New compounds, processes for preparing the same and their use as drugs

EP4601744A1Pending Publication Date: 2025-08-20B&A ONCOMEDICAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023790246
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-11
Filing Date
2023-10-10
Publication Date
2025-08-20

AI Technical Summary

Technical Problem

Current NKCC1 inhibitors, such as bumetanide, face limitations due to low bioavailability, poor blood-brain barrier permeability, and significant diuretic side effects, which restrict their effectiveness in treating neurological and cancerous disorders.

Method used

Development of new compounds that specifically inhibit NKCC1 transporters with enhanced bioavailability, improved blood-brain barrier permeability, and reduced diuretic side effects, designed to treat a range of neurological disorders, cancers, and other diseases.

Benefits of technology

The new compounds effectively inhibit NKCC1 transporters, offering improved therapeutic efficacy for neurological and cancerous conditions with minimized diuretic side effects and enhanced bioavailability, allowing for more targeted treatment approaches.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

The invention relates to compounds and their therapeutic use, said compounds having the formula (I): wherein, for example,  Z is representing a (II)  X is representing a NR5R6 group wherein R5 and R6 are hydrogen,  R1 is representing hydrogen atom,  R2A and R2B represent hydrogen,  R4 is representing a phenyl ring,  R9 is representing a (III) group  R3 is representing OH, or a pharmaceutically acceptable salt of said compound, its isomers, in particular under pure form, diastereomers, epimers and enantiomers or a mixture of said isomers, diastereomers, epimers and enantiomers.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] NEW COMPOUNDS, PROCESSES FOR PREPARING THE SAME AND THEIR USE AS DRUGS FIELD OF THE INVENTION The invention relates to new compounds, processes for preparing the same and their use as drugs. In particular, the invention relates to news compounds for treating cancers, psychiatric, neurodegenerative and other peripheral or metabolic diseases. PRIOR ART NKCC1 and KCC2, best known as chloride importer and extruder, respectively, play a crucial role in maintaining adequate [Cl-]ilevels: low levels underlie the classical inhibitory actions of GABA in adult neurons and high levels are associated with a paradoxical excitatory action of GABA. Excitatory actions & high [Cl-]i levels are observed in pathological conditions, neurons failing to maintain low levels consequently to high activity of NKCC1 and reduced activity of KCC2 (reviewed in Ben-Ari, Y. et al. 2007. Physiological Reviews 87(4):1215–68; Savardi, Annalisa et al. 2021. Trends in Pharmacological Sciences 42(12):1009-1034; Ben-Ari Y.2017. Trends Neurosci.40(9):536-554). Excitatory GABA actions have been reported in ASD, Rett, Fragile X, infantile epilepsies and neurodegenerative disorders such as Parkinson, Huntington, etc.; cerebro-vascular infarcts, traumatic injuries, post-traumatic disorder, chronic pain, spinal cord lesions, glioblastoma, severe brain tumors, but also peripheral ones including breast and lung cancers (Savardi, Annalisa et al.2021. Trends in Pharmacological Sciences 42(12):1009-1034; Ben- Ari Y.2017. Trends Neurosci.40(9):536-554). Restoring low [Cl-]ilevels and inhibitory actions of GABA by a NKCC1 antagonist (such as Bumetanide) attenuates the severity of many brain disorders (Savardi, Annalisa et al. 2021. Trends in Pharmacological Sciences 42(12):1009-1034; Ben-Ari Y. 2017. Trends Neurosci.40(9):536-554). Pilot trials and larger phase 2 trials have reported an attenuation by bumetanide of the severity of disorders in Fragile X, Tuberous Sclerosis, Down syndrome, or Parkinson Disease (Savardi, Annalisa et al. 2021. Trends in Pharmacological Sciences 42(12):1009-1034; Ben-Ari Y.2017. Trends Neurosci.2540(9):536-554; Van Andel, Dorinde M et al. 2020. Molecular Autism 11(1):1–14) In sum, the convergence of experimental and clinical data reflects the importance of the NKCC1 / KCC2 activity and GABA polarity, and particularly bumetanide, as promising treatment of many brain disorders. Bumetanide (3-(butylamino)-4-phenoxy-5-sulfamoylbenzoic acid) was introduced in clinical medicine in 1972 as a drug with high diuretic potency (Ingram. 1964. British Medical journal December:1640–41) mediated by an inhibition of NKCC2, a cotransporter of Na+, K+, and Cl-expressed in the renal thick of ascending loop of Henle. This site of action led to the classification of these drugs as “loop” diuretics, as opposed to thiazide diuretics, which work in more distal segments of the nephron. Loop diuretics are typically delivered orally or intravenously to treat congestive heart failure and brain edema. When taken orally, the diuretic is absorbed by the intestine, thereby delaying the time to peak effect to 60-90 min, compared to 10-30 min for intravenous administration. Once in the blood, >95% of the diuretic binds to serum albumin thereby reducing its systemic bioavailability. The second target of bumetanide -NKCC1-is widely expressed throughout the body, and in central and peripheral nervous systems. As most of bumetanide in plasma is albumin-bound, only a fraction will diffuse across biological membranes leading to brain levels that are 200-300-fold lower in the brain than the plasma. In addition, the blood brain barrier is quite impermeable to Bumetanide further limiting its central actions in particular if it is also considered the diuretic side effects. Therefore, new compounds synthesis is requested. SUMMARY OF THE INVENTION One of the aims of the invention is to provide new compounds, which are inhibitors of the NKCC1 transporters. Another aim of the invention is to provide inhibitors of the NKCC1 transporters which have a good blood brain barrier permeability and high bioavailability. Another aim of the invention is to provide inhibitors of the NKCC1 transporters which have low diuretic side effects. Another aim of the invention is to provide drugs liable to treat cancers such as glioblastoma, pancreas cancer, prostate cancer, lung cancer, kidney cancer and colon cancer. Another aim of the invention is to provide drugs liable to treat neurological and psychiatric disorders including schizophrenia and autistic spectrum disorder, fragile X, Rett syndrome, Down syndrome, infantile epilepsies, tuberous sclerosis and other neurodevelopmental disorders notably genetic forms of autism. Another aim of the invention is to provide drugs liable to treat neurodegenerative diseases such as Parkinson disease, Alzheimer disease and Huntington disease. Another aim of the invention is to provide drugs liable to treat brain trauma, spinal cord injury, chronic pain and cerebro-vascular infarcts. Another aim of the Invention is to provide drugs liable to treat peripheral diseases such as Autosomal dominant polycystic kidney disease. DETAILED DESCRIPTION The invention relates to a compound of the formula (I): wherein ^ Z is representing o a wherein R1is representing hydrogen, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3- C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1- C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1- C10)alkyl group, said group optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3- C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, ^ and X is representing : o a NR5R6 group wherein R5 and R6 are independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3- C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1- C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1- C10)alkyl group, said groups optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3- C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, or o a NR5R6group wherein R5and R6together with the nitrogen atom bearing them forming a C4-C10 membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead, a combination of these forms or fused with an aryl ring, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, an aryl ring or (C1-C10)acyl group, or o a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, ^ group wherein R10 and R11 are representing independently a hydrogen and an aryl ring, an aryl ring and a hydrogen, a hydrogen and a heteroaryl ring or a heteroaryl ring and a hydrogen said aryl and heteroaryl are optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group ^ R2Aand R2Brepresent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or R2Aand R2Btogether with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group or (C3-C10)heterocycloalkyl group, ^ R4is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8or (C1-C10)acylamino group, ^ R9 is representing: o group wherein R3 is representing OH, (C1-C10)alcoxy group, (C3- C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3- C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group o group wherein R12 and R13 represent independently hydrogen, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3- C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR7R8, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, or (C3-C10)cycloalkyl(C1- C10)alkylcarbonylamino group o o ^ R7 and R8 are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7and R8together with the nitrogen atom bearing them forming a C3-C12membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, said above mentioned alkyl rings being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms, or a pharmaceutically acceptable salt of said compound, its isomers, in particular under pure form, diastereomers, epimers and enantiomers or a mixture of said isomers, diastereomers, epimers and enantiomers. It has been unexpectedly found that compounds of formula (I) are inhibitors of the NKCC1 transporters. The expression “NKCC1 transporters” means Na-K-Cl co-transporter isoform 1, and are active cotransporter that bring Na+, K+, and 2 Cl- into the cell and play an important role in intracellular Cl- accumulation. The expression “cycloalkyl” means a cyclopropyl, a cyclobutyl, a cyclopentyl, a cyclohexyl, a cycloheptyl, a cyclooctyl, a cyclononyl or a cyclodecyl. The expression “heterocycloalkyl” means a cycloalkyl wherein one or more carbon atom is substituted by an oxygen, a nitrogen or a sulfur. A “(C1-C10)alkyl” group means an alkyl group having from 1 to 10 carbon atoms. A “(C1-C10)alcoxy” group means an alkyl group which is singularly bonded to oxygen 1 to 10 carbon atoms. It has the same meaning as alkyloxy. A “alkenyloxy” group means a carbon chain comprising at least one carbon-to-carbon double bond and comprising an alcoxy function that is not supported by the carbon included in a carbon-to-carbon double bond. A “alkynyloxy” group means a carbon chain comprising at least one carbon-to-carbon triple bond and comprising an alcoxy function that is not supported by the carbon included in a carbon-to-carbon triple bond. The expression “pharmaceutically acceptable salt” means all pharmaceutically or physiologically acceptable salt forms of the compounds of formula (I) which may be formed, by protonation of the nitrogen of the amino group bearing the R2A and R2B groups, with an inorganic or organic acid, or as a salt of an acid group (such as a carboxylic acid group) with a physiologically acceptable cation. It may also be formed with the carboxylic acid function when R3is representing OH, and the proton of this function is protonating an inorganic or organic base forming a salt. It can also be formed with the protonation of a nitrogen which might be on a substituent worn by R1, R2A, R2B, R3, R4, R5, R6, R7, R8, R10, R11, R12 and R13. Exemplary base addition salts comprise,: alkali metal salts such as sodium or potassium salts; alkaline earth metal salts such as calcium or magnesium salts; zinc salts; ammonium salts; aliphatic amine salts such as trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, procaine salts, meglumine salts, ethylenediamine salts, or choline salts; aralkyl amine salts such as N,N- dibenzylethylenediamine salts, benzathine salts, benethamine salts; heterocyclic aromatic amine salts such as pyridine salts, picoline salts, quinoline salts or isoquinoline salts; quaternary ammonium salts such as tetramethylammonium salts, tetraethylammonium salts, benzyltrimethylammonium salts, benzyltriethylammonium salts, benzyltributylammonium salts, methyltrioctylammonium salts or tetrabutylammonium salts; and basic amino acid salts such as arginine salts, lysine salts, or histidine salts. Exemplary acid addition salts comprise, mineral acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate salts (such as, e.g., sulfate or hydrogensulfate salts), nitrate salts, phosphate salts (such as, e.g., phosphate, hydrogenphosphate, or dihydrogenphosphate salts), carbonate salts, hydrogencarbonate salts, perchlorate salts, borate salts, organic acid salts such as acetate, propionate, butyrate, pentanoate, hexanoate, heptanoate, octanoate, cyclopentanepropionate, decanoate, undecanoate, oleate, stearate, lactate, maleate, oxalate, fumarate, tartrate, malate, citrate, succinate, adipate, gluconate, glycolate, nicotinate, benzoate, salicylate, ascorbate, pamoate (embonate), camphorate, glucoheptanoate, or pivalate salts; sulfonate salts such as methanesulfonate (mesylate), ethanesulfonate (esylate), 2- hydroxyethanesulfonate (isethionate), benzenesulfonate (besylate), p-toluenesulfonate (tosylate), 2- naphthalenesulfonate (napsylate), 3-phenylsulfonate, or camphorsulfonate salts; glycerophosphate salts; and acidic amino acid salts such as aspartate or glutamate salts. Preferred pharmaceutically / physiologically acceptable salts of the compounds of formula (I) include a hydrochloride salt, a hydrobromide salt, a mesylate salt, a sulfate salt, a tartrate salt, a fumarate salt, an acetate salt, a citrate salt, and a phosphate salt. The expression “enantiomers” means here two compounds of the same molecular formulae but having a different stereochemical configuration. The expression “isomers” means that the compounds could have several stereogenic centers and 25 the compounds could be epimers, enantiomers, diastereomers. The expression “isomer” means also position isomers of substituents. The expression “diastereoisomers” means two compounds of the same formulae but being a non-mirror image and non-identical stereoisomers. The expression “epimers” means one of a pair of two diastereoisomers but having a difference of only one stereogenic center. The expression “pure form” means a compound having a purity level of a least 95%, and more particularly 98%. When Z is representing representing NR5R6, the compound is a sulfonimidamide. When X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, the compound is a sulfoximine. When Z is representing a group wherein R10 and R11 are representing independently a hydrogen and an aryl ring, an aryl ring and a hydrogen, a hydrogen and a heteroaryl ring or a heteroaryl ring and a hydrogen, the compound is a sulfonamide. In particular, the (S) and (R) enantiomers of the sulfoximine function are part of the present invention. In particular, the (S) and (R) enantiomers of the sulfonimidamide function are part of the present invention. In particular, when Z is representing , X is representing NR5R6, at least one chosen among R1, R5 and R6 is a hydrogen atom and at least one chosen among R1, R5 and R6 is different from a hydrogen atom, the compound can be present in two tautomeric forms that are part of the invention. The case where there is only one hydrogen atom among R1, R5and R6corresponds to the abovementioned situation. The case where there is two hydrogen atom among R1, R5 and R6 corresponds to the abovementioned situation. As a non-limiting example, when R5is an ethyl group, R6is a hydrogen and R1is an aryl ring, the compound can be present in two forms :

[0002] When R9 is representing group and R3 is representing OH, the compound comprises a carboxylic acid function. When R9 is representing group and R3 is representing (C1-C10)alcoxy group, (C3- C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3- C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, the compound comprises an ester function. When R9is representing compound comprises an amide function. When R9 is representing ring, the compound comprises a oxadiazolone ring. When R9 is representing ring, the compound comprises a tetrazole ring. In particular, compounds of the invention can be chosen from :

[0003] O O O R N NH N N pounds of the Invention relates to a choice of R between H O , R , R N 9 , or NH N wherein R3 (except OH), R12 and R13 have the meaning defined above. Compounds of the Invention relates to a choice of Z between wherein X, R1 R5, R6, R10 and R11 have the meaning defined above. The present invention relates to all possible combinations of choice of R9and Z in the table above. As a non-limiting example, compound of the invention can resulting from a O R N combination of R9being R and Z being wherein X is different from NR5R6and R1,R12and R13have the meaning defined above. According to another embodiment, the invention relates to a compound as defined above of the formula (I): wherein ^ Z is o a wherein R1 is representing hydrogen, (C1-C10)alkyl group, (C3- C6)cycloalkyl group, (C3-C6)cycloalkyl(C1-C6)alkyl group, (C3-C6)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C6)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C6)alkyl group, aryl(C1-C6)alcoxy group, aryl(C3-C6)cycloalkyl group, aryl(C3-C6)cycloalkyl(C1-C6)alkyl group, heteroaryl(C1-C6)alkyl group, heteroaryl(C3- C6)cycloalkyl group, heteroaryl(C3-C6)cycloalkyl(C1-C6)alkyl group, said group optionally substituted by one or more deuterium, halogen atoms, (C1- C6)alkyl group, (C3-C6)cycloalkyl group, (C1-C6)alcoxy group, (C3-C6)cycloalkyl(C1- C6)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C6)acyl group, (C1-C6)acylamino group, (C3-C6)cycloalkylcarbonylamino group, (C3-C6)cycloalkyl(C1- C6)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C6)alkylcarbamoyl group, (C3-C6)cycloalkylcarbamoyl group, or (C3- C6)cycloalkyl(C1-C6)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, ^ and X is representing : o a NR5R6 group wherein R5 and R6 are independently hydrogen, (C1-C6)alkyl group, (C3-C6)cycloalkyl group, (C3-C6)cycloalkyl(C1-C6)alkyl group, (C3- C6)heterocycloalkyl group, (C3-C6)heterocycloalkyl(C1-C6)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C6)alkyl group, aryl(C1-C6)alcoxy group, aryl(C3- C6)cycloalkyl group, aryl(C3-C6)cycloalkyl(C1-C6)alkyl group, heteroaryl(C1-C6)alkyl group, heteroaryl(C3-C6)cycloalkyl group, heteroaryl(C3-C6)cycloalkyl(C1-C6)alkyl group, said groups optionally substituted by one or more deuterium, halogen atoms, (C1- C6)alkyl group, (C3-C6)cycloalkyl group, (C1-C6)alcoxy group, (C3-C6)cycloalkyl(C1- C6)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C6)acyl group, (C1-C6)acylamino group, (C3-C6)cycloalkylcarbonylamino group, (C3-C6)cycloalkyl(C1- C6)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C6)alkylcarbamoyl group, (C3-C6)cycloalkylcarbamoyl group, or (C3- C6)cycloalkyl(C1-C6)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, or o a NR5R6group wherein R5and R6together with the nitrogen atom bearing them forming a C4-C6 membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead, a combination of these forms or fused with an aryl ring, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C6)alkyl group, (C3-C6)cycloalkyl group, (C3-C6)cycloalkyl(C1-C6)alkyl group, (C3-C6)heterocycloalkyl group, (C3-C6)heterocycloalkyl(C1-C6)alkyl group, (C1- C6)alcoxy group, (C3-C6)cycloalkyl(C1-C6)alcoxy group, nitro, amino, hydroxy, an aryl ring or (C1-C6)acyl group, or o a (C1-C6)alkyl group, (C3-C6)cycloalkyl group or (C3-C6)cycloalkyl(C1-C6)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C6)alcoxy group, (C3-C6)cycloalkyl(C1-C6)alcoxy group or nitro, ^ group wherein R10 and R11 are representing independently a hydrogen and an aryl ring, an aryl ring and a hydrogen, a hydrogen and a heteroaryl ring or a heteroaryl ring and a hydrogen said aryl and heteroaryl are optionally substituted by one or more deuterium, halogen atoms, (C3-C6)cycloalkyl group, (C3-C6)cycloalkyl(C1-C6)alkyl group, (C3-C6)heterocycloalkyl group, (C3-C6)heterocycloalkyl(C1-C6)alkyl group, (C1-C6)alcoxy group, (C3-C6)cycloalkyl(C1- C6)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C6)acylamino group, (C3- C6)cycloalkylcarbonylamino group, (C3-C6)cycloalkyl(C1-C6)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C6)alkylcarbamoyl group, (C3- C6)cycloalkylcarbamoyl group or (C3-C6)cycloalkyl(C1-C10)alkylcarbamoyl group ^ R2A and R2B represent independently hydrogen, (C1-C6)alkyl group, (C3-C6)cycloalkyl group, (C3- C6)cycloalkyl(C1-C10)alkyl group, (C3-C6)heterocycloalkyl group, (C3-C6)heterocycloalkyl(C1- C6)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C6)alkyl group, aryl(C3-C6)cycloalkyl group, heteroaryl(C1-C6)alkyl group or heteroaryl(C3-C6)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C6)cycloalkyl group, (C1-C6)alcoxy group, (C3-C6)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or R2Aand R2Btogether with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C6)alkyl group, (C1-C6)alcoxy group or (C3-C6)heterocycloalkyl group, ^ R4is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1-C6)alkyl group, (C3-C6)cycloalkyl group, (C3-C6)cycloalkyl(C1-C6)alkyl group, (C1-C6)alcoxy group, (C3-C6)heterocycloalkyl group, (C3-C6)heterocycloalkyl(C1-C6)alkyl group, (C3- C6)cycloalkyl(C1-C6)alcoxy group, nitro, amino, hydroxy, NR7R8or (C1-C6)acylamino group,^R9is representing: o group wherein R3 is representing OH, (C1-C6)alcoxy group, (C3- C6)cycloalcoxy group, (C3-C6)cycloalkyl(C1-C6)alcoxy group, (C3- C6)heterocycloalkyl(C1-C6)alcoxy group, a (C2-C6)alkenyloxy group comprising 1 to 2 alkenyl function, a (C2-C6)alkynyloxy group comprising 1 to 2 alkynyl function, O- aryl ring, O-heteroaryl ring, aryl(C1-C6)alcoxy group, aryl(C3-C6)cycloalcoxy group, aryl(C3-C6)cycloalkyl(C1-C6)alcoxy group, heteroaryl(C1-C6)alcoxy group, heteroaryl(C3-C6)cycloalcoxy group, or heteroaryl(C3-C6)cycloalkyl(C1-C6)alcoxy group o group wherein R12and R13represent independently hydrogen, (C1- C6)alkyl group, (C3-C6)cycloalkyl group, (C3-C6)cycloalkyl(C1-C6)alkyl group, (C3- C6)heterocycloalkyl group, (C3-C6)heterocycloalkyl(C1-C6)alkyl group, (C1-C6)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C6)alkyl group, aryl(C3-C6)cycloalkyl group, heteroaryl(C1-C6)alkyl group, heteroaryl(C3-C6)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C6)alcoxy group, NR7R8, (C1-C6)acylamino group, (C3-C6)cycloalkylcarbonylamino group, or (C3-C6)cycloalkyl(C1-C6)alkylcarbonylamino group o o ^ R7and R8are representing independently a (C1-C6)alkyl group, (C3-C6)cycloalkyl group or (C3- C6)cycloalkyl(C1-C6)alkyl group, or R7and R8together with the nitrogen atom bearing them forming a C3-C6membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C6)alkyl group, (C3-C6)cycloalkyl group, (C3-C6)cycloalkyl(C1-C6)alkyl group, (C1-C6)alcoxy group or (C3- C6)heterocycloalkyl group, said above mentioned alkyl rings being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms, or a pharmaceutically acceptable salt of said compound, its isomers, in particular under pure form, diastereomers, epimers and enantiomers or a mixture of said isomers, diastereomers, epimers and enantiomers. This above chemical structure concerns compounds having carbon chains of 1 to 6 carbon atoms. One of the advantages of these compounds is their better solubility on aqueous media. According to another embodiment, the invention relates to the compound as defined above of the formula (II): wherein R1, R2A, R2B, R4, R5, R6and R9have the meaning defined above. This chemical structure as defined above corresponds to the sulfonimidamide class. These compounds are aza-analogues of sulfonamides, in which one of the oxygens has been replaced by a nitrogen atom. It has a stereogenic sulfur center, in which both (S) and (R) enantiomers are part of the invention. to another embodiment, the invention relates to the compound as defined above, of the formula wherein R1, R2A, R2B, R4, and R9 have the meaning defined above, and X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro. This chemical structure as defined above corresponds to the sulfoximine class. These compounds are aza-analogues of sulfones, in which one of the oxygens has been replaced by a nitrogen atom. It has a stereogenic sulfur center, in which both (S) and (R) enantiomers are part of the invention. According to another embodiment, the invention relates to the compound as defined above, of the formula (IV): wherein R2A, R2B, R4, R9, R10and R11have the meaning defined above. This chemical structure as defined above corresponds to the sulfonamide class. These compounds comprise a sulfonyl group connected to an amine group in which R10or R11are an aryl ring or a heteroaryl ring. According to another embodiment, the invention relates to the compound as defined above, of the formula wherein R4, R9, R10and R11have the meaning defined above, and R2A and R2B are representing independently a hydrogen and a (C1-C10)alkyl, or a (C1-C10)alkyl and a hydrogen. This chemical structure as defined above corresponds to the sulfonamide class. This above chemical structure concerns sulfonamide compounds having carbon chains of 1 to 10 carbon atoms directly branched on the amine function of the central phenyl group. One of the advantages of these compounds is the increased inhibition of NKCC1 and a better permeability towards blood-brain barrier. According to another embodiment, the invention relates to the compound as defined above, of the formula (V): wherein Z, R2A, R2B, and R4have the meaning defined above. This above chemical structure of formula (V) corresponds to a class of carboxylic acid compounds. This type of structure can protonate an inorganic or organic base to form a salt. According to another embodiment, the invention relates to the compound as defined above, of the formula wherein Z, R2A, R2B, and R4have the meaning defined above, R3has the meaning defined above but is different from OH. This above chemical structure of formula (VI) corresponds to a class of ester compounds. According to another embodiment, the invention relates to the compound as defined above, of the formula (VII): wherein Z, R2A, R2B, R4, R12and R13have the meaning defined above. This above chemical structure of formula (VI) corresponds to a class of amide compounds. According to another embodiment, the invention relates to the compound as defined above, chosen amongst: - the compound of the formula (VIII): wherein Z, R2A, R2B and R4 have the meaning defined in above, or - the compound of the formula (IX): wherein Z, R2A, R2Band R4have the meaning defined above. This above chemical structure of formula (VIII) corresponds to a class of oxadiazolone compounds. This above chemical structure of formula (IX) corresponds to a class of tetrazole compounds. According to another embodiment, the invention relates to the compound as defined above, of the formula (X): meaning defined above, and R4 is representing a phenyl ring, optionally substituted by one or more halogen atoms, (C1-C10)alkyl group or (C1-C10)alcoxy group. This above chemical structure concerns compounds having phenyl ring branched on the ether function of the central phenyl group. RAccording to another embodiment, the invention relates to the compound as defined above, of the formula wherein Z, R4 and R9 have the meaning defined above, and R2A and R2B are representing independently a hydrogen and a (C1-C10)alkyl group, a (C1-C10)alkyl group and a hydrogen, a hydrogen and a (C11-C12)alkyl group, or a (C11-C12)alkyl group and a hydrogen, said (C1-C10)alkyl group is optionally substituted by one or more halogen atoms or (C1-C10)alcoxy group. This chemical structure comprises an alkyl chain attached to the aryloxyphenyl core of the molecule. According to another embodiment, the invention relates to the compound as defined above, of the formula (XII): wherein R1, R2A, R2B, R4, R5and R6have the meaning defined above. This above chemical structure of formula (XII) is a carboxylic acid compound belonging to the sulfonimidamide class. According to another embodiment, the invention relates to the compound as defined above, of the formula wherein R1, R2A, R2B, R4, R5and R6have the meaning defined above, R3has the meaning defined above but is different from OH. This above chemical structure of formula (XIII) is an ester compound belonging to the sulfonimidamide class. According to another embodiment, the invention relates to the compound as defined above, of the formula (XIV) : wherein R1, R2A, R2B, and R4 have the meaning defined above, and X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, This above chemical structure of formula (XIV) is a carboxylic acid compound belonging to the sulfoximine class. to another embodiment, the invention relates to the compound as defined above, of the formula wherein R1, R2A, R2Band R4have the meaning defined above, R3has the meaning defined above but is different from OH, X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro. This above chemical structure of formula (XV) is an ester compound belonging to the sulfoximine class. According to another embodiment, the invention relates to the compound as defined above, chosen amongst: - a compound of formula (XVI): wherein R1, R2A, R2B and R4 have the meaning defined above, and X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1- C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, or - a compound of formula (XVII): defined in above and X have the meaning defined above. This above chemical structure of formula (XVI) is an oxadiazolone compound belonging to the sulfoximine class. This above chemical structure of formula (XVII) is a tetrazole compound belonging to the sulfoximine class. According to another embodiment, the invention relates to the compound as defined above, of the formula (XVIII): wherein R2A, R2B, R4, R10and R11have the meaning defined above. This above chemical structure of formula (XVIII) is a carboxylic acid compound belonging to the sulfonamide class. According to another embodiment, the invention relates to the compound as defined above, of the formula wherein R2A, R2B, R4, R10and R11have the meaning defined above, R3has the meaning defined above but is different from OH. This above chemical structure of formula (XIX) is an ester compound belonging to the sulfonamide class. According to another embodiment, the invention relates to the compound as defined above, of the formula (XX): wherein R2A, R2B, R4, R10, R11, R12 and R13 have the meaning defined above. This above chemical structure of formula (XX) is an amide compound belonging to the sulfonamide class. According to another embodiment, the invention relates to the compound as defined above, chosen amongst : - the compound of formula (XXI) : wherein R2A, R2B, R4, R10 and R11 have the meaning defined above. or - the compound of formula (XXII) : wherein R2A, R2B, R4, R10and R11have the meaning defined above. This above chemical structure of formula (XXI) is an oxadiazolone compound belonging to the sulfonamide class. This above chemical structure of formula (XXII) is a tetrazole compound belonging to the sulfonamide class. According to another embodiment, the invention relates to the compound as defined above, of the formula wherein ^ Z is ^ wherein R1 is representing hydrogen atom, (C1-C10)alkyl group or an aryl ring and X is representing : o a NR5R6 group wherein R5 and R6 are independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl goup, aryl(C1-C10)alcoxy group or heteroaryl(C1-C10)alkyl group said groups optionally substituted by one or more halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group, (C1-C10)acyl group or (C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, or o a NR5R6 group wherein R5 and R6 together with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead, a combination of these forms or fused with an aryl ring, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said groups optionally substituted by one or more halogen atoms, (C1-C10)alkyl group or (C1-C10)acyl group ^ R2A and R2B are representing independently a hydrogen and a (C1-C10)alkyl group, a (C1-C10)alkyl group and a hydrogen, or a (C1-C10)alkyl group and a (C1-C10)alkyl group, ^ R4 is representing a phenyl ring. This above chemical structure of formula (XXIII) corresponds to a class of carboxylic acid compounds and the sulfonimidamide class. According to another embodiment, the invention relates to the compound as defined above, of the formula wherein ^ Z is representing wherein R1 is representing hydrogen atom, (C1-C10)alkyl group or an aryl ring and X is representing a (C1-C10)alkyl group ^ R2Aand R2Bare representing independently a hydrogen and a (C1-C10)alkyl group, a (C1-C10)alkyl group and a hydrogen, or a (C1-C10)alkyl group and a (C1-C10)alkyl group, ^ R4is representing a phenyl ring. This above chemical structure of formula (XXIV) corresponds to a class of carboxylic acid compounds and the sulfoximine class. According to another embodiment, the invention relates to the compound as defined above, of the formula ^ Z is representing group wherein R10 and R11 are representing independently a hydrogen and an aryl ring or an aryl ring and a hydrogen, ^ R2Aand R2Bare representing independently a hydrogen and a (C1-C10)alkyl group, a (C1-C10)alkyl group and a hydrogen, or a (C1-C10)alkyl group and a (C1-C10)alkyl group, ^ R4is representing a phenyl ring. This above chemical structure of formula (XXIV) corresponds to a class of carboxylic acid compounds and the sulfonamide class. According to another embodiment, the invention relates to the compound as defined above, of the formula (I) wherein ^ Z is ^ wherein R1 is representing hydrogen atom, (C1-C10)alkyl group or an aryl ring and X is representing : o a NR5R6 group wherein R5 and R6 are independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group or heteroaryl(C1-C10)alkyl group said groups optionally substituted by one or more halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group, (C1-C10)acyl group or (C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, or o a NR5R6 group wherein R5 and R6 together with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead, a combination of these forms or fused with an aryl ring, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said groups optionally substituted by one or more halogen atoms, (C1-C10)alkyl or (C1- C10)acyl group group ^ group wherein R10 and R11 are representing independently a hydrogen and an aryl ring or an aryl ring and a hydrogen, ^ R2A and R2B are representing independently a hydrogen and a (C1-C10)alkyl group, a (C1-C10)alkyl group and a hydrogen, or a (C1-C10)alkyl group and a (C1-C10)alkyl group, ^ R4is representing a phenyl ring, ^ R9is representing: o a group wherein R3 is representing (C1-C10)alcoxy group, o group wherein R12and R13represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, optionally substituted by one or more halogen atoms or (C1-C10)alcoxy group, o o This above chemical structure of formula (I) can corresponds to the class of ester, amide, oxadiazolone or tetrazole and to the class of sulfonimidamide, sulfoximine or sulfonamide. According to another embodiment, the invention relates to the compound as defined above, having a formula chosen among the following ones: ^ methyl 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxy-benzoate (Compound 1), ^ methyl 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxy-benzoate (Compound 2), ^ methyl 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)-benzoate (Compound 3), ^ methyl 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)-benzoate (Compound 4), ^ methyl 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 5), ^ methyl 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxy-benzoate (Compound 6), ^ methyl 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (Compound 7), ^ methyl 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 8), ^ methyl 3-(butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 9), ^ methyl 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 10), ^ methyl 3-(azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (Compound 11), ^ methyl 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 12), ^ methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoate (Compound 13), ^ methyl 3-(butylamino)-5-[(N-methylanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 14), ^ methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoate (Compound 15), ^ methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoate (Compound 16), ^ methyl 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 17), ^ methyl 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoate (Compound 18), ^ methyl 3-(butylamino)-5-(indolin-1-ylsulfonimidoyl)-4-phenoxy-benzoate (Compound 19), ^ methyl 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxy- benzoate (Compound 20), ^ methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 21), ^ methyl 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 22), ^ methyl 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 23), ^ methyl 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-benzoate (Compound 24), ^ methyl 3-(aminosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (Compound 25), ^ methyl 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 26), ^ methyl 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 27), ^ methyl 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 28), ^ methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoate (Compound 29), ^ methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 30) ^ methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoate (Compound 31). ^ methyl 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoate (Compound 32), ^ methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoate (Compound 33), ^ methyl 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoate (Compound 34), ^ methyl 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 35), ^ methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoate (Compound 36), ^ methyl 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoate (Compound 37), ^ methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoate (Compound 38), ^ methyl 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoate (Compound 39), ^ methyl 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 40), ^ methyl 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoate (Compound 41), ^ methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxy- benzoate (Compound 42), ^ methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoate (Compound 43), ^ methyl 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoate (Compound 44), ^ methyl 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoate (Compound 45), ^ methyl 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxy-benzoate (Compound 46), ^ methyl 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 47), ^ methyl 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoate (Compound 48), ^ methyl 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxy- benzoate (Compound 49), ^ methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)methylamino]sulfonimidoyl]-4-phenoxy- benzoate (Compound 50), ^ 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 51), ^ 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 52), ^ 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)benzoic acid (Compound 53), ^ 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)benzoic acid (Compound 54), ^ 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 55), ^ 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 56), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoic acid (Compound 57), ^ 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 58), ^ 3-(butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 59), ^ 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 60), ^ 3-(azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoic acid (Compound 61) ^ 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 62). ^ 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 63), ^ 3-(butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoic acid (Compound 64), ^ 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 65), ^ 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoic acid (Compound 66), ^ 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 67), ^ 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 68), ^ 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 69), ^ 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 70), ^ 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 71), ^ 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 72), ^ 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoic acid (Compound 73), ^ 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 74), ^ 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoic acid (Compound 75), ^ 3-(butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoic acid (Compound 76), ^ 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 77), ^ 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 78), ^ 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 79), ^ 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoic acid (Compound 80), ^ 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoic acid (Compound 81), ^ 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 82), ^ 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoic acid (Compound 83), ^ 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoic acid (Compound 84), ^ 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 85), ^ 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoic acid (Compound 86), ^ 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 87), ^ 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 88), ^ 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoic acid (Compound 89), ^ 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoic acid (Compound 90), ^ 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoic acid (Compound 91), ^ 3-[[(1-acetyl-4-piperidyl)amino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 92) ^ 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoic acid (Compound 93). ^ 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 94), ^ 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 95) ^ 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoic acid (Compound 96). ^ 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 97), ^ methyl 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxy-benzoate (Compound 98), ^ methyl 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 99), ^ 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxybenzoic acid (Compound 100), ^ 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 101), ^ 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-N-methyl-4-phenoxy-benzamide (Compound 102), ^ 3-(butylamino)-N-methyl-4-phenoxy-5-[(tetrahydropyran-4- ylmethylamino)sulfonimidoyl]benzamide (Compound 103), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methyl-4-phenoxy- (Compound 104), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N,N-dimethyl-4-phenoxy-benzamide (Compound 105), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-cyclopropyl-4-phenoxy-benzamide (Compound 106), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(cyclopropylmethyl)-4-phenoxy-benzamide (Compound 107), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methoxy-4-phenoxy-benzamide (Compound 108), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-benzamide (Compound 109), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2-difluoroethyl)-4-phenoxy-benzamide (Compound 110), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2,2-trifluoroethyl)-4-phenoxy-benzamide (Compound 111), ^ 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methyl-4-phenoxy-benzamide (Compound 112), ^ 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methoxy-4-phenoxy-benzamide (Compound 113), ^ 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-(2-methoxyethyl)-4-phenoxy-benzamide (Compound 114), ^ 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (Compound 115), ^ 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methyl-4-phenoxy- benzamide (Compound 116), ^ 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methoxy-4-phenoxy- benzamide (Compound 117), ^ 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-(2-methoxyethyl)-4- phenoxy-benzamide (Compound 118), ^ 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-N-(2,2,2- trifluoroethyl)benzamide (Compound 119), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-N-(3,3,3-trifluoropropyl)benzamide (Compound 120), ^ 3-(butylamino)-N-methoxy-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzamide (Compound 121), ^ 3-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-5-[(tetrahydropyran-4- ylamino)sulfonimidoyl]benzamide (Compound 122), ^ 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]-N-(2,2,2- trifluoroethyl)benzamide (Compound 123), ^ methyl 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoate (Compound 124), ^ 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoic acid (Compound 125), ^ 3-(butylamino)-2-phenoxy-N-phenyl-5-(1H-tetrazol-5-yl)benzenesulfonamide (Compound 126) ^ 3-(butylamino)-5-(5-oxo-2H-1,2,4-oxadiazol-3-yl)-2-phenoxy-N-phenyl-benzenesulfonamide (Compound 127). ^ methyl 3-(butylamino)-5-(N-butyl-S-methyl-sulfonimidoyl)-4-phenoxy-benzoate (Compound 128), ^ methyl 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxy-benzoate (Compound 129), ^ 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 130), ^ 3-(butylamino)-5-(N-butyl-S-methyl-sulfonimidoyl)-4-phenoxy-benzoic acid (Compound 131), ^ methyl 3-amino-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoate (Compound 132), ^ methyl 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoate (Compound 133), ^ 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 134), ^ N-butyl-3-(N,S-dimethylsulfonimidoyl)-2-phenoxy-5-(1H-tetrazol-5-yl)aniline (Compound 135) According to another embodiment, the invention relates to the compound of the formula (XIIi): wherein ^ R2Aand R2Brepresent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or R2Aand R2Btogether with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group or (C3-C10)heterocycloalkyl group, ^ Rx is (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, ^ R14, R15 and R16 are representing independently a methyl group, an ethyl group, an isopropyl group, a tert-butyl group or an aryl group, ^ R4is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8or (C1-C10)acylamino group, ^ R3is representing (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1- C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3- C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3- C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group ^ R7 and R8 are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7 and R8 together with the nitrogen atom bearing them forming a C3-C12 membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, said above mentioned alkyl groups being linear or branched, said above mentioned aryl groups being 6 membered aromatic carbon cycles said above mentioned heteroaryl groups being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms, its isomers, in particular under pure form, diastereomers, epimers and enantiomers or a mixture of said isomers, diastereomers, epimers and enantiomers in particular, as intermediary compounds for the synthesis of compounds as defined above. These compounds as defined above are intermediate products of the synthesis of sulfonimidamides, and their preparation is included in the description of the synthesis of sulfonimidamides. According to another embodiment, the invention relates to the compound of the formula (XIIIi): (XIIIi) wherein ^ Rx is (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, ^ R4 is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8 or (C1-C10)acylamino group, ^ R3is representing (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1- C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3- C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3- C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group ^ R7and R8are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7and R8together with the nitrogen atom bearing them forming a C3-C12membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, said above mentioned alkyl groups being linear or branched, said above mentioned aryl groups being 6 membered aromatic carbon cycles said above mentioned heteroaryl groups being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms, its isomers, in particular under pure form, diastereomers, epimers and enantiomers or a mixture of said isomers, diastereomers, epimers and enantiomers. in particular, as intermediary compounds for the synthesis of compounds as defined above. These compounds as defined above are intermediate products of the synthesis of sulfoximines and their preparation is included in the description of the synthesis of sulfoximines. According to another embodiment, the invention relates to the compound of the formula (XIVi): wherein ^ R3is representing OH, (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1- C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3- C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3- C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group ^ R17 is representing a group chosen among: wherein X is representing (C1- C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, ^ R18 is representing a group chosen among a chlorine, a bromine, a fluorine or wherein R4is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8or (C1-C10)acylamino group, ^ R7and R8are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7 and R8 together with the nitrogen atom bearing them forming a C3-C12 membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, its isomers, in particular under pure form, diastereomers, epimers and enantiomers or a mixture of said isomers, diastereomers, epimers and enantiomers, in particular, as intermediary compounds for the synthesis of compounds as defined above. These compounds as defined above are intermediate products, that comprise a thiophenol or thioether function, of the synthesis of sulfoximines and their preparation is included in the description of the synthesis of sulfoximines. According to another embodiment, the invention relates to the following compound: methyl 3-(butylamino)-5-[[tert-butyl(dimethyl)silyl]sulfamoyl]-4-phenoxy-benzoate (Int02), This compound is an intermediate product of the synthesis of sulfonimidamides. According to another embodiment, the invention relates to the following compound: methyl 3-(methylsulfonimidoyl)-5-nitro-4-phenoxy-benzoate (Int07) This compound is an intermediate product of the synthesis of sulfoximines. According to another embodiment, the invention relates to the compound of formula: 4-chloro-3-nitro-5-sulfanyl-benzoic acid (Int04), methyl 4-chloro-3-methylsulfanyl-5-nitro-benzoate (Int05), or methyl 3-methylsulfanyl-5-nitro-4-phenoxy-benzoate (Int06) These compounds are intermediate products of the synthesis of sulfoximines. The invention relates to a process of preparation of a compound of formula (II) as defined above: wherein ^ R5and R6are independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3- C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1- C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group, said groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, or ^ R5 and R6 together with the nitrogen atom bearing them forming a C4-C10 membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead, a combination of these forms or fused with an aryl ring, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, an aryl ring or (C1- C10)acyl group, ^ R1is representing hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1- C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3- C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group, said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, ^ R2A and R2B represent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or R2A and R2B together with the nitrogen atom bearing them forming a C4-C10 membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1- C10)alcoxy group or (C3-C10)heterocycloalkyl group, ^ R4 is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8or (C1-C10)acylamino group, ^ R9 is representing: ^ a group wherein R3 is representing OH, (C1-C10)alcoxy group, (C3- C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1- C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2- C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1- C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group ^ group wherein R12and R13represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR7R8, (C1- C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, or (C3-C10)cycloalkyl(C1- C10)alkylcarbonylamino group, ^ R7and R8are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7 and R8 together with the nitrogen atom bearing them forming a C3-C12 membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, comprising the following steps: a) a silylation step of a compound of formula (XXVI): (XXVI) wherein R2A, R2B and R4 have the meaning defined above and GP1 is a protecting group, in particular representing (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1- C10)alcoxy group wherein R7and R8have the meaning defined above with a of formula (XXVII): wherein R14, R15 and R16 are representing independently a methyl group, an ethyl group, an isopropyl group, a butyl group, a tert-butyl group or an aromatic group, to obtain a compound of formula (XVIII): wherein GP1, R2A, R2B, R4, R14, R15and R16have the meaning defined above a substitution on said of formula (XVIII) to replace one of the oxygens on the radicalin particular with dichlorotriphenylphosphorane or a mixture of PPh3and (CCl3)2and HNR5R6, wherein R5and R6 have the meaning defined above, to obtain a compound of formula (XXIX): wherein GP1, R2A, R2B, R4, R5, R6, R14, R15and R16have the meaning defined above, c) a deprotection of the silyl function of said compound (XXIX), in particular with acidic acetonitrile, to obtain a compound of formula (XXX): wherein GP1, R2A, R2B, R4, R5 and R6 have the defined above said compound being of said formula (II) when and possibly, d) ^ an addition of R1-B(OH)2 wherein R1 is representing an aryl ring or a heteroaryl ring, on said compound of formula (XXX), in particular with Cu(OAc)2, said aryl or heteroaryl ring optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1- C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, to obtain a compound of formula (XXXI):, wherein GP1, R1, R2A, R2B, R4, R5 and R6 have the defined above, said compound being of formula (II) when or ^ an addition of formaldehyde on said compound of formula (XXX), to obtain a compound of formula (XXXI): wherein GP1 R2A, R2B, R4, R5 and R6 have the meaning defined above and R1 is representing a methyl group, said compound being of formula (II) when or ^ an addition of (C1-C10)alkyl-Br group, (C3-C10)cycloalkyl-Br group, a (C3-C10)cycloalkyl(C1-C10)alkyl- Br group, a (C3-C10)heterocycloalkyl-Br group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl-Br group, an aryl(C1-C10)alkyl-Br group, an aryl(C1-C10)alcoxy-Br group, an aryl(C3-C10)cycloalkyl-Br group, an aryl(C3-C10)cycloalkyl(C1-C10)alkyl-Br group, heteroaryl(C1-C10)alkyl-Br group, heteroaryl(C3- C10)cycloalkyl-Br group or heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl-Br group on said compound of formula (XXX), in particular with K2CO3, KH or NaH said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, to obtain a compound of formula (XXXI): wherein GP1, R2A, R2B, R4, R5and R6have the meaning defined above and R1is representing (C1- C10)alkyl group, (C3-C10)cycloalkyl group, a (C3-C10)cycloalkyl(C1-C10)alkyl group, a (C3- C10)heterocycloalkyl group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl(C1-C10)alkyl group, an aryl(C1-C10)alcoxy group, an aryl(C3-C10)cycloalkyl group, an aryl(C3-C10)cycloalkyl(C1- C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group or heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, on said compound of formula (XXX), in particular with K2CO3, KH or NaH said compound being of formula (II) when and possibly, e) a saponification of said compound of formula (XXX) or formula , in with LiOH, NaOH or KOH, to obtain a compound of said formula (II) wherein and possibly, f) an amidation of one compound of said formula (II) wherein HNR12R13, wherein R12 and R13 have the meaning defined above, in particular with N,N- diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyl uronium, 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, to obtain a compound of formula (II) wherein R9 is representing group, said above mentioned alkyl groups being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms. This process described above is a process of preparation of compounds of formula (II) that are part of the sulfonimidamide class. The step d) is optional when R1 is representing a hydrogen The step e) is optional if the compound is part of the ester class. The compound obtained at the end of step f) is part of the amide class. This process comprising the 3 following steps : a), b) and c) is part of the invention. This process comprising the 4 following steps : a), b), c) and d) is part of the invention. This process comprising the 4 following steps : a), b), c) and e) is part of the invention. This process comprising the 5 following steps : a), b), c), d) and e) is part of the invention. This process comprising the 5 following steps : a), b), c), e) and f) is part of the invention. This process comprising the 6 following steps : a), b), c), d), e) and f) is part of the invention. In this particular embodiment, the step a) is a silylation step of a compound of formula (XXVI) with a compound of formula (XXVII), for instance at a temperature from 0°C to 100 °C, preferably at 50°C during 18 hours in a cyclic ether as a solvent chosen among tetrahydrofuran, diethyl ether, dimethoxymethane, dimethoxyethane, diethoxymethane, tetrahydrofuran, tert butyl methyl ether, tert-butyl ethyl ether, methyltetrahydrofuran, 1,4-dioxane or methoxycyclopentane, preferably tetrahydrofuran and a tertiary or aromatic amine as a base among triethylamine, diisopropylamine, pyridine or dimethylaminopyridine. In this particular embodiment, the step b) is a substitution step on the sulfur atom of a compound of formula (XXVIII) to synthesize the sulfonimidamide function; using for instance dichloro triphenyl phosphorane or triphenylphosphine and hexachloroethane in chloroform or dichloromethane or THF, preferably chloroform at a temperature from -50°C to 75°C, preferably 0°C. In this particular embodiment, the step c) is a deprotection step of the silyl function of a compound of formula (XXIX) using for instance acidic acetonitrile at a temperature from -20°C to 100°C, preferably at 20°C, or using a source of fluorine ion in particular tetrabutyl ammonium fluoride or potassium fluoride or cesium fluoride in THF at 20°C. In this particular embodiment, the step d) is an addition step of R1-B(OH)3 on a compound of formula (XXX) for instance at a temperature from 20°C to 200°C, preferably 100°C during 16 hours in a cyclic ether as a solvent chosen among tetrahydrofuran, diethyl ether, dimethoxymethane, The invention relates to a process of preparation of a compound of formula (III) as defined above, wherein ^ X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, ^ R1is representing hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1- C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3- C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group, said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, ^ R2A and R2B represent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or R2Aand R2Btogether with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1- C10)alcoxy group or (C3-C10)heterocycloalkyl group, ^ R4 is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8 or (C1-C10)acylamino group, ^ R9 is representing: ^ a group wherein R3 is representing OH, (C1-C10)alcoxy group, (C3- C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1- C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2- C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1- C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group ^ group wherein R12and R13represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR7R8, (C1- C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, or (C3-C10)cycloalkyl(C1- C10)alkylcarbonylamino group or ^ ^ R7and R8are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7and R8together with the nitrogen atom bearing them forming a C3-C12membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, comprising the following steps: a) a reduction, on a compound of formula (XXXII): wherein Y is representing a fluorine, a chlorine or a bromine, in particular with PPh3 or SnCl2 or zinc powder to obtain a compound of formula (XXXIII): wherein Y have the meaning defined above b) an addition of the X and GP1groups, in particular the addition of ^ X-Z and Gp1-Z in particular with X-Z and a base, in particular iodomethane and Cs2CO3or K2CO3 ^ X-Z and Gp1-OH, in particular with X-Z and an aqueous base, in particular MeI and aqueous NaOH in a first step, then with a coupling reagent and Gp1-OH in particular with1-Ethyl-3-(3- dimethylaminopropyl)carbodiimide and 4-dimethylaminopyridine in Gp1-OH or with an alcohol and an acid in particular with Gp1-OH and sulfuric acid, ^ X-Z and Gp1-OH, in particular with an alcohol and an acid, in particular with Gp1-OH and sulfuric acid, in particular with methanol and sulfuric acid in a first step, then with X-Z and a base, in particular MeI and Cs2CO3 or K2CO3 wherein Z is representing bromine or a iodine and and X have the meaning defined above on said compound of formula (XXXIII), to obtain a compound of formula (XXXIV): wherein Y, GP1 and X have the meaning defined above c) an aromatic nucleophilic substitution of said compound (XXXIV) with R4-OH, wherein R4has the meaning defined above, in particular with K2CO3 or Cs2CO3, NaOMe, triethylamine, N,N- diisopropylethylamine or 1,8-diazabicyclo[5.4.0]undec-7-ene to obtain a compound of formula wherein GP1, X and R4 have the meaning defined above d) an oxidation of said compound of formula (XXXV), in particular with (diacetoxyiodo)benzene and an ammonium provider, such as ammonium carbamate, ammonium carbonate, ammonia or ammonium acetate, to obtain a compound of formula (XXXVI): wherein GP1, X and R4 have the meaning defined above e) a reduction of said compound of formula (XXXVI) to obtain a compound of formula (XXXVII): in particular with palladium and hydrogen, FeCl2, ZnCl2or SnCl2in aqueous ammonium chloride, wherein GP1, X and R4 have the meaning defined above f) ^ a reductive amination of said compound of formula (XXXVII), by addition of a compound of formula (XXXVIII) or (XXXIX) and a reductive agent, in particular NaBH(OAc)3 or NaBH3CN: T2A(XXXVIII) being O T2B(XXXIX) beingOwherein T2A and T2B represent independently hydrogen, (C1-C9)alkyl group, (C10-C11)alkyl group optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, ^ an alkylation of said compound of formula (XXXVII), by addition of a compound of formula (XL) or (XLI) or of compounds of formulae (XL) and (XLI) and a base, in particular Cs2CO3or K2CO3, (XL) being R2AHal (XLI) beingR2BHalwherein Hal is representing a chlorine or a bromine to obtain a compound of formula (XLII): wherein GP1, R4and X have the meaning defined above and R2A, R2Bare representing hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1- C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1- C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or ^ an arylation of said compound of formula (XXXVII), in particular a palladium or copper- catalysed, by addition of a compound of formula (XLIII) or (XLIV) or of compounds of formulae (XLIII) and (XLIV) and a catalyst, in particular chosen among copper (II) acetate, palladium diacetate, tris(dibenzylideneacetone)dipalladium (0) or palladium (II) [1,1'- bis(diphenylphosphanyl)ferrocene] dichloride (XLIII) being R2AM (XLIV) beingR2B Mwherein R2Aand R2Bare representing independently an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1- C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, wherein M is representing a chlorine or a bromine wherein Mx1and Mx2are representing independently a hydrogen or a (C1-C6) alkyl group, Mx1 and Mx2 being possibly linked by a covalent bond or ^ a nucleophilic aromatic substitution of said compound of formula (XXXVII), by addition of compounds of formulae (XLV) and (XLVI) and a base, in particular triethylamine, (XLV) being R2AF (XLVI) being R2BF to obtain a compound of formula (XLII): wherein GP1, R4and X have the meaning defined above and R2A, R2Bare representing independently a hydrogen, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3- C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or ^ a double alkylation of said compound of formula (XXXVII), by addition of a compound of formula and a base, in particular Cs2CO3, K2CO3 or triethylamine, wherein Hal is representing a chlorine or a bromine and n is a positive integer being from 4 to 10 to obtain a compound of formula (XLIX): wherein GP1, R4 and X have the meaning defined above and R2A and R2B together with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group or (C3-C10)heterocycloalkyl group, said compounds of formulae (XLII) or (XLIX) being of formula (III) when and R1 = H and possibly, g) ^ an addition of R1-B(OH)2wherein R1is representing an aryl ring or a heteroaryl ring, on one of compounds of formulae (XLII) or (XLIX), in particular with Cu(OAc)2, said aryl or heteroaryl ring optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1- C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, to obtain a compound of formula (L): wherein GP1, R1, R2A, R2B, R4 and X have the defined above, said compound being of formula (III) when or ^ an addition of formaldehyde, on one of compounds of formulae (XLII) or (XLIX), to obtain a compound of formula (L): wherein GP1 R2A, R2B, R4 and X have the defined and R1 is a methyl group, said compound being of formula (III) when or ^ an addition of (C1-C10)alkyl-Br group, (C3-C10)cycloalkyl-Br group, a (C3-C10)cycloalkyl(C1- C10)alkyl-Br group, a (C3-C10)heterocycloalkyl-Br group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl- Br group, an aryl(C1-C10)alkyl-Br group, an aryl(C1-C10)alcoxy-Br group, an aryl(C3- C10)cycloalkyl-Br group, an aryl(C3-C10)cycloalkyl(C1-C10)alkyl-Br group, heteroaryl(C1- C10)alkyl-Br group, heteroaryl(C3-C10)cycloalkyl-Br group or heteroaryl(C3-C10)cycloalkyl(C1- C10)alkyl-Br group on said compound of formula (XXX), in particular with K2CO3, KH or NaH said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, to obtain a compound of formula (L): wherein GP1, R2A, R2B, R4 and X have the meaning defined above and R1 is representing (C1- C10)alkyl group, (C3-C10)cycloalkyl group, a (C3-C10)cycloalkyl(C1-C10)alkyl group, a (C3- C10)heterocycloalkyl group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl(C1-C10)alkyl group, an aryl(C1-C10)alcoxy group, an aryl(C3-C10)cycloalkyl group, an aryl(C3-C10)cycloalkyl(C1- C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group or heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, said compound being of formula (III) when and possibly, h) a saponification of one of compound of formulae (XLII), or , in with LiOH, NaOH or KOH, to obtain a compound of said formula (III) wherein and possibly, i) an amidation of a compound of said formula (III) wherein HNR12R13, wherein R12 and R13 have the meaning defined above, in particular with N,N- diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyl uranium, 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3- tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium to obtain a compound of formula (III) wherein R9 is representing , or after step h), j) an amidation, followed a followed by a cyclization of a compound of said formula (III) wherein particular with 1,1'-carbonyldiimidazole and an ammonia solution (amidation) followed by pyridine and trifluoroacetic anhydride or thionyl chloride in dimethylformamide or phosphorus pentoxide in methanol, chloroform or toluene (dehydration), followed by sodium azide and ammonium chloride (cyclization), to obtain a compound of formula (III) wherein R9 is representing ring, said above mentioned alkyl groups being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms. This process described above is a process of preparation of compounds of formula (III) that belong to the sulfoximine class. The step g) is optional when R1 is representing a hydrogen The step h) is optional if the compound is part of the ester class. The compound obtained at the end of step i) is part of the amide class. The compound obtained at the end of step j) is part of the tetrazole class. This process comprising the 6 following steps : a), b), c), d), e) and f) is part of the invention. This process comprising the 7 following steps : a), b), c), d), e), f) and g) is part of the invention. This process comprising the 7 following steps : a), b), c), d), e), f) and h) is part of the invention. This process comprising the 8 following steps : a), b), c), d), e), f), g) and h) is part of the invention. This process comprising the 8 following steps : a), b), c), d), e), f), h) and i) is part of the invention. This process comprising the 9 following steps : a), b), c), d), e), f), g), h) and i) is part of the invention. This process comprising the 9 following steps : a), b), c), d), e), f), h), i) and j) is part of the invention. This process comprising the 10 following steps : a), b), c), d), e), f), g), h), i) and j) is part of the invention. In this particular embodiment, the step a) is a reduction step of a compound of formula (XXXII) for example at a temperature from 0°C to 200°C, preferably 100°C for 16 hours. In this particular embodiment, the step b) is an addition step of X and / or GP1group(s) on a compound of formula (XXXIII), for instance at a temperature at a temperature from -20°C to 100°C, in particular at 20°C in a polar solvent chosen among dimethylformamide, dimethylsulfoxide, butanone, 1-4 dioxane, hexamethylphosphoramide or dimethylacetamide, in particular dimethylformamide. In this particular embodiment, the step c) is an aromatic nucleophilic substitution step of R4-OH on a compound of formula (XXXIV) for instance at a temperature from 20°C to 200°C, in particular 100°C in a polar solvent chosen among dimethylformamide, dimethylsulfoxide, butanone, 1-4 dioxane, hexamethylphosphoramide or dimethylacetamide, in particular dimethylformamide. In this particular embodiment, the step d) is an oxidation step on a compound of formula (XXXV) to synthesize the sulfoximine function. The reaction is carried out for instance at a temperature from -75°C to 80 °C, in particular 20°C in a polar protic solvent chosen among methanol, ethanol, isopropanol, butanol, hexafluoroisopropanol, in particular methanol. In this particular embodiment, the step e) is a reduction step of a compound of formula (XXXVI), for instance at a temperature from -50°C to 100°C, preferably 20°C in a polar protic solvent chosen among methanol, ethanol, isopropanol, butanol, hexafluoroisopropanol, in particular methanol. In this particular embodiment, the step f) is an addition step on a compound of formula (XXXVII), for instance at a temperature from -50°C to 100°C, preferably 20°C in a solvent chosen among dichloromethane, chloroform, 1,2-dichloroethane, tetrachloroethane and tetrahydrofuran, in particular 1,2- dichloroethane. In this particular embodiment, the step g) is an addition step of a compound of formula R1-B(OH)2on a compound of formula (XLII) or (XLIX), for instance at a temperature from 20°C to 200°C, preferably 100°C during 16 hours in a cyclic ether as a solvent chosen among tetrahydrofuran, diethyl ether, dimethoxymethane, dimethoxyethane, diethoxymethane, tetrahydrofuran, tert-butyl-methyl ether, tert- butyl-ethyl ether, methyl-tetrahydrofuran, 1,4-dioxane or methoxycyclopentane, preferably 1,4-dioxane. In this particular embodiment, the step h) is a saponification step of one compound of formulae (XLII), (XLIX) or (L), for instance at a temperature from -50 °C to 75 °C, preferably at 20°C. The invention relates to a process of preparation of a compound of formula (IV) as defined above, wherein ^ R10 and R11 are representing independently a hydrogen and an aryl or an aryl and a hydrogen, said aryl is optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1- C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1- C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1- C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group or (C3-C10)cycloalkyl(C1- C10)alkylcarbamoyl group ^ R2A and R2B represent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or R2A and R2B together with the nitrogen atom bearing them forming a C4-C10 membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1- C10)alcoxy group or (C3-C10)heterocycloalkyl group, ^ R4 is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8 or (C1-C10)acylamino group, ^ R9is representing: o group wherein R3 is representing OH, (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1- C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1- C10)alcoxy group o group wherein R12and R13represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR7R8, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group o o ^ R7 and R8 are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7 and R8 together with the nitrogen atom bearing them forming a C3-C12 membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, comprising the following steps: a) an addition of an Ph-Hal group, in particular with CuI, N,N′-dimethylethylenediamine and potassium carbonate, wherein Hal is representing a bromine or a iodine, on a compound of formula (LI): wherein R2A, R2B and R4 have the meaning defined above and GP1 is a protecting group, in particular representing (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O- heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1- C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, to obtain a compound of formula (LIII): wherein GP1, R2A, R2Band R4have the defined above, said compound being of formula (IV) when and possibly, b) a saponification of said compound of formula (LIII), in particular with LiOH, NaOH or KOH, to obtain a compound of said compound of formula (IV), wherein and possibly, o c) a step of amidation followed a of said compound of formula (IV), wherein particular with 1,1'-carbonyldiimidazole and an ammonia solution (amidation) followed by pyridine and trifluoroacetic anhydride or thionyl chloride in dimethylformamide or phosphorus pentoxide in methanol, chloroform or toluene (dehydration), to obtain a compound of formula (LIV): wherein R2A, R2Band R4have the meaning defined above, and, o d) a cyclization of said compound of formula (LIV), in particular with sodium azide and ammonium chloride, to obtain a compound of formula (IV) wherein R9 is o d’) a step of addition of HO-NH followed by a cyclization on said compound of formula (LIV), in particular with hydroxylammonium chloride and NaHCO3 (addition of HO-NH) followed by 1,1'-carbonyldiimidazole and 1,8-diazabicyclo[5.4.0]undec- 7-ene , to obtain a compound of formula (IV) wherein R9is representing ring, (Sulfonamide oxadiazolone et tétrazole) or after step b), e) an amidation of said compound of formula (IV) wherein R9 is representing representing OH, with HNR12R13, wherein R12 and R13 have the meaning defined above, in particular with N,N-diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyl uranium, 1- ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3- tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, to obtain a compound of formula (IV) wherein R9is a representing a group, said above mentioned alkyl groups being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms. This process described above is a process of preparation of compounds of formula (IV) that belong to the sulfonamide class. The step b) is optional if the compound is part of the ester class. The compound obtained at the end of step b) is part of the carboxylic acid class. One step chosen among d) or d’) is mandatory if step c) is implemented The compound obtained at the end of step d) is part of the tetrazole class. The compound obtained at the end of step d’) is part of the oxadiazolone class. The compound obtained at the end of step e) is part of the amide class. This process comprising the 1 following steps : a) is part of the invention. This process comprising the 2 following steps : a) and b) is part of the invention. This process comprising the 4 following steps : a), b), c) and d) is part of the invention. This process comprising the 4 following steps : a), b), c) and d’) is part of the invention. This process comprising the 3 following steps : a), b) and e) is part of the invention. According to another embodiment, the invention relates to the compound as defined above for its use as a drug. According to another embodiment, the invention relates to a pharmaceutical composition, comprising a compound as defined above, as an active substance, and a pharmaceutically acceptable excipient. The pharmaceutical compositions can be formulated as dosage forms for oral or parenteral administration. According to another embodiment, the invention relates to the pharmaceutical composition as defined above, in a unitary form comprising from 0.033 mg to 200 mg of active substance (for a human being weighing 70 kg). According to another embodiment, the invention relates to the pharmaceutical composition as defined above, formulated for an administration of active substance at a range of 0.00047 mg / kg to 2.86 mg / kg of body weight. According to another embodiment, the invention relates to a method of treatment of a patient in need thereof comprising the administration of a pharmaceutical composition as defined above, so that the active substance is administrated at a dose of 0.1 mg / day to 200 mg / day, preferably from about 0.5 mg / day to about 100 mg / day. According to another embodiment, the invention relates to the compound as defined above or the pharmaceutical composition as defined above, for its use in the prevention or the treatment of pathologies involving a functional deficit of the inhibition of the NKCC1 transporter. The term “prevention” of a disorder or disease as used herein is also well known in the art. For example, a patient / subject suspected of being prone to suffer from a disorder or disease may particularly benefit from a prevention of the disorder or disease. The subject / patient may have a susceptibility or predisposition for a disorder or disease, including but not limited to hereditary predisposition. Such a predisposition can be determined by standard methods or assays, using, e.g., genetic markers or phenotypic indicators. It is to be understood that a disorder or disease to be prevented in accordance with the present invention has not been diagnosed or cannot be diagnosed in the patient / subject (for example, the patient / subject does not show any clinical or pathological symptoms). Thus, the term “prevention” comprises the use of a compound of the present invention before any clinical and / or pathological symptoms are diagnosed or determined or can be diagnosed or determined by the attending physician. It is to be understood that the present invention specifically relates to each and every combination of features described herein, including any combination of general and / or preferred features. In particular, the invention specifically relates to each combination of meanings (including general and / or preferred meanings) for the various groups and variables comprised in formula (I). The term “treatment” of a disorder or disease as used herein is well known in the art. “Treatment” of a disorder or disease implies that a disorder or disease is suspected or has been diagnosed in a patient / subject. A patient / subject suspected of suffering from a disorder or disease typically shows specific clinical and / or pathological symptoms which a skilled person can easily attribute to a specific pathological condition (i.e., diagnose a disorder or disease). The “treatment” of a disorder or disease may, for example, lead to a halt in the progression of the disorder or disease (e.g., no deterioration of symptoms) or a delay in the progression of the disorder or disease (in case the halt in progression is of a transient nature only). The “treatment” of a disorder or disease may also lead to a partial response (e.g., amelioration of symptoms) or complete response (e.g., disappearance of symptoms) of the subject / patient suffering from the disorder or disease. Accordingly, the “treatment” of a disorder or disease may also refer to an amelioration of the disorder or disease, which may, e.g., lead to a halt in the progression of the disorder or disease or a delay in the progression of the disorder or disease. Such a partial or complete response may be followed by a relapse. It is to be understood that a subject / patient may experience a broad range of responses to a treatment (such as the exemplary responses as described herein above). The treatment of a disorder or disease may, inter alia, comprise curative treatment (preferably leading to a complete response and eventually to healing of the disorder or disease) and palliative treatment (including symptomatic relief). According to another embodiment, the invention relates to the compound as defined above or the pharmaceutical composition as defined above, for its use in the prevention or the treatment of one of the following pathologies: ^ cancer, in particular glioblastoma, pancreas cancer, prostate cancer, lung cancer, kidney cancer, colon cancer, cerebral disorders; ^ neurodegenerative or psychiatric, in particular schizophrenia, autistic spectrum disorder, fragile X, Rett syndrome, Down syndrome, Parkinson disease; or ^ pathologies associated to an inflammatory state. ^ Epilepsies including temporal lobe epilepsies, infantile epilepsies, partial or genealized seizures that have been shown to be associated with high (Cl-)ilevels and failure of inhibition – with a shift to excitation- by GABA. LIST OF FIGURES Figure 1. Functional NKCC1 assays. A. Contribution of NKCC1 to K+ influx in native HEK293 cells under isosmotic (basal) conditions. K+ influx was measured in untreated cells (Cntr), cells exposed to 100 µM ouabain (ouab), 20 µM bumetanide (bum), or both. B. Signal separation between native HEK293 cells with and without 20 µM bumetanide. Cells were tested in a hypertonic saline and in the presence of 100 µM ouabain. These conditions became our standard conditions for drug testing. C. Absence of bumetanide-sensitive K+ influx in Δ-NKCC1 HEK293 cells. Note that the K+ influx was reduced to basal levels. Figure 2. Brain slice (hippocampus) with electrical stimulation and recording (1). Hippocampal subfield CA3 (2). Bipolar stimulation electrode (3). Hippocampal subfields CA1 (4). Dentate gyrus Figure 3. Normalized GDP current density in CA3 pyramidal neurons in presence of NKCC1 inhibitor Panel A. Normalized GDP current density in CA3 pyramidal neurons according to the concentration of compound 57 in µM Panel B. Normalized GDP current density in CA3 pyramidal neurons according to the concentration of compound 51 in µM Panel C. Normalized GDP current density in CA3 pyramidal neurons according to the concentration of compound 57 and compound 51 in µM. Figure 4. Cell-attached recording Tetanus in CA1 pyramidal neurons in presence of compound 51 (20 stimulus, 100 Hz, 4 consecutive traces superimposed), expressed in picoampere per second. The upper bars are representing the 100 Hz stimulation of stratum radiatum in control conditions, and the lower bars are representing 30 minutes after application of 2 µM of compound 51. Figure 5. Cell-attached recording Tetanus in CA1 pyramidal neurons in presence of compound 57 (20 stimulus, 100 Hz, 4 consecutive traces superimposed), expressed in picoampere per second. The upper bars are representing the 100 Hz stimulation of stratum radiatum in control conditions, and the lower bars are representing 30 minutes after application of 2 µM of compound 57. Figure 6. Post-tetanus frequency (normalized) in presence or not of 2 µM of compound 51 (withing 20 seconds window s after tetanus stimulation) (paired two-tailed t test: p=1*e-4, n=5 cells). The error bars represent standard error of the mean. Figure 7. Post-tetanus frequency (normalized) in presence or not of 2 µM of compound 57 (withing 20 seconds window s after tetanus stimulation) (paired two-tailed t test: p=1*e-4, n=5 cells). The error bars represent standard error of the mean. EXAMPLES Legend CDI: carbonyldiimidazole ; CHCl3: chloroform ; CH3CN: acetonitrile ; CV: column volume ; d: doublet ; DBU: 1,8-Diazabicyclo[5.4.0]undec-7-ene ; DIPEA: N-Ethyl diisopropylamine ; DCM : dichloromethane ; DMAP: 4-dimethylaminopyridine ; DMF: N,N-dimethylformamid ; DMSO: dimethylsulfoxide ; ESI+: positive electrospray ionisation ; Et2O: diethyl ether ; EtOAc: ethyl acetate ; GP: general procedure ; H2: hydrogen ; HATU: 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate ; HCl: hydrogen chloride ; HPLC / MS: high-pressure liquid chromatography / mass spectrometry ; K2CO3: potassium carbonate ; KNO3: potassium nitrate ; LiOH: lithium hydroxide ; m: multiplet ; MeI: methyl iodide ; MeOH: Methanol ; MS: mass spectrometry ; NaOH: sodium hydroxide ; Na2SO4: sodium sulfate nBu: n-butyl ; PIDA: (diacetoxyiodo)benzene ; Pyr.: pyridine ; s: singulet ; t: triplet ; TBDMSCl: tert-butyl dimethylsilyl chloride ; TFAA: trifluoroacetic anhydride ; THF: tetrahydrofuran ; TLC: thin layer chromatography ; UV: ultra-violet Analytical equipment 1H NMR analyses (400 MHz), 13C NMR (101 MHz) and 19F NMR spectra (376 MHz) were recorded with a Bruker ULTRASHIELD 400 spectrometer. Processing and analyses of the spectra were performed with MestReNova. Data appear in the following order: chemical shifts in ppm which were referenced to the internal solvent signal, multiplicity, coupling constant J in Hertz and number of protons. Reversed-phase HPLC / MS analyses were carried out with a Waters Alliance 2795 HPLC equipped with an autosampler, an inline membrane degasser, a column oven (temperature set at 45°C), a UV detector, and a ZQ quadrupole mass detector working in ionization electrospray mode. Compounds (0.1 to 0.3 mg) were solubilized in a minimum amount of DMSO completed with acetonitrile (Total volume of 1 mL). Standard analytical parameters: flow rate of 1mL / min and volume of injection of 5 μL . - Acidic conditions: Waters XSelect CSH C18 column (3.5 μm, 2.1 x 50 mm). Gradient: (H2O + 0.04% v / v HCO2H (10 mM)) / ACN from 95 / 5 to 0 / 100 in 2.5 min. - Alkaline conditions: Waters Xbridge C18 column (3.5 μm, 2.1 x 50 mm). Gradient: (H2O + 0.06% v / v NH3(aq) (10 mM)) / ACN from 95 / 5 to 0 / 100 in 2.5 min. 1 – General synthetic scheme for compounds 1-123 Step 1: methyl 3-(butylamino)-4-phenoxy-5-sulfamoyl-benzoate (Int01) Compound Int01 was obtained starting from Bumetanide (28395-03-1) following the procedure described in Bioorganic Chemistry, 2020, 100, 103878. Step 2: methyl 3-(butylamino)-5-[[tert-butyl(dimethyl)silyl]sulfamoyl]-4-phenoxy-benzoate (Int02) To a stirred suspension of Int01 (1.16 g, 3.06 mmol) in dry THF (4 mL, 0.8 M) was added triethylamine (940 µL, 6.75 mmol, 2.2 equiv.) under argon atmosphere. The mixture was stirred for 10 minutes at 20°C and a solution of TBDMSCl (610 mg, 3.83 mmol, 1.25 equiv.) in toluene (1 mL) was added dropwise. The resulting mixture was stirred at 50°C for 18 hours. The solution was cooled down to 20°C and the resulting suspension was filtrated. The solid was washed with Et2O and the combined filtrates were concentrated under reduced pressure. The resulting crude was stirred for 5 minutes in a mixture of THF / Et2O (2 / 1, 12 mL) and the suspension was filtrated. The filtrate was concentrated under reduced pressure to afford Int02 (1.50 g, 2.90 mmol, 94%) as an orange oil. C24H36N2O5SiS; MS (ESI+) m / z: 493 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.95 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.30 (dd, J = 8.7 Hz, J = 7.4 Hz, 2H), 7.14–7.04 (m, 1H), 6.93–6.89 (m, 2H), 4.45 (brs, 1H), 3.94 (s, 3H), 3.83 (t, J = 5.4 Hz, 1H), 3.11-3.09 (m, 2H), 1.45–1.38 (m, 2H), 1.20-1.10 (m, 2H), 0.85 (s, 9H), 0.81 (t, J = 7.3 Hz, 3H), 0.12 (s, 6H). General Procedure 1 (GP1): sulfonimidamide preparation: Step 3: Method A A solution of triphenylphosphine (1.1 equiv.) and hexachloroethane (1.1 equiv.) in CHCl3 (0.6 M) was stirred at 70°C for 3 hours. After cooling down to 20°C, triethylamine (1.5 equiv.) was added to the white suspension. The resulting yellow suspension was stirred for 10 minutes at 20°C and was cooled down to 0°C. A solution of Int02 (1 equiv.) in CHCl3(0.6 M) was added and the resulting clear solution was stirred for 20 minutes at 0°C. Amine (3 equiv.) in CHCl3 (2 M) was added and the resulting solution was heated up to 20°C and stirred for 2 hours. The solvent was removed and the crude mixture was diluted in CH3CN (0.1 M). HCl 37% (0.5 v / v CH3CN) was added at 20°C and the resulting solution was stirred at 20°C for 45 minutes. The solution was basified until pH = 10 using a saturated solution of NaHCO3 and the aqueous layer was extracted with EtOAc. The combined organic layers were dried over Na2SO4, filtrated, and concentrated under reduced pressure to afford the crude sulfonimidamide. The crude residue was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 10 CV) to provide pure Compound 1 to 21. Method B A solution of triphenylphosphine (1.1 equiv.) and hexachloroethane (1.1 equiv.) in CHCl3 (0.6 M) was stirred at 70°C for 3 hours. After cooling down to 20°C, triethylamine (1.5 equiv.) was added to the white suspension. The resulting yellow suspension was stirred for 10 minutes at 20°C and was cooled down to 0°C. A solution of Int02 (1 equiv.) in CHCl3(0.6 M) was added and the resulting clear solution was stirred for 20 minutes at 0°C. Amine (3 equiv.) in CHCl3 (2 M) was added and the resulting solution was heated up to 20°C and stirred for 2 hours. The solvent was removed and the crude mixture was diluted in CH3CN (0.1 M). A solution of tetrabutylammonium fluoride (1M in THF, 1 equiv.) was added at 20°C and the resulting solution was stirred at 20°C for 5 hours. If necessary, a solution of tetrabutylammonium fluoride (1M in THF, 2 equiv.) was added at 20°C, and the resulting solution was stirred at 20°C for until full conversion was observed (conversion monitored by LCMS). Water was added to the reaction mixture that was extracted with a mixture of CHCl3 : iPrOH (8:2). The combined organic layer was concentrated under reduced pressure. The crude residue was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 10 CV) to provide pure Compound 22 to 50. General Procedure 2 (GP2): methyl ester saponification: Step 4 - Compound 51 to 101: Method A To a solution of methyl ester (1 equiv.) diluted in a mixture of THF / H2O / MeOH 1 / 1 / 1 (0.1 M) was added LiOH (2 equiv.). The resulting mixture was stirred for 2 hours at 20°C or until full conversion was observed. THF was removed and the mixture was diluted in water (5 mL). The aqueous layer was washed with EtOAc and was acidified with HCl 1N until pH = 2-3. The aqueous layer was extracted with EtOAc and the resulting organic layer was dried over Na2SO4, filtrated, and concentrated under reduced pressure to afford the corresponding carboxylic acid. Method B In a sealed tube, potassium trimethylsilanolate (2.4 equiv.) was added to a solution of methyl ester (1 equiv.) diluted in dry tetrahydrofuran (0.2 M). The reaction was stirred at 20°C for 16 hours. Portions of potassium trimethylsilanolate (0.6 equiv.) could be added every 4 hours to go to complete conversion (conversion monitored by LCMS). Once the full conversion is reached, water was added to the reaction mixture. The aqueous layer was acidified upon addition of an aqueous solution of HCl 1N to reach pH=2-3. The organic layer was extracted with DCM three times and the combined organic layers were washed with brine once, dried over MgSO4, filtered, and concentrated under reduced pressure to afford the corresponding carboxylic acid. General Procedure 3 (GP3): peptide coupling reaction: Step 5: To a solution of carboxylic acid (1 equiv.) in N,N-dimethylformamide (0.1 M) were added DIPEA (1.5 equiv.) and HATU (1.2 equiv.) at 20°C. The resulting mixture was stirred at 20°C up to complete conversion (conversion monitored by LCMS). The reaction was poured into a saturated aqueous solution of NH4Cl and extracted twice with DCM. The combined organic layers were washed with brine, dried over MgSO4, filtered and concentrated under reduced pressure. The crude was purified by reverse phase LCMS. The pure fractions containing the target compounds were collected and concentrated under reduced pressure to provide pure Compound 102 to 123. methyl 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxy-benzoate (Compound 1) According to GP1 (step 3 – Method A) starting from Int02 and Methylamine 2M in THF, Compound 1 was isolated as a white solid (44 mg, 0.11 mmol, 14%). C19H25N3O4S; MS (ESI+) m / z: 392 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.04 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.34-7.28 (m, 2H), 7.12-7.05 (m, 1H), 6.93-6.87 (m, 2H), 3.94 (s, 3H), 3.89 (t, J = 5.4 Hz, 1H), 3.15-3.07 (m, 2H), 2.53 (s, 3H), 1.48-1.38 (m, 2H), 1.22-1.11 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 1.2 Compound 2 methyl 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxy-benzoate (Compound 2) According to GP1 (step 3 – Method A) starting from Int02 and dimethylamine 2M in THF, Compound 2 was isolated as a sticky yellow solid (25 mg, 0.06 mmol, 8%). C20H27N3O4S; MS (ESI+) m / z: 406 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.02 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.32-7.26 (m, 2H), 7.08-7.03 (m, 2H), 6.85-6.80 (m, 2H), 3.94 (s, 3H), 3.89 (t, J = 5.5 Hz, 1H), 3.14-3.07 (m, 2H), 2.75 (s, 6H), 1.48–1.38 (m, 2H), 1.23–1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.3 Compound 3 methyl 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)-benzoate (Compound 3) According to GP1 (step 3 – Method A) starting from Int02 and pyrrolidine, Compound 3 was isolated as a white solid (25 mg, 0.06 mmol, 7.5%). C22H29N3O4S; MS (ESI+) m / z: 432 [M+H]+. 1.4 Compound 4 methyl 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)-benzoate (Compound 4) According to GP1 (step 3 – Method A) starting from Int02 and piperidine, Compound 4 was isolated as sticky white solid (150 mg, 0.34 mmol, 35%). C23H31N3O4S; MS (ESI+) m / z: 446 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.01 (d, J = 2.0 Hz, 1H), 7.52 (d, J = 2.0 Hz, 1H), 7.31-7.26 (m, 2H), 7.08-7.01 (m, 1H), 6.84-6.79 (m, 2H), 3.93 (s, 3H), 3.89 (t, J = 5.5 Hz, 1H), 3.21-3.04 (m, 6H), 2.71 (brs, 1H), 1.53-1.46 (m, 4H), 1.46-1.38 (m, 4H), 1.23-1.12 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.5 methyl 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 5) According to GP1 (step 3 – Method A) starting from Int02 and N-methylethanamine, Compound 5 was isolated as a white solid (102.4 mg, 0.1346 mmol, 25%). C21H29N3O4S; MS (ESI+) m / z: 420 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.01 (d, J = 2.0 Hz, 1H), 7.52 (d, J = 2.0 Hz, 1H), 7.33–7.26 (m, 2H), 7.09 – 7.02 (m, 1H), 6.86 – 6.79 (m, 2H), 3.93 (s, 3H), 3.86 (t, J = 5.5 Hz, 1H), 3.28 – 3.05 (m, 4H), 2.77 (s, 3H), 2.73 (s, 1H), 1.42 (m, 2H), 1.22-1.11 (m, 2H), 1.07 (t, J = 7.1 Hz, 3H), 0.82 (t, J = 7.3 Hz, 3H). 1.6 Compound 6 methyl 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxy-benzoate (Compound 6) According to GP1 (step 3 – Method A) starting from Int02 and morpholine, Compound 6 was isolated as a white solid (206 mg 0.4511 mmol, 47%). C22H29N3O5S; MS (ESI+) m / z: 448 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.98 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.31–7.24 (m, 2H), 7.05 (td, J = 7.4, 1.1 Hz, 1H), 6.85–6.75 (m, 2H), 3.92 (s, 4H), 3.61 – 3.48 (m, 4H), 3.21–3.07 (m, 6H), 1.50–1.37 (m, 2H), 1.25-1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.7 Compound 7 methyl 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (Compound 7) According to GP1 (step 3 – Method A) starting from Int02 and aniline, Compound 7 was isolated as a white solid (86 mg 0.1877 mmol, 19%). C24H27N3O4S; MS (ESI+) m / z: 454 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.98 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.31–7.24 (m, 2H), 7.05 (td, J = 7.4, 1.1 Hz, 1H), 6.85–6.75 (m, 2H), 3.92 (s, 4H), 3.61 – 3.48 (m, 4H), 3.21–3.07 (m, 6H), 1.50 – 1.37 (m, 3H), 1.25-1.09 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.8 Compound 8 methyl 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 8) According to GP1 (step 3 – Method A) starting from Int02 and benzylamine, Compound 8 was isolated as a white solid (178 mg, 0.3699 mmol, 38%). C25H29N3O4S; MS (ESI+) m / z: 468 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.07 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.31–7.19 (m, 5H), 7.17-7.11 (m, 2H), 7.08-7.02 (m, 1H), 6.90–6.81 (m, 2H), 4.18-4.10 (m, 1H), 3.95 (s, 3H), 3.98-3.91 (m, 1H), 3.88-3.82 (m, 1H), 3.114-3.08 (m, 2H), 1.49-1.38 (m, 2H), 1.27–1.11 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H). 1.9 Compound 9 methyl 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 10) According to GP1 (step 3 – Method A) starting from Int02 and cyclopropylamine, Compound 10 was isolated as a white solid (173 mg, 0.4141mmol, 61%). C21H27N3O4S; MS (ESI+) m / z: 418 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.10 (d, J = 2.0 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.34–7.27 (m, 2H), 7.12–7.06 (m, 1H), 6.93–6.86 (m, 2H), 3.94 (s, 3H), 3.91 (t, J = 5.8 Hz, 1H), 3.17-3.08 (m, 2H), 2.23-2.16 (m, 1H), 1.49-1.38 (m, 2H), 1.24-1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H), 0.62–0.50 (m, 2H), 0.50–0.44 (m, 1H), 0.44–0.34 (m, 1H). 1.11 Compound 11 methyl 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 12) According to GP1 (step 3 – Method A) starting from Int02 and cyclohexanemethylamine, Compound 12 was isolated as a white solid (99 mg, 0.2084 mmol, 31%). C25H35N3O4S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.02 (d, J = 2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.34–7.27 (m, 2H), 7.12-7.03 (m, 1H), 6.92–6.86 (m, 2H), 3.92 (s, 3H), 3.91- 3.85 (m, 1H), 3.17-3.06 (m, 2H), 2.77-2.68 (m, 1H), 2.58-2.48 (m, 1H), 1.68-1.55 (m, 5H), 1.48-1.37 (m, 2H), 1.23–1.06 (m, 6H), 0.87–0.72 (m, 5H). 1.13 Compound 13 methyl 3-(butylamino)-5-[(N-methylanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 14) According to GP1 (step 3 – Method A) starting from Int02 and N-methylaniline, Compound 14 was isolated as a white solid (87 mg, 0.1712 mmol, 18%). C25H29N3O4S; MS (ESI+) m / z: 468 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.97 (d, J = 2.0 Hz, 1H), 7.53 (d, J = 2.0 Hz, 1H), 7.33 – 7.19 (m, 3H) overlapping with Chloroform-d, 7.18 – 7.10 (m, 2H), 7.08 – 6.99 (m, 1H), 6.71 (dd, J = 8.7, 1.1 Hz, 2H), 3.91 (s, 3H), 3.87 – 3.76 (m, 1H), 3.25 (s, 3H), 3.10 (td, J = 6.9, 5.4 Hz, 2H), 1.47 – 1.34 (m, 2H), 1.21 – 1.09 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H). 1.15 Compound 15 (B73) methyl 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 17) According to GP1 (step 3 – Method A) starting from Int02 and 3-methoxyaniline, Compound 17 was isolated as a white solid (151 mg, 0.3091 mmol, 64%). C25H29N3O5S; MS (ESI+) m / z: 484 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.11 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.33 – 7.27 (m, 2H), 7.13 – 7.07 (m, 1H), 6.99 (t, J = 8.1 Hz, 1H), 6.93 – 6.87 (m, 2H), 6.46 (dddd, J = 11.8, 7.9, 2.2, 0.9 Hz, 2H), 6.23 (t, J = 2.2 Hz, 1H), 3.94 (s, 3H), 3.64 (s, 3H), 3.11 (t, J = 6.9 Hz, 2H), 1.47 – 1.37 (m, 2H), 1.16 (h, J = 7.4 Hz, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.18 Compound 18 (B78) methyl 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoate (Compound 18) According to GP1 (step 3 – Method A) starting from Int02 and 4-phenylpiperidine, Compound 18 was isolated as a white solid (213 mg, 0.4001 mmol, 83%). C29H35N3O4S; MS (ESI+) m / z: 522 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.05 (d, J = 2.0 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.36 – 7.27 (m, 4H), 7.22 – 7.17 (m, 1H), 7.14 – 7.07 (m, 3H), 6.88 – 6.84 (m, 2H), 3.94 (s, 3H), 3.98 – 3.90 (m, 2H), 3.13 (t, J = 7.0 Hz, 2H), 2.67 (m, 2H), 2.52 – 2.42 (m, 1H), 1.79 (m, 2H), 1.65 – 1.50 (m, 2H), 1.45 (m, 2H), 1.27 – 1.13 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H). 1.19 Compound 19 (B79) methyl 3-(butylamino)-5-(indolin-1-ylsulfonimidoyl)-4-phenoxy-benzoate (Compound 19) According to GP1 (step 3 – Method A) starting from Int02 and indoline, Compound 19 was isolated as a pale brown solid (163 mg, 0.3365 mmol, 70%). C26H29N3O4S; MS (ESI+) m / z: 480 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.22 (d, J = 2.0 Hz, 1H), 7.49 (d, J = 2.0 Hz, 1H), 7.26 – 7.23 (m, 1H), 7.20 – 7.15 (m, 2H), 7.05 – 6.97 (m, 3H), 6.85 (td, J = 7.4, 1.1 Hz, 1H), 6.72 – 6.67 (m, 2H), 3.94 (s, 3H), 3.48 (q, J = 7.0 Hz, 2H), 3.02 (t, J = 6.9 Hz, 2H), 2.83 – 2.62 (m, 2H), 1.38 – 1.30 (m, 2H), 1.08 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 1.20 20 methyl 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxy-benzoate (Compound 20) According to GP1 (step 3 – Method A) starting from Int02 and 8-oxa-3-azabicyclo[3.2.1]octane, Compound 20 was isolated as a white solid (210 mg, 0.4434 mmol, 92%). C24H31N3O5S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.95 (d, J = 2.0 Hz, 1H), 7.53 (d, J = 2.0 Hz, 1H), 7.32 – 7.26 (m, 2H), 7.09 – 7.03 (m, 1H), 6.85 – 6.80 (m, 2H), 4.36 (m, 2H), 3.93 (s, 3H), 3.50 (dd, J = 41.7, 11.5 Hz, 2H), 3.10 (t, J = 7.0 Hz, 2H), 2.94 (m, 2H), 2.02 – 1.88 (m, 4H), 1.43 (m, 2H), 1.18 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 1.21 Compound 21 (B81) methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 21) According to GP1 (step 3 – Method A) starting from Int02 and 1-methylpyrazol-3-amine, Compound 21 was isolated as a pale yellow oil (44 mg, 0.0952 mmol, 20%). C22H37N5O4S; MS (ESI+) m / z: 458 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.13 (d, J = 2.0 Hz, 1H), 7.70 – 7.64 (m, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.46 (m, 1H), 7.29 (m, 2H), 7.11 – 7.06 (m, 1H), 6.95 – 6.91 (m, 2H), 3.92 (s, 3H), 3.76 (s, 3H), 3.09 (q, J = 6.5 Hz, 2H), 1.41 (m, 2H), 1.16 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.22 Compound 22 (B96) methyl 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 22) According to GP1 (step 3 – Method B) starting from Int02 and 3-chloroaniline, Compound 22 was isolated as an off-white foam (224 mg, 0.4590 mmol, 91%). C24H26ClN3O4S; MS (ESI+) m / z: 488 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.09 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 2.0 Hz, 1H), 7.35 – 7.28 (m, 2H), 7.17 – 7.11 (m, 1H), 7.02 – 6.96 (m, 1H), 6.91 – 6.83 (m, 3H), 6.69 – 6.64 (m, 1H), 6.56 (t, J = 2.1 Hz, 1H), 3.95 (s, 3H), 3.12 (t, J = 7.0 Hz, 2H), 1.48 – 1.39 (m, 2H), 1.23 – 1.13 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 1.23 Compound 23 (B97) methyl 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 23) According to GP1 (step 3 – Method B) starting from Int02 and (3-chlorophenyl)methanamine, Compound 23 was isolated as a white solid (262 mg, 0.5219 mmol, 99%). C25H28ClN3O4S; MS (ESI+) m / z: 502 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.01 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 1.9 Hz, 1H), 7.32 – 7.26 (m, 2H), 7.18 – 7.12 (m, 3H), 7.10 – 7.03 (m, 2H), 6.92 – 6.86 (m, 2H), 4.19 – 3.96 (m, 2H), 3.95 (s, 3H), 3.10 (t, J = 7.0 Hz, 2H), 1.50 – 1.38 (m, 2H), 1.23 – 1.14 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H). 1.24 24 methyl 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-benzoate (Compound 24) According to GP1 (step 3 – Method B) starting from Int02 and isoindolin, Compound 24 was isolated as a brown oil (239 mg, 0.4834 mmol, 97%). C26H29N3O4S; MS (ESI+) m / z: 480 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.04 (d, J = 2.0 Hz, 1H), 7.51 (d, J = 2.0 Hz, 1H), 7.24 – 7.16 (m, 4H), 7.14 – 7.09 (m, 2H), 6.99 – 6.94 (m, 1H), 6.85 – 6.80 (m, 2H), 4.71 – 4.61 (m, 4H), 3.91 (s, 3H), 3.07 (t, J = 7.0 Hz, 2H), 1.44 – 1.35 (m, 2H), 1.20 – 1.09 (m, 2H), 0.80 (t, J = 7.4 Hz, 3H). 1.25 Compound 25 (B99) methyl 3-(aminosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (Compound 25) According to GP1 (step 3 – Method B) starting from Int02 and a 0.5 M solution of ammonia in dioxane, Compound 25 was isolated as a white solid (113 mg, 0.2994 mmol, 59%). C18H23N3O4S; MS (ESI+) m / z: 379 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.97 (d, J = 2.0 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.35 – 7.29 (m, 2H), 7.10 (td, J = 7.3, 1.0 Hz, 1H), 6.97 – 6.89 (m, 2H), 4.89 (s, 2H), 3.94 (s, 3H), 3.87 (t, J = 5.5 Hz, 1H), 3.14 – 3.07 (m, 2H), 1.46 – 1.37 (m, 2H), 1.21 – 1.11 (m, 2H), 0.82 (t, J = 7.4 Hz, 3H). 1.26 Compound 26 (B105) methyl 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 26) According to GP1 (step 3 – Method B) starting from Int02 and 2-chloroaniline, Compound 26 was isolated as a white solid (63 mg, 0.1291 mmol, 28%). C24H26ClN3O4S; MS (ESI+) m / z: 488 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.26 (d, J = 1.9 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.34 (dd, J = 8.1, 1.5 Hz, 1H), 7.30 – 7.26 (m, 3H), 7.08 (td, J = 7.7, 1.6 Hz, 2H), 6.93 – 6.89 (m, 3H), 3.95 (s, 3H), 3.09 (t, J = 6.9 Hz, 2H), 1.46 – 1.34 (m, 2H), 1.21 – 1.06 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H). 1.27 Compound 27 (B106)

[0004] methyl 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 27) According to GP1 (step 3 – Method B) starting from Int02 and 4-chloroaniline, Compound 27 was isolated as a white solid (97 mg, 0.1990 mmol, 43%). C24H26ClN3O4S; MS (ESI+) m / z: 488 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.09 (d, J = 2.0 Hz, 1H), 7.58 (d, J = 2.0 Hz, 1H), 7.35 – 7.27 (m, 2H), 7.12 (t, J = 7.4 Hz, 1H), 7.07 – 7.00 (m, 2H), 6.93 – 6.85 (m, 2H), 6.71 – 6.58 (m, 2H), 3.95 (s, 3H), 3.12 (t, J = 7.0 Hz, 2H), 1.50 – 1.37 (m, 2H), 1.22 – 1.11 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 1.28 Compound 28 (B107) methyl 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 28) According to GP1 (step 3 – Method B) starting from Int02 and 3-(difluoromethoxy)aniline, Compound 28 was isolated as a white solid (209 mg, 0.4023 mmol, 87%). C25H27F2N3O5S; MS (ESI+) m / z: 520 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.09 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 2.0 Hz, 1H), 7.31 (dd, J = 8.5, 7.2 Hz, 2H), 7.17 – 7.09 (m, 1H), 7.05 (t, J = 8.1 Hz, 1H), 6.92 – 6.85 (m, 2H), 6.71 – 6.61 (m, 2H), 6.43 (d, J = 74.4 Hz, 1H), 6.31 (t, J = 2.3 Hz, 1H), 3.95 (s, 3H), 3.12 (t, J = 7.0 Hz, 2H), 1.49 – 1.37 (m, 2H), 1.24 – 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 1.29 Compound 29 (B108) methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoate (Compound 29) According to GP1 (step 3 – Method B) starting from Int02 and tetrahydropyran-4-amine, Compound 29 was isolated as an off-white solid (236 mg, 0.4959 mmol, 95%). C23H31N3O5S; MS (ESI+) m / z: 462 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.04 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.1 Hz, 1H), 7.35 – 7.28 (m, 2H), 7.12 – 7.06 (m, 1H), 6.95 – 6.88 (m, 2H), 3.94 (s, 3H), 3.91 – 3.71 (m, 2H), 3.45 – 3.23 (m, 3H), 3.17 – 3.06 (m, 2H), 1.90 – 1.50 (m, 2H), 1.48 – 1.24 (m, 4H), 1.22 – 1.12 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.30 Compound 30 (B109) methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 30) According to GP1 (step 3 – Method B) starting from Int02 and 1-methylpiperidin-4-amine, Compound 30 was isolated as a yellow oil (191 mg, 0.4024 mmol, 87%). C24H34N4O4S; MS (ESI+) m / z: 475 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.03 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.37 – 7.26 (m, 2H), 7.13 – 7.05 (m, 1H), 6.97 – 6.84 (m, 2H), 3.94 (s, 3H), 3.86 (t, J = 5.4 Hz, 1H), 3.11 (q, J = 6.5 Hz, 2H), 2.75 – 2.61 (m, 2H), 2.27 (s, 3H), 1.95 – 1.82 (m, 2H), 1.77 – 1.61 (m, 2H), 1.53 – 1.34 (m, 4H), 1.21 – 1.11 (m, 2H), 1.01 (t, J = 7.3 Hz, 1H), 0.82 (t, J = 7.3 Hz, 3H). 1.31 Compound 31 (B110) methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoate (Compound 31) According to GP1 (step 3 – Method B) starting from Int02 and pyrimidin-2-amine, Compound 31 was isolated as a yellow oil (129 mg, 0.2832 mmol, 61%). C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.24 (d, J = 5.1 Hz, 2H), 8.06 (d, J = 1.9 Hz, 1H), 7.52 (d, J = 1.9 Hz, 1H), 7.12 (t, J = 7.7 Hz, 2H), 6.92 (d, J = 8.5 Hz, 1H), 6.72 (t, J = 7.6 Hz, 3H), 3.88 (s, 3H), 3.86 – 3.80 (m, 1H), 3.07 – 2.99 (m, 2H), 1.42 – 1.30 (m, 2H), 1.14 – 1.06 (m, 2H), 0.74 (t, J = 7.3 Hz, 3H). 1.32 Compound 32 (B118) methyl 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoate (Compound 32) According to GP1 (step 3 – Method A) starting from Int02 and pyrazin-2-amine, Compound 32 was isolated as a yellow oil (30 mg, 0.0667 mmol, 13%). C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.06 (d, J = 1.9 Hz, 1H), 7.94 – 7.91 (m, 2H), 7.59 (d, J = 1.2 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.24 – 7.18 (m, 2H), 7.09 – 7.04 (m, 1H), 6.75 – 6.71 (m, 2H), 5.80 (s, 1H), 3.94 (s, 3H), 3.87 (t, J = 5.3 Hz, 1H), 3.15 – 3.06 (m, 2H), 1.47 – 1.37 (m, 2H), 1.22 – 1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.33 Compound 33 (B121) methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoate (Compound 33) According to GP1 (step 3 – Method B) starting from Int02 and pyrimidin-5-amine, Compound 33 was isolated as an off-white solid (16 mg, 0.0358 mmol, 10%). C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.68 (s, 1H), 8.09 (d, J = 2.0 Hz, 1H), 7.99 (s, 2H), 7.62 (d, J = 2.0 Hz, 1H), 7.34 – 7.28 (m, 2H), 7.18 – 7.11 (m, 1H), 6.88 – 6.83 (m, 2H), 5.16 (s, 1H), 3.96 (s, 3H), 3.93 (t, J = 5.4 Hz, 1H), 3.14 (q, J = 6.5 Hz, 2H), 1.49 – 1.40 (m, 2H), 1.25 – 1.14 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H). 1.34 Compound 34 (B122) methyl 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoate (Compound 34) According to GP1 (step 3 – Method B) starting from Int02 and 2-phenylethanamine, Compound 34 was isolated as an off-white solid (73 mg, 0.1258 mmol, 83%). C26H31N3O4S; MS (ESI+) m / z: 482 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.02 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.30 – 7.26 (m, 3H), 7.26 – 7.21 (m, 2H), 7.10 – 7.06 (m, 3H), 6.80 – 6.75 (m, 2H), 3.94 (s, 3H), 3.82 (s, 1H), 3.27 – 3.19 (m, 1H), 3.11 (t, J = 7.0 Hz, 2H), 3.08 – 2.99 (m, 1H), 2.74 – 2.58 (m, 2H), 1.48 – 1.38 (m, 2H), 1.24 – 1.11 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 1.35 Compound 35 (B123) methyl 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 35) According to GP1 (step 3 – Method B) starting from Int02 and 2-(3-chlorophenyl)ethanamine, Compound 35 was isolated as an off-white solid (136 mg, 0.2187 mmol, 59%). C26H30ClN3O4S; MS (ESI+) m / z: 516 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.01 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.29 – 7.27 (m, 3H), 7.22 – 7.19 (m, 2H), 7.10 – 7.04 (m, 2H), 6.83 – 6.78 (m, 2H), 3.94 (s, 3H), 3.88 – 3.79 (m, 1H), 3.30 – 3.17 (m, 1H), 3.11 (t, J = 7.0 Hz, 2H), 3.08 – 2.98 (m, 1H), 2.72 – 2.55 (m, 2H), 1.48 – 1.38 (m, 2H), 1.23 – 1.14 (m, 2H), 0.83 (t, J = 7.4 Hz, 3H). 1.36 Compound 36 (B124) methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoate (Compound 36) According to GP1 (step 3 – Method B) starting from Int02 and 3-pyridylmethylamine, Compound 36 was isolated as a white solid (129 mg, 0.2753 mmol, 74%). C24H28N4O4S; MS (ESI+) m / z: 469 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.42 (d, J = 39.5 Hz, 2H), 8.05 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 8.1 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.22 (t, J = 6.4 Hz, 1H), 7.09 – 7.04 (m, 1H), 6.90 – 6.86 (m, 2H), 4.21 – 3.97 (m, 2H), 3.95 (s, 3H), 3.88 (t, J = 5.6 Hz, 1H), 3.11 (q, J = 6.6 Hz, 2H), 1.49 – 1.40 (m, 2H), 1.24 – 1.13 (m, 2H), 0.84 (t, J = 7.4 Hz, 3H). 1.37 Compound 37 (B125) methyl 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoate (Compound 37) According to GP1 (step 3 – Method B) starting from Int02 and 2-(3-pyridyl)ethylamine, Compound 37 was isolated as a white solid (121 mg, 0.2507 mmol, 68%). C25H30N4O4S; MS (ESI+) m / z: 483 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.48 (d, J = 4.9 Hz, 1H), 8.38 (s, 1H), 8.01 (d, J = 2.0 Hz, 1H), 7.55 (d, J = 2.0 Hz, 1H), 7.54 – 7.51 (m, 1H), 7.32 – 7.27 (m, 3H), 7.08 (t, J = 7.4 Hz, 1H), 6.87 – 6.80 (m, 2H), 3.94 (s, 3H), 3.87 (t, J = 5.8 Hz, 1H), 3.27 – 3.17 (m, 1H), 3.11 (q, J = 6.6 Hz, 2H), 3.07 – 2.99 (m, 1H), 2.74 – 2.63 (m, 2H), 1.49 – 1.39 (m, 2H), 1.23 – 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoate (Compound 38) According to GP1 (step 3 – Method B) starting from Int02 and thiazol-2-ylmethylamine, Compound 38 was isolated as a yellow oil (197 mg, 0.4151 mmol, 95%). C22H26N4O4S2; MS (ESI+) m / z: 475 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.05 (d, J = 2.0 Hz, 1H), 7.64 (d, J = 3.3 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.31 – 7.25 (m, 2H), 7.22 (d, J = 3.3 Hz, 1H), 7.09 – 7.02 (m, 1H), 6.89 (dt, J = 7.8, 1.0 Hz, 2H), 4.52 – 4.33 (m, 2H), 3.94 (s, 3H), 3.88 (d, J = 12.2 Hz, 1H), 3.10 (t, J = 7.1 Hz, 2H), 1.42 (dq, J = 8.2, 7.0 Hz, 2H), 1.22 – 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 1.39 Compound 39 (B127) methyl 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoate (Compound 39) According to GP1 (step 3 – Method B) starting from Int02 and 2-thiazol-2-ylethylamine, Compound 39 was isolated as a white solid (111 mg, 0.2272 mmol, 61%). C23H28N4O4S2; MS (ESI+) m / z: 489 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.04 (d, J = 2.0 Hz, 1H), 7.70 (d, J = 3.4 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.32 – 7.26 (m, 2H), 7.23 (d, J = 3.3 Hz, 1H), 7.10 – 7.03 (m, 1H), 6.89 – 6.85 (m, 2H), 3.93 (s, 3H), 3.83 (s, 1H), 3.49 – 3.42 (m, 1H), 3.39 – 3.30 (m, 1H), 3.15 – 3.06 (m, 4H), 1.46 – 1.38 (m, 2H), 1.22 – 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 1.40 40 methyl 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 40) According to GP1 (step 3 – Method B) starting from Int02 and (1-methylimidazol-2-yl)amine, Compound 40 was isolated as a yellow solid (8 mg, 0.0177 mmol, 5%). C22H27N5O4S; MS (ESI+) m / z: 458 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.06 (d, J = 1.9 Hz, 1H), 7.53 (d, J = 2.0 Hz, 1H), 7.24 – 7.20 (m, 2H), 7.02 – 6.95 (m, 1H), 6.89 – 6.85 (m, 2H), 6.83 (d, J = 2.3 Hz, 1H), 6.54 (d, J = 2.4 Hz, 1H), 3.88 (s, 3H), 3.84 (t, J = 6.2, 4.3 Hz, 1H), 3.25 (s, 3H), 3.05 (q, J = 6.5 Hz, 2H), 1.40 – 1.33 (m, 2H), 1.15 – 1.06 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 1.41 Compound 41 (B129) methyl 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoate (Compound 41) According to GP1 (step 3 – Method B) starting from Int02 and 2-pyridylamine, Compound 41 was isolated as a yellow solid (57 mg, 0.1254 mmol, 34%). C23H26N4O4S; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.01 (d, J = 2.0 Hz, 1H), 7.99 – 7.93 (m, 1H), 7.52 (d, J = 2.0 Hz, 1H), 7.45 – 7.38 (m, 1H), 7.25 – 7.20 (m, 2H), 7.08 – 7.01 (m, 1H), 6.86 – 6.79 (m, 2H), 6.77 – 6.69 (m, 1H), 6.60 – 6.55 (m, 1H), 3.90 (s, 3H), 3.83 (t, J = 5.5 Hz, 1H), 3.12 – 3.04 (m, 2H), 1.44 – 1.35 (m, 2H), 1.20 – 1.08 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H). methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 42) According to GP1 (step 3 – Method B) starting from Int02 and (1-methylpyrazol-3-yl)methylamino, Compound 42 was isolated as a yellow solid (49.5 mg, 0.0997 mmol, 27%). C23H29N5O4S; MS (ESI+) m / z: 472 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.05 (d, J = 2.0 Hz, 1H), 7.53 (d, J = 2.0 Hz, 1H), 7.32 – 7.23 (m, 2H), 7.17 (d, J = 2.2 Hz, 1H), 7.07 – 7.00 (m, 1H), 6.91 – 6.84 (m, 2H), 6.02 (d, J = 2.2 Hz, 1H), 4.19 – 3.99 (m, 2H), 3.93 (s, 3H), 3.88 – 3.81 (m, 1H), 3.79 (s, 3H), 3.09 (q, J = 6.0, 5.4 Hz, 2H), 1.47 – 1.36 (m, 2H), 1.23 – 1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.43 Compound 43 (B153) methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoate (Compound 43) According to GP1 (step 3 – Method B) starting from Int02 and thiazol-2-ylamine, Compound 43 was isolated as a grey solid (5 mg, 0.0115 mmol, 3%). C21H24N4O4S2; MS (ESI+) m / z: 461 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.04 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.32 – 7.23 (m, 2H), 7.11 – 7.05 (m, 2H), 6.88 – 6.83 (m, 2H), 6.61 (d, J = 3.9 Hz, 1H), 3.92 (s, 3H), 3.85 (t, J = 5.4 Hz, 1H), 3.09 (q, J = 6.5 Hz, 2H), 1.45 – 1.35 (m, 2H), 1.21 – 1.08 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H). 1.44 Compound 44 (B154) methyl 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoate (Compound 44) According to GP1 (step 3 – Method B) starting from Int02 and pyridine-4-amine, Compound 44 was isolated as a white solid (10 mg, 0.0418 mmol, 10%). C23H26N4O4S; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.16 (d, J = 5.4 Hz, 2H), 8.09 (d, J = 2.0 Hz, 1H), 7.60 (d, J = 2.0 Hz, 1H), 7.32 – 7.27 (m, 2H), 7.15 – 7.10 (m, 1H), 6.85 – 6.81 (m, 2H), 6.54 (d, J = 5.4 Hz, 2H), 3.96 (s, 3H), 3.90 (t, J = 5.4 Hz, 1H), 3.12 (q, J = 6.6 Hz, 2H), 1.49 – 1.39 (m, 2H), 1.24 – 1.11 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 1.45 Compound 45 (B156) methyl 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoate (Compound 45) According to GP1 (step 3 – Method B) starting from Int02 and pyridazine-4-amine, Compound 45 was isolated as a white solid (28 mg, 0.0608 mmol, 14%). C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.62 (dd, J = 6.0, 1.0 Hz, 1H), 8.16 (dd, J = 2.8, 1.0 Hz, 1H), 8.05 (d, J = 1.9 Hz, 1H), 7.61 (d, J = 2.0 Hz, 1H), 7.30 – 7.24 (m, 2H), 7.15 – 7.10 (m, 1H), 6.82 – 6.77 (m, 3H), 3.96 (s, 3H), 3.95 – 3.91 (m, 1H), 3.17 – 3.09 (m, 2H), 1.49 – 1.38 (m, 2H), 1.23 – 1.12 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.46 Compound 46 (B157) methyl 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxy-benzoate (Compound 46) According to GP1 (step 3 – Method B) starting from Int02 and butylamine, Compound 46 was isolated as a white solid (136 mg, 0.3074 mmol, 70%). C22H31N3O4S; MS (ESI+) m / z: 434 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.04 (d, J = 2.0 Hz, 1H), 7.56 (d, J= 2.0 Hz, 1H), 7.35 – 7.28 (m, 2H), 7.12 – 7.06 (m, 1H), 6.93 – 6.88 (m, 2H), 3.93 (s, 3H), 3.90 (t, J = 8.8 Hz, 1H), 3.12 (q, J = 6.6 Hz, 2H), 2.95 – 2.86 (m, 1H), 2.76 – 2.67 (m, 1H), 1.48 – 1.39 (m, 2H), 1.31 – 1.13 (m, 6H), 0.85 – 0.79 (m, 6H). 1.47 Compound 47 (B158) methyl 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 47) According to GP1 (step 3 – Method B) starting from Int02 and bicyclo[1.1.1]pentan-1-amine, Compound 47 was isolated as a white solid (62 mg, 0.1398 mmol, 32%). C23H29N3O4S; MS (ESI+) m / z: 444 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.06 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.35 – 7.28 (m, 2H), 7.13 – 7.05 (m, 1H), 6.95 – 6.88 (m, 2H), 3.94 (s, 3H), 3.91 – 3.84 (m, 1H), 3.12 (t, J = 6.5 Hz, 2H), 2.26 (s, 1H), 1.78 (s, 6H), 1.49 – 1.39 (m, 2H), 1.24 – 1.12 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H). 1.48 Compound 48 (B159) methyl 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoate (Compound 48) According to GP1 (step 3 – Method B) starting from Int02 and 3-aminoquinuclidine, Compound 48 was isolated as a colourless oil (7.5 mg, 0.0154 mmol, 4%). C25H34N4O4S; MS (ESI+) m / z: 487 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 7.93 (d, J = 1.9 Hz, 1H), 7.49 (d, J = 2.0 Hz, 1H), 7.27 – 7.21 (m, 2H), 7.06 – 7.00 (m, 1H), 6.86 – 6.81 (m, 2H), 3.87 (s, 3H), 3.80 (t, J = 5.5 Hz, 1H), 3.39 – 3.30 (m, 1H), 3.08 – 3.01 (m, 2H), 3.01 – 2.94 (m, 1H), 2.80 – 2.61 (m, 4H), 2.36 – 2.27 (m, 1H), 1.77 – 1.42 (m, 4H), 1.41 – 1.32 (m, 2H), 1.32 – 1.23 (m, 1H), 1.16 – 1.05 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 1.49 Compound 49 (B160) methyl 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 49) According to GP1 (step 3 – Method B) starting from Int02 and 1-[4-(aminomethyl)-1-piperidyl]ethenone, Compound 49 was isolated as a colourless oil (166 mg, 0.3252 mmol, 74%). C26H36N4O5S; MS (ESI+) m / z: 517 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.01 (t, J = 2.4 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.35 – 7.28 (m, 2H), 7.10 (t, J = 7.3 Hz, 1H), 6.93 – 6.88 (m, 2H), 4.54 (d, J = 13.7 Hz, 1H), 3.94 (s, 3H), 3.92 – 3.86 (m, 1H), 3.75 (d, J = 13.7 Hz, 1H), 3.11 (q, J = 5.9 Hz, 2H), 2.93 (t, J = 12.9 Hz, 1H), 2.81 (dd, J = 12.8, 6.7 Hz, 1H), 2.59 (td, J = 13.5, 6.6 Hz, 1H), 2.44 (q, J = 11.9 Hz, 1H), 2.05 (s, 3H), 1.71 (t, J = 15.8 Hz, 1H), 1.57 (d, J = 13.6 Hz, 2H), 1.48 – 1.40 (m, 2H), 1.24 – 1.13 (m, 2H), 1.09 – 0.86 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 50) According to GP1 (step 3 – Method B) starting from Int02 and (1-methyl-4-piperidyl)methanamine, Compound 50 was isolated as a white solid (5 mg, 0.0102 mmol, 2%). C25H36N4O4S; MS (ESI+) m / z: 489 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 7.99 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.35 – 7.29 (m, 2H), 7.14 – 7.08 (m, 1H), 6.92 – 6.87 (m, 2H), 3.94 (s, 3H), 3.92 – 3.88 (m, 1H), 3.32 (d, J = 11.7 Hz, 2H), 3.16 – 3.07 (m, 2H), 2.84 (dd, J = 13.1, 4.5 Hz, 1H), 2.62 (s, 3H), 2.61 – 2.56 (m, 0H), 2.49 (s, 3H), 1.88 – 1.70 (m, 2H), 1.61 (s, 3H), 1.48 – 1.40 (m, 2H), 1.24 – 1.13 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 1.51 Compound 51 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 51) According to GP2 (step 4 – Method A), starting from Compound 1, Compound 51 was isolated as a white solid (32 mg, 0.08 mmol, 74%). C18H23N3O4S; MS (ESI+) m / z: MS (ESI+) m / z: 378 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.75 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.29-7.24 (m, 2H), 7.04-6.98 (m, 1H), 6.87- 6.82 (m, 2H), 4.91 (t, J = 5.7 Hz, 1H), 3.05-3.03 (m, 2H), 2.42 (s, 3H), 1.42-1.30 (m, 2H), 1.14-1.04 (m, 2H), 0.77 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.2, 142.3, 139.7, 136.1, 129.1 (2C), 127.9, 122.2, 116.9, 115.5 (2C), 114.3, 42.1, 30.2, 29.4, 19.3, 13.6. 1.52 Compound 52 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 52) According to GP2 (step 4 – Method A), starting from Compound 2, Compound 52 was isolated as a white solid (22 mg, 0.055 mmol, 89%). C19H25N3O4S; MS (ESI+) m / z: 392 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 13.13 (s, 1H), 7.79 (d, J = 1.9 Hz, 1H), 7.41 (d, J = 2.0 Hz, 1H), 7.31 – 7.23 (m, 2H), 7.01 (t, J = 7.3 Hz, 1H), 6.77 (d, J = 8.1 Hz, 2H), 4.97-4.91 (m, 1H), 4.13 (s, 1H), 3.09-3.01 (m, 2H), 2.63 (s, 6H), 1.40-1.31 (m, 2H), 1.25-1.06 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.6, 156.1, 142.54, 139.7, 133.4, 129.2 (2C), 128, 122, 118.2, 115.1 (2C), 114.6, 42.1, 40.1, 37.6, 30.1, 19.3, 13.5. 1.53 Compound 53 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)benzoic acid (Compound 53) According to GP2 (step 4 – Method A), starting from Compound 3, Compound 53 was isolated as a white solid (22 mg, 0.055 mmol, 89%). C21H27N3O4S; MS (ESI+) m / z: 418 [M+H]+; 1H NMR (400 MHz, CD3OD): δ 7.93 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 2.0 Hz, 1H), 7.37 – 7.26 (m, 2H), 7.09 – 7.04 (m, 1H), 6.93–6.82 (m, 2H), 3.25 – 3.17 (m, 4H), 3.13 (t, J = 6.9 Hz, 2H), 1.72-1.58 (m, 4H), 1.50-1.38 (m, 2H), 1.24-1.12 (m, 2H), 0.83 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, CD3OD): δ 168.8, 157.5, 144.4, 141.3, 136.2, 130.8 (2C), 129.7, 124.0, 119.2, 117.1, 116.2 (2C), 48.7 (2C), 43.7, 32.0, 26.5 (2C), 20.9, 14. 1.54 Compound 54 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)benzoic acid (Compound 54) According to GP2 (step 4 – Method A), starting from Compound 4, Compound 54 was isolated as a white solid (105 mg, 0.24 mmol, 90%). C22H29N3O4S; MS (ESI+) m / z: 432 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.12 (s, 1H), 7.78 (d, J = 2.0 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.31-7.23 (m, 2H), 7.03-6.97 (m, 1H), 6.79-6.72 (m, 2H), 4.97 (t, J = 5.7 Hz, 1H), 4.06 (brs, 1H), 3.09-3.02 (m, 2H), 3.01-2.92 (m, 4H), 1.48-1.30 (m, 8H), 1.15-1.05 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.6, 157.1, 143.6, 140.7, 134.6, 130.1 (2C), 128.9, 122.9, 119.1, 116.1 (2C), 115.5, 47.5 (2C), 43.0, 31.1, 26.2 (2C), 24.3, 20.2, 14.5. 1.55 Compound 55 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 55) According to GP2 (step 4 – Method A), starting from Compound 5, Compound 55 was isolated as a white solid (24 mg, 0.0586 mmol, 99%). C20H27N3O4S; MS (ESI+) m / z: 406 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.12 (s, 1H), 7.81 (d, J = 2.0 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.31–7.23 (m, 2H), 7.05–6.98 (m, 1H), 6.81–6.75 (m, 2H), 4.89 (t, J = 5.7 Hz, 1H), 4.08 (s, 1H), 3.16–2.91 (m, 4H), 2.65 (s, 3H), 1.41–1.30 (m, 2H), 1.17–1.04 (m, 2H), 0.98 (t, J = 7.1 Hz, 3H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.7 156.0, 142.5, 139.5, 135.2, 129.2 (2C), 127.9, 122.1, 117.9, 115.2 (2C), 114.5, 44.4, 42.1, 34.1, 30.1, 19.3, 13.6, 13.3. 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 56) According to GP2 (step 4 – Method A), starting from Compound 6, Compound 56 was isolated as a white solid (38 mg, 0.085 mmol, 95%). C21H27N3O5S; MS (ESI+) m / z: 434 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.78 (d, J = 1.9 Hz, 1H), 7.50–7.44 (m, 1H), 7.27 (t, J = 7.8 Hz, 2H), 7.00 (t, J = 7.3 Hz, 1H), 6.77 (d, J = 8.0 Hz, 2H), 4.87 (m, 1H), 3.48-3.35 (m, 4H), 3.10-3.02 (m, 2H), 2.98-2.92 (m, 4H), 1.42-1.32 (m, 2H), 1.18-1.06 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): 167.6, 156.8, 142.8, 139.4, 132.6, 129.7 (2C), 122.4, 118.8, 115.8, 115.6 (2C), 66.2 (2C), 46.5 (2C), 42.7, 30.8 (2C), 19.8, 14.1. 1.57 Compound 57 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoic acid (Compound 57) According to GP2 (step 4 – Method A), starting from Compound 7, Compound 57 was isolated as a white solid (46 mg, 0.100 mmol, 91%). C23H25N3O4S; MS (ESI+) m / z: 440 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 12.95 (s, 1H), 7.86 (d, J = 2.0 Hz, 1H), 7.42 (d, J = 2.1 Hz, 1H), 7.29-7.20 (m, 2H), 7.06-6.96 (m, 3H), 6.84 (d, J = 8.0 Hz, 2H), 6.79-6.71 (m, 1H), 6.57 (d, J = 7.9 Hz, 2H), 5.07-5.00 (m, 1H), 3.12-3.04 (m, 2H), 1.43-1.32 (m, 2H), 1.19– 1.05 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.6, 156, 142.5, 139.6, 137.8, 128.9 (2C), 128.9 (3C), 127.8, 122.5, 122, 120.4 (2C), 116, 115.7 (2C), 114.5, 42, 30.1, 19.3, 13.6. 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 58) According to GP2 (step 4 – Method A), starting from Compound 8, Compound 58 was isolated as a white solid (43 mg, 0.092 mmol, 86%). C24H27N3O4S; MS (ESI+) m / z: 454 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.80 (d, J = 2.0 Hz, 1H), 7.37 (d, J = 2.0 Hz, 1H), 7.30–7.14 (m, 7H) 7.04–6.98 (m, 1H), 6.89–6.82 (m, 2H), 4.88 (t, J = 5.7 Hz, 1H), 4.03 (s, 2H), 3.05 (q, J = 6.6 Hz, 2H), 1.43 – 1.30 (m, 2H), 1.18–1.06 (m, 2H), 0.79 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.1, 142.3, 139.6, 137.4, 129.1 (2C), 127.9 (3C), 127.4 (3C), 126.6, 122.1, 116.6, 115.5 (2C), 114.3, 46.7, 42.1, 30.2, 19.3, 13.6. 1.59 Compound 59 3-(butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 59) According to GP2 (step 4 – Method A), starting from Compound 9, Compound 59 was isolated as a white solid (43 mg, 0.092 mmol, 86%). C20H27N3O5S; MS (ESI+) m / z: 422 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.78 (d, J = 2.0 Hz, 1H), 7.39 (d, J = 2.0 Hz, 1H), 7.31–7.22 (m, 2H), 7.05–6.97 (m, 1H), 6.87–6.80 (m, 2H), 4.93 (t, J = 5.7 Hz, 1H), 3.23 (t, J = 6.1 Hz, 2H), 3.15 (s, 3H), 3.09-3.01 (m, 2H), 2.94 (t, J = 6.1 Hz, 2H), 1.41–1.32 (m, 2H), 1.17–1.04 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.1, 142.3, 139.6, 137.1, 129.2 (2C), 127.8, 122.2, 116.6, 115.4 (2C), 114.3, 71, 57.8, 42.6, 42.1, 30.1, 19.3, 13.6. 1.60 Compound 60 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 60) According to GP2 (step 4 – Method A), starting from Compound 10, Compound 60 was isolated as a white solid (33 mg, 0.0823 mmol, 86%). C20H25N3O4S; MS (ESI+) m / z: 404 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.83 (d, J = 2.0 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.30–7.22 (m, 2H), 7.04–6.98 (m, 1H), 6.88–6.78 (m, 2H), 4.94 (t, J = 5.7 Hz, 1H), 3.11-3.00 (m, 2H), 2.27-2.14 (m, 1H), 1.43–1.31 (m, 2H), 1.17-1.04 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H), 0.43–0.24 (m, 4H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.1, 142.3, 139.9, 136.8, 129 (2C), 127.8, 122.1, 117.1, 115.6 (2C), 114.3, 42.1, 30.2, 24.8, 19.3, 13.6, 5.43, 5.4. 1.61 Compound 61 3-(azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoic acid (Compound 61) According to GP2 (step 4 – Method A), starting from Compound 11, Compound 61 was isolated as a white solid (37 mg, 0.077 mmol, 71%). C23H31N3O4S; MS (ESI+) m / z: 446 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.09 (s, 1H), 7.81 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.32–7.25 (m, 2H), 7.08-6.98 (m, 1H), 6.81–6.76 (m, 2H), 4.88- 4.84 (m, 1H), 4.04 (s, 1H), 3.24-3.15 (m, 2H), 3.24-3.06 (m, 2H), 3.06-2.99 (m, 2H), 1.59-1.45 (m, 8H), 1.38–1.29 (m, 2H), 1.16-1.03 (m, 2H), 0.76 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 155.9, 142.3, 139.4, 136.1, 129.3 (2C), 127.7, 122.2, 117.7, 115.2 (2C), 114.4, 48.3 (2C), 42.1, 30.1, 29.2 (2C), 26.3 (2C), 19.2, 13.5. 1.62 62 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 62) According to GP2 (step 4 – Method A), starting Compound 12, Compound 62 was isolated as a white solid (19 mg, 0.0407 mmol, 39%). C24H33N3O4S; MS (ESI+) m / z: 460 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.76 (s, 1H), 7.40 (s, 1H), 7.32-7.24 (m, 2H), 7.07-6.97 (m, 1H), 6.85 (d, J = 8.0 Hz, 2H), 5.01-4.93 (m, 1H), 3.09-3.00 (m, 2H), 2.62 (d, J = 6.8 Hz, 2H), 1.66-1.48 (m, 6H), 1.43-1.30 (m, 2H), 1.17-1.02 (m, 5H), 0.82-0.70 (m, 5H). 13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.1, 142.4, 139.7, 136.9, 129.2 (2C), 127.9, 122.2, 116.6, 115.5 (2C), 114.4, 49.2, 42, 37.5, 30.2, 30.2 (2C), 26, 25.3 (2C), 19.3, 13.6. 1.63 Compound 63 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 63) According to GP2 (step 4 – Method A), starting from Compound 13, Compound 63 was isolated as a white solid (36 mg, 0.0782 mmol, 74%). C23H31N3O5S; MS (ESI+) m / z: 462 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.77 (d, J = 1.9 Hz, 1H), 7.40 (d, J = 1.9 Hz, 1H), 7.33-7.21 (m, 2H), 7.07-6.97 (m, 1H), 6.85 (d, J = 8.1 Hz, 2H), 5.02-4.94 (m, 1H), 3.82 – 3.70 (m, 2H), 3.21–3.10 (m, 2H), 3.10-3.01 (m, 2H), 2.73-2.64 (m, 2H), 1.55–1.42 (m, 3H), 1.41–1.32 (m, 2H), 1.18-0.84 (m, 4H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.6, 156.1, 142.4, 139.7, 136.8, 129.2 (2C), 127.9, 122.2, 116.5, 115.5 (2C), 114.4, 66.7 (2C), 48.7, 42.1, 35.1, 30.330.3, 30.1, 19.3, 13.6. 3-(butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoic acid (Compound 64) According to GP2 (step 4 – Method A), starting from Compound 16, Compound 64 was isolated as a yellow solid (30 mg, 0.0647 mmol, 22%). C22H24N4O4S; MS (ESI+) m / z: 441 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.94 (dd, J = 4.7, 1.5 Hz, 1H), 7.85 (d, J = 2.0 Hz, 1H), 7.63 (d, J = 2.6 Hz, 1H), 7.45 (d, J = 2.0 Hz, 1H), 7.22 (dd, J = 8.6, 7.3 Hz, 2H), 7.10 – 6.98 (m, 2H), 6.98 – 6.90 (m, 1H), 6.86 – 6.78 (m, 2H), 5.14 (t, J = 5.8 Hz, 1H), 3.14 – 3.00 (m, 2H), 1.44 – 1.33 (m, 2H), 1.17 – 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.0, 156.5, 144.0, 143.2, 141.1, 139.9, 137.7, 129.4 (2C), 129.2, 128.4, 123.9, 122.6, 116.3 (2C), 116.0, 115.3, 42.5, 30.6, 19.8, 14.5, 14.1. 1.65 Compound 65 (B84) 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 65) According to GP2 (step 4 – Method A), starting from Compound 17, Compound 65 was isolated as a off- white solid (116 mg, 0.2470 mmol, 79%). C24H27N3O5S; MS (ESI+) m / z: 470 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.11 (s, 1H), 7.85 (d, J = 2.0 Hz, 1H), 7.42 (d, J = 2.0 Hz, 1H), 7.26 – 7.21 (m, 2H), 7.03 – 6.97 (m, 1H), 6.89 (t, J = 8.1 Hz, 1H), 6.84 – 6.81 (m, 2H), 6.32 (dd, J = 8.1, 2.5 Hz, 1H), 6.28 – 6.23 (m, 1H), 6.01 (s, 1H), 5.02 (s, 1H), 3.55 (s, 3H), 3.06 (t, J = 6.8 Hz, 2H), 1.43 – 1.31 (m, 2H), 1.18 – 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 160, 156, 143, 140, 129 (4C), 128, 123, 116 (3C), 115 (2C), 109, 107 (2C), 55.1, 42.4, 30.6, 19.7, 14.1. 1.66 Compound 66 (B85) 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoic acid (Compound 66) According to GP2 (step 4 – Method A), starting from Compound 18, Compound 66 was isolated as an off-white solid (241 mg, 0.4652 mmol, 95%). C28H33N3O4S; MS (ESI+) m / z: 508 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.15 (s, 1H), 7.82 (d, J = 2.0 Hz, 1H), 7.43 (d, J = 2.0 Hz, 1H), 7.34 – 7.24 (m, 4H), 7.20 – 7.11 (m, 3H), 7.03 (t, J = 7.3 Hz, 1H), 6.83 – 6.78 (m, 2H), 5.05 (t, J = 5.4 Hz, 2H), 3.76 (d, J = 12.0 Hz, 2H), 3.12 – 3.02 (m, 2H), 2.59 – 2.51 (m, 3H), 1.73 – 1.66 (m, 2H), 1.49 – 1.29 (m, 3H), 1.13 (h, J = 7.4 Hz, 2H), 0.78 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 157, 146, 143, 140, 134, 130 (2C), 129 (2C), 128, 127 (2C), 126, 122, 119, 116 (2C), 115, 46.4 (2C), 42.3, 33.0 (2C), 30.7, 19.7, 14.1. 1.67 Compound 67 (B86) 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 67) According to GP2 (step 4 – Method A), starting from Compound 21, Compound 67 was isolated as a white solid (7 mg, 0.0160 mmol, 17%). C21H25N5O4S; MS (ESI+) m / z: 444 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.07 (s, 1H), 7.89 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.29 – 7.19 (m, 3H), 7.06 – 6.97 (m, 3H), 6.86 – 6.80 (m, 2H), 5.39 (s, 1H), 4.88 (t, J = 5.7 Hz, 1H), 3.58 (s, 3H), 3.04 (q, J = 6.6 Hz, 2H), 1.39 – 1.31 (m, 2H), 1.15 – 1.04 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 1.68 Compound 68 (B87) 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 68) According to GP2 (step 4 – Method A), starting from Compound 15, Compound 68 was isolated as an off-white solid (50 mg, 0.1076 mmol, 70%). C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.97 (s, 1H), 8.58 (s, 2H), 7.79 (d, J = 1.9 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.24 (dd, J = 8.7, 7.3 Hz, 2H), 7.03 – 6.91 (m, 1H), 6.89 – 6.78 (m, 2H), 4.95 – 4.80 (m, 1H), 4.09 (s, 2H), 3.05 (q, J = 6.5 Hz, 2H), 1.47 – 1.26 (m, 2H), 1.23 – 1.04 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.2, 157.2, 156.6, 156.5 (3C), 142.8, 140.0, 137.5, 129.5 (2C), 128.7, 122.6, 117.0, 115.9 (2C), 115.0, 42.6, 42.5, 30.7, 19.8, 14.1. 1.69 Compound 69 (B95) 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 69) According to GP2 (step 4 – Method A), starting from Compound 20, Compound 69 was isolated as a white solid (29 mg, 0.0625 mmol, 14%). C23H29N3O5S; MS (ESI+) m / z: 460 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.10 (s, 1H), 7.75 (d, J = 1.9 Hz, 1H), 7.41 (d, J = 1.9 Hz, 1H), 7.30 – 7.23 (m, 2H), 7.03 – 6.97 (m, 1H), 6.78 – 6.73 (m, 2H), 4.93 (t, J = 5.7 Hz, 1H), 4.33 – 4.27 (m, 2H), 3.38 – 3.25 (m, 2H), 3.08 – 3.01 (m, 2H), 2.76 – 2.64 (m, 2H), 1.90 – 1.84 (m, 1H), 1.77 – 1.68 (m, 3H), 1.41 – 1.31 (m, 2H), 1.16 – 1.04 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 157, 150, 143, 140, 130 (2C), 128, 122, 119, 116 (2C), 115, 73.6, 51.8 (2C), 42.4, 30.4, 27.6 (3C), 19.7, 14.0. 1.70 Compound 70 (B100) 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 70) According to GP2 (step 4 – Method A), starting from Compound 22, Compound 70 was isolated as an off-white foam (221 mg, 0.4476 mmol, 98%). C23H24ClN3O4S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.14 (s, 1H), 7.83 (d, J = 1.9 Hz, 1H), 7.44 (d, J = 2.0 Hz, 1H), 7.23 (dd, J = 8.6, 7.3 Hz, 2H), 7.01 (q, J = 7.8 Hz, 2H), 6.83 – 6.79 (m, 2H), 6.76 (dd, J = 7.8, 2.1 Hz, 1H), 6.47 (d, J = 8.1 Hz, 1H), 6.37 (s, 1H), 5.13 (t, J = 5.7 Hz, 1H), 3.08 (q, J = 6.4 Hz, 2H), 1.42 – 1.33 (m, 2H), 1.19 – 1.08 (m, 2H), 0.78 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 157 (2C), 143, 140, 138, 133, 130, 129 (2C), 128, 122 (2C), 121, 120, 116 (3C), 115, 42.4, 30.5, 19.7, 14.0. 1.71 Compound 71 (B101) 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 71) According to GP2 (step 4 – Method A), starting from Compound 23, Compound 71 was isolated as an white solid (238 mg, 0.4828 mmol, 93%). C24H26ClN3O4S; MS (ESI+) m / z: 488 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.78 (d, J = 2.0 Hz, 1H), 7.35 (d, J = 2.0 Hz, 1H), 7.29 – 7.18 (m, 5H), 7.15 (d, J = 7.1 Hz, 1H), 7.00 (t, J = 7.3 Hz, 1H), 6.87 – 6.83 (m, 2H), 4.82 (t, J = 5.4 Hz, 1H), 4.04 (s, 2H), 3.03 (q, J = 6.4 Hz, 2H), 1.41 – 1.32 (m, 2H), 1.17 – 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 156, 142, 140, 137, 133 (2C), 130, 129 (2C), 128, 127, 126, 123, 117, 116 (2C), 115, 46.4, 42.4, 30.6, 19.6, 14.0. 1.72 Compound 72 (B102) 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 72) According to GP2 (step 4 – Method A), starting from Compound 24, Compound 72 was isolated as a brown foam (242 mg, 0.5042 mmol, 95%). C25H27N3O4S; MS (ESI+) m / z: 466 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.09 (s, 1H), 7.89 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.22 (s, 4H), 7.21 – 7.18 (m, 2H), 6.93 (t, J = 7.4 Hz, 1H), 6.80 – 6.77 (m, 2H), 4.89 (t, J = 5.7 Hz, 1H), 4.60 – 4.47 (m, 4H), 2.99 (q, J = 6.4 Hz, 2H), 1.35 – 1.27 (m, 2H), 1.10 – 1.00 (m, 2H), 0.72 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 156, 142, 140, 137, 133 (2C), 130, 129 (2C), 128, 127, 126, 123, 117, 116 (2C), 115, 46.4, 42.4, 30.6, 19.6, 14.0. 1.73 Compound 73 (B104) 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoic acid (Compound 73) According to GP2 (step 4 – Method A), starting from Compound 32, Compound 73 was isolated as a brown foam (20 mg, 0.0453 mmol, 10%). C21H23N5O4S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.19 (s, 1H), 7.87 (d, J = 2.0 Hz, 1H), 7.83 – 7.81 (m, 1H), 7.75 (d, J = 2.7 Hz, 1H), 7.43 – 7.40 (m, 2H), 7.11 (d, J = 1.5 Hz, 1H), 7.08 – 7.02 (m, 2H), 6.88 (t, J = 7.3 Hz, 1H), 6.62 – 6.58 (m, 2H), 5.06 (t, J = 6.0 Hz, 1H), 3.05 (q, J = 6.3 Hz, 2H), 1.40 – 1.30 (m, 2H), 1.16 – 1.06 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167, 156 (2C), 155, 142, 141, 139, 135, 134, 129 (2C), 122, 118, 116 (2C), 115 (2C), 42.4, 30.4, 19.7, 14.0. 1.74 Compound 74 (B111) 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 74) According to GP2 (step 4 – Method B), starting from Compound 28, Compound 74 was isolated as a white solid (25 mg, 0.0472 mmol, 52%). C24H25F2N3O5S; MS (ESI+) m / z: 506 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.15 (s, 1H), 7.84 (d, J = 2.0 Hz, 1H), 7.43 (d, J = 2.0 Hz, 1H), 7.26 – 7.19 (m, 3H), 7.04 – 6.99 (m, 2H), 6.83 – 6.80 (m, 2H), 6.54 (dd, J = 8.2, 2.4 Hz, 1H), 6.44 (d, J = 8.0 Hz, 1H), 6.21 (s, 1H), 5.09 (t, J = 5.8 Hz, 1H), 3.07 (q, J = 6.5 Hz, 2H), 1.42 – 1.33 (m, 2H), 1.19 – 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.55 (2C), 156.01 (2C), 142.64 (2C), 139.50, 129.31, 128.86 (2C), 122.01 (2C), 121.80, 117.86, 116.32, 115.58 (2C), 114.69, 113.33, 110.33, 42.00, 30.13, 19.30, 13.58. 1.75 Compound 75 (B112) 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoic acid (Compound 75) According to GP2 (step 4 – Method B), starting from Compound 29, Compound 75 was isolated as a white solid (34 mg, 0.0760 mmol, 72%). C22H29N3O5S; MS (ESI+) m / z: 448 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.81 (d, J = 2.0 Hz, 1H), 7.37 (d, J = 2.0 Hz, 1H), 7.27 (t, J = 7.9 Hz, 2H), 7.01 (t, J = 7.3 Hz, 1H), 6.87 – 6.83 (m, 2H), 4.89 (t, J = 6.5 Hz, 1H), 3.75 – 3.65 (m, 2H), 3.30 – 3.22 (m, 2H), 3.18 (t, J = 11.4 Hz, 2H), 3.04 (q, J = 6.5 Hz, 2H), 1.56 – 1.46 (m, 2H), 1.39 – 1.31 (m, 3H), 1.14 – 1.04 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.69 (2C), 156.08 (2C), 142.30 (2C), 138.47, 129.08 (2C), 122.13, 116.42, 115.57 (2C), 114.22, 65.77 (2C), 49.58, 42.05, 33.89, 30.14, 19.25, 13.57. 1.76 Compound 76 (B113) [(pyrimidin-2-ylamino)sulfonimidoyl]benzoic acid (Compound 76) Method B), starting from Compound 31, Compound 76 was isolated as a mmol, 82%). m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.30 – 8.25 (m, 2H), J = 1.9 Hz, 1H), 7.45 (d, J = 2.0 Hz, 1H), 7.04 (t, J = 7.7 Hz, 2H), 6.93 – 6.82 2H), 5.29 – 5.17 (m, 1H), 3.09 – 3.02 (m, 2H), 1.40 – 1.30 (m, 2H), 1.16 – Hz, 3H). 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 77) According to GP2 (step 4 – Method B), starting from Compound 26, Compound 77 was isolated as a white solid (31 mg, 0.0646 mmol, 96%). C23H24ClN3O4S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.13 (s, 1H), 8.07 (d, J = 1.9 Hz, 1H), 7.42 (d, J = 1.9 Hz, 1H), 7.26 – 7.22 (m, 3H), 7.22 – 7.19 (m, 2H), 7.08 – 6.95 (m, 2H), 6.85 – 6.75 (m, 3H), 4.93 (t, J = 5.7 Hz, 1H), 3.05 (q, J = 6.5 Hz, 2H), 1.40 – 1.29 (m, 2H), 1.14 – 1.03 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.60, 156.04, 142.35, 139.94, 137.62, 129.40, 128.99 (2C), 127.44, 126.83 (2C), 122.59 (2C), 122.19, 121.30, 116.61, 115.63 (2C), 114.75, 42.03, 30.12, 19.25, 13.56. 1.78 78 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 78) According to GP2 (step 4 – Method B), starting from Compound 27, Compound 78 was isolated as a white solid (44 mg, 0.0939 mmol, 97%). C23H24ClN3O4S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 13.19 (s, 1H), 7.83 (d, J = 1.9 Hz, 1H), 7.43 (d, J = 2.0 Hz, 1H), 7.23 (dd, J = 8.6, 7.2 Hz, 2H), 7.18 (s, 1H), 7.05 – 6.98 (m, 3H), 6.81 (dd, J = 8.1, 1.4 Hz, 2H), 6.48 (d, J = 8.0 Hz, 2H), 5.09 – 5.03 (m, 1H), 3.07 (q, J = 6.6 Hz, 2H), 1.42 – 1.33 (m, 2H), 1.18 – 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 1.79 Compound 79 (B116) 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 79) According to GP2 (step 4 – Method B), starting from Compound 30, Compound 79 was isolated as a white solid (15 mg, 0.0326 mmol, 31%). C23H32N4O4S; MS (ESI+) m / z: 461 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.79 (d, J = 1.9 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.32 – 7.23 (m, 2H), 7.00 (t, J = 7.3 Hz, 1H), 6.87 – 6.82 (m, 2H), 4.84 (t, J = 5.0 Hz, 1H), 4.34 (s, 3H), 3.04 (q, J = 6.5 Hz, 2H), 2.73 – 2.62 (m, 2H), 2.19 (s, 3H), 2.14 – 1.90 (m, 2H), 1.62 – 1.51 (m, 2H), 1.39 – 1.31 (m, 3H), 1.17 – 1.08 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 1.80 Compound 80 (B117) 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoic acid (Compound 80) According to GP2 (step 4 – Method B), starting from Compound 33, Compound 80 was isolated as a yellow solid (34 mg, 0.0761 mmol, 76%). C21H23N5O4S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.50 (s, 1H), 7.84 (d, J = 1.8 Hz, 1H), 7.76 (s, 2H), 7.50 (d, J = 1.9 Hz, 1H), 7.49 – 7.46 (m, 2H), 7.20 (t, J = 7.8 Hz, 2H), 6.99 (t, J = 7.3 Hz, 1H), 6.77 (d, J = 8.1 Hz, 2H), 5.07 – 4.99 (m, 1H), 3.07 (q, J = 6.5 Hz, 2H), 1.43 – 1.33 (m, 2H), 1.19 – 1.09 (m, 2H), 0.79 (t, J = 7.4 Hz, 3H). 1.81 Compound 81 (B130) 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoic acid (Compound 81) According to GP2 (step 4 – Method A), starting from Compound 34, Compound 81 was isolated as a white solid (25 mg, 0.0543 mmol, 97%). C25H29N3O4S; MS (ESI+) m / z: 468 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.78 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.31 – 7.22 (m, 4H), 7.21 – 7.15 (m, 1H), 7.14 – 7.08 (m, 2H), 7.01 (t, J = 7.3 Hz, 1H), 6.84 – 6.79 (m, 2H), 4.91 (t, J = 5.8 Hz, 1H), 3.09 – 2.93 (m, 4H), 2.58 (t, J = 7.7 Hz, 2H), 1.41 – 1.31 (m, 2H), 1.17 – 1.04 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.15, 156.60, 142.83, 140.14, 137.48, 129.65 (2C), 129.01 (3C), 128.77 (2C), 128.39, 126.56, 122.68, 117.20, 115.94 (2C), 114.82, 45.19, 42.55, 36.31, 30.66, 19.77, 14.07. 1.82 82 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 82) According to GP2 (step 4 – Method A), starting from Compound 35, Compound 82 was isolated as a white solid (35 mg, 0.0691 mmol, 94%). C25H28ClN3O4S; MS (ESI+) m / z: 502 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.77 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.30 – 7.23 (m, 4H), 7.20 – 7.18 (m, 1H), 7.10 – 7.06 (m, 1H), 7.01 (t, J = 7.3 Hz, 1H), 6.82 (d, J = 8.1 Hz, 2H), 4.85 (t, J = 5.7 Hz, 1H), 3.08 – 2.95 (m, 4H), 2.60 (t, J = 7.4 Hz, 2H), 1.43 – 1.30 (m, 2H), 1.14 – 1.05 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.21, 156.62, 142.76, 140.03, 137.42, 133.30, 130.51, 129.65 (4C), 128.96, 127.86, 126.53, 122.67, 117.23, 115.96 (2C), 114.86, 44.75, 42.56, 35.79, 30.68, 19.77, 14.06. 1.83 Compound 83 (B132) 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoic acid (Compound 83) According to GP2 (step 4 – Method A), starting from Compound 36, Compound 83 was isolated as a white solid (32 mg, 0.0704 mmol, 98%). C23H26ClN4O4S; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.42 – 8.32 (m, 2H), 7.78 (d, J = 2.0 Hz, 1H), 7.59 (d, J = 7.6 Hz, 1H), 7.36 (d, J = 2.0 Hz, 1H), 7.30 – 7.18 (m, 3H), 6.99 (t, J = 7.3 Hz, 1H), 6.88 – 6.81 (m, 2H), 4.85 (t, J = 5.8 Hz, 1H), 4.06 (s, 2H), 3.03 (q, J = 6.6 Hz, 2H), 1.42 – 1.32 (m, 2H), 1.19 – 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.71, 159.88, 156.16, 148.79, 147.79, 142.26, 139.51, 137.22, 135.15, 129.11 (2C), 122.99 (2C), 122.13, 116.58, 115.51 (2C), 114.38, 44.19, 42.09, 30.20, 19.29, 13.59. 1.84 84 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoic acid (Compound 84) According to GP2 (step 4 – Method A), starting from Compound 37, Compound 84 was isolated as a white solid (33 mg, 0.0702 mmol, 94%). C24H28N4O4S; MS (ESI+) m / z: 469 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.41 – 8.33 (m, 2H), 7.77 (d, J = 1.9 Hz, 1H), 7.57 – 7.52 (m, 1H), 7.42 – 7.35 (m, 1H), 7.32 – 7.23 (m, 3H), 7.01 (t, J = 7.3 Hz, 1H), 6.82 (d, J = 8.1 Hz, 2H), 4.87 (t, J = 5.7 Hz, 1H), 3.10 – 2.97 (m, 4H), 2.61 (t, J = 7.3 Hz, 2H), 1.43 – 1.30 (m, 2H), 1.17 – 1.05 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.77, 156.15, 149.81 (2C), 147.33, 142.27, 139.49, 136.90 (2C), 136.10, 129.14 (2C), 123.31, 122.16, 116.71, 115.48 (2C), 114.38, 44.14, 42.08, 32.91, 30.19, 19.28, 13.58. 1.85 Compound 85 (B134) 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 85) According to GP2 (step 4 – Method A), starting from Compound 38, Compound 85 was isolated as a white solid (38 mg, 0.0792 mmol, 98%). C21H24N4O4S2; MS (ESI+) m / z: 461 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.82 (d, J = 2.0 Hz, 1H), 7.63 (d, J = 3.3 Hz, 1H), 7.56 – 7.50 (m, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.24 (t, J = 7.8 Hz, 2H), 6.98 (t, J = 7.4 Hz, 1H), 6.88 – 6.83 (m, 2H), 4.97 – 4.89 (m, 1H), 4.28 (s, 2H), 3.05 (q, J = 6.6 Hz, 2H), 1.41 – 1.31 (m, 2H), 1.17 – 1.05 (m, 2H), 0.77 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.11, 158.42, 156.62, 153.55, 142.52 (2C), 136.46, 129.59 (2C), 126.18, 122.83, 120.10, 116.78, 116.02 (2C), 114.97, 45.23, 42.55, 30.65, 19.77, 14.07. 1.86 Compound 86 (B135) 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoic acid (Compound 86) According to GP2 (step 4 – Method A), starting from Compound 39, Compound 86 was isolated as a white solid (28 mg, 0.0594 mmol, 99%). C22H26N4O4S2; MS (ESI+) m / z: 475 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.79 (d, J = 2.0 Hz, 1H), 7.62 (dd, J = 49.1, 3.3 Hz, 2H), 7.39 (d, J = 2.0 Hz, 1H), 7.31 – 7.23 (m, 2H), 7.04 – 6.97 (m, 1H), 6.87 – 6.81 (m, 2H), 4.89 (t, J = 5.7 Hz, 1H), 3.19 – 3.13 (m, 2H), 3.09 – 2.96 (m, 4H), 1.42 – 1.30 (m, 2H), 1.17 – 1.05 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.10, 166.69, 156.12, 142.31, 142.09, 139.57, 136.87, 129.13 (2C), 128.17, 122.16, 119.49, 116.67, 115.46 (2C), 114.44, 42.83, 42.07, 33.36, 30.17, 19.28, 13.57. 1.87 Compound 87 (B136) 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 87) According to GP2 (step 4 – Method A), starting from Compound 42, Compound 87 was isolated as a colourless oil (8 mg, 0.0145 mmol, 27%). C22H27N5O4S; MS (ESI+) m / z: 458 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.79 – 7.76 (m, 1H), 7.65 – 7.60 (m, 1H), 7.51 – 7.44 (m, 1H), 7.41 – 7.36 (m, 1H), 7.30 – 7.22 (m, 2H), 7.04 – 6.96 (m, 1H), 6.83 (d, J = 8.1 Hz, 2H), 6.01 (s, 1H), 4.83 – 4.75 (m, 1H), 3.94 (s, 2H), 3.71 (s, 3H), 3.03 (q, J = 6.5 Hz, 2H), 1.40 – 1.31 (m, 2H), 1.17 – 1.05 (m, 2H), 0.80 – 0.75 (m, 3H). 1.88 88 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 88) According to GP2 (step 4 – Method B), starting from Compound 40, Compound 88 was isolated as a white solid (8 mg, 0.0177 mmol, 97%). C21H25N5O4S; MS (ESI+) m / z: 444 [M+H]+; 1H NMR (400 MHz, DMSO-d6) 7.86 (d, J = 1.9 Hz, 1H), 7.41 (s, 1H), 7.17 (t, J = 7.8 Hz, 2H), 6.97 (t, J = 7.3 Hz, 1H), 6.71 – 6.66 (m, 2H), 6.63 (d, J = 8.1 Hz, 2H), 6.59 – 6.52 (m, 1H), 4.95 – 4.85 (m, 1H), 3.07 – 2.98 (m, 2H), 2.71 (s, 3H), 1.37 – 1.28 (m, 2H), 1.13 – 1.01 (m, 2H), 0.75 (t, J = 7.3 Hz, 3H). 1.89 Compound 89 (B138) 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoic acid (Compound 89) According to GP2 (step 4 – Method A), starting from Compound 41, Compound 89 was isolated as a white solid (18 mg, 0.0386 mmol, 70%). C22H24N4O4S; MS (ESI+) m / z: 441 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 13.13 (s, 1H), 7.90 – 7.85 (m, 2H), 7.39 (d, J = 2.0 Hz, 1H), 7.35 – 7.23 (m, 2H), 7.14 – 7.06 (m, 2H), 6.94 – 6.89 (m, 1H), 6.70 – 6.62 (m, 3H), 5.01 – 4.94 (m, 1H), 3.03 (q, J = 6.6 Hz, 2H), 1.39 – 1.29 (m, 2H), 1.15 – 1.05 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 1.90 90 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoic acid (Compound 90) According to GP2 (step 4 – Method A), starting from Compound 43, Compound 90 was isolated as a white solid (20 mg, 0.0448 mmol, 55%). C20H22N4O4S2; MS (ESI+) m / z: 447 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.09 (d, J = 2.0 Hz, 1H), 7.64 – 7.62 (m, 1H), 7.27 – 7.19 (m, 2H), 7.08 (d, J = 4.0 Hz, 1H), 7.03 (t, J = 7.4 Hz, 1H), 6.82 (d, J = 8.0 Hz, 2H), 6.77 (d, J = 3.9 Hz, 1H), 3.13 (t, J = 6.9 Hz, 2H), 1.48 – 1.37 (m, 2H), 1.17 (h, J = 7.4 Hz, 2H), 0.83 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 169.72, 168.43, 157.38, 143.98, 141.08, 136.47, 135.90, 133.76, 130.57 (2C), 123.92, 119.01, 117.74, 116.47 (2C), 112.74, 43.72, 31.96, 20.84, 14.00. 1.91 Compound 91 (B164) 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoic acid (Compound 91) According to GP2 (step 4 – Method A), starting from Compound 44, Compound 91 was isolated as a white solid (16 mg, 0.0374 mmol, 96%). C22H24N4O4S; MS (ESI+) m / z: 441 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.08 (d, J = 5.8 Hz, 2H), 7.84 (d, J = 1.9 Hz, 1H), 7.47 (d, J = 1.9 Hz, 1H), 7.19 (t, J = 7.8 Hz, 2H), 6.99 (t, J = 7.3 Hz, 1H), 6.75 (d, J = 8.1 Hz, 2H), 6.48 (d, J = 5.8 Hz, 2H), 5.25 (t, J = 5.7 Hz, 1H), 3.07 (q, J = 6.6 Hz, 2H), 1.44 – 1.31 (m, 2H), 1.19 – 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 3-[[(1-acetyl-4-piperidyl)amino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 92) According to GP1 (step 3 – Method B) starting from Int02 and 1-(4-amino-1-piperidyl)ethanone, the methyl ester intermediate was not isolated as a pure form and was directly saponified following GP2 (step 4 – Method A), to isolate Compound 92 was isolated as a white solid (37 mg, 0.0779 mmol, 20% over 2 steps). C24H32N4O5S; MS (ESI+) m / z: 489 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.81 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.31 – 7.23 (m, 2H), 7.00 (t, J = 7.3 Hz, 1H), 6.88 – 6.82 (m, 2H), 4.88 (t, J = 5.8 Hz, 1H), 4.07 – 3.84 (m, 1H), 3.67 – 3.49 (m, 1H), 3.04 (q, J = 6.5 Hz, 2H), 3.01 – 2.92 (m, 1H), 2.70 – 2.60 (m, 1H), 1.92 (s, 3H), 1.63 – 1.44 (m, 2H), 1.41 – 1.31 (m, 2H), 1.30 – 1.16 (m, 2H), 1.15 – 1.06 (m, 3H), 0.76 (t, J = 7.3 Hz, 3H). 1.93 Compound 93 (B166) 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoic acid (Compound 93) According to GP2 (step 4 – Method A), starting from Compound 45, Compound 93 was isolated as a white solid (15 mg, 0.0340 mmol, 83%). C21H23N5O4S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.58 (s, 1H), 8.06 (s, 1H), 7.98 – 7.80 (m, 1H), 7.68 (s, 1H), 7.22 (t, J = 7.8 Hz, 2H), 7.06 (t, J = 7.3 Hz, 1H), 7.02 – 6.84 (m, 1H), 6.79 (d, J = 8.0 Hz, 2H), 3.17 (t, J = 6.9 Hz, 2H), 1.52 – 1.41 (m, 2H), 1.28 – 1.15 (m, 2H), 0.85 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 157.48, 152.92, 144.52, 142.10, 140.55, 136.49, 132.34, 130.48 (3C), 123.94, 118.10, 117.88, 116.89, 116.45 (2C), 43.70, 31.98, 20.91, 14.02. 1.94 Compound 94 (B167) 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 94) According to GP2 (step 4 – Method A), starting from Compound 46, Compound 94 was isolated as a white solid (38 mg, 0.0906 mmol, 97%). C21H29N3O4S; MS (ESI+) m / z: 420 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.09 (d, J = 1.9 Hz, 1H), 7.58 (d, J = 1.9 Hz, 1H), 7.35 – 7.27 (m, 2H), 7.09 (t, J = 7.4 Hz, 1H), 6.91 (d, J = 7.9 Hz, 2H), 3.12 (t, J = 6.9 Hz, 2H), 2.97 (dt, J = 12.9, 6.8 Hz, 1H), 2.83 – 2.74 (m, 1H), 1.50 – 1.40 (m, 2H), 1.39 – 1.14 (m, 6H), 0.84 (t, J = 7.2 Hz, 6H). 13C NMR (101 MHz, DMSO-d6): δ 169.42, 155.91, 142.67, 140.38, 135.54, 130.17 (2C), 123.63, 119.18, 116.53, 115.24 (2C), 43.53, 43.26, 31.73, 31.15, 19.99, 19.93, 13.81, 13.76. 1.95 Compound 95 (B168) 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 95) According to GP2 (step 4 – Method A), starting from Compound 47, Compound 95 was isolated as a white solid (14 mg, 0.0340 mmol, 98%). C22H27N3O4S; MS (ESI+) m / z: 430 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.14 – 8.11 (m, 1H), 7.58 – 7.56 (m, 1H), 7.30 (t, J = 7.8 Hz, 2H), 7.08 (t, J = 7.4 Hz, 1H), 6.91 (d, J = 8.1 Hz, 2H), 3.12 (t, J = 7.0 Hz, 2H), 2.27 (s, 1H), 1.82 (s, 6H), 1.48 – 1.39 (m, 2H), 1.23 – 1.13 (m, 2H), 0.83 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 155.84, 149.38, 142.60, 140.54, 136.71, 130.11 (2C), 123.62, 118.86, 116.50, 115.46 (2C), 53.30 (3C), 43.27, 31.14, 24.21, 19.98, 13.81. 1.96 Compound 96 (B169) 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoic acid (Compound 96) According to GP2 (step 4 – Method A), starting from Compound 48, Compound 96 was isolated as a white solid (5 mg, 0.0113 mmol, 99%). C24H32N4O4S; MS (ESI+) m / z: 473 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.94 (d, J = 1.9 Hz, 1H), 7.66 (d, J = 1.9 Hz, 1H), 7.42 – 7.29 (m, 2H), 7.09 (t, J = 7.3 Hz, 1H), 6.97 (d, J = 7.8 Hz, 2H), 4.62 – 4.55 (m, 1H), 3.88 – 3.79 (m, 1H), 3.34 – 3.29 (m, 1H), 3.25 – 3.04 (m, 5H), 2.99 – 2.89 (m, 1H), 2.70 – 2.62 (m, 1H), 2.07 – 1.77 (m, 4H), 1.53 – 1.43 (m, 2H), 1.29 – 1.18 (m, 2H), 0.87 (t, J = 7.4 Hz, 3H). 1.97 Compound 97 (B170) 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 97) According to GP2 (step 4 – Method A), starting from Compound 49, Compound 97 was isolated as a white solid (65 mg, 0.1203 mmol, 99%). C25H34N4O5S; MS (ESI+) m / z: 504 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.02 – 8.00 (m, 1H), 7.57 – 7.55 (m, 1H), 7.33 – 7.26 (m, 2H), 7.08 (t, J = 7.4 Hz, 1H), 6.90 (d, J = 8.1 Hz, 2H), 4.54 (d, J = 9.0 Hz, 1H), 3.77 (d, J = 13.5 Hz, 1H), 3.11 (t, J = 7.0 Hz, 2H), 3.04 – 2.83 (m, 2H), 2.70 (dt, J = 13.2, 7.4 Hz, 1H), 2.55 – 2.41 (m, 1H), 2.08 (s, 3H), 1.76 (t, J = 15.5 Hz, 1H), 1.68 – 1.53 (m, 2H), 1.51 – 1.37 (m, 2H), 1.23 – 0.94 (m, 5H), 0.82 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 169.44, 168.74, 155.93, 142.67, 139.98, 130.17 (2C), 128.28, 123.64, 118.53, 116.59, 115.26 (2C), 48.54, 46.42, 43.23, 41.64, 36.68, 31.13, 30.21, 29.38, 25.47, 21.49, 19.97, 13.80. 1.98 Compound 98 methyl 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxy-benzoate (Compound 98) In a sealed tube, to a solution of Compound 5 (50 mg, 0.110 mmol, 1.00 eq.) in 1,4-dioxane (0.5482 mL, 0.2 M) was added successively copper acetate (II) (30 mg, 0.164 mmol, 1.50 eq.), pyridine (0.021 mL, 0.263 mmol, 2.40 eq.) and methylboronic acid (13 mg, 0.219 mmol, 2.00 eq.) under O2atmosphere. The reaction mixture was stirred at 100°C for 16 hours. The conversion was checked by LC-MS. The reaction mixture was concentrated under reduced pressure. The crude residue was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 99 / 1 to 65 / 35) to afford Compound 98 as a colourless oil (m = 6 mg, 0.0138 mmol, 13%). C22H31N3O4S; MS (ESI+) m / z: 434 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.05 (d, J = 2.0 Hz, 1H), 7.48 (d, J = 2.0 Hz, 1H), 7.32–7.22 (m, 2H), 7.08–6.98 (m, 1H), 6.87–6.79 (m, 2H), 3.93 (s, 3H), 3.89- 3.83 m, 1H), 3.32-3.19 (m, 1H), 3.17–3.03 (m, 3H), 2.77 (s, 3H), 2.67 (s, 3H), 1.47–1.35 (m, 2H), 1.21- 1.12 (m, 2H), 1.10 (t, J = 7.1 Hz, 3H), 0.81 (t, J = 7.3 Hz, 3H). 1.99 Compound 99 (B94) methyl 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 99) In a sealed tube, to a solution of Compound 11 (100 mg, 0.217 mmol, 1.00 eq.) in acetonitrile (0.7860 mL, 0.5 M) was added successively copper acetate (II) (49 mg, 0.272 mmol, 1.25 eq.), triethylamine (0.040 mL, 0.2720 mmol, 1.25 eq.) and phenylboronic acid (40 mg, 0.326 mmol, 1.5 eq.) under O2atmosphere. The reaction mixture was stirred at 20°C for 24 hours. The conversion was checked by LC-MS. The reaction mixture was concentrated under reduced pressure. The crude residue was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 99 / 1 to 65 / 35) to afford Compound 11 as a brown oil (m = 8 mg, 0.0149 mmol, 7%). C30H37N3O4S; MS (ESI+) m / z: 536 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.20 (d, J = 2.0 Hz, 1H), 7.53 (d, J = 2.0 Hz, 1H), 7.32 – 7.27 (m, 2H), 7.13 – 7.04 (m, 3H), 6.93 – 6.91 (m, 1H), 6.91 – 6.83 (m, 4H), 3.95 (s, 3H), 3.45 – 3.31 (m, 4H), 3.10 (t, J = 7.0 Hz, 2H), 1.56 – 1.32 (m, 10H), 1.22 – 1.11 (m, 2H), 0.81 (t, J = 7.4 Hz, 3H). 1.100 Compound 100 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxybenzoic acid (Compound 100) According to GP2 (step 4 – Method A), starting from Compound 98, Compound 100 was isolated as a colourless sticky oil (5.6 mg, 0.0129 mmol, 94%). C21H29N3O4S; MS (ESI+) m / z: 420 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.10 (s, 1H), 7.88 (d, J = 2.0 Hz, 1H), 7.39 (d, J = 2.1 Hz, 1H), 7.31–7.23 (m, 2H), 7.06-6.97 (m, 1H), 6.79–6.73 (m, 2H), 4.96- 4.88 (m, 1H), 3.20-3.08 (m, 1H), 3.09-2.95 (m, 3H), 2.67 (s, 3H), 2.52 (s, 3H), 1.40-1.29 (m, 2H), 1.15- 1.05 (m, 2H), 1.01 (t, J = 7.1 Hz, 3H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.6, 156.1, 142.5, 139.9, 133.2, 129.2 (2C), 127.8, 122.1, 118.6, 115.2 (2C), 114.4, 44.4, 42, 33.9, 30.1, 27.6, 19.3, 13.6, 13.2. 1.101 Compound 101 (B103) 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 101) According to GP2 (step 4 – Method A), starting from Compound 99, Compound 101 was isolated as a colourless oil (7 mg, 0.0134 mmol, 90%). C29H35N3O4S; MS (ESI+) m / z: 522 [M+H]+; 1H NMR (400 MHz, Acetonitrile-d3): δ 8.03 (d, J = 2.0 Hz, 1H), 7.51 (d, J = 2.0 Hz, 1H), 7.36 – 7.27 (m, 2H), 7.17 – 7.03 (m, 3H), 6.92 – 6.78 (m, 5H), 4.40 – 4.22 (m, 1H), 3.42 – 3.23 (m, 4H), 3.10 (t, J = 7.0 Hz, 2H), 1.58 – 1.30 (m, 10H), 1.18 – 1.07 (m, 2H), 0.80 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, Acetonitrile-d3): δ 166.6, 156.8, 145.1, 143.7, 130.0 (2C), 129.3 (2C), 127.9, 124.0 (2C), 123.1, 121.9, 119.2, 116.0 (3C), 49.6 (2C), 43.1, 31.1, 29.3 (2C), 27.0 (2C), 20.1, 13.5. (+2C overlapping with CD3CN signal). 1.102 Compound 102 (B71) 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-N-methyl-4-phenoxy-benzamide (Compound 102) According to GP3 (step 5), starting from Compound 58, Compound 102 was isolated as a yellow oil (3 mg, 0.0062 mmol, 15%). C25H34N4O5S; MS (ESI+) m / z: 467 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.52 (d, J = 2.1 Hz, 1H), 7.41 (d, J = 2.1 Hz, 1H), 7.24 – 7.13 (m, 3H) overlapping with Chloroform-d, 7.08 – 7.00 (m, 2H), 7.00 – 6.92 (m, 1H), 6.85 – 6.73 (m, 2H), 6.38 – 6.21 (m, 1H), 4.04 (d, J = 13.9 Hz, 1H), 3.88 – 3.76 (m, 2H), 3.11 – 2.99 (m, 2H), 2.95 (d, J = 4.8 Hz, 3H), 1.42 – 1.29 (m, 2H), 1.16 – 1.05 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.0, 155.7, 142.8, 138.5, 136.6, 134.1, 132.4, 130.0 (2C), 128.5 (2C), 127.9 (2C), 127.7, 123.5, 115.1, 115.0 (2C), 114.0, 48.0, 43.1, 31.0, 26.9, 19.8, 13.6. 1.103 103 3-(butylamino)-N-methyl-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzamide (Compound 103) According to GP3 (step 5), starting from Compound 63, Compound 103 was isolated as a yellow oil (6 mg, 0.0119 mmol, 2%). C24H34N4O4S; MS (ESI+) m / z: 475 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.60 (d, J = 2.1 Hz, 1H), 7.50 (d, J = 2.1 Hz, 1H), 7.38 – 7.30 (m, 2H), 7.11 (t, J = 7.4 Hz, 1H), 6.91 (d, J = 8.1 Hz, 2H), 6.55 (d, J = 4.9 Hz, 1H), 3.97 – 3.87 (m, 3H), 3.35 – 3.23 (m, 2H), 3.20 – 3.10 (m, 2H), 3.06 – 2.97 (m, 4H), 2.82 – 2.72 (m, 1H), 2.62 – 2.52 (m, 1H), 1.50 – 1.40 (m, 4H), 1.28 – 1.09 (m, 4H), 0.84 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 167.0, 155.8, 142.8, 138.3, 134.2, 132.5, 130.1 (2C), 123.5, 115.0, 115.0 (2C), 114.1, 67.4, 67.4, 49.5, 43.1, 35.3, 31.0, 30.4, 30.4, 26.9, 19.8, 13.6. 1.104 104 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methyl-4-phenoxy-benzamide (Compound 104) According to GP3 (step 5), starting from Compound 57, Compound 104 was isolated as a yellow oil (4 mg, 0.0088 mmol, 8%). C24H28N4O3S; MS (ESI+) m / z: 453 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.53 (d, J = 4.7 Hz, 1H), 7.76 (d, J = 2.1 Hz, 1H), 7.36 (d, J = 2.0 Hz, 1H), 7.26 – 7.19 (m, 2H), 7.08 – 6.91 (m, 5H), 6.87 – 6.78 (m, 2H), 6.78 – 6.71 (m, 1H), 6.60 – 6.45 (m, 2H), 4.93 – 4.82 (m, 1H), 3.15 – 3.04 (m, 2H), 2.81 (d, J = 4.5 Hz, 3H), 1.45 – 1.32 (m, 2H), 1.20 – 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.2, 156.6, 142.8, 138.5, 132.0, 129.3 (2C), 128.7 (3C), 123.1 (2C), 122.3 (2C), 120.7, 116.2 (2C), 114.7, 113.2, 42.6, 30.8, 26.8, 19.8, 14.1. 1.105 Compound 105 (B89) 3-(anilinosulfonimidoyl)-5-(butylamino)-N,N-dimethyl-4-phenoxy-benzamide (Compound 105) According to GP3 (step 5), starting from Compound 57, Compound 105 was isolated as a yellow oil (8 mg, 0.0163 mmol, 15%). C25H30N4O3S; MS (ESI+) m / z: 467 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.29 – 7.15 (m, 3H), 7.08 – 6.94 (m, 4H), 6.91 (d, J = 1.9 Hz, 1H), 6.87 – 6.79 (m, 2H), 6.74 (t, J = 7.3 Hz, 1H), 6.66 – 6.50 (m, 2H), 4.95 (t, J = 5.8 Hz, 1H), 3.09 – 2.91 (m, 8H), 1.44 – 1.29 (m, 2H), 1.18 – 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 169.3, 156.3, 142.4, 136.7, 133.6, 128.9 (2C), 128.3 (3C), 122.5 (2C), 121.9, 120.3, 115.6 (2C), 113.2, 112.7, 42.0, 40.1, 34.7, 30.3, 19.3, 13.6 + 1C overlapping with DMSO signal). 1.106 Compound 106 (B90) 3-(anilinosulfonimidoyl)-5-(butylamino)-N-cyclopropyl-4-phenoxy-benzamide (Compound 106) According to GP3 (step 5), starting from Compound 57, Compound 106 was isolated as a yellow oil (25 mg, 0.0486 mmol, 44%). C26H30N4O3S; MS (ESI+) m / z: 479 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.56 (d, J = 4.1 Hz, 1H), 7.74 (d, J = 2.0 Hz, 1H), 7.32 (d, J = 2.0 Hz, 1H), 7.28 – 7.18 (m, 2H), 7.06 – 6.92 (m, 5H), 6.88 – 6.79 (m, 2H), 6.79 – 6.69 (m, 1H), 6.62 – 6.44 (m, 2H), 4.91 – 4.75 (m, 1H), 3.14 – 3.04 (m, 2H), 2.93 – 2.79 (m, 1H), 1.45 – 1.31 (m, 2H), 1.20 – 1.08 (m, 2H), 0.83 – 0.68 (m, 5H), 0.66 – 0.56 (m, 2H). 13C NMR (101 MHz, DMSO-d6): δ 167.2, 156.6, 142.7, 138.5, 132.0, 129.3 (3C), 128.7 (3C), 123.1, 122.4, 120.8, 116.1 (3C), 114.7, 113.4, 42.6, 30.8, 23.6, 19.8, 14.1, 6.3, 6.2. 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(cyclopropylmethyl)-4-phenoxy-benzamide (Compound 107) According to GP3 (step 5), starting from Compound 57, Compound 107 was isolated as a yellow oil (31 mg, 0.0629 mmol, 57%). C27H32N4O3S; MS (ESI+) m / z: 493 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.68 (t, J = 5.7 Hz, 1H), 7.78 (d, J = 2.0 Hz, 1H), 7.37 (d, J = 2.0 Hz, 1H), 7.30 – 7.17 (m, 2H), 7.07 – 6.90 (m, 5H), 6.89 – 6.80 (m, 2H), 6.73 (t, J = 7.3 Hz, 1H), 6.61 – 6.45 (m, 2H), 4.90 – 4.78 (m, 1H), 3.22 – 3.15 (m, 2H), 3.14 – 3.03 (m, 2H), 1.45 – 1.33 (m, 2H), 1.20 – 0.99 (m, 4H), 0.78 (t, J = 7.3 Hz, 3H), 0.51 – 0.40 (m, 2H), 0.29 – 0.20 (m, 2H). 13C NMR (101 MHz, DMSO-d6): δ 165.8, 156.7, 142.7, 138.5, 132.2, 129.3 (2C), 128.7 (3C), 123.1 (2C), 122.4 (2C), 120.8, 116.1 (2C), 114.7, 113.5, 44.1, 42.6, 30.8, 26.0, 19.8, 14.1, 11.5, 3.8. 1.108 Compound 108 (B92) 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methoxy-4-phenoxy-benzamide (Compound 108) According to GP3 (step 5), starting from Compound 57, Compound 108 was isolated as a yellow oil (27 mg, 0.0576 mmol, 53%). C24H28N4O4S; MS (ESI+) m / z: 469 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 11.88 (s, 1H), 7.70 (d, J = 2.0 Hz, 1H), 7.33 – 7.16 (m, 3H), 7.08 – 6.93 (m, 5H), 6.88 – 6.79 (m, 2H), 6.79 – 6.71 (m, 1H), 6.54 (s, 2H), 5.07 – 4.89 (m, 1H), 3.74 (s, 3H), 3.14 – 3.00 (m, 2H), 1.47 – 1.31 (m, 2H), 1.22 – 1.08 (m, 2H), 0.79 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 163.7, 156.6 (2C), 142.9, 139.0, 129.8, 129.4 (2C), 128.8, 127.8 (4C), 123.1, 122.5, 116.2 (2C), 114.5, 113.0, 63.8, 42.5, 30.7, 19.8, 14.1. 1.109 Compound 109 (B93) 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-benzamide (Compound 109) According to GP3 (step 5), starting from Compound 57, Compound 109 was isolated as a yellow oil (29 mg, 0.0584 mmol, 53%). C26H32N4O4S; MS (ESI+) m / z: 497 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.73 – 8.59 (m, 1H), 7.78 (d, J = 2.0 Hz, 1H), 7.39 (d, J = 2.1 Hz, 1H), 7.30 – 7.19 (m, 2H), 7.07 – 6.92 (m, 5H), 6.89 – 6.80 (m, 2H), 6.80 – 6.69 (m, 1H), 6.61 – 6.45 (m, 2H), 4.94 – 4.79 (m, 1H), 3.59 – 3.40 (m, 4H), 3.29 (s, 3H), 3.14 – 3.05 (m, 2H), 1.47 – 1.33 (m, 2H), 1.19 – 1.08 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 165.9 (2C), 156.6 (2C), 142.8, 138.6, 131.9, 129.3 (2C), 128.7 (2C), 123.1 (2C), 122.4, 120.7, 116.1 (2C), 114.7, 113.4, 71.0, 58.4, 42.6, 30.8, 19.8, 14.1 (+ 1C overlapping with DMSO signal). 1.110 Compound 110 (B119) 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2-difluoroethyl)-4-phenoxy-benzamide (Compound 110) According to GP3 (step 5), starting from Compound 57, Compound 110 was isolated as a purple oil (15.7 mg, 0.0306 mmol, 52%). C25H28F2N4O3S; MS (ESI+) m / z: 503 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.68 (d, J = 2.1 Hz, 1H), 7.45 (d, J = 2.1 Hz, 1H), 7.33 – 7.27 (m, 2H), 7.14 – 7.07 (m, 3H), 6.95 – 6.88 (m, 3H), 6.77 – 6.73 (m, 2H), 6.61 (t, J = 6.2 Hz, 1H), 5.97 (tt, J = 56.0, 4.1 Hz, 1H), 3.92 (s, 1H), 3.89 – 3.76 (m, 2H), 3.11 (t, J = 7.0 Hz, 2H), 1.46 – 1.38 (m, 2H), 1.22 – 1.10 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.111 Compound 111 (B120) 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2,2-trifluoroethyl)-4-phenoxy-benzamide (Compound 111) According to GP3 (step 5), starting from Compound 57, Compound 111 was isolated as a yellow oil (11.2 mg, 0.0204 mmol, 35%). C25H27F3N4O3S; MS (ESI+) m / z: 521 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.68 (d, J = 2.1 Hz, 1H), 7.49 – 7.47 (m, 1H), 7.33 – 7.28 (m, 1H), 7.15 – 7.07 (m, 3H), 6.96 – 6.88 (m, 3H), 6.77 – 6.73 (m, 2H), 6.65 (t, J = 6.5 Hz, 1H), 4.18 – 4.05 (m, 2H), 3.97 – 3.89 (m, 1H), 3.15 – 3.06 (m, 2H), 1.47 – 1.36 (m, 2H), 1.22 – 1.09 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 1.112 Compound 112 (B140) 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methyl-4-phenoxy-benzamide (Compound 112) According to GP3 (step 5), starting from Compound 72, Compound 112 was isolated as a grey solid (10 mg, 0.0197 mmol, 31%). C26H30N4O3S; MS (ESI+) m / z: 479 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.62 (d, J = 2.0 Hz, 1H), 7.44 (d, J = 2.0 Hz, 1H), 7.23 – 7.15 (m, 4H), 7.13 – 7.08 (m, 2H), 6.94 (t, J = 7.3 Hz, 1H), 6.83 – 6.77 (m, 2H), 6.32 – 6.23 (m, 1H), 4.69 – 4.57 (m, 4H), 3.86 (t, J = 5.2 Hz, 1H), 3.08 (q, J = 6.4 Hz, 2H), 3.01 (d, J = 4.8 Hz, 3H), 1.44 – 1.33 (m, 2H), 1.18 – 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 167.17, 156.07, 143.23, 138.95, 136.66, 134.20, 132.37, 129.93 (2C), 127.57 (2C), 123.22, 122.63 (2C), 114.97, 114.91 (3C), 114.50, 53.90 (2C), 43.18, 31.13, 27.06, 19.93, 13.76. 1.113 Compound 113 (B141) 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methoxy-4-phenoxy-benzamide (Compound 113) According to GP3 (step 5), starting from Compound 72, Compound 113 was isolated as a yellow oil (6 mg, 0.0116 mmol, 18%). C26H30N4O4S; MS (ESI+) m / z: 495 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 9.40 (s, 1H), 7.64 (d, J = 2.0 Hz, 1H), 7.38 (d, J = 2.0 Hz, 1H), 7.23 – 7.14 (m, 4H), 7.12 – 7.07 (m, 2H), 6.97 – 6.92 (m, 1H), 6.82 – 6.76 (m, 2H), 4.63 (s, 4H), 3.88 (s, 3H), 3.10 – 3.02 (m, 2H), 1.42 – 1.33 (m, 2H), 1.17 – 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 165.22, 155.96, 143.32, 139.41, 136.55 (2C), 134.30, 129.94 (2C), 127.59 (2C), 123.29 (2C), 122.62 (2C), 114.89 (3C), 64.74, 53.90 (2C), 43.16, 31.08, 19.90, 13.74. 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-(2-methoxyethyl)-4-phenoxy-benzamide (Compound 114) According to GP3 (step 5), starting from Compound 72, Compound 114 was isolated as a yellow oil (9.7 mg, 0.0182 mmol, 28%). C28H34N4O4S; MS (ESI+) m / z: 523 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.69 (d, J = 2.1 Hz, 1H), 7.42 (d, J = 2.1 Hz, 1H), 7.22 – 7.07 (m, 6H), 6.98 – 6.90 (m, 1H), 6.85 – 6.75 (m, 2H), 6.65 (t, J = 5.3 Hz, 1H), 4.71 – 4.56 (m, 4H), 3.85 (t, J = 5.1 Hz, 1H), 3.72 – 3.53 (m, 4H), 3.40 (s, 3H), 3.06 (q, J = 6.5 Hz, 2H), 1.44 – 1.32 (m, 2H), 1.19 – 1.06 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 166.69, 162.66, 156.05, 143.10, 138.98, 136.64 (2C), 134.40, 132.36, 129.90 (2C), 127.53 (2C), 123.20, 122.60 (2C), 114.99, 114.89 (2C), 71.17, 59.01, 53.86 (2C), 43.17, 40.11, 31.12, 19.92, 13.74. 1.115 Compound 115 (B143) 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (Compound 115) According to GP3 (step 5), starting from Compound 72, Compound 115 was isolated as a white solid (4.4 mg, 0.0076 mmol, 12%). C27H29F3N4O3S; MS (ESI+) m / z: 547 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.69 (d, J = 2.1 Hz, 1H), 7.44 (d, J = 2.1 Hz, 1H), 7.24 – 7.15 (m, 4H), 7.14 – 7.08 (m, 2H), 6.96 (t, J = 7.4 Hz, 1H), 6.82 – 6.78 (m, 2H), 6.63 (t, J = 6.6 Hz, 1H), 4.70 – 4.60 (m, 4H), 4.17 – 4.07 (m, 2H), 3.89 (t, J = 5.4 Hz, 1H), 3.07 (q, J = 6.6 Hz, 2H), 1.43 – 1.33 (m, 2H), 1.17 – 1.07 (m, 2H), 0.78 (t, J = 7.4 Hz, 3H). 1.116 Compound 116 (B144) 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methyl-4-phenoxy-benzamide (Compound 116) According to GP3 (step 5), starting from Compound 71, Compound 116 was isolated as a white solid (7.6 mg, 0.0141 mmol, 21%). C25H29ClN4O3S; MS (ESI+) m / z: 501 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.00 (s, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.47 (d, J = 2.1 Hz, 1H), 7.31 – 7.26 (m, 2H), 7.21 – 7.11 (m, 3H), 7.06 (t, J = 7.4 Hz, 1H), 7.03 – 6.99 (m, 1H), 6.89 – 6.85 (m, 2H), 6.37 – 6.28 (m, 1H), 4.12 – 3.89 (m, 2H), 3.86 (s, 1H), 3.11 (t, J = 7.0 Hz, 2H), 3.03 (d, J = 4.9 Hz, 3H), 1.48 – 1.37 (m, 2H), 1.23 – 1.13 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 167.06, 155.86, 142.96, 138.89, 138.57, 134.47, 134.33, 132.55, 130.21 (2C), 129.86, 128.14, 127.94, 126.11, 123.72, 115.29, 115.17 (2C), 113.99, 47.64, 43.21, 31.19, 27.09, 19.99, 13.80. 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methoxy-4-phenoxy-benzamide (Compound 117) According to GP3 (step 5), starting from Compound 71, Compound 117 was isolated as a yellow oil (7.7 mg, 0.0149 mmol, 22%). C25H29ClN4O4S; MS (ESI+) m / z: 517 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 9.60 (s, 1H), 7.55 (s, 1H), 7.39 (d, J = 1.9 Hz, 1H), 7.31 – 7.23 (m, 2H), 7.20 – 7.12 (m, 2H), 7.11 – 7.09 (m, 1H), 7.08 – 7.03 (m, 1H), 7.02 – 6.98 (m, 1H), 6.88 – 6.83 (m, 2H), 4.12 – 3.89 (m, 2H), 3.89 (s, 3H), 3.13 – 3.06 (m, 2H), 1.47 – 1.37 (m, 2H), 1.23 – 1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 165.02, 162.72, 155.77, 143.03, 138.97, 138.88, 134.43, 130.21 (2C), 129.84, 128.11, 127.91, 126.13, 123.75, 115.16 (2C), 115.10, 114.24, 64.70, 47.62 (2C), 43.18, 31.14, 19.96, 13.78. 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-(2-methoxyethyl)-4-phenoxy- benzamide (Compound 118) According to GP3 (step 5), starting from Compound 71, Compound 118 was isolated as a colourless oil (9.7 mg, 0.0169 mmol, 25%). C27H33ClN4O4S; MS (ESI+) m / z: 545 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.61 (d, J = 2.0 Hz, 1H), 7.46 (d, J = 2.1 Hz, 1H), 7.32 – 7.26 (m, 2H), 7.19 – 7.15 (m, 2H), 7.13 – 7.10 (m, 1H), 7.09 – 7.05 (m, 1H), 7.05 – 7.00 (m, 1H), 6.90 – 6.85 (m, 2H), 6.62 (t, J = 5.3 Hz, 1H), 4.13 – 3.88 (m, 2H), 3.87 (t, J = 5.3 Hz, 1H), 3.71 – 3.63 (m, 2H), 3.61 – 3.56 (m, 2H), 3.41 (s, 3H), 3.11 (q, J = 6.4 Hz, 2H), 1.48 – 1.38 (m, 2H), 1.23 – 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 166.51, 155.87, 142.86, 138.95, 138.59, 134.48, 132.56, 130.21 (2C), 129.85, 128.12, 127.92, 126.14, 123.71, 115.30, 115.18 (2C), 114.23, 71.17, 59.03, 47.72, 43.22, 40.14, 31.19, 19.99, 13.80. 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-N-(2,2,2- trifluoroethyl)benzamide (Compound 119) According to GP3 (step 5), starting from Compound 71, Compound 119 was isolated as a yellow oil (2.7 mg, 0.0047 mmol, 7%). C26H28ClF3N4O3S; MS (ESI+) m / z: 569 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.64 – 7.61 (m, 1H), 7.48 – 7.45 (m, 1H), 7.31 – 7.27 (m, 2H), 7.19 – 7.13 (m, 2H), 7.12 – 7.11 (m, 1H), 7.10 – 7.05 (m, 1H), 7.04 – 7.00 (m, 1H), 6.87 (d, J = 21.7 Hz, 2H), 6.81 (t, J = 5.8 Hz, 1H), 4.19 – 4.09 (m, 2H), 4.10 – 3.92 (m, 2H), 3.90 (t, J = 5.4 Hz, 1H), 3.11 (q, J = 6.6 Hz, 2H), 1.48 – 1.38 (m, 2H), 1.22 – 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 166.43, 161.65, 155.76, 143.05, 139.19, 138.78, 134.49, 131.03, 130.26 (2C), 129.86, 128.13, 127.97, 126.15, 123.85, 115.42, 115.19 (2C), 114.10, 47.74, 43.19, 41.52, 41.17, 31.14, 19.97, 13.78. 1.120 Compound 120 (B148) 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-N-(3,3,3-trifluoropropyl)benzamide (Compound 120) According to GP3 (step 5), starting from Compound 57, Compound 120 was isolated as a colourless oil (9 mg, 0.0152 mmol, 19%). C26H29F3N3O3S; MS (ESI+) m / z: 535 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.63 (d, J = 2.1 Hz, 1H), 7.44 (d, J = 2.1 Hz, 1H), 7.33 – 7.27 (m, 2H), 7.15 – 7.06 (m, 3H), 6.97 – 6.86 (m, 3H), 6.77 – 6.71 (m, 2H), 6.59 (t, J = 6.2 Hz, 1H), 3.91 (t, J = 5.2 Hz, 1H), 3.71 (q, J = 6.5 Hz, 2H), 3.11 (q, J = 6.6 Hz, 2H), 2.56 – 2.41 (m, 2H), 1.47 – 1.36 (m, 2H), 1.22 – 1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 166.58, 155.68, 142.93, 138.70, 136.03, 131.88, 130.27, 130.13 (2C), 128.99 (2C), 123.70, 123.21 (2C), 123.02, 115.38 (2C), 115.19, 113.28, 43.18, 33.92, 33.65, 31.12, 19.94, 13.77. 1.121 121 3-(butylamino)-N-methoxy-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzamide (Compound 121) According to GP3 (step 5), starting from Compound 75, Compound 121 was isolated as a yellow oil (9 mg, 0.0105 mmol, 27%). C23H32N4O5S; MS (ESI+) m / z: 477 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 9.46 (s, 1H), 7.56 (s, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.33 – 7.28 (m, 2H), 7.12 – 7.06 (m, 1H), 6.92 – 6.87 (m, 2H), 3.89 (s, 3H), 3.88 – 3.75 (m, 2H), 3.41 – 3.23 (m, 3H), 3.15 – 3.06 (m, 2H), 1.79 – 1.71 (m, 1H), 1.57 – 1.51 (m, 1H), 1.46 – 1.26 (m, 4H), 1.19 – 1.10 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 155.74, 143.07, 139.07, 136.16, 130.20 (3C), 123.78 (2C), 115.33 (3C), 113.77, 66.69, 66.49, 64.60, 50.77, 43.18, 34.22, 33.72, 31.09, 19.93, 13.76. 1.122 Compound 122 (B150) 3-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzamide (Compound 122) According to GP3 (step 5), starting from Compound 75, Compound 122 was isolated as a yellow oil (6.3 mg, 0.0125 mmol, 32%). C25H36N4O5S; MS (ESI+) m / z: 505 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.62 (d, J = 2.1 Hz, 1H), 7.46 (d, J = 1.8 Hz, 1H), 7.33 – 7.28 (m, 2H), 7.09 (t, J = 7.4 Hz, 1H), 6.90 (d, J = 8.1 Hz, 2H), 6.65 (t, J = 5.2 Hz, 1H), 3.92 – 3.75 (m, 2H), 3.73 – 3.52 (m, 4H), 3.40 (s, 3H), 3.40 – 3.24 (m, 3H), 3.16 – 3.06 (m, 2H), 1.79 (d, J = 13.1 Hz, 1H), 1.54 (d, J = 13.1 Hz, 1H), 1.47 – 1.26 (m, 4H), 1.21 – 1.10 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 166.60, 155.87, 142.85, 138.67, 132.59, 130.16 (2C), 123.68 (2C), 115.35 (2C), 115.20, 113.71, 71.15, 66.73, 66.51, 59.02, 50.74, 43.20, 40.13, 34.31, 33.71, 31.14, 19.94, 13.77. 1.123 123 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]-N-(2,2,2- trifluoroethyl)benzamide (Compound 123) According to GP3 (step 5), starting from Compound 75, Compound 123 was isolated as a yellow oil (5 mg, 0.0105 mmol, 27%). C24H31F3N4O4S; MS (ESI+) m / z: 529 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.66 (d, J = 2.1 Hz, 1H), 7.47 (d, J = 2.0 Hz, 1H), 7.35 – 7.28 (m, 2H), 7.13 – 7.07 (m, 2H), 6.91 – 6.87 (m, 2H), 4.13 – 4.05 (m, 1H), 3.93 – 3.76 (m, 3H), 3.42 – 3.24 (m, 3H), 3.11 (q, J = 6.6 Hz, 2H), 1.77 (d, J = 13.1 Hz, 1H), 1.56 (d, J = 12.9 Hz, 1H), 1.48 – 1.27 (m, 4H), 1.19 – 1.10 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 166.58, 155.73, 142.98, 132.19, 130.19 (2C), 128.58, 123.78 (2C), 115.30 (3C), 113.66, 66.69, 66.49, 64.57, 50.80, 43.17, 38.75, 34.29, 33.72, 31.09, 19.92, 13.75. 3 – Synthetic scheme for the synthesis of compounds 124 to 127

[0005] Step 1: methyl 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoate (Compound 124) To a stirred solution of Int01 (2.00 g, 3.28 mmol, 1 eq.) in dry acetonitrile (16.4 mL, 0.2 M) were added potassium carbonate (1.13 g, 8.19 mmol, 2.5 equiv.), copper(I) iodide (62 mg, 0.328 mmol, 0.1 equiv.), N,N'-dimethylethylenediamine (176 µL, 1.64 mmol, 0.5 equiv.). The solution was degassed under Argon and sonication then, bromobenzene (412 µL, 3.93 mmol, 1.20 equiv.) was added at 20°C. The reaction vessel was flushed with Argon, sealed and stirred at 80°C for 16 hours. The reaction was cooled down to 20°C and filtered over a pad of celite to give a crude that was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 100 / 0 to 40 / 60 over 10 CV) to afford Compound 124 (1.45 g, 3.2 mmol, 97%) as a white solid C24H26N2O5S; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 10.24 (s, 1H), 7.69 (d, J = 2.0 Hz, 1H), 7.39 (d, J = 2.0 Hz, 1H), 7.32 – 7.16 (m, 4H), 7.08 – 6.97 (m, 4H), 6.82 – 6.77 (m, 2H), 5.10 (t, J = 5.6 Hz, 1H), 3.86 (s, 3H), 3.00 (q, J = 6.5 Hz, 2H), 1.36 – 1.24 (m, 2H), 1.09 – 0.98 (m, 2H), 0.73 (t, J = 7.3 Hz, 3H). Step 2: 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoic acid (Compound 125) To a stirred solution of Compound 124 (1.45 g, 3.2 mmol, 1 equiv.) in a mixture of THF / MeOH / Water 1 / 1 / 1 (30 mL, 0.1 M) was added LiOH monohydrate (270 mg, 6.4 mmol, 2 equiv.). The resulting mixture was stirred at 20°C for 36 hours. The mixture was acidified with an aqueous solution of HCl 1N until pH = 2-3. The aqueous layer was extracted with EtOAc and the resulting organic layer was dried over Na2SO4, filtrated, and concentrated under reduced pressure to afford Compound 125 (1.3 g, 2.95 mmol, 92%) as a white solid. C23H24N2O5S; MS (ESI+) m / z: 441 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.21 (s, 1H), 10.21 (s, 1H), 7.69 (d, J = 2.0 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.28 – 7.18 (m, 4H), 7.08 – 6.97 (m, 4H), 6.82 – 6.78 (m, 2H), 5.03 (t, J = 5.7 Hz, 1H), 3.00 (q, J = 6.5 Hz, 2H), 1.37 – 1.26 (m, 2H), 1.09 – 0.98 (m, 2H), 0.73 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 166.8, 156.5, 142.9, 140.5, 138.1, 134.1, 129.6 (2C), 129.5 (2C), 128.8, 124.0, 122.9, 119.7 (2C), 117.2, 116.2, 116.2 (2C), 42.4, 30.5, 19.7, 14.0. Step 3: 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzamide (Int03) To a stirred solution of Compound 125 (283 mg, 0.565 mmol, 1 equiv.) in CH3CN (5.6 mL, 0.1 M) was added CDI (101 mg, 0.622 mmol, 1.1 equiv.). The resulting mixture was stirred at 50°C for 1 hour. After cooling at 20°C, a 28% aqueous solution of ammonium hydroxide (90 µL, 0.622 mmol, 1.1 equiv.) was added. The reaction mixture was stirred at 20°C for 16 hours. The reaction mixture was concentrated under reduced pressure and the crude was purified by automated flash chromatography with DCM / MeOH (gradient from 100 / 0 to 90 / 10 over 13 CV) to afford Int03 (234 mg, 0.533 mmol, 94%) as a yellow oil. C23H25N3O4S; MS (ESI+) m / z: 440 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 10.13 (s, 1H), 8.12 (s, 1H), 7.67 (d, J = 2.1 Hz, 1H), 7.43 (s, 1H), 7.39 (d, J = 2.0 Hz, 1H), 7.29 – 7.15 (m, 4H), 7.08 – 6.93 (m, 4H), 6.84 – 6.76 (m, 2H), 4.83 (t, J = 5.7 Hz, 1H), 3.01 (q, J = 6.6 Hz, 2H), 1.37 – 1.23 (m, 2H), 1.15 – 0.98 (m, 2H), 0.73 (t, J = 7.3 Hz, 3H). Step 4: 3-(butylamino)-5-cyano-2-phenoxy-N-phenyl-benzenesulfonamide (Int04) To a stirred solution of Int03 (180 mg, 0.315 mmol, 1 equiv.) in CH3CN (1.8 mL, 0.18 M) were added dry pyridine (25 µL, 0.315 mmol, 1 equiv.) and TFAA (44 µL, 0.315 mmol, 1 equiv.). The resulting mixture was stirred at 20°C for 4 hours. The reaction mixture was concentrated under reduced pressure and the crude was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 100 / 0 to 40 / 60 over 10 CV) to afford Int04 (135 mg, 0.266 mmol, 84%) as a colourless oil. C23H23N3O3S; MS (ESI+) m / z: 422 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 10.31 (s, 1H), 7.41 – 7.35 (m, 2H), 7.29 – 7.20 (m, 4H), 7.08 – 7.00 (m, 4H), 6.82 – 6.77 (m, 2H), 5.35 (t, J = 5.7 Hz, 1H), 3.00 (q, J = 6.6 Hz, 2H), 1.33 – 1.24 (m, 2H), 1.08 – 0.96 (m, 2H), 0.72 (t, J = 7.3 Hz, 3H). Step 5: 3-(butylamino)-2-phenoxy-N-phenyl-5-(1H-tetrazol-5-yl)benzenesulfonamide (Compound 126) To a stirred solution of Int04 (50 mg, 0.120 mmol, 1 equiv.) in DMF (2 mL, 0.06 M) were added sodium azide (32 mg, 0.498 mmol, 4.5 equiv.) and ammonium chloride (25 mg, 0.468 mmol, 3.9 equiv.). The resulting mixture was stirred at 120°C for 4 hours. After cooling at 20°C the reaction mixture was diluted with EtOAc and washed with brine, the organic layer was dried over Na2SO4, filtrated, and concentrated under reduced pressure to afford Compound 126 (51 mg, 0.110 mmol, 91%) as an off-white solid. C23H24N6O3S; MS (ESI+) m / z: 465 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 10.10 (s, 1H), 7.81 (d, J = 1.8 Hz, 1H), 7.53 (d, J = 1.9 Hz, 1H), 7.28 – 7.15 (m, 5H), 7.10 – 7.05 (m, 2H), 7.03 – 6.93 (m, 2H), 6.85 – 6.81 (m, 2H), 4.75 (t, J = 5.7 Hz, 1H), 3.02 (q, J = 6.6 Hz, 2H), 1.39 – 1.30 (m, 2H), 1.14 – 1.03 (m, 2H), 0.75 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 159.20, 156.68, 142.21, 137.97, 136.04, 133.48, 128.97 (2C), 128.87 (3C), 123.15, 121.99, 118.92 (2C), 115.62 (2C), 113.53, 112.74, 42.14, 30.27, 19.28, 13.58. Step 6: 3-(butylamino)-N-hydroxy-4-phenoxy-5-(phenylsulfamoyl)benzamidine (Int05) To a stirred solution of Int04 (135 mg, 0.266 mmol, 1 equiv.) in EtOH (3 mL, 0.09 M) was added a solution of hydroxylamine hydrochloride (37 mg, 0.532 mmol, 2 equiv.) in a 1M aqueous solution of NaHCO3 (800 µL, 3 equiv.), the resulting white suspension was stirred at 80°C for 4 hours. The reaction mixture was cooled down to 20°C and poured into water. The organic layer was extracted twice with EtOAc. The combined organic layers were concentrated under reduced pressure to give Int05 (116 mg, 0.255 mmol, 96%) as an off-white solid. C23H26N4O4S; MS (ESI+) m / z: 455 [M+H]+. Step 7: 3-(butylamino)-5-(5-oxo-2H-1,2,4-oxadiazol-3-yl)-2-phenoxy-N-phenyl-benzenesulfonamide (Compound 127) To a stirred solution of Int05 (116 mg, 0.255 mmol, 1 equiv.) in dioxane (2.5 mL, 0.1 M) were added DBU (42 µL, 0.280 mmol, 1.10 equiv.) and CDI (58 mg, 0.383 mg, 1.5 eq.). The resulting solution was stirred at 100°C for 16 hours. The reaction mixture was concentrated under reduced pressure and the crude was purified by automated flash chromatography with DCM / MeOH (gradient from 100 / 0 to 90 / 10 over 10 CV) to afford Compound 127 (62 mg, 0.129 mmol, 51%) as a yellow oil. C24H24N4O5S; MS (ESI+) m / z: 481 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.08 (s, 1H), 10.26 (s, 1H), 7.61 (d, J = 2.0 Hz, 1H), 7.30 – 7.18 (m, 5H), 7.09 – 6.98 (m, 4H), 6.84 – 6.79 (m, 2H), 5.20 (t, J = 5.7 Hz, 1H), 3.01 (q, J = 6.6 Hz, 2H), 1.37 – 1.28 (m, 2H), 1.10 – 1.00 (m, 2H), 0.74 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO-d6): δ 160.37, 157.10, 156.02, 142.92, 139.07, 137.50, 134.35, 129.04 (2C), 128.99 (2C), 123.54, 122.43, 121.22, 119.16 (2C), 115.70 (2C), 112.93, 112.54, 41.90, 29.98, 19.20, 13.54. 4 – Synthetic scheme for the synthesis of compound 128 to 135 Step 1: 4-chloro-3-chlorosulfonyl-5-nitro-benzoic acid (Int06) To a solution of 4-chloro-3-chlorosulfonyl-benzoic acid (CAS 2494-79-3) (1.4 g, 5.49 mmol, 1 equiv.) diluted in concentrated sulfuric acid (4.4 mL, 82.33 mmol, 15 equiv.) was added KNO3 (555 mg, 5.79 mmol, 1 equiv.) at 0°C, the resulting yellow suspension was stirred at 100°C for 16 hours. During the temperature ramping up, suspension dissolved. The reaction mixture was poured in 20 mL ice / water and extracted with EtOAc, the combined organic layers were dried over Na2SO4, filtrated and concentrated under reduced pressure to afford Int06 (793 mg, 2.64 mmol, 48%) as a white solid. C7H3Cl2NO6S; 1H NMR (400 MHz, DMSO-d6): δ 8.63 (d, J = 2.1 Hz, 1H), 8.37 (d, J = 2.1 Hz, 1H). Step 2: 4-chloro-3-nitro-5-sulfanyl-benzoic acid (Int07) To a solution of Int06 (2 g, 6.66 mmol, 1 equiv.) diluted in toluene (66.6 mL, 0.1 M) was added triphenylphosphine (5.25 g, 20 mmol, 3 equiv.) at 20°C, the resulting yellow suspension was stirred at 20°C for 1 hour. Water was added and stirring was continued for 1 hour. Addition of 1M NaOH and phase separation. The organic layer was washed twice with NaOH 1M. The aqueous layer was acidified to pH 3 with HCl 2M filtration of the suspension, solid washed once with water and air dried to afford Int07 (400 mg, 1.54 mmol, 23%) as a white solid. C7H4ClNO4S; MS (ESI+) m / z: 232 [M-1]-; 1H NMR (400 MHz, DMSO-d6): δ 8.55 (d, J = 1.7 Hz, 1H), 8.45 (s, 2H), 8.33 (d, J = 1.7 Hz, 1H). Step 3: methyl 4-chloro-3-methylsulfanyl-5-nitro-benzoate (Int08) To a solution of Int07 (400 mg, 1.71 mmol, 1 equiv.) diluted in DMF (11 mL, 0.15 M) were added K2CO3(710 mg, 5.14 mmol, 3 equiv.) and MeI (234 µL, 3.77 mmol, 2.2 equiv.) at 20°C, the resulting yellow suspension was stirred at 20°C for 16 hours. The reaction mixture was poured into water and extracted with EtOAc, the combined organic layers were dried over Na2SO4, filtrated and concentrated under reduced pressure to afford Int08 (220 mg, 0.80 mmol, 47%) as a yellow solid. C9H8ClNO4S; MS (ESI+) m / z: 262, 264 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.26 (d, J = 1.8 Hz, 1H), 7.95 (d, J = 1.8 Hz, 1H), 3.93 (s, 3H), 2.67 (s, 3H). Step 4: methyl 3-methylsulfanyl-5-nitro-4-phenoxy-benzoate (Int09) To a solution of Int08 (90 mg, 0.34 mmol, 1 equiv.) diluted in DMF (3 mL, 0.1 M) were added phenol (35.6 mg, 0.38 mmol, 1.1 equiv.) and K2CO3 (95 mg, 0.70 mmol, 2 equiv.) at 20°C, the resulting yellow suspension was stirred at 100°C for 4 hours. The reaction mixture was poured into water and extracted with EtOAc, the combined organic layers were dried over Na2SO4, filtrated and concentrated under reduced pressure. The crude oil was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 100 / 0 to 1 / 1 over 10 CV) to afford Int09 (64 mg, 0.2 mmol, 60%) as a yellow solid. C15H13NO5S; MS (ESI+) m / z: 320 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.32 (d, J = 2.0 Hz, 1H), 8.10 (d, J = 2.0 Hz, 1H), 7.38-7.31 (m, 2H), 6.91-6.87 (m, 2H), 6.80 – 6.71 (m, 1H), 3.95 (s, 3H), 2.54 (s, 3H). Step 5: methyl 3-(methylsulfonimidoyl)-5-nitro-4-phenoxy-benzoate (Int10) To a solution of Int09 (270 mg, 0.85 mmol, 1.00 equiv.) diluted in MeOH (8 mL, 0.1 M) and CH2Cl2(2 mL) were added ammonium carbamate (264 mg, 3.38 mmol, 4 equiv.) and (diacetoxyiodo)benzene (817 mg, 2.54 mmol, 3 equiv.) at 20°C, the resulting yellow suspension was stirred at 20°C for 2 hours. The reaction mixture was concentrated under reduced pressure and then purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 9 CV) to afford Int10 (276 mg, 0.75 mmol, 89%) as a yellow solid. C15H14N2O6S; MS (ESI+) m / z: 351 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.82 (d, J = 2.2 Hz, 1H), 8.70 (d, J = 2.2 Hz, 1H), 7.37-7.31 (m, 2H), 7.19–7.08 (m, 1H), 7.01–6.91 (m, 2H), 4.92 (d, J = 1.4 Hz, 1H), 3.97 (s, 3H), 3.28 (d, J = 1.4 Hz, 3H). Step 6 and Step 7: methyl 3-(butylamino)-5-(N-butyl-S-methyl-sulfonimidoyl)-4-phenoxy-benzoate (Compound 128) methyl 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxy-benzoate (Compound 129) To a stirred solution of Int10 (276 mg, 0.75 mmol, 1.00 equiv.) in MeOH (7.5 mL, 0.1 M) was added under Argon, Palladium 10% sur charcoal (80 mg, 0.07 mmol, 0.100 equiv.), the resulting black suspension was stirred under 1 atmosphere H2 at 20°C for 16 hours. The reaction mixture was filtered over celite and the filtrate was concentrated under reduced pressure to give Int11. Step 7: Int11 as a crude oil was taken up in 1,2-dichloroethane (7.5 mL, 0.1 M) and treated with butyraldehyde (276 µL, 2.99 mmol, 4.00 equiv.) and sodium triacetoxyborohydride (280 mg, 1.49 mmol, 2.00 equiv.), the resulting yellow suspension was stirred at 20°C for 4 hours. Addition of water to the reaction mixture and extraction with CH2Cl2. The organic layer was dried over Na2SO4, filtered and concentrated under reduced pressure. The crude oil was purified by preparative TLC with CH2Cl2 / MeOH 95 / 5 to afford: Compound 128 (3 mg, 0.007 mmol, 1%) as a yellow oil. C23H32N2O4S; MS (ESI+) m / z: 433 [M+H]+ Compound 129 (13 mg, 0.03 mmol, 19%) as a yellow oil. C19H24N2O4S; MS (ESI+) m / z: 377 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 7.93 (d, J = 2.0 Hz, 1H), 7.52 (d, J = 2.0 Hz, 1H), 7.29–7.18 (m, 2H), 7.00 (t, J = 7.4 Hz, 1H), 6.79 (d, J = 8.1 Hz, 2H), 3.87 (s, 3H), 3.13 (s, 3H), 3.8–3.01 (m, 2H), 1.44–1.31 (m, 2H), 1.17–1.03 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). Step 8: 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 130) To a stirred solution of Compound 129 (13 mg, 0.03 mmol, 1 equiv.) in THF (690 µL, 0.05 M) was added a 2M aqueous solution of sodium hydroxide (104 µL, 0.18 mmol, 6 equiv.) at 20°C, the resulting solution was stirred at 20°C for 16 hours. THF was removed and the mixture was diluted in water (5 mL). The aqueous layer was washed with EtOAc and was acidified with HCl 1N until pH = 2-3. The aqueous layer was extracted with EtOAc and the resulting organic layer was dried over Na2SO4, filtrated and concentrated under reduced pressure to afford Compound 130 (2 mg, 0.005 mmol, 14%) as a yellow oil. C18H22N2O4S; MS (ESI+) m / z: 363 [M+H]+, MS (ESI-) m / z: 361 [M-H]-; 1H NMR (400 MHz, CD3CN) δ 7.87 (d, J = 2.0 Hz, 1H), 7.58 (d, J = 2.0 Hz, 1H), 7.39–7.28 (m, 2H), 7.14–7.06 (m, 1H), 6.93–6.86 (m, 2H), 4.37 (brs, 1H), 3.19 (s, 3H), 3.14 (t, J = 7.0 Hz, 2H), 1.99 (s, 1H), 1.49–1.38 (m, 2H), 1.24–1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H). Step 9: 3-(butylamino)-5-(N-butyl-S-methyl-sulfonimidoyl)-4-phenoxy-benzoic acid (Compound 131) To a stirred solution of Compound 128 (3 mg, 0.007 mmol, 1 equiv.) in THF (140 µL, 0.05 M) was added a 2M aqueous solution of sodium hydroxide (21 µL, 0.042 mmol, 6 equiv.) at 20°C, the resulting solution was stirred at 20°C for 16 hours. THF was removed and the mixture was diluted in water (1 mL). The aqueous layer was washed with EtOAc and was acidified with HCl 1N until pH = 2-3. The aqueous layer was extracted with EtOAc and the resulting organic layer was dried over Na2SO4, filtrated and concentrated under reduced pressure to afford Compound 131 (2 mg, 0.005 mmol, 80%) as a yellow oil. C22H30N2O4S; MS (ESI+) m / z: 419 [M+H]+; 1H NMR (400 MHz, Acetonitrile-d3) δ 7.82 (d, J = 2.0 Hz, 1H), 7.58 (d, J = 2.0 Hz, 1H), 7.32 (dd, J = 8.7, 7.3 Hz, 2H), 7.14 – 7.04 (m, 1H), 6.86 (dt, J = 7.8, 1.1 Hz, 2H), 4.41 (s, 1H), 3.15 (s, 3H), 2.85 – 2.72 (m, 1H), 2.48 – 2.37 (m, 1H), 1.54 – 1.38 (m, 2H), 1.34 – 1.09 (m, 6H), 1.08 – 0.94 (m, 1H), 0.91 – 0.73 (m, 6H). Step 10: methyl 3-(N,S-dimethylsulfonimidoyl)-5-nitro-4-phenoxy-benzoate (Int11) A solution of Int10 (249 mg, 0.618 mmol, 1 equiv.) diluted in a 37% aqueous solution of formaldehyde (54 mL, 33.3 mmol, 54 equiv.) and formic acid (10 mL, 264 mmol, 430 equiv.) was stirred at 100°C for 48 hours. The reaction mixture was concentrated under reduced pressure and the crude was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 100 / 0 to 0 / 100 over 10 CV) to afford Int11 (129 mg, 0.354 mmol, 57%) as a yellow solid. C16H16N2O6S; MS (ESI+) m / z: 365 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.76 – 8.70 (m, 2H), 7.36 – 7.31 (m, 2H), 7.15 – 7.09 (m, 1H), 6.99 – 6.94 (m, 2H), 3.97 (s, 3H), 3.35 (s, 3H), 2.35 (s, 3H). Step 11: methyl 3-amino-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoate (Compound 132) To a solution of Int11 (124 mg, 0.313 mmol, 1 equiv.) diluted in a 1 / 2 mixture of water and Ethanol (1 mL / 2 mL, 0.1 M) was added ammonium chloride (167 mg, 3.13 mmol, 10 equiv.), the resulting solution was stirred at 85°C then, iron powder (70 mg, 1.25 mmol, 4 equiv.) was added and the resulting grey suspension was stirred at 85°C for 16 hours. The reaction mixture was filtered over a pad of celite, the filtrate was concentrated under reduced pressure and the crude was purified by automated flash chromatography with DCM / MeOH (gradient from 100 / 0 to 90 / 10 over 10 CV) to afford Compound 132 (25 mg, 0.075 mmol, 24%) as a white solid. C16H18N2O4S; MS (ESI+) m / z: 335 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.10 (d, J = 2.0 Hz, 1H), 7.72 (d, J = 2.0 Hz, 1H), 7.34 – 7.28 (m, 2H), 7.15 – 7.02 (m, 1H), 6.93 – 6.84 (m, 2H), 3.94 (s, 3H), 3.22 (s, 3H), 2.44 (s, 3H). Step 12: methyl 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoate (Compound 133) To a solution of Compound 132 (23 mg, 0.065 mmol, 1 equiv.) diluted in MeOH (300 µL, 0.25 M) were added butyraldehyde (6.5 µL, 0.072 mmol, 1.1 equiv.), acetic acid (3.7 µL, 0.065 mmol, 1 equiv.) and sodium cyanoborohydride (6.6 mg, 0.104 mmol, 1.6 equiv.) the resulting solution was stirred at 20°C for 1 hour. The reaction was quenched with an aqueous solution of NaOH 1M. The organic layer was extracted with AcOEt, washed with brine, dried with Na2SO4, filtered and concentrated under reduced pressure. The crude oil was purified by automated flash chromatography with DCM / MeOH (gradient from 100 / 0 to 90 / 10 over 10 CV) to afford Compound 133 (13 mg, 0.033 mmol, 51%) as a yellow oil. C20H26N2O4S; MS (ESI+) m / z: 391 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.00 (s, 1H), 7.60 (s, 1H), 7.29 (t, J = 7.9 Hz, 2H), 7.06 (t, J = 7.3 Hz, 1H), 6.84 (d, J = 8.0 Hz, 2H), 3.95 (s, 3H), 3.19 (s, 3H), 3.17 – 3.11 (m, 2H), 2.43 (s, 3H), 1.51 – 1.41 (m, 2H), 1.25 – 1.16 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H). Step 13: 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 134) To a solution of Compound 133 (7 mg, 0.013 mmol, 1 equiv.) diluted in THF / MeOH / H2O (100 µL / 100 µL / 100 µL, 0.03 M) was added lithium hydroxide monohydrate (1.1 mg, 0.052 mmol, 4 equiv.). After 4 hours at 20°C the mixture was diluted in water (1 mL). The aqueous layer was washed with EtOAc then it was acidified with HCl 1N until pH = 2-3. The aqueous layer was extracted with EtOAc and the resulting organic layer was dried over Na2SO4, filtrated and concentrated under reduced pressure to afford Compound 134 (3 mg, 0.008 mmol, 61%) as a yellow oil. C19H24N2O4S; MS (ESI+) m / z: 377 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.78 – 7.70 (m, 1H), 7.55 (s, 1H), 7.33 – 7.24 (m, 2H), 7.02 (t, J = 7.3 Hz, 1H), 6.79 (d, J = 8.0 Hz, 2H), 4.96 – 4.82 (m, 1H), 3.13 (s, 3H), 3.11 – 3.04 (m, 2H), 2.19 (s, 3H), 1.46 – 1.36 (m, 2H), 1.20 – 1.12 (m, 2H), 0.80 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO) δ 162.3, 156.6 (2C), 142.6, 132.5, 129.7 (2C), 122.6, 118.7, 118.5, 116.6, 115.5 (2C), 43.6, 42.7, 30.9, 29.7, 19.9, 14.1. Step 14: 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzamide (Int12) To a solution of Compound 134 (140 mg, 0.346 mmol, 1 equiv.) diluted in acetonitrile (3.5 mL, 0.1 M) was added CDI (62 mg, 0.380 mmol, 1.1 equiv.) at 20°C. The resulting solution was stirred at 50°C for 1 hour, then at 20°C a 28% aqueous solution ammonium hydroxide (58 µL, 0.415 mmol, 1.20 eq.) was added and the resulting suspension was stirred at 20°C for 4 hours. The reaction mixture was concentrated under reduced pressure and the crude was purified by automated flash chromatography with DCM / MeOH (gradient from 100 / 0 to 90 / 10 over 10 CV) to afford Int12 (70 mg, 0.186 mmol, 50%) as a yellow oil. C19H25N3O3S; MS (ESI+) m / z: 376 [M+H]+. Step 15: 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzonitrile (Int13) To a solution of Int12 (70 mg, 0.186 mmol, 1 equiv.) diluted in dry 1,4-dioxane (0.8 mL, 0.2 M) in a flame dried vial under Ar were added dropwise pyridine (15 µL, 0.190 mmol, 1.20 equiv.) then trifluoroacetic anhydride (22 µL, 0.158 mmol, 1 equiv.) at 20°C. The same quantities of pyridine and TFAA were added again each 30 minutes till complete conversion. The reaction mixture was purified by preparative TLC eluted with CyHex / EA 1 / 1 to afford Int13 (14 mg, 0.038 mmol, 21%) as a yellow oil. C19H23N3O2S; MS (ESI+) m / z: 358 [M+H]+. Step 16: N-butyl-3-(N,S-dimethylsulfonimidoyl)-2-phenoxy-5-(1H-tetrazol-5-yl)aniline (Compound 135) To a solution of Int13 (14 mg, 0.038 mmol, 1 equiv.) diluted in N,N-dimethylformamide (0.8 mL, 0.0500 M) were added ammonium chloride (8.1 mg, 0.152 mmol, 4 equiv.) and sodium azide (7.4 mg, 0.114 mmol, 3 equiv.) at 20°C. The resulting white suspension was stirred at 120°C for 5 hours. Reaction mixture was concentrated under reduced pressure, taken up in EtOAc, washed with water, aqueous layer was extracted 3 times with EtOAc then twice with CHCl3 / iPrOH 8 / 2. Organic layers were dried over MgSO4, filtered and concentrated under reduced pressure to afford Compound 135 (5 mg, 0.038 mmol, 33%) as a yellow oil. C19H24N6O2S; MS (ESI+) m / z: 401 [M+H]+; 1H NMR (400 MHz, Methanol-d4) δ 7.94 (s, 1H), 7.76 (s, 1H), 7.39 – 7.28 (m, 2H), 7.18 – 7.05 (m, 1H), 6.94 (d, J = 8.0 Hz, 2H), 3.27 – 3.20 (m, 2H), 2.42 (s, 3H), 1.59 – 1.49 (m, 2H), 1.31 (s, 3H), 1.28 – 1.21 (m, 2H), 0.90 – 0.81 (m, 3H). 13C NMR (101 MHz, Methanol-d4) δ 156.1, 143.8, 138.5, 132.2, 129.3 (2C), 124.1, 122.7, 115.5, 114.9 (2C), 113.7, 42.4, 42.2, 30.6, 29.4, 28.4, 19.6, 12.6.

[0006] 3 – Analytical data table Table 2. Analytical data table.

[0007] 4 – Biological Protocols The compounds of the invention have been tested for evaluating their potency in inhibiting the NKCC1 channel. The test used is a cellular assay expressing the NKCC1 channel: HEK293 cells are human cells derived from embryonic kidney. The inhibitory activity of the compounds has been evaluated in measuring the modification of the potassium flux at 2 concentrations, as described hereafter in the biological protocol. 4.1 Native HEK293 cells HEK293 cells are human cells derived from embryonic kidney. They express at their plasma membranes proteins that transport potassium (K+). Among these proteins is the Na-K-2Cl cotransporter or NKCC1. This transporter contributes to 40-50% of K+ influx into the cells. The remaining of K+ transport is mediated by the Na+ / K+-ATPase (also known as Na+ pump or Na+ / K+ pump), which also contributes some 40-50% of the influx basal flux of 5-10%, which is mainly due to K+ channels (Figure 1A). Thus, the HEK293 cell in culture is an ideal model to study the function of NKCC1 and test compounds that inhibits its transport. The assay to measure NKCC1 function was optimized to obtain the next signal to noise ratio: a. A slightly hypertonic saline was used to stimulate NKCC1 function. The culture medium, where the cells were grown and passaged, had a measured osmolarity of 330 mOsM. The saline used for the K+ influx measurements had an osmolarity of 370-380 mOsM. By consistent use of this simple manipulation, the NKCC1 signal was enhanced. b. Ouabain, an inhibitor of the Na+ / K+ pump, was used at 100 µM. The use of ouabain greatly reduced the flux not mediated by the cotransporter. This manipulation significantly increased signal / noise ratio. c. A radioactive isotope was used to trace the inward movement of K+ into the cell (influx). This allowed for highly precise measurements of K+ influx. Because radioactive isotopes of K+ had very short half-lives, radioactive isotopes of Rb+ were used. Rubidium was a monovalent cation which was readily transporter at the K+ binding site by many transporters and channels. Rb+ was a congener of K+, being transported undistinguishably from K+.83Rb (half-life of 83 days) was used since 86Rb (half-life of 19.6 days) is no longer commercially available. The 83Rb isotope was used as a tracer, i.e. at a very low amounts to trace the movement of K+. As indicated in Figure 1B, the assay was validated with 2 reference compounds: Ref 1 is bumetanide, Ref 2 is furosemide. K+ influx measured in native HEK293 was in the range of 7000-9000 pmoles K+ per mg protein per min. In the presence of 20 µM Ref 1, the flux was reduced to 600-900 pmoles K+ per mg protein per min. Thus, there was a very solid dynamic range. In each experiment, the flux without Ref 1 was set at 1000 (equivalent to 100.0%) and the flux with 20 µM bumetanide was set at 0 (equivalent to 0%). Table 3. Percent inhibition of drugs on NKCC1 at 2 and 20 µM. 4.2 NKCC1-KO HEK293 cells NKCC1 expression was eliminated from HEK293 cells using CRISPR / cas9. Cells were transfected with a vector expressing a cas9-EGFP fusion protein and a guide RNA specific to a NKCC1 sequence (CCGCTTCCGCGTGAACTTCG; SEQ ID NO: 1) located within exon 1. Two days post transfection, cells were FACS sorted and cells expressing EGFP and cas9 (green cells) were plated at 1 cell per well in 96 well plates. Cells were grown to confluence, duplicated, and tested for NKCC1 function using Tl+ (another congener of K+) and a thallium sensitive fluorescent dye in the presence or absence of bumetanide. As seen in Figure 1C, K+ influx measured using our 83Rb uptake assay was reduced to baseline levels in NKCC1- KO HEK293 cells. In these cells, bumetanide no longer affected K+influx. 4.3 Detailed Flux Protocol For the flux experiments, 35-mm culture dishes were coated with 0.1 mg / mL poly-L-lysine and placed in large 20 x 20 [square] dishes. For convenience, the poly-L-lysine was placed in the dishes the day before the experiment. Before plating the cells, the poly-L-lysine was aspirated, and each dish washed twice with 1 mL sterile water. Cells from 3 confluent 10-cm dishes were detached with trypsin and resuspended into 49 mL complete medium. Cells (2 mL / 35-mm dish) were plated in 24 dishes and allowed to attach for at least 2 hours prior to the flux. This setup allowed the measurement of 8 conditions in triplicates. For the flux, culture medium was aspirated and replaced with 1 mL saline for a preincubation period of 15 min. The saline was aspirated and replaced with 1 mL identical saline containing 0.25 µCi / mL 83Rb for 15 min. Following the uptake period, the radioactive solution was aspirated, and the cells washed 3 times with ice- cold saline. Cells were then lyzed with 500 µl 0.25N NaOH for 1 hour, neutralized with 250 uL glacial acetic acid and 300 µL and 30 µL aliquots were used for µ-scintillation counting and protein assays, respectively. Two 5 µL of each flux solution was used to determine cpm and relate those cpm to nmoles K+. Potassium influx was expressed in nmoles K+ per mg protein per min. Note that within an experiment, groups of 3 dishes were separated 2 min apart for easy handling. Also note that since all dishes were plated with a homogeneous cell suspension, and all dishes were identical, the protein content was measured from a subset of dishes. 4.4 Approach Each compound was initially tested on NKCC1 at concentrations of 2 ^M and 20 ^M in an experiment that always included no drug (flux = 1000) and 20 ^M bumetanide (flux = 0). Many experiments also included bumetanide at 2 ^M and for this condition, the flux was highly consistent (171 ± 21, n = 6). Table 4. Inhibition of drugs on NKCC1 at 2 and 20 ^M. The compounds are active in inhibiting NKCC1. % NKCC1 mediated flux inhibition: % NKCC1 mediated flux inhibition ≥ 75%: ++++ 75% > NKCC1 mediated flux inhibition ≥ 50%: +++ 50% > NKCC1 mediated flux inhibition ≥ 30%: ++ 30% > NKCC1 mediated flux inhibition ≥ 10%: + Among the compounds of the invention there is a set of molecules of particular interest with % of inhibition equal or superior to 30%, called group 1, among this set of class 1 there is a subset of molecules of particular interest with a % in inhibition equal or superior to 50%, called group 2, among this set of class 2 there is a subset of molecules of particular interest with a % in inhibition equal or superior to 75%, called group 3.

[0008] 4.5 Dose-responses of 51 and 57 on giant depolarizing potentials (GDPs) in CA3 pyramidal neurons in hippocampus 51 and 57 were tested to evaluate their basic neuronal intrinsic properties and excitability. Current-clamp whole-cell recordings were performed in CA3 pyramidal neurons in hippocampal slices from P14-15 mice with a bipolar stimulation electrode (Figure 2). Table 5. GDPs current density in the presence of the compound 57. Table 6. GDPs current density in the presence of the compound 57 (means). As seen in Figure 3 panel A and Figure 3 panel C, compound 57 is able to block GDPs in CA3 pyramidal neurons in hippocampus. Table 7. GDPs current density in the presence of the compound 51. Table 8. GDPs current density in the presence of the compound 51 (means). As seen in Figure 3 panel B and Figure 3 panel C, compound 51 is able to block GDPs in CA3 pyramidal neurons in hippocampus. 4.5 Effect of 51 and 57 on seizure-like events (SLE) triggered by tetanus stimulation of stratum radiatum in hippocampus Use of a NKCC1 inhibitor to block the activation of NKCC1 can reduce the [Cl−]i, and thereby attenuate the excitatory GABAAR responses during epilepsy. Therefore, anticonvulsant effects of 51 on modulating the GABA polarity in acute seizure models was investigated. The seizure-like events in CA1 pyramidal neurons were triggered by tetanic stimulation of stratum radiatum in hippocampus by 51 (Figure 4) and 57 (Figure 5).51 (2 µM) significantly decrease post-tetanus spike frequency to 0.27±0.07 of control (n=5, two- tailed, pared t-test, p=5*e-4). Thus, 51 potently suppressed the GABAAR-mediated depolarization during SLEs (Figure 6) and exhibited potent anticonvulsive activity. 57 also potently suppressed the GABAAR- mediated depolarization during SLEs (Figure 7) and exhibited potent anticonvulsive activity. 4.6 Conclusion The biological results showed the compounds of the invention being inhibitors of NKCC1. The preferred set of compounds had an inhibitory activity at 20 µM in the range of 10 to 95 % of inhibition. Another set of preferred compounds had its inhibitory activity in the range of 30 to 95 %. Among the former set, the preferred set of compounds had its inhibitory activity in the range of 50 to 95 %. Ultimately, the set of compounds with an inhibitory activity between 70 to 95 % is the preferred one.

Claims

CLAIMS 1. A compound of the formula (I):wherein ^ Z is ^ awherein R1 is representing hydrogen, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1- C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group, said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, ^ and X is representing : o a NR5R6 group wherein R5 and R6 are independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3- C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1- C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1- C10)alkyl group, said groups optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3- C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms,or o a NR5R6group wherein R5and R6together with the nitrogen atom bearing them forming a C4-C10 membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead, a combination of these forms or fused with an aryl ring, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, an aryl ring or (C1-C10)acyl group, or o a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, ^group wherein R10and R11are representing independently a hydrogen and an aryl ring, an aryl ring and a hydrogen, a hydrogen and a heteroaryl ring or a heteroaryl ring and a hydrogen said aryl and heteroaryl are optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group ^ R2A and R2B represent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or R2Aand R2Btogether with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen,said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group or (C3-C10)heterocycloalkyl group, ^ R4 is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8or (C1-C10)acylamino group, ^ R9 is representing: ogroup wherein R3 is representing OH, (C1-C10)alcoxy group, (C3- C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3- C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group ogroup wherein R12 and R13 represent independently hydrogen, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3- C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR7R8, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, or (C3-C10)cycloalkyl(C1- C10)alkylcarbonylamino group oo ^ R7and R8are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7and R8together with the nitrogen atom bearing them forming a C3-C12membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, said above mentioned alkyl rings being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms, or a pharmaceutically acceptable salt of said compound, its isomers, in particular under pure form, diastereomers, epimers and enantiomers or a mixture of said isomers, diastereomers, epimers and enantiomers.

2. The compound of claim 1, of the formula (II):wherein R1, R2A, R2B, R4, R5, R6and R9have the meaning defined in claim 1.

3. The compound of claim 1, of the formula (III):wherein R1, R2A, R2B, R4, and R9 have the meaning defined in claim 1, and X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro.

4. The compound of claim 1, of the formula (IV):wherein R2A, R2B, R4, R9, R10and R11have the meaning defined in claim 1.

5. The compound of any one of claim 1 or 4, of the formula (IV):wherein R4, R9, R10and R11have the meaning defined in claim 1, and R2A and R2B are representing independently a hydrogen and a (C1-C10)alkyl, or a (C1-C10)alkyl and a hydrogen.wherein Z, R2A, R2B, and R4have the meaning defined in claim 1.

7. The of of claims 1 to 5, of the formula (VI):wherein Z, R2A, R2B, and R4 have the meaning defined in claim 1, R3 has the meaning defined in claim 1 but is different from OH.

8. The compound of any of claims 1 to 5, of the formula (VII):wherein Z, R2A, R2B, R4, R12and R13have the meaning defined in claim 1.

9. The compound of any of claims 1 to 5, chosen amongst: - the compound of the formula (VIII):wherein Z, R2A, R2Band R4have the meaning defined in claim 1, or - the compound of the formula (IX):wherein Z, R2A, R2Band R4have the meaning defined in claim 1.

10. The compound of any of claims 1 to 9, of the formula (X):wherein Z, R2A, R2B and R9 have the meaning defined in claim 1, and R4 is representing a phenyl ring, optionally substituted by one or more halogen atoms, (C1-C10)alkyl group or (C1-C10)alcoxy group.

11. The compound of any of claims 1 to 10, of the formula (XI):wherein Z, R4and R9have the meaning defined in claim 1, and R2A and R2B are representing independently a hydrogen and a (C1-C10)alkyl group, a (C1-C10)alkyl group and a hydrogen, a hydrogen and a (C11-C12)alkyl group, or a (C11-C12)alkyl group and a hydrogen, said (C1-C10)alkyl group is optionally substituted by one or more halogen atoms or (C1-C10)alcoxy group.

12. The compound of any one of claims 1 to 2 or 6, of the formula (XII):wherein R1, R2A, R2B, R4, R5and R6have the meaning defined in claim 1.

13. The compound of any one of claims 1 to 2 or 7, of the formula (XIII):wherein R1, R2A, R2B, R4, R5and R6have the meaning defined in claim 1, R3has the meaning defined in clam 1 but is different from OH.

14. The compound of any one of claims 1, 3 or 6, of the formula (XIV) :wherein R1, R2A, R2B, and R4have the meaning defined in claim 1, and X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, 15. The compound of any one of claims 1, 3 or 7, of the formula (XV) :defined in claim 1, R3 has the meaning defined in clam 1 but is different from OH, X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro.

16. The compound of any one of claims 1, 3 or 9, chosen amongst: - a compound of formula (XVI):wherein R1, R2A, R2B and R4 have the meaning defined in claim 1, and X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1- C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, or - a compound of formula (XVII):wherein R1, R2A, R2Band R4have the meaning defined in claim 1 and X have the meaning defined above.

17. The compound of any one of claims 1, 4, 5 or 6 of the formula (XVIII):wherein R2A, R2B, R4, R10and R11have the meaning defined in claim 1.

18. The compound of any one of claims 1, 4, 5 or 7 of the formula (XIX):wherein R2A, R2B, R4, R10 and R11 have the meaning defined in claim 1, R3 has the meaning defined in clam 1 but is different from OH.

19. The compound of any one of claims 1, 4, 5 or 8 of the formula (XX):wherein R2A, R2B, R4, R10, R11, R12 and R13 have the meaning defined in claim 1.

20. The compound of any one of claims 1, 4, 5 or 9, chosen amongst : - the compound of formula (XXI) :wherein R2A, R2B, R4, R10 and R11 have the meaning defined in claim 1. or - the compound of formula (XXII) :wherein R2A, R2B, R4, R10 and R11 have the meaning defined in claim 1.

21. The compound of any one of claims 1, 2, 6 or 12, of the formula (XXIII):wherein ^ Z is ^wherein R1 is representing hydrogen atom, (C1-C10)alkyl group or an aryl ring and X is representing : o a NR5R6 group wherein R5 and R6 are independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl goup, aryl(C1-C10)alcoxy group or heteroaryl(C1-C10)alkyl group said groups optionally substituted by one or more halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group, (C1-C10)acyl group or (C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, oro a NR5R6 group wherein R5 and R6 together with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead, a combination of these forms or fused with an aryl ring, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said groups optionally substituted by one or more halogen atoms, (C1-C10)alkyl group or (C1-C10)acyl group ^ R2A and R2B are representing independently a hydrogen and a (C1-C10)alkyl group, a (C1-C10)alkyl group and a hydrogen, or a (C1-C10)alkyl group and a (C1-C10)alkyl group, ^ R4is representing a phenyl ring.

22. The of one of claims 1, 3, 6 or 14, of the formula (XXIV)wherein ^ Z is representingwherein R1is representing hydrogen atom, (C1-C10)alkyl group or an aryl ring and X is representing a (C1-C10)alkyl group ^ R2A and R2B are representing independently a hydrogen and a (C1-C10)alkyl group, a (C1-C10)alkyl group and a hydrogen, or a (C1-C10)alkyl group and a (C1-C10)alkyl group, ^ R4is representing a phenyl ring.

23. The compound of any one of claims 1, 4, 6 or 17, of the formula (XXV)(XXV) wherein ^ Z is representinggroup wherein R10and R11are representing independently a hydrogen and an aryl ring or an aryl ring and a hydrogen, ^ R2A and R2B are representing independently a hydrogen and a (C1-C10)alkyl group, a (C1-C10)alkyl group and a hydrogen, or a (C1-C10)alkyl group and a (C1-C10)alkyl group, ^ R4is representing a phenyl ring.

24. The compound of claim 1, of the formula (I)wherein ^ Z is ^wherein R1 is representing hydrogen atom, (C1-C10)alkyl group or an aryl ring and X is representing : o a NR5R6 group wherein R5 and R6 are independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group or heteroaryl(C1-C10)alkyl group said groups optionally substituted by one or more halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group, (C1-C10)acyl group or (C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, or o a NR5R6 group wherein R5 and R6 together with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead, a combination of these forms or fused with an aryl ring, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen,said groups optionally substituted by one or more halogen atoms, (C1-C10)alkyl or (C1- C10)acyl group group ^group wherein R10and R11are representing independently a hydrogen and an aryl ring or an aryl ring and a hydrogen, ^ R2Aand R2Bare representing independently a hydrogen and a (C1-C10)alkyl group, a (C1-C10)alkyl group and a hydrogen, or a (C1-C10)alkyl group and a (C1-C10)alkyl group, ^ R4 is representing a phenyl ring, ^ R9 is representing:o a group wherein R3is representing (C1-C10)alcoxy group, ogroup wherein R12and R13represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, optionally substituted by one or more halogen atoms or (C1-C10)alcoxy group, o o25. The compound, according to claim 1, having a formula chosen among the following ones: ^ methyl 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxy-benzoate (Compound 1), ^ methyl 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxy-benzoate (Compound 2), ^ methyl 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)-benzoate (Compound 3),^ methyl 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)-benzoate (Compound 4), ^ methyl 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 5), ^ methyl 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxy-benzoate (Compound 6), ^ methyl 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (Compound 7), ^ methyl 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 8), ^ methyl 3-(butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 9), ^ methyl 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 10), ^ methyl 3-(azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (Compound 11), ^ methyl 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 12), ^ methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoate (Compound 13), ^ methyl 3-(butylamino)-5-[(N-methylanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 14), ^ methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoate (Compound 15), ^ methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoate (Compound 16), ^ methyl 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 17), ^ methyl 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoate (Compound 18), ^ methyl 3-(butylamino)-5-(indolin-1-ylsulfonimidoyl)-4-phenoxy-benzoate (Compound 19), ^ methyl 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxy- benzoate (Compound 20), ^ methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 21), ^ methyl 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 22), ^ methyl 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 23), ^ methyl 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-benzoate (Compound 24), ^ methyl 3-(aminosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoate (Compound 25), ^ methyl 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 26), ^ methyl 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 27), ^ methyl 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 28), ^ methyl 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoate (Compound 29), ^ methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 30) ^ methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoate (Compound 31). ^ methyl 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoate (Compound 32), ^ methyl 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoate (Compound 33), ^ methyl 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoate (Compound 34),^ methyl 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 35), ^ methyl 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoate (Compound 36), ^ methyl 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoate (Compound 37), ^ methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoate (Compound 38), ^ methyl 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoate (Compound 39), ^ methyl 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 40), ^ methyl 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoate (Compound 41), ^ methyl 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxy- benzoate (Compound 42), ^ methyl 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoate (Compound 43), ^ methyl 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoate (Compound 44), ^ methyl 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoate (Compound 45), ^ methyl 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxy-benzoate (Compound 46), ^ methyl 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 47), ^ methyl 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoate (Compound 48), ^ methyl 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxy- benzoate (Compound 49), ^ methyl 3-(butylamino)-5-[[(1-methyl-4-piperidyl)methylamino]sulfonimidoyl]-4-phenoxy- benzoate (Compound 50), ^ 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 51), ^ 3-(butylamino)-5-(dimethylaminosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 52), ^ 3-(butylamino)-4-phenoxy-5-(pyrrolidin-1-ylsulfonimidoyl)benzoic acid (Compound 53), ^ 3-(butylamino)-4-phenoxy-5-(1-piperidylsulfonimidoyl)benzoic acid (Compound 54), ^ 3-(butylamino)-5-[[ethyl(methyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 55), ^ 3-(butylamino)-5-(morpholinosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 56), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoic acid (Compound 57), ^ 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 58), ^ 3-(butylamino)-5-[(2-methoxyethylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 59), ^ 3-(butylamino)-5-[(cyclopropylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 60), ^ 3-(azepan-1-ylsulfonimidoyl)-5-(butylamino)-4-phenoxy-benzoic acid (Compound 61) ^ 3-(butylamino)-5-[(cyclohexylmethylamino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 62). ^ 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 63), ^ 3-(butylamino)-4-phenoxy-5-[(3-pyridylamino)sulfonimidoyl]benzoic acid (Compound 64), ^ 3-(butylamino)-5-[(3-methoxyanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 65), ^ 3-(butylamino)-4-phenoxy-5-[(4-phenyl-1-piperidyl)sulfonimidoyl]benzoic acid (Compound 66), ^ 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 67),^ 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 68), ^ 3-(butylamino)-5-(8-oxa-3-azabicyclo[3.2.1]octan-3-ylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 69), ^ 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 70), ^ 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 71), ^ 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 72), ^ 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoic acid (Compound 73), ^ 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 74), ^ 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzoic acid (Compound 75), ^ 3-(butylamino)-4-phenoxy-5-[(pyrimidin-2-ylamino)sulfonimidoyl]benzoic acid (Compound 76), ^ 3-(butylamino)-5-[(2-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 77), ^ 3-(butylamino)-5-[(4-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 78), ^ 3-(butylamino)-5-[[(1-methyl-4-piperidyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 79), ^ 3-(butylamino)-4-phenoxy-5-[(pyrimidin-5-ylamino)sulfonimidoyl]benzoic acid (Compound 80), ^ 3-(butylamino)-4-phenoxy-5-[(2-phenylethylamino)sulfonimidoyl]benzoic acid (Compound 81), ^ 3-(butylamino)-5-[[2-(3-chlorophenyl)ethylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 82), ^ 3-(butylamino)-4-phenoxy-5-[(3-pyridylmethylamino)sulfonimidoyl]benzoic acid (Compound 83), ^ 3-(butylamino)-4-phenoxy-5-[[2-(3-pyridyl)ethylamino]sulfonimidoyl]benzoic acid (Compound 84), ^ 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylmethylamino)sulfonimidoyl]benzoic acid (Compound 85), ^ 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoic acid (Compound 86), ^ 3-(butylamino)-5-[[(1-methylpyrazol-3-yl)methylamino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 87), ^ 3-(butylamino)-5-[[(1-methylimidazol-2-yl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 88), ^ 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoic acid (Compound 89), ^ 3-(butylamino)-4-phenoxy-5-[(thiazol-2-ylamino)sulfonimidoyl]benzoic acid (Compound 90), ^ 3-(butylamino)-4-phenoxy-5-[(4-pyridylamino)sulfonimidoyl]benzoic acid (Compound 91), ^ 3-[[(1-acetyl-4-piperidyl)amino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 92) ^ 3-(butylamino)-4-phenoxy-5-[(pyridazin-4-ylamino)sulfonimidoyl]benzoic acid (Compound 93). ^ 3-(butylamino)-5-(butylaminosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 94), ^ 3-[(1-bicyclo[1.1.1]pentanylamino)sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 95) ^ 3-(butylamino)-4-phenoxy-5-[(quinuclidin-3-ylamino)sulfonimidoyl]benzoic acid (Compound 96). ^ 3-[[(1-acetyl-4-piperidyl)methylamino]sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 97), ^ methyl 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxy-benzoate (Compound 98),^ methyl 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoate (Compound 99), ^ 3-(butylamino)-5-[S-[ethyl(methyl)amino]-N-methyl-sulfonimidoyl]-4-phenoxybenzoic acid (Compound 100), ^ 3-[S-(azepan-1-yl)-N-phenyl-sulfonimidoyl]-5-(butylamino)-4-phenoxy-benzoic acid (Compound 101), ^ 3-[(benzylamino)sulfonimidoyl]-5-(butylamino)-N-methyl-4-phenoxy-benzamide (Compound 102), ^ 3-(butylamino)-N-methyl-4-phenoxy-5-[(tetrahydropyran-4- ylmethylamino)sulfonimidoyl]benzamide (Compound 103), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methyl-4-phenoxy- (Compound 104), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N,N-dimethyl-4-phenoxy-benzamide (Compound 105), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-cyclopropyl-4-phenoxy-benzamide (Compound 106), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(cyclopropylmethyl)-4-phenoxy-benzamide (Compound 107), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-methoxy-4-phenoxy-benzamide (Compound 108), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-benzamide (Compound 109), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2-difluoroethyl)-4-phenoxy-benzamide (Compound 110), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-N-(2,2,2-trifluoroethyl)-4-phenoxy-benzamide (Compound 111), ^ 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methyl-4-phenoxy-benzamide (Compound 112), ^ 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-methoxy-4-phenoxy-benzamide (Compound 113), ^ 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-N-(2-methoxyethyl)-4-phenoxy-benzamide (Compound 114), ^ 3-(butylamino)-5-(isoindolin-2-ylsulfonimidoyl)-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (Compound 115), ^ 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methyl-4-phenoxy- benzamide (Compound 116), ^ 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-methoxy-4-phenoxy- benzamide (Compound 117), ^ 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-N-(2-methoxyethyl)-4- phenoxy-benzamide (Compound 118), ^ 3-(butylamino)-5-[[(3-chlorophenyl)methylamino]sulfonimidoyl]-4-phenoxy-N-(2,2,2- trifluoroethyl)benzamide (Compound 119), ^ 3-(anilinosulfonimidoyl)-5-(butylamino)-4-phenoxy-N-(3,3,3-trifluoropropyl)benzamide (Compound 120), ^ 3-(butylamino)-N-methoxy-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]benzamide (Compound 121), ^ 3-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-5-[(tetrahydropyran-4- ylamino)sulfonimidoyl]benzamide (Compound 122), ^ 3-(butylamino)-4-phenoxy-5-[(tetrahydropyran-4-ylamino)sulfonimidoyl]-N-(2,2,2- trifluoroethyl)benzamide (Compound 123), ^ methyl 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoate (Compound 124), ^ 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoic acid (Compound 125), ^ 3-(butylamino)-2-phenoxy-N-phenyl-5-(1H-tetrazol-5-yl)benzenesulfonamide (Compound 126)^ 3-(butylamino)-5-(5-oxo-2H-1,2,4-oxadiazol-3-yl)-2-phenoxy-N-phenyl-benzenesulfonamide (Compound 127). ^ methyl 3-(butylamino)-5-(N-butyl-S-methyl-sulfonimidoyl)-4-phenoxy-benzoate (Compound 128), ^ methyl 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxy-benzoate (Compound 129), ^ 3-(butylamino)-5-(methylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 130), ^ 3-(butylamino)-5-(N-butyl-S-methyl-sulfonimidoyl)-4-phenoxy-benzoic acid (Compound 131), ^ methyl 3-amino-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoate (Compound 132), ^ methyl 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoate (Compound 133), ^ 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 134), ^ N-butyl-3-(N,S-dimethylsulfonimidoyl)-2-phenoxy-5-(1H-tetrazol-5-yl)aniline (Compound 135) 26. A process of preparation of a compound of formula (II) according to claim 2:wherein ^ R5and R6are independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3- C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1- C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group, said groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, or ^ R5 and R6 together with the nitrogen atom bearing them forming a C4-C10 membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead, a combination of these forms or fused with an aryl ring, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, an aryl ring or (C1- C10)acyl group, ^ R1is representing hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1- C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3- C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group, said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms,^R2Aand R2Brepresent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or R2A and R2B together with the nitrogen atom bearing them forming a C4-C10 membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1- C10)alcoxy group or (C3-C10)heterocycloalkyl group,^R4is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8 or (C1-C10)acylamino group, ^ R9 is representing: ^ agroup wherein R3 is representing OH, (C1-C10)alcoxy group, (C3- C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1- C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2- C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1- C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group^group wherein R12and R13represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR7R8, (C1- C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, or (C3-C10)cycloalkyl(C1- C10)alkylcarbonylamino group ^ R7and R8are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7and R8together with the nitrogen atom bearing them forming a C3-C12membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, comprising the following steps: a) a silylation step of a compound of formula (XXVI):wherein R2A, R2B and R4 have the meaning defined above and GP1 is a protecting group, in particular representing (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1- C10)alcoxy group wherein R7 and R8 have the meaning defined above with a compound of formula (XXVII):R15R16R14SiCl (XXVII) wherein R14, R15 and R16 are representing independently a methyl group, an ethyl group, an isopropyl group, a butyl group, a tert-butyl group or an aromatic group, to obtain a compound of formula (XVIII):wherein GP1, R2A, R2B, R4, R14, R15 and R16 have the meaning defined above a substitution on said of formula (XVIII) to replace one of the oxygens on theradicalin particular with dichlorotriphenylphosphorane or a mixture of PPh3 and (CCl3)2 and HNR5R6, wherein R5 and R6 have the meaning defined above, to obtain a compound of formula (XXIX):wherein GP1, R2A, R2B, R4, R5, R6, R14, R15 and R16 have the meaning defined above,c) a deprotection of the silyl function of said compound (XXIX), in particular with acidic acetonitrile, to obtain a compound of formula (XXX):wherein GP1, R2A, R2B, R4, R5 and R6 have the defined above said compound being of said formula (II) whenand possibly, d) ^ an addition of R1-B(OH)2 wherein R1 is representing an aryl ring or a heteroaryl ring, on said compound of formula (XXX), in particular with Cu(OAc)2, said aryl or heteroaryl ring optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1- C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, to obtain a compound of formula (XXXI):,wherein GP1, R1, R2A, R2B, R4, R5 and R6 have the meaning defined above, said compound being of formula (II) whenor ^ an addition of formaldehyde on said compound of formula (XXX), to obtain a compound of formula (XXXI):wherein GP1R2A, R2B, R4, R5and R6have the meaning defined above and R1is representing a methyl group, said compound being of formula (II) whenor ^ an addition of (C1-C10)alkyl-Br group, (C3-C10)cycloalkyl-Br group, a (C3-C10)cycloalkyl(C1-C10)alkyl- Br group, a (C3-C10)heterocycloalkyl-Br group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl-Br group, an aryl(C1-C10)alkyl-Br group, an aryl(C1-C10)alcoxy-Br group, an aryl(C3-C10)cycloalkyl-Br group, an aryl(C3-C10)cycloalkyl(C1-C10)alkyl-Br group, heteroaryl(C1-C10)alkyl-Br group, heteroaryl(C3- C10)cycloalkyl-Br group or heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl-Br group, on said compound of formula (XXX), in particular with K2CO3, KH or NaH, said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, to obtain a compound of formula (XXXI):wherein GP1, R2A, R2B, R4, R5and R6have the meaning defined above and R1is representing (C1- C10)alkyl group, (C3-C10)cycloalkyl group, a (C3-C10)cycloalkyl(C1-C10)alkyl group, a (C3- C10)heterocycloalkyl group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl(C1-C10)alkyl group, an aryl(C1-C10)alcoxy group, an aryl(C3-C10)cycloalkyl group, an aryl(C3-C10)cycloalkyl(C1- C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group or heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, said compound being of formula (II) whenand possibly, e) a saponification of said compound of formula (XXX) or formula (XXXI), in particular with LiOH, NaOH or KOH, to obtain a compound of said formula (II) whereinand possibly, f) an amidation of one compound of said formula (II) whereinHNR12R13, wherein R12 and R13 have the meaning defined above, in particular with N,N- diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyl uronium, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3-tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3- hexafluorophosphate, to obtain a compound of formula (II) wherein R9 is representinggroup, said above mentioned alkyl groups being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms.

27. A process of preparation of a compound of formula (III) according to claim 3,wherein ^ X is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group or an aryl(C1-C10)alkyl group, in particular a benzyl group said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro, ^ R1 is representing hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1- C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3- C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group, said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, ^ R2A and R2B represent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or R2A and R2B together with the nitrogen atom bearing them forming a C4-C10 membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1- C10)alcoxy group or (C3-C10)heterocycloalkyl group, ^ R4 is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8 or (C1-C10)acylamino group, ^ R9is representing: ^ agroup wherein R3is representing OH, (C1-C10)alcoxy group, (C3- C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1- C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2- C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1- C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group ^group wherein R12 and R13 represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR7R8, (C1- C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, or (C3-C10)cycloalkyl(C1- C10)alkylcarbonylamino group or^ ^ R7and R8are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7and R8together with the nitrogen atom bearing them forming a C3-C12membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, comprising the following steps: a) a reduction, on a compound of formula (XXXII):wherein Y is representing a fluorine, a chlorine or a bromine, in particular with PPh3 or SnCl2 or zinc powder to obtain a compound of formula (XXXIII):wherein Y have the meaning defined above b) an addition of the X and GP1 groups, in particular the addition of ^ X-Z and Gp1-Z in particular with X-Z and a base, in particular iodomethane and Cs2CO3or K2CO3^ X-Z and Gp1-OH, in particular with X-Z and an aqueous base, in particular MeI and aqueous NaOH in a first step, then with a coupling reagent and Gp1-OH in particular with1-Ethyl-3-(3- dimethylaminopropyl)carbodiimide and 4-dimethylaminopyridine in Gp1-OH or with an alcohol and an acid in particular with Gp1-OH and sulfuric acid, ^ X-Z and Gp1-OH, in particular with an alcohol and an acid, in particular with Gp1-OH and sulfuric acid, in particular with methanol and sulfuric acid in a first step, then with X-Z and a base, in particular MeI and Cs2CO3 or K2CO3 wherein Z is representing bromine or a iodine and and X have the meaning defined above on said compound of formula (XXXIII), to obtain a compound of formula (XXXIV):wherein Y, GP1 and X have the meaning defined above c) an aromatic nucleophilic substitution of said compound (XXXIV) with R4-OH, wherein R4has the meaning defined above, in particular with K2CO3 or Cs2CO3, NaOMe, triethylamine, N,N- diisopropylethylamine or 1,8-diazabicyclo[5.4.0]undec-7-ene to obtain a compound of formulawherein GP1, X and R4 have the meaning defined above d) an oxidation of said compound of formula (XXXV), in particular with (diacetoxyiodo)benzene and an ammonium provider, such as ammonium carbamate, ammonium carbonate, ammonia or ammonium acetate, to obtain a compound of formula (XXXVI):wherein GP1, X and R4 have the meaning defined above e) a reduction of said compound of formula (XXXVI) to obtain a compound of formula (XXXVII):in particular with palladium and hydrogen, or FeCl2, ZnCl2or SnCl2in aqueous ammonium chloride, wherein GP1, X and R4 have the meaning defined above f) ^ a reductive amination of said compound of formula (XXXVII), by addition of a compound of formula (XXXVIII) or (XXXIX) and a reductive agent, in particular NaBH(OAc)3 or NaBH3CN: T2A(XXXVIII) being O T2B(XXXIX) beingOwherein T2A and T2B represent independently hydrogen, (C1-C9)alkyl group, (C10-C11)alkyl group optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8,^ an alkylation of said compound of formula (XXXVII), by addition of a compound of formula (XL) or (XLI) or of compounds of formulae (XL) and (XLI) and a base, in particular Cs2CO3or K2CO3, (XL) being R2AHal (XLI) beingR2BHalwherein Hal is representing a chlorine or a bromine to obtain a compound of formula (XLII):wherein GP1, R4and X have the meaning defined above and R2A, R2Bare representing hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1- C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1- C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or ^ an arylation of said compound of formula (XXXVII), in particular a palladium or copper- catalysed, by addition of a compound of formula (XLIII) or (XLIV) or of compounds of formulae (XLIII) and (XLIV) and a catalyst, in particular chosen among copper (II) acetate, palladium diacetate, tris(dibenzylideneacetone)dipalladium (0) or palladium (II) [1,1'- bis(diphenylphosphanyl)ferrocene] dichloride (XLIII) being R2AM (XLIV) beingR2B Mwherein R2Aand R2Bare representing independently an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1- C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8,wherein M is representing a chlorine or a brominewherein Mx1and Mx2are representing independently a hydrogen or a (C1-C6) alkyl group, Mx1 and Mx2 being possibly linked by a covalent bond or ^ a nucleophilic aromatic substitution of said compound of formula (XXXVII), by addition of compounds of formulae (XLV) and (XLVI) and a base, in particular triethylamine, (XLV) being R2AF (XLVI) being R2BF to obtain a compound of formula (XLII):wherein GP1, R4and X have the meaning defined above and R2A, R2Bare representing independently a hydrogen, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3- C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or ^ a double alkylation of said compound of formula (XXXVII), by addition of a compound of formula and a base, in particular Cs2CO3, K2CO3 or triethylamine,wherein Hal is representing a chlorine or a bromine and n is a positive integer being from 4 to 10 to obtain a compound of formula (XLIX):wherein GP1, R4 and X have the meaning defined above and R2A and R2B together with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group or (C3-C10)heterocycloalkyl group, said compounds of formulae (XLII) or (XLIX) being of formula (III) whenand R1 = H and possibly, g) ^ an addition of R1-B(OH)2wherein R1is representing an aryl ring or a heteroaryl ring, on one of compounds of formulae (XLII) or (XLIX), in particular with Cu(OAc)2, said aryl or heteroaryl ring optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1- C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, to obtain a compound of formula (L):wherein GP1, R1, R2A, R2B, R4 and X have the defined above, said compound being of formula (III) whenor ^ an addition of formaldehyde, on one of compounds of formulae (XLII) or (XLIX), to obtain a compound of formula (L):wherein GP1 R2A, R2B, R4 and X have the defined and R1 is a methyl group, said compound being of formula (III) whenor ^ an addition of (C1-C10)alkyl-Br group, (C3-C10)cycloalkyl-Br group, a (C3-C10)cycloalkyl(C1- C10)alkyl-Br group, a (C3-C10)heterocycloalkyl-Br group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl- Br group, an aryl(C1-C10)alkyl-Br group, an aryl(C1-C10)alcoxy-Br group, an aryl(C3- C10)cycloalkyl-Br group, an aryl(C3-C10)cycloalkyl(C1-C10)alkyl-Br group, heteroaryl(C1- C10)alkyl-Br group, heteroaryl(C3-C10)cycloalkyl-Br group or heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl-Br group on one of compounds of formulae (XLII) or (XLIX), in particular with K2CO3, KH or NaH, said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, to obtain a compound of formula (L):wherein GP1, R2A, R2B, R4 and X have the meaning defined above and R1 is representing (C1- C10)alkyl group, (C3-C10)cycloalkyl group, a (C3-C10)cycloalkyl(C1-C10)alkyl group, a (C3- C10)heterocycloalkyl group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl(C1-C10)alkyl group, an aryl(C1-C10)alcoxy group, an aryl(C3-C10)cycloalkyl group, an aryl(C3-C10)cycloalkyl(C1- C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group or heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, said compound being of formula (III) whenand possibly,h) a saponification of one of compound of formulae (XLII), or , in with LiOH, NaOH or KOH, to obtain a compound of said formula (III) whereinand possibly, i) an amidation of a compound of said formula (III) whereinHNR12R13, wherein R12 and R13 have the meaning defined above, in particular with N,N- diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyl uranium, 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3- tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium to obtain a compound of formula (III) wherein R9 is representing, or after step h), j) an amidation, followed a followed by a cyclization of a compound of said formula (III) whereinparticular with 1,1'-carbonyldiimidazole and an ammonia solution (amidation) followed by pyridine and trifluoroacetic anhydride or thionyl chloride in dimethylformamide or phosphorus pentoxide in methanol, chloroform or toluene (dehydration), followed by sodium azide and ammonium chloride (cyclization), to obtain a compound of formula (III) wherein R9 is representingring, (Sulfoximine tétrazole) said above mentioned alkyl groups being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms.

28. A process of preparation of a compound of formula (IV) according to claim 4,wherein ^ R10 and R11 are representing independently a hydrogen and an aryl or an aryl and a hydrogen, said aryl is optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1- C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1- C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1- C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group or (C3-C10)cycloalkyl(C1- C10)alkylcarbamoyl group ^ R2A and R2B represent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3- C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR7R8, or R2A and R2B together with the nitrogen atom bearing them forming a C4-C10 membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1- C10)alcoxy group or (C3-C10)heterocycloalkyl group, ^ R4 is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3- C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR7R8 or (C1-C10)acylamino group, ^ R9is representing: ogroup wherein R3 is representing OH, (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a(C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1- C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1- C10)alcoxy group ogroup wherein R12and R13represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR7R8, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group o o^ R7 and R8 are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3- C10)cycloalkyl(C1-C10)alkyl group, or R7 and R8 together with the nitrogen atom bearing them forming a C3-C12 membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3- C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, comprising the following steps: a) an addition of an Ph-Hal group, in particular with CuI, N,N′-dimethylethylenediamine and potassium carbonate, wherein Hal is representing a bromine or a iodine, on a compound of formula (LI):wherein R2A, R2B and R4 have the meaning defined above and GP1 is a protecting group, in particular representing (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O- heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1- C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, to obtain a compound of formula (LIII):wherein GP1, R2A, R2Band R4have the defined above, said compound being of formula (IV) whenand possibly, b) a saponification of said compound of formula (LIII), in obtain a compound of said compound of formula (IV), whereinand possibly,o c) a step of amidation followed a of said compound of formula (IV), whereinparticular with 1,1'-carbonyldiimidazole and an ammonia solution (amidation) followed by pyridine and trifluoroacetic anhydride or thionyl chloride in dimethylformamide or phosphorus pentoxide in methanol, chloroform or toluene (dehydration), to obtain a compound of formula (LIV):wherein R2A, R2Band R4have the meaning defined above, and, o d) a cyclization of said compound of formula (LIV), in particular with sodium azide and ammonium chloride, to obtain a compound of formula (IV) wherein R9 isor o d’) a step of addition of HO-NH followed by a cyclization on said compound of formula (LIV), in particular with hydroxylammonium chloride and NaHCO3 (addition of HO-NH) followed by 1,1'-carbonyldiimidazole and 1,8-diazabicyclo[5.4.0]undec- 7-ene , to obtain a of formula (IV) wherein R9is representingor after step b), c) an amidation of said compound of formula (IV) wherein R9 is representingis representing OH, with HNR12R13, wherein R12 and R13 have the meaning defined above, inparticular with N,N-diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyl uranium, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido- 1,1,3,3-tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphate, to obtain a compound of formula (IV) wherein R9is a representinggroup, said above mentioned alkyl groups being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms.

29. The compound according to any one of claims 1 to 25 for its use as a drug.

30. A pharmaceutical composition, comprising a compound as defined in any one of claims 1 to 25, as an active substance, and a pharmaceutically acceptable excipient.

31. The pharmaceutical composition, according to claim 30, in a unitary form comprising from 0.033 mg to 200 mg of active substance (for a human being weighing 70 kg).

32. A pharmaceutical composition, according to claim 31, formulated for an administration of active substance at a range of 0.00047 mg / kg to 2.86 mg / kg of body weight.

33. The compound of any one of claims 1 to 25, for its use in the prevention or the treatment of pathologies involving a functional deficit of the inhibition of the NKCC1 transporter.

34. The compound of any one of claims 1 to 25, for its use in the prevention or the treatment of one of the following pathologies: cancer, in particular glioblastoma, pancreas cancer, prostate cancer, lung cancer, kidney cancer, colon cancer, cerebral disorders, neurodegenerative or psychiatric, in particular schizophrenia, autistic spectrum disorder, fragile X, Rett syndrome, Down syndrome, Parkinson disease, pathologies associated to an inflammatory state or epilepsies including temporal lobe epilepsies, infantile epilepsies, partial or genealized seizures that have been shown to be associated with high (Cl-)ilevels and failure of inhibition – with a shift to excitation- by GABA.