equipped with a 20x objective lens, a PerfectFocus system, a Lambda XL Xenon lamp (Sutter) with 5 mm liquid light guide (Sutter), and either an Andor iXon3897 EMCCD camera or Andor Zyla4.2 (+) sCMOS camera. All stage, shutter, and filter wheel movements were carried out by custom code written in publicly available software (µManager, ImageJ).

[0172] Image processing was performed using scripts written in Python on the ImageJ macro language. Survival analysis was conducted manually where live neurons were identified and tracked over the imaging interval and cell death was determined for each neuron by rounding of the soma, degenerating processes.

[0173] Results

[0174] UPF1 expression by AAV9 transduction reduced the risk of death for all UPF1 variants at different dose levels (Figs.2A to 2F). V5-UPF1_11 was the most potent vector that protected against TDP-43 toxicity at all dose levels, and showed the greatest survival at the lowest MOI of 50K (Fig.2C).

[0175] Example 3: UPF1 expression constructs protect iNeurons against C9orf72 toxicity

[0176] Next, the ability of UPF1 expression constructs to protect against C9orf72 toxicity was examined in iNeurons expressing C9orf72. C9orf72 iNeurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged by semi-automated microscopy. Custom scripts were used to identify neuronal soma and assign a unique ID to each cell. Neuronal loss was indicated by dissolution or rounding of the cell body, dendritic beading, or loss of fluorescence. The time to death for each cell was used to create cumulative hazard plots displaying the risk of death overtime for neurons in each population. See Example 2 for more detailed Materials and Methods.

[0177] Results:

[0178] UPF1 expression by AAV transduction reduced the risk of death for most UPF1 variants at different dose levels (Figs. 3A to 3F). V6-UPF_6 was the most potent vector for reducing C9orf72 toxicity in the iNeuron model (Fig. 3D). V5-UPF1_11 was also a potent vector that protected against C9orf72 toxicity at the two lowest MOI of 50K and 100K, indicating that this vector was also protective against additional forms of ALS toxicity (Fig. 3C). 45 150336825.1Docket No.162027.49376

[0179] Example 4: Expression of UPF1 variants in patient derived C9orf72 iPSNs

[0180] Cell culture

[0181] iPSCs were grown in 6-well plates on rhLaminin-521 (Thermo Fisher) using Essential 8™ Medium (Gibco) and passaged using Versene (Gibco). Wildtype iPSCs were derived from human neonatal fibroblasts (Lonza) by nucleofecting with OCT3 / 4, hSK, hUL, and mIR. C9orf72 iPSCs were acquired from NINDS (National Institute of Neurological Disorders and Stroke), cell line ND50000. Cell cultures were maintained at 37 °C and 5% CO2.

[0182] Motor neuron differentiation

[0183] Motor neurons were derived from iPSCs as per Hall, C.E., et al. Progressive motor neuron pathology and the role of astrocytes in a human stem cell model of VCP-related ALS. Cell Reports 19, 1739-1749 (2017). Briefly, iPSCs were grown to confluency and neural induction was induced using N-2 / B2-7™ medium (equal parts Neurobasal Medium and DMEM / F12+GlutaMAX, plus 1% B-27™ supplement, 0.5% N-2 supplement, 0.5% non- essential amino acids, 1 mM L-glutamine (all from Gibco), and 2.5 ug / ml insulin (Sigma)) supplemented with 1uM Dorsomophin (Millipore), 2 µM SB431542 (Tocris Bioscience), and 3 µM CHIR99021 (Miltenyi Biotec). At Day 8, the neuroepithelial layer was dissociated with 1 mg / ml Dispase (Gibco), removed from the underlying cells, and plated onto laminin-coated plates. The neuroepithelium was patterned in N-2 / B2-7™ with 0.5 µM retinoic acid and 1 µM Purmorphamine until Day 14, at which point it was treated for four days with N-2 / B2-7™ + 1 µM Purmorphamine until terminal differentiation in N-2 / B2-7™ + 0.1 µM Compound E.

[0184] Transduction

[0185] For the UPF1 vector transduction assay, cells were seeded into 12-well plates for terminal differentiation at a density of 200,000 cells / well. On Day 4 of terminal differentiation, AAV was added to the medium at an MOI of 500,000. Cells were harvested using Accutase (Stemcell) seven days after transduction.

[0186] RT-qPCR

[0187] RNA was extracted from harvested cells using the RNeasy Plus Mini Kit (Qiagen). cDNA was then transcribed from 250 ng of purified RNA using the Superscript IV VILO Master Mix (Thermo Fisher). RT-qPCR was performed using Taqman Primer / probe set. Exogenous UPF1 gene levels were measured by targeting the WPRE region of synthetic UPF1 transcripts. Each sample was compared to β-actin and GAPDH control reactions.

[0188] UPF1 primers (5’-3’):

[0189] Forward primer: TGGTATTCTTAACTATGTTGCTCCT (SEQ ID NO:57) 46 150336825.1Docket No.162027.49376

[0190] Reverse primer: AAGCCATACGGGAAGCAATAG (SEQ ID NO:58)

[0191] Probe: FAM-ACGCTATGTGGATACGCTGCTTT (SEQ ID NO:59)

[0192] Results

[0193] Fold enrichment of exogenous UPF1 RNA levels in C9Orf72 iPSNs after transduction of each of the UPF1 variant constructs was compared to non-transduced cells, as measured by qRT-PCR. Figs.4A and 4B show the results for two independent experiments.

[0194] Example 5: Expression of UPF1 variants increases motor neuron survival in FUS-ALS knock-in mouse model

[0195] Mouse lines and procedures

[0196] Mutant FUS knock-in mice were generated as described in Korobeynikov et al., Antisense oligonucleotide silencing of FUS expression as a therapeutic approach in amyotrophic lateral sclerosis, Nat Med.2022 Jan;28(1):104-116. For ICV injection, newborn animals were first anesthetized on ice, and then 5 uL of AAV2retro at 1.0 x 10^13 vg / mL concentration was injected into the right lateral ventricle (2 mm frontal and 1 mm lateral to bregma) using a Hamilton Neuro syringe. After the injection, animals were placed on a heating pad and monitored until recovery. VP1 capsid variant AAV2retro is described in PCT Publication WO2017218842 (SEQ ID NO:44 in WO2017218842), which is hereby incorporated in its entirety.

[0197] To collect fixed tissue samples, the animals were transcardially perfused with PBS- heparin solution followed by 4% paraformaldehyde; brain and spinal cord tissues were dissected.

[0198] Immunofluorescence

[0199] Spinal cord samples were sectioned at 70-μm thickness on a Leica VT 1000S vibratome. Tissue sections were incubated in primary antibodies (Chicken anti-GFP, Thermo Fisher A10262 at 1:250; Goat anti-ChAT, Millipore AB144P at 1:250; Rabbit anti-Iba1, Wako 019-19741 at 1:250; Rabbit anti-GFAP, Agilent Z0334 at 1:300) diluted in 5% normal donkey serum in Tris-buffered saline with 0.5% Triton X-100 (TBS-T) overnight at 4 °C. The sections were then washed in TBS-T three times and incubated with the corresponding secondary antibodies (Alexa 488 anti-chicken, Thermo Fisher at 1:100; Alexa 594 anti-goat, Thermo Fisher A110058 at 1:300; Alexa 647 anti-rabbit, Thermo Fisher A31573 at 1:300) for 1 h. After three washes in TBS-T, the sections were mounted in aqueous medium (Fluoromount G, Southern Biotech) and imaged using a Leica SP8 confocal microscope. Images were analyzed using LAS X and ImageJ software packages. 47 150336825.1Docket No.162027.49376

[0200] Results

[0201] To assess the ability of UPF1 expression constructs to inhibit FUS-related toxicity, FUS-ALS knock-in mice (MN-P517L / ∆14) were treated at P1 with intracerebroventricular (ICV) injections of AAV2retro to express UPF1 variant constructs (V1, V3-9). The number of ChAT-positive motor neurons (MNs) at lumbar level 4 and 5 at P180 in was normalized to the MNs count in C14 (WT) mice expressing GFP control. Results are shown in Fig.5.

[0202] A summary of in vitro and in vivo experiments for constructs V1 and V3-V8 can be found in Tables 4 and 5.

[0203] A summary of the nucleic acid and protein sequences disclosed herein can be found in Tables 6-8.Docket No.162027.49376Table 4. Summary of in vitro experiments for constructs V1 and V3-V8.Table 5. Summary of in vivo experiments for constructs V1 and V3-V8. In vivo rescue conditions: 1: AAV9 FUS Mouse (FUSP517L / ∆C14; ChAT-Cre); 2: AAV2retro FUS Mouse (FUSP517L / ∆C14; ChAT-Cre) (Example 5); 3: AAV9 TDP43 Rat (AAV9-TDP43); 4:AAV2retro TDP43 Rat (AV9-TDP43).Docket No.162027.49376 Table 6. Sequences of individual expression construct elements.Docket No.162027.4937651 150336825.1Docket No.162027.4937652 150336825.1Docket No.162027.4937653 150336825.1Docket No.162027.4937654 150336825.1Docket No.162027.4937655 150336825.1Docket No.162027.4937656 150336825.1Docket No.162027.4937657 150336825.1Docket No.162027.4937658 150336825.1Docket No.162027.4937659 150336825.1Docket No.162027.4937660 150336825.1Docket No.162027.4937661 150336825.1Docket No.162027.4937662 150336825.1Docket No.162027.49376Table 7. Combined promoter and 5’ UTR sequences.5′ UTR is in bold.63 150336825.1Docket No.162027.4937664 150336825.1Docket No.162027.4937665 150336825.1Docket No.162027.4937666 150336825.1Docket No.162027.4937667 150336825.1Docket No.162027.49376Table 8. Sequences for constructs.68 150336825.1Docket No.162027.4937669 150336825.1Docket No.162027.4937670 150336825.1Docket No.162027.4937671 150336825.1Docket No.162027.4937672 150336825.1Docket No.162027.4937673 150336825.1Docket No.162027.4937674 150336825.1Docket No.162027.4937675 150336825.1Docket No.162027.4937676 150336825.1Docket No.162027.4937677 150336825.1Docket No.162027.4937678 150336825.1Docket No.162027.4937679 150336825.1Docket No.162027.4937680 150336825.1Docket No.162027.4937681 150336825.1Docket No.162027.4937682 150336825.1Docket No.162027.4937683 150336825.1Docket No.162027.4937684 150336825.1Docket No.162027.4937685 150336825.1Docket No.162027.4937686 150336825.1Docket No.162027.49376Table 8. Protein sequences.87 150336825.1Docket No.162027.4937688 150336825.1

Claims

Docket No.162027.49376 CLAIMS We claim:

1. An expression construct comprising: (a) a promoter; (b) a sequence encoding UPF1, operatively linked to the promoter; and (c) a polyadenylation signal.

2. The expression construct of claim 1, wherein the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs:3-17.

3. The expression construct of claim 2, wherein the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs:3-17.

4. The expression construct of claim 3, wherein the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs:3-17.

5. The expression construct of claim 4, wherein the promoter comprises a sequence selected from the group consisting of SEQ ID NOs:3-17.

6. The expression construct of claim 1, wherein the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs:5-7.

7. The expression construct of claim 6, wherein the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs:5-7.

8. The expression construct of claim 7, wherein the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs:5-7.

9. The expression construct of claim 8, wherein the promoter comprises a sequence selected from the group consisting of SEQ ID NOs:5-7.

10. The expression construct of claim 1, wherein the promoter comprises a sequence that is at least 80% identical to SEQ ID NO:

7.

11. The expression construct of claim 10, wherein the promoter comprises a sequence that is at least 90% identical SEQ ID NO:

7.

12. The expression construct of claim 11, wherein the promoter comprises a sequence that is at least 95% identical to SEQ ID NO:

7.

13. The expression construct of claim 12, wherein the promoter comprises SEQ ID NO:

7.

14. The expression construct of any one of claims 1-13, wherein the sequence encoding UPF1 is codon-optimized.

15. The expression construct of any one of claims 1-13, wherein the sequence encoding UPF1 comprises a sequence that is at least 80% identical to any one of SEQ ID NOs:19-22.Docket No.162027.49376 16. The expression construct of claim 15, wherein the sequence encoding UPF1 comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:19-22.

17. The expression construct of claim 16, wherein the sequence encoding UPF1 comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:19-22.

18. The expression construct of claim 17, wherein the sequence encoding UPF1 comprises a sequence selected from the group consisting of SEQ ID NOs:19-22.

19. The expression construct of any one of claims 1-13, wherein the sequence encoding UPF1 comprises a sequence that is at least 80% identical to SEQ ID NO:

21.

20. The expression construct of claim 19, wherein the sequence encoding UPF1 comprises a sequence that is at least 90% identical to SEQ ID NO:

21.

21. The expression construct of claim 20, wherein the sequence encoding UPF1 comprises a sequence that is at least 95% identical to SEQ ID NO:

21.

22. The expression construct of claim 21, wherein the sequence encoding UPF1 comprises SEQ ID NO:

21.

23. The expression construct of any of the preceding claims, wherein the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 80% identical to SEQ ID NO:

38.

24. The expression construct of claim 23, wherein the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 90% identical to identical to SEQ ID NO:

38.

25. The expression construct of claim 24, wherein the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 95% identical to identical to SEQ ID NO:

38.

26. The expression construct of claim 25, wherein the sequence encoding UPF1 encodes a protein comprising SEQ ID NO:

38.

27. The expression construct of any of the preceding claims, wherein the expression construct further comprises a 5’ untranslated region (UTR).

28. The expression construct of claim 27, wherein the 5′ UTR comprises a sequence that is at least 90% identical to SEQ ID NO:

18.

29. The expression construct of claim 28, wherein the 5′ UTR comprises a sequence that is at least 95% identical to SEQ ID NO:

18.

30. The expression construct of claim 29, wherein the 5′ UTR comprises SEQ ID NO:

18.

31. The expression construct of any of the preceding claims, wherein the expression construct further comprises a posttranscriptional regulatory element.

32. The expression construct of claim 31, wherein the posttranscriptional regulatory element comprises a sequence that is at least 80% identical to any one of SEQ ID NOs:23-26. 90 150336825.1Docket No.162027.49376 33. The expression construct of claim 32, wherein the posttranscriptional regulatory element comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:23-26.

34. The expression construct of claim 33, wherein the posttranscriptional regulatory element comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:23-26.

35. The expression construct of claim 34, wherein the posttranscriptional regulatory element comprises any one of SEQ ID NOs:23-26.

36. The expression construct of claim 31, wherein the posttranscriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:24 or SEQ ID NO:

25.

37. The expression construct of claim 36, wherein the posttranscriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:24 or SEQ ID NO:

25.

38. The expression construct of claim 37, wherein the posttranscriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:24 or SEQ ID NO:

25.

39. The expression construct of claim 38, wherein the posttranscriptional regulatory element comprises SEQ ID NO:24 or SEQ ID NO:

25.

40. The expression construct of claim 31, wherein the posttranscriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:

24.

41. The expression construct of claim 40, wherein the posttranscriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:

24.

42. The expression construct of claim 41, wherein the posttranscriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:

24.

43. The expression construct of claim 42, wherein the posttranscriptional regulatory element comprises SEQ ID NO:

24.

44. The expression construct of any of the preceding claims, wherein the expression construct further comprises an miRNA binding site (miRBS) that is at least 80% identical to SEQ ID NO:

27.

45. The expression construct of claim 44, wherein the expression construct comprises an miRBS that is at least 90% identical to SEQ ID NO:

27.

46. The expression construct of claim 45, wherein the expression construct comprises an miRBS that is at least 95% identical to SEQ ID NO:

27.

47. The expression construct of claim 46, wherein the expression construct comprises SEQ ID NO:

27.

48. The expression construct of any one of claims 1-47, wherein the polyadenylation signal comprises a sequence that is at least 80% identical to any one of SEQ ID NOs:28-30. 91 150336825.1Docket No.162027.49376 49. The expression construct of claim 48, wherein the polyadenylation signal comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:28-30.

50. The expression construct of claim 49, wherein the polyadenylation signal comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:28-30.

51. The expression construct of claim 50, wherein the polyadenylation signal comprises any one of SEQ ID NOs:28-30.

52. The expression construct of any one of claims 1-47, wherein the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:

29.

53. The expression construct of claim 52, wherein the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:

29.

54. The expression construct of claim 53, wherein the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:

29.

55. The expression construct of claim 54, wherein the polyadenylation signal comprises SEQ ID NO:

29.

56. A vector comprising the expression construct of any one of claims 1-55.

57. The vector of claim 56, wherein the vector is a viral vector.

58. The vector of claim 57, wherein the vector is an AAV vector.

59. A vector comprising a nucleic acid sequence comprising (i) the expression construct of any one of claims 1-55 and (ii) one or more inverted terminal repeats (ITR).

60. The vector of claim 59, wherein the nucleic acid sequence comprises a 5′ ITR and a 3′ ITR.

61. The vector of claim 60, wherein the 5′ ITR and a 3′ ITR are derived from adeno-associated virus (AAV) serotype AAV2.

62. The vector of claim 61, wherein the sequence of the 5′ ITR is at least 80% identical to any one of SEQ ID NOs:1, 54, or 55.

63. The vector of claim 62, wherein the sequence of the 5′ ITR is at least 90% identical to any one of SEQ ID NOs:1, 54, or 55.

64. The vector of claim 63, wherein the sequence of the 5′ ITR is at least 95% identical to any one of SEQ ID NOs:1, 54, or 55.

65. The vector of claim 64, wherein the sequence of the 5′ ITR comprises any one of SEQ ID NOs:1, 54, or 55.

66. The vector of claim 60 or 62-65, wherein the sequence of the 3′ ITR is at least 80% identical to SEQ ID NO:2 or SEQ ID NO:

56.

67. The vector of claim 66, wherein the sequence of the 3′ ITR is at least 90% identical to SEQ ID NO:2 or SEQ ID NO:

56. 92 150336825.1Docket No.162027.49376 68. The vector of claim 67, wherein the sequence of the 3′ ITR is at least 95% identical to SEQ ID NO:2 or SEQ ID NO:

56.

69. The vector of claim 68, wherein the sequence of the 3′ ITR comprises SEQ ID NO:2 or SEQ ID NO:

56.

70. The vector of claim 60, wherein the 5′ ITR comprises SEQ ID NO:1 and wherein the 3′ ITR comprises SEQ ID NO:

2.

71. A vector comprising the expression construct of claim 1, wherein the vector comprises a sequence that is 80% identical to any one of SEQ ID NOs:32-37.

72. The vector of claim 71, wherein the vector comprises a sequence that is 90% identical to any one of SEQ ID NOs:32-37.

73. The vector of claim 72, wherein the vector comprises a sequence that is 95% identical to any one of SEQ ID NOs:32-37.

74. The vector of claim 73, wherein the vector comprises any one of SEQ ID NOs:32-37.

75. A vector comprising the expression construct of claim 1, wherein the vector comprises a sequence that is 80% identical to SEQ ID NO:

34.

76. The vector of claim 75, wherein the vector comprises a sequence that is 90% identical to SEQ ID NO:

34.

77. The vector of claim 76, wherein the vector comprises a sequence that is 95% identical to SEQ ID NO:

34.

78. The vector of claim 77, wherein the vector comprises SEQ ID NO:

34.

79. The vector of any one of claims 58-70, wherein the vector comprises a capsid derived from AAV7m8, AAV9, AAV2-retro, or AAVrh.

10.

80. The vector of any one of claims 58-70, wherein the vector comprises a capsid comprising capsid proteins derived from AAV2-retro and AAVrh.

10.

81. A cell comprising the expression construct of any one of claims 1-55 or the vector of any one of claims 56-80.

82. A pharmaceutical composition comprising (i) the expression construct of claims 1-55 or the vector of any one of claims 56-80 and (ii) a pharmaceutically acceptable carrier.

83. A method for reducing transactive response DNA binding protein 43 (TDP43) toxicity in a subject in need thereof, the method comprising administering to the subject the vector of any one of claims 56-80 or the pharmaceutical composition of claim 82.

84. A method for reducing C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject the vector of any one of claims 56-80 or the pharmaceutical composition of claim 82. 93 150336825.1Docket No.162027.49376 85. A method for reducing fused in sarcoma / translocated in liposarcoma (FUS / TLS) toxicity in a subject in need thereof, the method comprising administering to the subject the vector of any one of claims 56-80 or the pharmaceutical composition of claim 82.

86. A method of treating a neurogenerative disease in a subject in need thereof, the method comprising administering to the subject the vector of any one of claims 56-80 or the pharmaceutical composition of claim 82.

87. The method of claim 86, wherein the neurogenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar dementia, Alzheimer’s disease (sporadic and familial), dementia with Lewy’s bodies with or without Alzheimer’s disease, Down syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson’s disease with and without dementia, Parkinson’s disease with LRKK2 mutation, Perry syndrome with DCTN1 mutation, ALS Parkinsonism–dementia complex of Guam, Huntington’s disease, and myopathy.

88. The method of claim 87, wherein the neurogenerative disease is amyotrophic lateral sclerosis (ALS).

89. A method for treating a neurogenerative disease associated with TDP43 toxicity in a subject in need thereof, the method comprising administering to the subject the vector of any one of claims 56-80 or the pharmaceutical composition of claim 82.

90. A method for treating a neurogenerative disease associated with C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject the vector of any one of claims 56-80 or the pharmaceutical composition of claim 82.

91. A method for treating a neurogenerative disease associated with FUS / TLS toxicity in a subject in need thereof, the method comprising administering to the subject the vector of any one of claims 56-80 or the pharmaceutical composition of claim 82.

92. The method of any one of claims 83-91, wherein the subject is a human.

93. The method of any one of claims 83-92, wherein the vector or the pharmaceutical composition is administered by intra-cisternal administration. 94 150336825.1