Use of gsk-3 activatior to modulate proteasome activity to prevent ageing associated conditions and diseases

Abstract

The present invention provides information comprising at least one activators of the GSK-3 for use in preventing and / or treating ageing and ageing associated conditions and diseases through increasing proteasome activity.

Description

[0001] USE OF GSK-3 ACTIVATOR TO MODULATE PROTEASOME ACTIVITY TO PREVENT AGEING ASSOCIATED CONDITIONS AND DISEASES

[0002] ABSTRACT

[0003] The present invention provides information comprising at least one activators of the GSK-3 for use in preventing and / or treating ageing and ageing associated conditions and diseases through increasing proteasome activity.

[0004] BACKGROUND OF THE INVENTION

[0005] Aging is associated with malfunctioning of the protein homeostasis network and interferes with crucial signaling pathways and is often associated with multiple human diseases. However, it has been difficult to separate the effects of aging per se from those of age-associated diseases (Vilchez et al 2014).

[0006] In the last few decades, there has been a dramatic increase in group of medical conditions, collectively called “protein misfolding disorders” that include Alzheimer’s disease (AD) and type 2 diabetes (Dobson, 2017). These protein-misfolding diseases disorders — almost unknown a century ago — are now becoming frighteningly common (Chiti and Dobson, 2017). Many of these “modern diseases” can be attributed to the fact that we are now living to ages unprecedented in all of human history, and as we get older, our protective mechanisms have a greater risk of failing (Hipp etal. 2014).

[0007] The oxidative stress is an important factor that cause protein unfolding. Upon oxidative damage, proteins unfold and expose hydrophobic regions which makes them prone to aggregation.

[0008] The contribution of oxidative stress in age-related organ changes is generally agreed that increases in reactive oxygen species (ROS) accompany aging, leading to functional alterations, increased incidence of disease, and a reduction in life span (Kregel and Zhang, 2007; Jung and Grune, 2013). Oxidative stress has also been demonstrated to have a major role in the initiation and progression of cardiovascular diseases including atherosclerosis and hypertansion, cerebrovascular disease (stroke), type 2 diabetes, cancer, several chronic neurodegenerative diseases including AD and Parkinson’s disease, osteoarthritis, osteoprosis, hearing loss, Age-related macular degeneration and others. Heart failure is the number one cause of hospitalization for people aged 65 and

[0009] 1

[0010] SUBSTITUTE SHEET (RULE 26) older, and nearly all patients with, or at risk of, heart disease have enhanced levels of oxidative stress (Jung and Grune, 2013; Jung et al 2014).

[0011] According to the generally accepted opinon, misfolded and aggregated proteins caused by oxidative stress are key pathological findings even the natural aging process (Reichmann, et al., 2018).

[0012] The protein quality control in cell is maintained by the protein homeostasis (proteostasis) network, which consists of the protein synthesis, protein folding complexes, and protein degredation machinery systems.

[0013] Proteome imbalance is accompanied by widespread protein aggregation, with abundant proteins that exceed solubility contributing most to aggregate load.

[0014] (Walther et al. 2017)

[0015] Therefore, clearance of misfolded proteins is critical for cell survival because misfolding alters a protein’s three-dimensional structure, impairing its biological activities and increasing its propensity to form toxic aggregates (Hartl, 2017).

[0016] Modulation of protein concentration via regulation of the proteolytic machineries has long been validated as promising milieu for the development of treatments for ageing and ageing related different human diseases such as neurodegeneration, cancer, and autoimmunity, ageing and ageing related diseases.

[0017] Therefore, increasing proteolytic capacity provides an important approach to maintaining proteostasis (Njomen and Tepe, 2019).

[0018] Although there is evidence suggesting that chaperone mediated autophagy is activated during oxidative stress response, the proteasome represents the major proteolytic machinery for the removal of oxidized and misfolded proteins and (Njomen and Tepe, 2019 Hipp et al. 2014, Pohl and Dikic, 2019).

[0019] The proteasome is a central protein degradation machine in eukaryotes. Through hydrolysis activities, it removes damaged proteins and ensures the delivery of amino acids to support on going biosynthesis. The proteasome makes up a staggering 1 %-2% of the entire proteome in healthy cells.

[0020] Degradation by the proteasome falls into two major categories:

[0021] The ubiquitin-proteasome system (UPS) and the ubiquitin-independent proteasome system(UIPS)

[0022] 2

[0023] SUBSTITUTE SHEET (RULE 26) At the center of the UPS is the proteasome as described by Yu and Matouschek (Yu and Matouschek, 2017). The human 26S proteasome consist of a barrel-shaped 20S core particle (CP) capped by one or two 19S regulatory particles (RPs) also called PA700. The 20S CP is a threonine protease that consists of four stacked rings. The two inner [3- rings contain three catalytic subunits (p5, |32, and [31) that display chymotrypsin-like, trypsin-like, and caspase- like activity, respectively. The outer a- rings serve as gated channels that regulate substrate entry and product exit from the inner catalytic chambers. These outer rings also act as docking surfaces for the 19S RPs. The a and [3- rings are each composed of heteroheptameric subunits; a1-a7 and [31 -[37, respectively. The 26S proteasome is formed when the 28-subunit CP is docked on one or both ends by the ATPase 19S cap (PA700). The 19S RP is responsible for 20S gate opening, substrate recognition and binding, unfolding, and threading of ubiquitinated substrates into the 20S CP (Yu and Matouschek, 2017; Jung etal. 2014)

[0024] A number of other non-ATPase regulatory particles such as the 1 1 S complex (PA28) and PA200 also reversibly associate with the 20S CP by docking onto the a- rings. The 19S RP consist of two subcomplexes, the base that interacts directly with the 20S and a peripheral lid. The base is comprised of hexameric AAA- ATPase subunits, Rpt1-Rpt6, and tetrameric non-ATPase subunits, Rpn1 , Rpn2, Rpn10, and Rpn13. The ATPase activity in the base is essential for protein substrate unfolding, gate opening, and translocation of substrate into the 20S core. The lid is made of nine non-ATPase subunits; Rpn3, Rpn5-Rpn9, Rpn11 , Rpn12, and Semi . The lid, specifically the Rpn11 subunit, functions as a deubiquitinase. Rpn13, Rpn10, and other reversibly associated proteins, such as radiation sensitivity abnormal 23 (Rad23) and dual-specificity protein kinase 2 serve as ubiquitin receptors that direct polyubiquitinated proteins to the proteasome. The Rpn subunits also create docking site (s) for other proteins including the proteasome associated deubiquitinating enzymes, ubiquitin specific peptidase 14 (USP14), and ubiquitin C-terminal hydrolase (UCH37) (Njomen and Tepe, 2019; Collins and Goldberg, 2017; Yu and Matouschek, 2017).

[0025] The 26S Proteasome and Ubiquitin-ATP-Dependent Proteolysis.

[0026] The 26S proteasome mainly targets structured proteins for degradation, although a certain fraction of misfolded, intrinsically disordered proteins (IDPs) and proteins containing disordered regions (IDRs) are also degraded by the 26S. Structured proteins due for degradation are tagged with chains of polyubiquitin which serve as a degron for

[0027] 3

[0028] SUBSTITUTE SHEET (RULE 26) their turnover. Polyubiquitinated proteins are recognized by the ubiquitin receptors, Rpn10 and Rpn13.The ubiquitin tag is then removed by deubiquitinases such as the Rpn1 1 , LISP14, and UCH37. The ATPase activities of the 19S base then unfolds and directs the protein into the catalytic chamber for degradation (Collins and Goldberg, 2017).

[0029] A well-defined series of enzymes, ubiquitin ligases (E1 , E2, and E3) coordinate the attachment of mono- and polyubiquitin to proteins. Ubiquitin is first activated in an ATP- dependent reaction by an E1 ubiquitin-activating enzyme, to which it becomes attached by a thioester bond. Subsequently, the activated ubiquitin is transferred to the active site cysteine of the E2 ubiquitin-conjugating enzyme. Ubiquitin-protein ligase (E3), together with E2 catalyze the transfer of ubiquitin onto the protein that is destined for degradation (Collins and Goldberg, 2017; Yu and Matouschek, 2017)

[0030] The 20S Proteasome and Ubiquitin-Independent Proteolysis.

[0031] Unlike the 26S proteasome which primarily degrades polyubiquitinated proteins, the 20S directly degrades misfolded, oxidatively damaged, and IDPs and IDR-containing proteins and does not require the unfoldase activity of the 19S base. Furthermore, 20S-mediated proteolysis does not require polyubiquitination of its substrates. IDPs and IDR-containing proteins, which lack this 3-dimensional structure, are thought to readily traverse the a- ring gate of 20S proteosome. Twenty percent of cellular proteins are classified as IDPs and as many as 41 % of the eukaryotic proteome is predicted to contain IDRs, suggesting that the substrate pool of the UIPS may be considerably large. These substrates are particularly relevant because they include the proteins that accumulate in neurodegenerative disorders, such as amyloid beta, tau, TDP-43, and a-synuclein, Prion Protein (PrP), Polyglutamine Repeats.

[0032] In cells, IDPs typically have shorter half-lives relative to structured proteins. The UPS and UIPS have both been shown to facilitate the rapid proteasomal degradation of IDPs, such as p21 , p53 and p27 (Chiti and Dobson, 2017).

[0033] The most important concern that may occur as consequence of decreased protesome activity is the accumulation of potentially toxic un / misfolded proteins as well as protein aggregates. The proteasome impairment will eventually affect the vital function of cytosolic processes and all other organelles due to the accumulation of unfolded and damaged proteins. In addition, the accumulating waste will also impede the recycling of amino acids and Ub that are both required for cell survival (Reichmann,et al. 2018).

[0034] 4

[0035] SUBSTITUTE SHEET (RULE 26) The accumulation of unfolded, misfolded, or damaged proteins severely impairs the function of organelles and cells and has been recognized as a crucial factor in aging and a wide variety of diseases.

[0036] During ageing, oxidized proteins appear to aggregate and accumulate to abnormally high levels. Such large aggregates, including amyloid, amorphous, or native-like assemblies, have links with a number of human diseases and physiological processes including ageing and ageing related diseases (Chondrogianni et al., 2015).

[0037] It is well known that total rates of protein degradation are reduced as an organism ages. It is also known that a decline in proteasome activity has been broadly implicated in ageing and age associated diseases, including neurodegeneration. Presumably this decline contributes to a catastrophic imbalance in proteostasis and accumulation of damaged and / or misfolded proteins.

[0038] The species with increased longevity and long-lived individuals within a given species exhibit higher proteasome activity and are less susceptible to diseases, including neurodegeneration (Chondrogianni et al, 2015).

[0039] Multiple studies have found that increased proteasome activity is beneficial, decreasing the accumulation of pathogenic proteins and delaying aging.

[0040] Since oxidatively modified proteins are known to be more susceptible to proteolytic degradation by the proteasome than native proteins, it seems obvious that the proteolytic activitiy of the proteasome is required more and more with increasing age. In contrast, it was known that the proteasome activity is progressively decreased with increasing age particularly by accumulating oxidized and cross-linked cellular proteins as shown in experiments.

[0041] Several reports indicate that one of the first detectable consequences of proteasome dysfunction concerns mitochondria, which develop deleterious alterations in their proteome (Pan et al, 2021 ). The protesome pathway preserve mitochondrial plasticity and quality by controlling several levels of mitochondrial dynamics. Depending on the degree of stress, they trigger adaptive responses (moderate stress) and removal of the damaged organelle by mitophagy (sustained stress) or, if these measures fail, induce cell death (irreparable damage). These activities and processes are tightly interconnected. During moderate stress, as a first line of defense against mitochondrial dysfunction, the protesome pathway is in charge of outer membrane PQC (protein quality control) and the degradation of damaged proteins in a process called outer mitochondrial membrane-associated degradation (OMMAD). Moreover, the protesome

[0042] 5

[0043] SUBSTITUTE SHEET (RULE 26) pathway directly controls mitochondrial dynamics by ubiquitinating and degrading proteins involved in mitochondrial fusion and fission processes (Roussel etal., 2013).

[0044] Several reports indicate that one of the first detectable consequences of proteasome dysfunction concerns mitochondria, which develop deleterious alterations in their proteome. Mitochondria are the cellular power plants that produce energy through oxidative phosphorylation. They also directly contact most (if not all) other cytosolic organelles (e.g., endoplasmic reticulum (ER), plasma membrane, and peroxisomes) to generate specialized networks that control several cellular functions like Ca2+ homeostasis, lipid synthesis, and apoptosis. Importantly, dysfunctional mitochondria are also the major source for oxidative stress through aberrant production of ROS, which has profound implications for the pathogenesis of various diseases, in particular neurodegenerative disorders and cancer, as well as aging.

[0045] As an inactive proteasome also compromises the ER-associated degradation (ERAD) pathway, severe ER stress is another unavoidable consequence of sustained proteasome inhibition (Ding et al, 2007).

[0046] Studies indicate that the cell is able to reversibly disassemble 26S proteasomes to elevate the levels of free 20S particles under oxidative conditions or in response to mitochondrial dysfunction (Davies, 2001 , Aiken etal.2011 ).

[0047] Autophagy lysosome pathway is another degradation pathway in which cytoplasmic components, such as protein aggregates and damaged organelles are degraded and recycled for maintaining normal cellular homeostasis. Depending on the context, autophagy and the proteasome share common substrates as well as regulatory factors. Both systems intersect and communicate at multiple points to coordinate and balance their actions in proteostasis and homeostasis of organelles (Kocaturk and Gozuacik, 2018).

[0048] Protein oxidation is a factor in multiple diseases of aging, including Alzheimer’s and Parkinson’s disease, atherosclerosis and arteriosclerosis, stroke, cancer, arthritis, cataract, macular degeneration, frailty and many others.

[0049] Loss of protein homeostasis and the adaptive capacity to respond to oxidative stress during aging may have a staggering impact on the world economy.

[0050] Therefore, finding a new method that increase the proteasome activity will be invaluable.

[0051] Glycogen synthase kinase-3 and its regulation

[0052] 6

[0053] SUBSTITUTE SHEET (RULE 26) Glycogen synthase kinase-3 (GSK-3) was originally demonstrated to play an important role in regulating glycogen synthesis, as one of the molecular events involved in insulin signaling. However, It was revealed that GSK-3 regulates a number of cellular functions such as cell proliferation, stem cell renewal, apoptosis and development (Pan and Valapala, 2022; Takahashi-Yanaga, 2013). Glycogen synthase kinase-3 (GSK-3) has two different paralogs, GSK-3a and GSK-3p. Although the mechanisms regulating GSK- 3 are not fully understood, It is well known that GSK-3 p can be indirectly modulated via regulation of several intracellular signaling cascades. It has long been kown that the two main signaling pathways known to affect GSK-3 are the Wnt / b-catenin and insulin pathways (Souder and Anderson, 2019, Takahashi-Yanaga, 2013, Mancinelli et al 2017) Currently, the reported Wnt signaling pathways are mainly grouped into the canonical pathway (a.k.a. Wnt / p-catenin signaling) and noncanonical pathways (e.g., Wnt / planar- cellpolarity-like pathway and the Wnt / Ca2+ pathway). While Wnt proteins participate in multiple important signaling pathways, their roles are not well understood.

[0054] In the Wnt / b-catenin signaling pathway (the canonical pathway), a Wnt induced inhibition of GSK-3 has been described. Without Wnt signals, cytoplasmic b-catenin is maintained at a low level through ubiquitin-proteasome-mediated degradation, which is regulated by the “destruction” complex composed of four different proteins: axin, adenomatous polyposis coli (APC), casein kinase 1 a (CK1 a) and GSK-3 (Takahashi-Yanaga, 2013; Palomer, et al 2019; Lecarpentier et al, 2019; Law and Zheng 2022)

[0055] Wnt signaling is initiated by binding of the extracellular secreted Wnt ligands (mainly WNT1 , WNT3A, and WNT8) to the seven transmembrane receptor Frizzleds / low-density (FZD) and its coreceptors LRP5 and LRP6. Upon binding of Wnt proteins to a receptor complex comprised of FZD lipoprotein receptor-related protein (Fz / LRP ), cytoplasmic Disheveled (Dvl), a protein downstream of the receptor complex, is phosphorylated thereby inhibiting GSK-3, resulting in the accumulation of b-catenin in the cytoplasm. Accumulated p-catenin translocates into the nucleus and forms a complex with members of the T-cell factor / lymphoid enhancer factor (TCF / LEF) family of transcription factors. To generate a transcriptionally active complex, p-catenin recruits the transcriptional coactivators cAMP response element binding protein (CREB)-binding protein (CBP) or its closely related homolog, p300 as well as other components of the basal transcription machinery, leading to the expression of downstream target genes. Thus, the activation of GSK-3 results in the inhibition of the Wnt / p-catenin signaling pathway and conversely, the inhibition of this kinase activates this pathway. In addition, as described above, it is

[0056] 7

[0057] SUBSTITUTE SHEET (RULE 26) also known that induction of the Wnt pathway inhibits GSK-3 (Larasati et al 2022;. Takahashi-Yanaga, 2013; Palomer, et al 2019)

[0058] In the canonical Wnt signaling pathway, several natural extracellular Wnt antagonists, including the Fz-related protein sFRP, Wnt inhibitory factor 1 , sclerostin, Wise, and DKK1 , exert inhibitory effects through competitively binding LRP5 / 6 to effectively block associations between Wnts and LRP5 / 6, thereby increasing the activity of GSK-3. Among them, DKK1 , a typical Wnt antagonist, antagonizes Wnt signaling by triggering the internalization of coreceptor LRP5 / 6 There are many studies showing that all wnt antogonists mentioned above, especially DKK1 are also effective on GSK-3 (Larasati et al 2022;. Takahashi-Yanaga, 2013; Palomer, et al 2019).

[0059] DKK1 , as a critical component in the canonical Wnt pathway including GSK-3, is linked to a variety of diseases including cancer, Alzheimer’s Disease, type 2 diabetes mellitus, and cardiovascular disease.

[0060] The signaling cascade is a complex canonical pathway in which [3-catenin is the master regulator. However, research showed that Wnt signal cascade may act independent of p-catenin, executing its effects in early development where calcium signaling is the central mediator.

[0061] While canonical Wnt signaling has been extensively dissected from the view point of molecular biology and biochemistry, non-canonical Wnt / Ca2+signaling has been less focused on. However, non-canonical Wnt signaling pathways such as Wnt planer cell polarity pathway, Wnt-JNK signaling pathway, Wnt / Ror receptor pathway, Wnt-GSK3MT pathway, Wnt-aPKC pathway, Wnt-RYK pathway, and Wnt-mTOR pathway may also transduce calcium-dependent cell signaling (Huang et al 2022, Larasati et al 2022;. Takahashi-Yanaga, 2013; Palomer, et al 2019)

[0062] The Non-canonical Wnt Signaling Cascade

[0063] The Wnt ligand is a secreted lipid-modified glycoprotein that binds to its cell surface receptor ligand Frizzled (Fz). The receptor has three extracellular and three intracellular loops. The extracellular N terminus contains a cysteine-rich domain (CRD) that binds to the cognate ligand. There are sites for glycosylations on the extracellular loops. The intracellular C terminus contains the PDZ (Psd-95 / dics large / ZO1 )-binding domain, all direct binding proteins identified so far, which physically interact with Fz in the downstream regulatory process have PDZ domain. According to the International Union of Pharmacology and other published reports, Fz receptors are G protein-coupled

[0064] 8

[0065] SUBSTITUTE SHEET (RULE 26) receptors. The binding of Wnt ligand to cognate Fz receptor leads to a short-lived increase in the concentration of certain intracellular signaling molecules, inositol 1 ,4,5- triphosphate (IP3), 1 ,2 diacylglycerol (DAG), and Ca2+(De, 2018). The elevation at the level of one or other secondary messengers leads to a rapid alteration in cellular function. IP3 and DAG are derived from membrane-bound phospholipid phosphatidyl inositol 4,5-bisphosphate by the action of phospholipase C located on the plasma membrane. Phospholipase C is activated by receptor ligand interaction. IP3 diffuses through the cytosol and interacts with the calcium channels present on the membrane of endoplasmic reticulum (ER) resulting in release of calcium ions. Calcium ions along with ubiquitously expressed eukaryotic protein calmodulin activate calcium calmodulindependent protein kinase II (CaMKII). DAG produced by hydrolysis of phosphatidyl inositol 4,5-bisphosphate along with released calcium from ER activates protein kinase C (PKC). Both CaMKII and PKC activate various regulatory proteins (NFKB and CREB), which are nuclear transcription factors. Similarly, calcium ions mobilized by IP3 from ER can activate widely expressed protein phosphatase calcinurin (Cn) that can activate cytoplasmic protein nuclear factor associated with T cells (NFAT) via dephosphorylation. Activated NFAT may boost the expression of several genes in neurons, cardiac and skeletal muscle cells, and pro-inflammatory genes in lymphocytes. Also, Wnt / Fz receptor ligand interaction may activate phosphodiesterase 6 (PDE6) in a calcium-dependent manner, leading to a decrease in cyclic guanosine monophosphate (cGMP) (Karabicici et al 2021 ; Takahashi-Yanaga, 2013; Palomer, et al 2019).

[0066] From ‘classical’ concept it may be said that Wnt1 , Wnt3a, Wnt8, and Wnt8b act in the canonical Wnt signaling pathway whereas Wnt4 and Wnt5a take part in the non- canonical Wnt signaling pathway. Several publications have shown that Wnt5a takes part in the non-canonical Wnt signaling pathway. Wnt5a, a ‘classical’ non-canonical Wnt signal transducer, activates the calcium signaling pathway in the presence of an Fz receptor. It has been shown that Wnt5a activates the calcium signaling pathway in the presence of receptor Fz2, 3, 4, 6, and receptor Fz 5; however Wnt5a may activate the [3- catenin-dependent pathway leading to an expression of downstream genes, if it encounters receptor Fz4 in the presence of low density lipoprotein receptor-related protein 5 (LRP5) or receptor Fz5 (Karabicici et al 2021 ; Takahashi-Yanaga, 2013; Palomer, et al 2019).

[0067] Wnt5a / Ror signaling activates the Ca2+ / CaMKII pathway and plays paramount roles in axonal pathfinding in mammalian brain. Also, the Fz receptors for Wnt ligands activating

[0068] 9

[0069] SUBSTITUTE SHEET (RULE 26) the p-catenin pathway remains coupled to LRP5 / 6 co-receptors and it has already been discovered that LRP5 / 6 co-receptors may take part in the non-canonical Wnt signaling pathway and may inhibit or cooperate in a complex way. It wa shown that in the presence of Wnt3a, the cells activated the canonical pathway, whereas in the presence of Wnt5a the cells activated the non-canonical pathway, with concomitant phosphorylation of co-receptors LRP5 / 6 and Ror2, respectively. In both cases, phosphorylation was mediated by GSK-3. It is worth mentioning that Dkk proteins belong to a distinct category of ligands that bind to LRP6 and are potential modulators of the canonical Wnt / p-catenin signaling cascade (Karabicici et al 2021 ; Takahashi-Yanaga, 2013; Palomer, et al 2019)..

[0070] Later it was discovered that Ca2+are the second messengers in Wnt5a signaling, which arise from G protein-linked phosphatidyl inositol signaling. Calcium also can regulate GSK-3 activity through calpain; calpain truncates the N-terminal regulatory domain of GSK-3 (Karabicici et al 2021 ; Takahashi-Yanaga, 2013; Palomer, et al 2019).

[0071] Cell signaling cascades activated by Wnt proteins are well conserved throughout evolution. Thus, it is not surprising that changes in Wnt pathway components and modulators — including loss or gain of function — play a role in many pathologies associated with proliferation, differentiation, motility and survival / apoptosis.

[0072] The Wnt signaling pathways similar to the GSK-3 play key roles in maintenance of homeostasis in mature tissues, growth, development, and cancer (Mancinelli et al 2017). Many molecules have been identified that have been proven to affect these two systems, which play a role in many pathologies associated with proliferation, differentiation, motility and survival / apoptosis

[0073] In addition, there are many publications that the Wnt pathways, in which GSK-3 is involved, is directly related to Alzheimer’s Disease (Takahashi-Yanaga, 2013; Palomer, et al 2019).

[0074] The above information and many similar publications show that both Wnt and GKS-3 play a role on the same pathway.

[0075] In insulin signaling pathway, Insulin activates phosphatidyl-inositide 3-kinase (PI3K) which in turn activates 3-phosphoinositide-dependent protein kinase 1 (PDK1 ), thus leading to Akt kinase phosphorylation. The latter phosphorylates and inhibits GSK-3, leading to dephosphorylation of GSK-3 substrates such as glycogen synthase and eukaryotic initiation factor 2B (elF2B), finally promoting conversion of glycogen synthase

[0076] 10

[0077] SUBSTITUTE SHEET (RULE 26) to its active form and stimulating both glycogen and protein synthesis (Huang et al 2022, Larasati et al 2022;. Takahashi-Yanaga, 2013; Palomer, et al 2019, Hermida et al 2018). Multiple signaling pathways feed into this site to imodulate the activation of GSK3, which can be mediated by Akt, protein kinase A (PKA), protein kinase C, p70 S6 kinase, and other kinases (Hermida et al 2018).

[0078] Over the past few years, a series of studies involving a combination of biochemical and behavioral approaches in normal and genetically modified mice have provided converging evidence for an involvement of the signaling molecules Akt and GSK3 in the regulation of behaviors by dopamine, norepinephrine, and 5-HT (with the exception of 5HT3 receptors) belong to the large family of G protein-coupled receptors (GPCRs) (Beaulieu et al 2009).

[0079] GSK3 has regulatory interactions with multiple intracellular receptor-coupled signaling proteins, such as [3-arrestin and G-proteins, as well as with several receptors themselves. Most wellunderstood is the dopamine D2 receptor signaling mechanism that involves GSK3 and [3-arrestin (Beaulieu et al 2009).

[0080] Overall, antidepressants acting on serotonin neurotransmission have been reported to activate Akt and inhibit GSK3. Several psychoactive drugs have also been shown to modulate the activity of the Akt / GSK3 signaling (Beaulieu et al 2009).

[0081] Drugs like Selective serotonin reuptake inhibitors (SSRIs) and MAO inhibitors that elevate serotonin synaptic transmission have been shown to inhibit GSK-3. On the contrary, drugs that elevate dopamine neurotransmission increase the kinase activity of GSK3 (Ropinirole, pramipexole, and levodopa are the well known drugs that boost dopamine levels). By blocking dopamine D2 receptors, classic antipsychotics can prevent the inhibition of Akt by dopamine and concomitant activation of GSK3. Atypical antipsychotics are also antagonists of serotonin receptors and may interfere with the regulation of GSK3 by the serotonin. Akt / GSK3 pathway is regulated by different types of psychiatric drugs, including antidepressants and lithium. Lithium activates PI3K itself, which in turn results in PI3K-dependent phosphorylation and activation of the Akt, then phosphorylation and inactivation of the GSK-3 (Beaulieu et al 2009; Kitagishi et al 2012). At present, the inhibitors for PI3K / Akt signaling are as follows. Pan-PI3K inhibitors, wortmannin and LY294002, are commonly used to inhibit cancer cell proliferation. Wortmannin is a fungal product, which exerts its effect by the covalent interaction to the conserved Lys802 of the p110a catalytic subunit. Both wortmannin and LY294002

[0082] 11

[0083] SUBSTITUTE SHEET (RULE 26) crossreact with PI3K-related kinases such as mTOR. A p1106 specific inhibitor (IC486068) enhances tumor vascular destruction (Kitagishi et al 2012).

[0084] The first developed group of Akt inhibitors was lipid-based inhibitors that include perifosine, phosphatidylinositol ether lipid analogs. The perifosine inhibits the translocation of Akt to the cell membrane. Inositol pentakisphosphate, one of the PI3K / Akt inhibitors, also inhibits tumor growth and angiogenesis. Several other Akt antagonists such as 9-methoxy-2-methylellipticinium acetate, indazole-pyridine A- 443654, and isoform-specific canthine alkaloid analogs have also been identified (Kitagishi et al 2012).

[0085] GSK-3 can also be phosphorylated at Ser9 / Ser21by the most downstream kinase of the classical mitogen-activated protein kinase (MAPK) cascade, called MAPK-activated protein kinase- 1 (MAPKAP-K1 , also called RSK). This provides a route for the inhibition of GSK3 by growth factors and other signals that activate this pathway. However, while insulin inhibits GSK-3 via the PI 3-kinase dependent / PKB pathway, and signals such as tumour-promoting phorbol esters inhibit GSK-3 via the classical MAPK cascade, other growth factors, such as epidermal growth factor (EGF), can inhibit GSK-3 by both pathways (Karabicici et al 2021 ; Takahashi-Yanaga, 2013; Palomer, et al 2019).

[0086] Amino acids have also been shown to inhibit GSK-3; this occurs via the mammalian target of rapamycin (mTOR) and the downstream S6K1 kinase (p70 ribosomal S6 kinase-1 ). S6K1 Another protein kinase that phosphorylates GSK-3 at Ser9 / Ser21in vitro is p70 ribosomal S6 kinase-1 (S6K1 ), and evidences suggests that this may underlie the inhibition of GSK-3 induced by amino acids in human myocytes. Thus the immunosuppressant drug rapamycin, which inactivates mammalian target of rapamycin (mTOR), a protein kinase required for the activation of S6K1 , suppresses the inhibition of GSK-3 induced by amino acids. The phosphorylation of GSK3 at Ser9 / Ser21can also be induced by incubating cells with cAMP-elevating agents or cell-permeant cAMP analogues, although the physiological relevance is not yet clear (Hermida et al 2017).

[0087] Reelin is a large secreted glycoprotein that is essential for correct neuronal positioning during neurodevelopment and is important for synaptic plasticity in the mature brain. Moreover, Reelin is expressed in many extraneuronal tissues; yet the roles of peripheral Reelin are largely unknown. In the brain, many of Reelin’s functions are mediated by a

[0088] 12

[0089] SUBSTITUTE SHEET (RULE 26) molecular signaling cascade that involves two lipoprotein receptors, apolipoprotein E receptor-2 (Apoer2) and very low density-lipoprotein receptor (Vldlr), the neuronal phosphoprotein Disabled-1 (Dab1 ), and members of the Src family of protein tyrosine kinases as crucial elements. Importantly, it was well demonstrated that the reelin pathway modulates GSK-3 via PI3 / akt (Bock and May, 2016).

[0090] In addition, it was demonstrated that Reelin directly potentiates glutamate-induced NMDA receptor-dependent calcium influx. This was mediated via activation of Src kinases, Dab1 and NMDAR phosphorylation and induced the phosphorylation of cAMP- responsive element binding protein (Creb) at serine 133, a transcription factor that modulates many aspects of neuronal development, plasticity and behavior in response to PI3K / Akt and Erk activation (Bock and May, 2016).

[0091] Studies reveal that, although its protumor or antitumor role is still debated depending on the cellular context, GSK-3 may be considered a promising molecular target in different tumors. In some studies, GSK-3 action supports cancer cells and suggest that its inhibition may have therapeutic benefits. Many GSK-3 inhibitors have been developed and may have an application in GSK-3 overexpressing tumors (Mancinelli et al 2017; Lecarpentier et al, 2019).

[0092] In fact, GSK-3 is suggested as a possible therapeutic target for many diseases, and many selective GSK-3 inhibitors are now available (Eldar-Finkelman and Martinez, 201 1 ).

[0093] Interestingly, almost all of the studies and patent applications on GSK-3 are related to the development of new GSK-3 inhibitors. To the extent that no molecule has been developed and described that directly activates GSK-3.

[0094] However, as stated above, it has been determined that molecules provide GSK-3 activation in many different pathways. For example, Differentiation-inducing- factor-1 (DIF-1 ), a morphogen produced by the cellular slime mold Dictyostelium discoideum is a critical component in the canonical Wnt pathway including GSK-3, is linked to a variety of diseases. It was reported that DIF-1 and DIF-3 inhibited the Wnt / b-catenin signaling pathway through the activation of GSK-3b independent of Akt inhibition, although the exact mechanism by which DIFs activate GSK-3b is not known (Wu and Pan, 2010).

[0095] In addition to the DIF-1 some other natural compounds such as All- ans retinoic acid (RA), Resveratrol, Diferuloylmethane (curcumin), berberine (BBR) Berberiscoptes and

[0096] 13

[0097] SUBSTITUTE SHEET (RULE 26) Troglitazone were reported to be related to Wnt pathway. Interestingly, all compounds mentioned above are shown to be linked to GSK-3 pathway regulation. In particular, curcumin (CUR) Curcuma longa, CUR acts by increasing the total level of GSK-3 / 3 in NCCIT human embryonic carcinoma cells, and in different types of cancer and pathologies such as neurological diseases, obesity, diabetes, and cardiovascular disease. BBR and RES act on PI3K / PTEN / AKT / mTORC1 / GSK-3 pathway with beneficial effects on diabetes, cardiovascular diseases, neurological disorders, and cancer (Morris et al 2022; Larriba et al. 2013; Neiheisel et al 2022; ).

[0098] Along with natural products, many molecules have been described that inhibit the Wnt / b- catenin and increase the activity of GSK-3 with the help of computer-aided drug technology and its clinical applications has been started (Table 1 ). Table shows the small-molecule modulators and their functions on the Wnt / b-catenin-GSK-3 pathway (Eldar-Finkelman and Martinez, 201 1 )..

[0099] Although GSK-3 activators could be used for the treatment of cancer and cardiac hypertrophy, no specific GSK-3 activators are presently under development. The majority of the reported inhibitors suppress PI3K / Akt activity, thereby activating GSK-3. Celecoxib, a non-steroidal anti-inflammatory drug (NSAID) developed as a selective inhibitor of COX-2, is used for the treatment of various forms of arthritis and for the management of acute and chronic pain. Celecoxib and 2,5-dimethyl-celecoxib (DMcelecoxib), a derivative that does not inhibit COX-2, were described as GSK-3b activator. The therapeutic effects of celecoxib and 2,5-dimethyl-celecoxib (DMcelecoxib), a derivative that does not inhibit COX-2, on cancer progression by inhibiting Akt and thereby activating GSK-3b have been reported. It was reported that celecoxib and DMcelecoxib prevented cardiac remodeling and reduced mortality in a dilated cardiomyopathy mice model through a COX-2-independent mechanism involving GSK-3 (Abdelhaleem et al, 2022).

[0100] Although major pathway components have been characterized in detail, regulation of Wnt signaling together with the GSK-3 within the context of human diseases remains only partially understood and has contradictory results. As mentioned above, almost all studies of disease treatment with GSK-3 modulation have been based on the use of drugs for GSK-3 inhibition.

[0101] Extensive lists of GSK-3 substrates have been reported and include amyloid precursor protein, APC, ATP-citrate lyase, axin, axil, / 3-catenin, c-jun, Jun B, Jun D, Ci155, C / EBP alpha, CRMP2, CRMP4, CREB, CTP, cyclin D1 , dystrophin, elF2B, glycogen synthase,

[0102] 14

[0103] SUBSTITUTE SHEET (RULE 26) glucocorticoid receptor, heat shock factor 1 , hnRNP, K-casein, KRP, MAB 1 B, MAP 2, MAP 2C, MITF, c-Myc, L-Myc, alpha NAC nascent polypeptide-associated complex, NCAM, NDRG1 , NDRG2, neurofilament L, neurofilament M, neurofilament H, Notch 1 C, p21 CIP1 , p53, presenilin, pyruvate DH, PP1 G-subunit, protein phosphatase inhibitor 2, stathmin, synphilin-1 , RSK1 , and Tau (https: / / thebiogrid.org / and (Robertson et al 2018).

[0104] However there is no clear explanation how the GSK-3 effect those different substrates.

[0105] SUMMARY OF THE INVENTION

[0106] It is well known that total rates of protein degradation are reduced as an organism ages. It is also known that a decline in proteasome activity has been broadly implicated in ageing and age associated diseases, including neurodegeneration.

[0107] Therefore, timely removal of oxidatively damaged proteins is of critical importance to maintain normal cellular homeostasis and viability (Hipp et al., 2014).

[0108] Increasing proteolytic capacity provides an alternative approach to maintaining proteostasis.

[0109] The proteasome is the cell’s first defense mechanism against accumulating proteotoxic stresses induced by oxidative damage.

[0110] The present invention is based on finding that GSK-3 modulations (increase or decrease in activity) affect the proteasome activities including chemotrypsin, trypsin and caspaselike activities. The present invention demonstrated that direct inhibition of the GSK-3 decreases the proteasome activities including Chemotrypsin Trypsin, and caspase-like dramatically (Fig. 3A-C). In addition, the present invention demonstrates that silencing the GSK-3 expression decreases the proteasome activities (Fig. 10 A-C). Importantly, the present invention demonstrated that GSK-3 activation increases the proteasome activities (Fig. 4 C-E). In the invention the more direct finding of GSK-3 increases proteasome activities is that the overexpression of GSK-3 in the HepG2 and T98G cells increases the cell’s proteasome activities (Fig.9 A-F).

[0111] The present invention states that GSK-3 modulation and consequent proteasome modulation may be directly mediated by molecules (eg. BIO, Lithium, etc.) or indirectly as a result of modulation of Wnt, insulin, PI3K- AKT, MAPK-MAPKAP-K1 , mTOR- S6K1 , cAMP-PKA, the toll-like receptor (TLR) family, Calcium, Reelin, Norepinephrinedopamine, inflammation and other pathways, which have been shown to modulate GSK- 3.

[0112] 15

[0113] SUBSTITUTE SHEET (RULE 26) Therefore, without wishing to be bound by any theory or mechanism of action, the present invention claims that the GSK-3 modulations change the proteasome activity including chemotrypsin, trypsin and caspase-like activities.

[0114] The invention claims and provides that Wnt activation inhibits the proteasome activities including chemotrypsin, trypsin and caspase-like by inhibiting GSK-3 (Fig. 4 A, B, E). In addition, the invention claims and provides that the inhibition of Wnt pathways increase the proteasome activities including chemotrypsin, trypsin and caspase-like activities by activating the GSK-3 (Fig. 4 C, D, and E).

[0115] The decline of the total rate of protein degradation contributes to a catastrophic imbalance in proteostasis and accumulation of oxidatively damaged and / or misfolded proteins. Therefore, the present invention provides compositions and methods for treatment of the diseases caused by the oxidatively damaged and / or protein-misfolding disorders by increasing the proteasome activity.

[0116] The present invention encompasses the finding that activation of proteasome by GSK-3 aktivators, through increased levels and / or increased activity, can provide effective treatment for, and even prophylaxis of, certain proteinopathies.

[0117] The present invention specifically encompasses the insight that, in some instances, increased chemotrypsin, trypsin and caspase-like activities of proteasome can provide effective treatment (and / or prophylaxis) of certain proteinopathies.

[0118] Thus, the present invention provides, in one aspect, a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer thereof, for use in treating the oxidatively damaged and / or protein-misfolding diseases. The disorders', related to the amyloidogenic intrinsically disordered proteins may comprise, but are not limited to amyloid p peptides, tau (Alzheimer’s disease), a-synuclein (Parkinson’s disease and other synucleinopathies), TAR DNA-binding protein 43, fused in sarcoma (FUS) protein (amyotrophic lateral sclerosis (ALS)), huntingtin (Huntington’s disease), a number of human functional amyloids (cytoplasmic polyadenylation element-binding protein (CPEB), T-cell-restricted intracellular antigen-1 (TIA-1 ), premelanosome protein 17 (Pmel17), secretory peptide hormones), and cell cycle related proteins including p53, p27, p21 (cell cycle, apoptosis), and others

[0119] 16

[0120] SUBSTITUTE SHEET (RULE 26) Thus, the present invention provides, in one aspect, a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer, which increases the proteasome activation and accordingly degrades the tested IDPs p53, p21 , pTau, which are the above determined IDP proteins (Fig. 4 C-E, Fig. 6 A-C, Fig. 7 A-H).

[0121] In some embodiments, the present invention provides proteasome activation by increasing GSK-3 activation as a new therapeutic approach to target proteotoxic disorders which are related to the amyloidogenic intrinsically disordered proteins aforementioned above and others.

[0122] As used herein, the term "amyloidopathy" or "amyloidopathic" refers to diseases, disorders, and / or conditions that are associated with or characterized by pathological accumulation of the any disease-linked protein exhibiting amyloid conformation (i.e., 3- pleated sheet), including but not limited to Alzheimer's disease, vascular dementia, and cognitive impairment.

[0123] Therefore, the present invention provides activation of proteasome in aged individuals, who are the major victim of proteotoxic disorders and diseases. Therefore, the present invention targets proteasome, which is one of the major target in preventing of aging which is associated proteotoxic disorders which is often associated with multiple human diseases. Furhermore, the present invention provides that targeting protesome is effective in treating and preventing of aging.

[0124] According to an aspect of some embodiments of the present invention there is provided an GSK-3 activator for use in treating aging and / or aging related conditions or diseases dependent protesome trypsin, chymotrypsin, and caspase-like activities decrease.

[0125] Therefore, the present invention provides compositions and methods not only treat diseases, but more importantly, prevent the causes of diseases which is associated with malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins.

[0126] In another embodiment, the present invention demonstrated that GSK-3 activators prevented cell senesence as a result of the experiment with p-galactosidase staining and cell proliferation assay of primary fibroblast cells (Fig .1 1 A-D) .

[0127] The present invention also demonstrated that modulations of GSK-3 affects the life span of C. elegans worms. The present invention demonstrated that at day 20, 2 times less

[0128] 17

[0129] SUBSTITUTE SHEET (RULE 26) worms survived in the group that received the GSK-3 inhibitors BIO and SKL2001 , compared to the group with the no-treatment (Fig. 12A and B). The present invention further demonstrates that the worm’s locomotor activities decreased dramatically in the presence of GSK-3 inhibitors BIO and SKL2001 (Fig. 12B).

[0130] In another embodiment, the present invention demonstrates that at day 22, almost 2 times more worms survived in the group that received the GSK-3 activator, celecoxib compared to group with the no-treatment (Fig. 12 C and D). In another embodiment, the present invention further demonstrates that the worm’s locomotor activities increase in the presence of GSK-3 activator, celecoxib compared to group with the no-treatment (Fig. 12 D).

[0131] The age-related reduction in fat oxidation may promote the accumulation of total and central body fat. Adipogenesis and lipid accumulation during aging have a great impact on the aging process and the pathogenesis of chronic, age-related diseases. Therefore, in the presence of BIO and control C. elagans groups on 20th days, the amount of fat in the organism was investigated by Nile Red staining. The results of the invention show that, on the 20th day, lipid accumulation in the C. elagans groups treated with BIO were more than 6-fold higher than the C. elegans grown in the medium without a drug (Figs 12 E and F). Further, present invention provides that lipid accumulation in the C. elagans groups treated with Celecoxib were significantly less compared to the C. elegans grown in medium without a drug (Figs 12 G and H).

[0132] NAD+ / NADH and NADP+ / NADPH are involved in various biological processes in mammalian cells. Although NAD+ and NADP+ are synthesised in sufficient amounts under normal conditions, shortage in their supply due to over consumption and their decreased synthesis has been observed with increasing age and under certain disease conditions. Several studies have proved that in a wide range of tissues, such as liver, skin, muscle, pancreas, and fat, the level of NAD+, NADP+ decreases with age. Therefore, the amount of NADP+ was investigated in C. elagans treated with a GSK-3 inhibitor or activator. It was found that 2 times less NADP+ was detected in the C. elagans treated with a GSK-3 inhibitor, BIO compared to the C. elegans without a drug (Fig. 12 I) and 2 times more NADP+ was detected in the C. elagans treated with celecoxib, compared to the C. elegans without drug on the 20th day ( Fig. 12 J).

[0133] 18

[0134] SUBSTITUTE SHEET (RULE 26) Therefore, the present invention provides a mediciment increase in both the healthspan and lifespan.

[0135] Further, the present invention provides compositions and methods effective in ameliorating onset and I or progression of the ageing. In particular the compositions of the present invention diminish or prevent symptoms of the ageing through increasing the proteasom activity.

[0136] Therefore, the present invention provides compositions and methods for treatment of aging which is associated with malfunctioning of the protein homeostasis network and interferes with crucial signaling pathways and is often associated with multiple human diseases.

[0137] Oxygen free radicals and other oxidants are causing potential danger for intracellular proteins during the lifetime of cells and organisms. The degradation of non-functional, oxidized proteins is an essential part of the antioxidant defenses of cells. The major proteolytic system responsible for the removal of oxidized cytosolic proteins is the proteasomal system (Grune, 2010).

[0138] According to an aspect of some embodiments of the present invention, there is provided an GSK-3 activator for use in detoxifying the cells with oxidatively damaged proteins by inducing the activity of the proteasome complex which is capable of directly targeting oxidatively damaged proteins to detoxify the cell.

[0139] Therefore, the present invention provides compositions and methods not only treat diseases, but more importantly, treat the causes of diseases which is associated with malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins.

[0140] According to an aspect of some embodiments of the present invention provides compositions and methods effective in ameliorating onset and / or progression of the ageing which is associated with malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins.

[0141] Therefore, the present invention provides compositions and methods which prevents the malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins, which are shown as the most important cause of aging, and provides prolongation of life.

[0142] 19

[0143] SUBSTITUTE SHEET (RULE 26) Many literature exists that on increased amounts of oxidized proteins in skeletal muscle, heart, skin, liver, lymphocytes and other tissues of various animal species during aging. Therefore, the present invention provides compositions and methods which maintain and increase muscle mass, strength and performance. In addition, the irreversible loss of cardiomyocytes due to oxidative stress is the main cause of heart dysfunction following ischemia / reperfusion injury and ageing-induced cardiomyopathy. Therefore, the present invention provides compositions and methods which prevents heart diseases by maintaining and / or improving the performance of the heart muscle, and is effective in ameliorating onset and I or progression of the heart dysfunction following ischemia / reperfusion injury and ageing-induced cardiomyopathy.

[0144] In another embodimen the present invention provides a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer thereof, for use in preventing the metabolic syndrome by regulating protein homeostasis and protein quality control

[0145] The present invention encompasses the finding that activation of proteasome by GSK-3 activator, through udjusting the malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins, can provide effective treatment for, and even prophylaxis of, the obesity and obesity associated disorders including cardiovascular diseases, insulin resistance, diabetes mellitus, dyslipidemia.

[0146] The age-related reduction in fat oxidation, therefore, may promote the accumulation of total and central body fat. Adipogenesis and lipid accumulation during aging have a great impact on the aging process and the pathogenesis of chronic, age-related diseases. The present invention demonstrated that amount of lipid droplets in of C. elegans treated with a GSK-3 activator was significantly less than in the non-treated controls (Fig. 12 G and H). The aging associated with malfunctioning of the lipid-protein homeostasis network and interferes with crucial signaling pathways and is often associated with multiple human diseases including PD.

[0147] Therefore, the present invention provides compositions and methods which prevents adipogenesis and lipid accumulation during aging by maintaining and / or improving the performance of the the lipid-protein homeostasis network.

[0148] In addition, the present invention provides compositions and methods ameliorating onset and / or progression of the adipogenesis and lipid accumulation by maintaintaining

[0149] 20

[0150] SUBSTITUTE SHEET (RULE 26) and increasing the muscle mass, strength and performance since a reduction in the size and / or oxidative capacity of the metabolically-active muscle mass is an important determinant of reduced fat oxidation. Decreased muscle mass and function are often closely related to aging and metabolic syndromes including (i) mitochondrial dysfunction, which causes various skeletal muscle (SkM) pathologies such as sarcopenia and muscular dystrophy, (ii): inflammatory myopathy caused by inflammation and oxidative stress, such as dermatomyositis, polymyositis, necrotizing autoimmune myositis, and sporadic inclusion body myositis, and (iii) chronic diseases that cause SkM damage, such as type 2 diabetes, obesity, chronic kidney disease, and chronic obstructive pulmonary disease. These syndromes often lead to a decline in the quality of life of patients over time and increase patient mortality.

[0151] Therefore, the present invention further provides compositions and methods which prevents the aging and metabolic syndromes by increasing the muscle mass and activity.

[0152] Therefore, in another embodimen the present invention provides a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer thereof, for use in preventing the metabolic syndrome by regulating protein homeostasis and protein quality control.

[0153] As indicated above the present invention demonstrated that the locomotor activities of C. elegans treated with a GSK-3 inhibitor were significantly decreased than in the controls (Fig. 12 B). In addition, the present invention demonstrated that the amount of lipid droplets in muscle tissues of C. elegans treated with a GSK-3 inhibitor was significantly more than the non-treated controls (Fig. 12 E and F). The present invention also demonstrated that the amount of lipid droplets in muscle tissues of C. elegans treated with a GSK-3 activator was significantly less than in the non-treated controls (Fig. 12 H and I).

[0154] Thus, the present invention provides, in one aspect, a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer thereof, for use in preventing the metabolic syndrome by increasing muscle mass and activity and accordingly regulates lipid metabolism.

[0155] In addition, the present invention provides, in one aspect, a pharmaceutical composition comprising at least one GSK-3 activator or a oharmaceutically acceptable salt, hydrate

[0156] 21

[0157] SUBSTITUTE SHEET (RULE 26) or pharmaceutically active enantiomer thereof, for use in preventing the obesity and related diseases which occur in conjunction with metabolic syndrome caused by the changes in lipid metabolism with age.

[0158] Therefore the present invention encompasses the finding that activation of proteasome by GSK-3 activator, through increased levels and / or increased activity, is useful in the prevention, amelioration and / or treatment of disorders of the metabolism influencing body weight, in particular in the treatment of obese subjects, in particular in the treatment of human subjects.

[0159] In accordance with this invention it is also envisaged that GSK-3 activator is employed in the medical intervention of secondary disorders related to a (pathological) increase of body weight. These 'secondary disorders' may comprise, but are not limited to diabetes type 2, high blood pressure (hypertension), cardiovascular diseases, cancer, problems with sexual function and disorder of the muscular or bone system.

[0160] The present invention provides compositions and methods which maintain and / or decrease the aging of skin and hair by decreasing accumulation of oxidized protein and lipids and inflamation. Therefore, present invention according to an aspect of some embodiments of the present invention there is provided an GSK-3 activator for use in detoxifying the cells with oxidatively damaged proteins and lipids by inducing the activity of the proteasome complex which is usable in cosmetics as anti-ageing.

[0161] It was shown by Kapetanou et al. that the proteasome activation enhances sternness and lifespan of human mesenchymal stem cells (Kapetanou etal,2017). Therefore, the present invention provides compositions and methods which maintain and increase the sternness characteristics which is the potential for self-renewal and for multilineage differentiation and lineage reprogramming of stem cells. In addition, the present invention demonstrates that the usage of GSK-3 activator increase the lifespan of human primary fibroblast cells (Fig. 1 1 A-D).

[0162] With an increase in age, the physiological activity of muscle stem cells decreases and the regeneration capacity of SkM declines and the efficiency of muscle repair decreases, and this is accompanied by a decrease quality and strength of muscles, and irreversible muscle loss which seriously affect the quality of life of the elderly. Therefore, the present invention provides compositions and methods which maintain and increase the sternness characteristics and prevent a decrease quality and strength of muscles,

[0163] 22

[0164] SUBSTITUTE SHEET (RULE 26) irreversible muscle loss, and muscle diseases which seriously affect the quality of life of the elderly by increasing proteasome activity.

[0165] The effects of the present invention is also not limited to muscle tissue, but also the invention provides compositions and methods which maintain and increase the sternness characteristics and prevent aging and associated diseases by ensuring the continuation of the regenerative character of all tissues including neurons.

[0166] The present invention provides compositions and methods which prevent and / or treat ocular pathologies of high incidence, such as age-related macular degeneration, cataracts, glaucoma, and diabetic retinopathy which are of multifactorial origin and are associated with genetic, environmental factors, age, and oxidative stress, among others; the latter factor is one of the most influential in ocular diseases, directly affecting the processes of autophagy activity.

[0167] Depending on the context, autophagy and the proteasome share common substrates as well as regulatory factors. Both systems intersect and communicate at multiple points to coordinate and balance their actions in proteostasis and homeostasis of organelles.

[0168] The most important concern that may occur as consequence of decreased protesome activity is the accumulation of potentially toxic un / misfolded proteins as well as protein aggregates. The proteasome impairment will eventually affect the vital function of cytosolic processes including autophagy and all other organelles due to the accumulation of unfolded and damaged proteins.

[0169] According to an aspect of some embodiments of the present invention there is provided an Wnt inhibitor or GSK-3 activator for use in treating or preventing ocular pathologies related with impaired protein organel turnover by increasing the proteasome activity and, accordingly, it acts by regulating autophagy-lysosome pathway.

[0170] According to an aspect of some embodiments of the present invention there is provided an GSK-3 activator for use in treating viral enfections by degredading proteins of viruses, such as HepC core protein. Another subject of this invention is HIV because proteasome inhibitors are known to activate the latent HIV (Cary and Peterlin 2020; Timilsina etal. 2019).

[0171] Tauopathies are neurodegenerative disorders characterized by the presence of filamentous deposits, consisting of hyperphosphorylated tau protein, in neurons and glia.

[0172] 23

[0173] SUBSTITUTE SHEET (RULE 26) Abnormal tau phosphorylation and deposition in neurons and glial cells is one of the major features in tauopathies (Weng and He 2021 )

[0174] In addition It has been reported that Tau protein abnormal hyperphosphorylation plays a central role in neurodegeneration triggered by traumatic brain injury and Traumatic spinal cord injury. Exemplary such tauopathies include amytrophic lateral sclerosis (ALS), parkinsonism, argyrophilic grain dementia, diffuse neurofibrillary tangles with calcification, frontotemporal dementia linked to chromosome 17, corticobasal degeneration, Pick's disease, progressive supranuclear palsy, progressive subcortical gliosis, and tangle only dementia.

[0175] Ever-mounting evidence suggests that the ubiquitin proteasome system (UPS) deficits contribute to p-Tau accumulation. And targeting UPS attenuates tau pathology.

[0176] The present invention provides methods relevant to tauopathies. The present invention demonstrates that GSK-3 modulation directly effects the amount of pTau dramatically. The present invention demonstrated that direct (by BIO) or indirect (by SKL2001 ) inhibition of GSK-3 increased the pTau amount dramaticilly in the cell (Fig. 2B, Fig. 50). The present invention also demonstrated that the GSK-3 activator, IWP-2, decreased the pTau amount in cell (Fig. 6A). In addition, the present invention showed that the overexpression of GSK-3 decreased the pTau amount in cell (Fig. 9G and H), In some embodiments, the cell is a neuronal cell. In some embodiments, the cell is a nonneuronal cell. In some embodiments, the cell expresses Tau proteins. In certain embodiments, the tauopathy is Alzheimer's disease.

[0177] Therefore, in one aspect, present invention provides compositions and methods which prevent and / or treat diseases mentioned above caused by the tauopathy.

[0178] In another aspect, present invention demonstrates that increased protesome activity in the presence of GSK-3 decrease serin racemesa, which decrease L-to-D-serin conversion (Fig. 6 A), which will be effective in preventing or treating diseases of cerebral ischemia, traumatic brain injury, peripheral neuropathy, cerebral ischemia, choroidal neovascularization, Hyperactivity brain syndrome, retinal ganglion cell loss, Long-term Sequelaes of concussion, Seizure, retinal ganglion cell loss in diabetics, chronic social defeat stress, and other neurodegeneratif diseases.

[0179] 24

[0180] SUBSTITUTE SHEET (RULE 26) Furthermore, the present invention provides compositions and methods which reduce the toxic effects of astrocytes by decreasing serin racemesa. Therefore, present inventions further provide a decrease in microvascular damage in diabetic retinopathy, synaptic damage after traumatic brain injury, neuronal over-activation, choroidal neovascularization, the pathologic symptoms of Alzheimer's disease, and neurodegeneration.

[0181] In another aspect, present invention provides compositions and methods which act as neuro-protective in neurological diseases.

[0182] The present invention provides compositions and methods which prevent and / or treat neurodegeneration caused by pathological insults including anticancer treatments, cerebral ischemia, traumatic brain injury, peripheral neuropathy, cerebral ischemia, choroidal neovascularization, retinal ganglion cell loss, Long-term Sequelaes of concussion, decreasing neurotoxic effects of astrocytes in Alzheimer's disease, Seizure (Saez- Atienzar and Masliah, 2020; Glass et all. 2010; Pender etall. 2020)

[0183] In another aspect, present invention demonstrates that increased protesome activity in the presence of GSK-3 activators decrease serin racemesa, which decrease L-to-D- serin conversion, which will be effective in preventing or treating schizophrenia and other psychological diseases.

[0184] The present invention provides methods that prevents, reduces or even treats the cognitive impairment and dementia which may stem from any etiology.

[0185] In one aspect present invention provides compositions and methods which prevent and / or treat renal diseases caused by accumulation of oxidatively damaged and / or misfolded proteins (Cauli et al. 2014).

[0186] In another aspect present invention provides compositions and methods which prevent and / or treat renal insuficiencies caused by aging, hyperlipidemia, hypertension, smoking, diabetes, obesity and other factors which cause oxidative damage to proteins. Therefore, present invention ameliorate and / or treat acute and chronic kidney disease.

[0187] In another aspect present invention provides a method for treating colorectal cancer by decreasing Serine racemase which enhances growth of colorectal cancer by producing pyruvate from serine (Ohshima et al. 2020).

[0188] 25

[0189] SUBSTITUTE SHEET (RULE 26) The present invention provides methods that prevents, reduces or even treats the cell proliferative diseases by reducing or preventing the unfolded protein accumulation.

[0190] Therefore, the present invention further provides, in another aspect, a method for treating different forms of cancer, in which protein homeostasis network is disturbed including increased protein synthesis, and misfolded protein production, accumulation of both misfolded protein aggregates, as well as apoptosis signaling proteins in cancer cells. In addition the present invention further provides methods that increase the sensitivity of cancer cells to antineoplastic drugs (Madden et al. 2019; Hsu et al. 2019).

[0191] The shortening of telomere length is one of metabolic derangements compromise the normal aging process (such as loss of muscle mass and strength). Previous studies have shown that inhibition of proteasome activity inhibits telomerase activity (Shalem- Cohavi et al. 2019).

[0192] Therefore, in another aspect, the present invention provides that GSK-3 activator increase telomerase activity by increasing the activity of proteasome. Consequently, in another aspect, present invention provides a method that GSK-3 activator delays cell senescence and accordingly, delay in aging process by increasing telomerase activity which provides prolongation of life.

[0193] The present invention encompasses the finding that activation of proteasome by GSK-3 activator, through increased levels and / or increased activity, can provide effective treatment for, and even prophylaxis of the endoplasmic reticulum (ER) related diseases by decreasing ER stress. Metabolic disesaes including, Insulin resistance, arteriosclerosis, diabetes mellitus, obezite, alcoholic and non-alcoholic fatty liver disease, hyperlipidemia; cancers including Leukemia, multiple myeloma, breast cancer, prostate tumor; immun system related diseases including, viral infections, Bacterial infections, Vitiligo, rheumatoid arthritis, type 1 diabetes and many neurological diseases are known to be associated with ER stress (Ding et al. 2007; Roussel et al. 2013).

[0194] The present invention encompasses the finding that activation of proteasome by GSK-3 activator, through increased levels and / or increased activity, can provide effective treatment for, and even prophylaxis of, certain Lysosomal Storage Diseases. The present invention encompasses the finding that activation of proteasome by GSK-3 activator, prevents the malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins which are associated

[0195] 26

[0196] SUBSTITUTE SHEET (RULE 26) with lysosome dysfunctions. Lysosomal storage diseases include Gaucher disease, Fabry disease, Niemann-Pick disease, Hunter syndrome, Glycogen storage disease II (Pompe disease), Tay-Sachs disease.

[0197] The present invention can provide effective treatment for, reduction of symtoms and even prophylaxis of, certain mitochondrial diseases including, Mitochondrial myopathy, Diabetes mellitus, Leber's hereditary optic neuropathy, Leigh syndrome, subacute sclerosing encephalopathy, Neuropathy, ataxia, deafness, retinitis pigmentosa, and ptosis, progressive symptoms of dementia, Myoneurogenic gastrointestinal encephalopathy, MERRF syndrome, MELAS syndrome, Huntington's disease, cancer, Alzheimer's disease, Parkinson's disease, bipolar disorder, schizophrenia, aging and senescence, anxiety disorders.

[0198] Autophagy lysosome pathway is another degradation pathway in which cytoplasmic components, such as protein aggregates and damaged organelles are degraded and recycled for maintaining normal cellular homeostasis. Depending on the context, autophagy and the proteasome share common substrates as well as regulatory factors. Both systems intersect and communicate at multiple points to coordinate and balance their actions in proteostasis and homeostasis of organelles (Kocaturk and Gozuacik, 2018).

[0199] The present invention can provide effective treatment for, reduction of symtoms and even prophylaxis of, certain autophagy related human diseases, such as Adult neurodegenerative Disorders including Parkinson's disease, Amyotrophic lateral schlerosis, Frontotemporal dementia, Neuronal ceroid lipofuscinosis, Fulminant neurodegeneration, Dementia with Lewy bodies; Pediatric Neurodevelopmental disorders including Spinocerebellar ataxia, Cortical atrophy and epilepsy, Childhoodonset neurodegeneration, BPAN, Spastic quadriplegia and brain abnormalities, Primary microcephaly, Hereditary spastic paraplegia, Ataxia with spasticity, Rett syndrome, Joubert syndrome, Leukoencephalopathy, Adolescent-onset dystonia, CEDNIK syndrome, Pelizaeus-Merzbacher-like disorder, West syndrome; Hereditary neuropathies including Sensory and autonomic neuropathy type II, Charcot-Marie-Tooth disease, Sensory and autonomic neuropathy type IF, Distal hereditary motor neuronopathy; Ophthalmological diseases including Primary open-angle glaucoma, Cataracts; Cardiac and skeletal myopathies including Danon’s cardiomyopathy, Distal myopathy with rimmed vacuole, Dilated cardiomyopathy, Sporadic inclusion body myositis, X-linked myopathy with excessive ""♦onhaov- inflammatory disorders including

[0200] 27

[0201] SUBSTITUTE SHEET (RULE 26) Crohn’s disease, Ulcerative colitis, Childhood asthma; Autoimmune diseases including Systemic lupus erythematous, Diabetes, Other autoimmune diseases; Infectious diseases including M. tuberculosis, M. leprae; Skeletal disorders including Osteopetrosis, Paget’s disease of the bone, Kashin-Beck disease; Congenital multisystem disorders including Global developmental abnormalities, Vici’s syndrome, Zellweger's syndrome, Glycosylation disorder with autophagy defects, Zimmerman- Laband syndrome, Hermansky-Pudlak syndrome, Multisystem proteinopathy.

[0202] Targeting cellular senescence

[0203] Ablation of senescent cells has been postulated as a promising therapeutic approach to target the ageing phenotype and, thus, to prevent, delay or mitigate ageing-related diseases. The aim with senolytic compounds is to rejuvenate organisms by selectively killing senescent cells and their efficacy is based on the ability of senescent cells to resist apoptosis. In another aspect the present invention demonstrate that GSK-3 activation increase proteasome activity and cause a decrease in p21 , p53, and pAktl which are the major target molecules of the senolytic drugs (Fig. 6 and Fig. 7).

[0204] Therefore, the present invention provides, in one aspect, a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer thereof, for use in ablation of senescent cells which has been postulated as a promising therapeutic approach to target the ageing phenotype and, thus, to prevent, delay or mitigate ageing-related diseases. Therefore, According to an aspect of some embodiments of the present invention there is provided an GSK-3 activator for use in treating ageing which is associated with increasing risk for developing multiple chronic diseases, the geriatric syndromes, impaired physical resilience and mortality (Saez- Atienzar and Masliah 2020.)

[0205] Amongst the diseases with emerging evidence for a causal contribution of cellular senescence or benefits of senolytics include, but are not limited to, Diabetes / Obesity, metabolic diseases, Cardiac dysfunction, congestive heart failure, myocardial infarction, Vascular hyporeactivity / calcification, AV fistulae, Frailty, Age-related muscle loss (Sarcopenia), arthritis, osteoporosis, falls, Chemotherapy complications, Radiation complications, Cancers, Bone marrow transplant complications, Organ transplantation complications, Myeloma / MGUS (monoclonal gammopathy of undetermined significance), Age-related cognitive dysfunction, other dementias, Alzheimer’s disease, Parkinson’s disease, Amyotrophic |-^+^-HI ^r.lArn^ic? Ataxia, Obesity-related

[0206] 28

[0207] SUBSTITUTE SHEET (RULE 26) neuropsychiatric dysfunction, Renal dysfunction, Urinary incontinence, Osteoporosis, Osteoarthritis, Age-related intervertebral disc disease, Idiopathic pulmonary fibrosis, Hyperoxic lung damage, Chronic obstructive pulmonary disease, Tobacco, Hepatic steatosis, Cirrhosis, Primary biliary cirrhosis, Progerias, Pre-eclampsia, Macular degeneration, Glaucoma, Cataracts, blindness, Prostatic hypertrophy, incontinence, Psoriasis, Healthspan, Lifespan and many others.

[0208] Importantly, in any case, attempts to improve proteostasis pharmacologically have to be at an early stage of disease before the manifestation of severe cellular dysfunction.

[0209] Direct-indirect GSK-3 activators

[0210] In certain embodiments, GSK-3 activators may be compounds that directly increase the activity or amount of GSK-3.

[0211] In certain embodiments, the direct action of GSK-3 activators may occur due to conformational changes on GSK-3 or due to conformational changes that occur due to phosphorylations in the GSK-3 protein.

[0212] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, from the modulation of Wnt, insulin, PI3K- AKT, MAPK-MAPKAP-K1 , mTOR- S6K1 , cAMP- PKA, The toll-like receptor (TLR) family, Calcium, Reelin, Norepinephrine-dopamine, inflammation, and other pathways by insulin growth factors, phorbol esters, amino acids, glucagon / adrenalin and others, which have been shown to affect the GSK-3 activation.

[0213] As described above, the Wnt pathway includes, in addition to the canonical pathway, the non-canonical Wnt signaling pathways such as Wnt planer cell polarity pathway, Wnt- JNK signaling pathway, Wnt / Ror receptor pathway, Wnt-GSK3MT pathway, Wnt-aPKC pathway, Wnt-RYK pathway, and Wnt-mTOR pathway.

[0214] Wnt signaling is modulated by a number of evolutionarily conserved inhibitors and activators. Wnt inhibitors belong to small protein families, including sFRP, Dkk, WIF, Wise / SOST, Cerberus, IGFBP, Shisa, Waifl , APCDD1 , and Tiki 1 . Their common feature is to antagonize Wnt signaling by preventing ligand-receptor interactions or Wnt receptor maturation. Conversely, the Wnt activators, R-spondin and Norrin, promote Wnt signaling by binding to Wnt receptors or releasing a Wnt-inhibitory step.

[0215] In the canonical Wnt signaling pathway, several natural extracellular Wnt antagonists, including the Fz-related protein sFRP, Wnt inhibitory factor 1 , sclerostin, Wise, and

[0216] 29

[0217] SUBSTITUTE SHEET (RULE 26) DKK1 , exert inhibitory effects through competitively binding LRP5 / 6 to effectively block associations between Wnts and LRP5 / 6, thereby increasing the activity of GSK-3.

[0218] In addition, many molecules are known to be involved in each of the non-canonical pathways, such as Ca2+ / CaMKII, which is involved in the Wnt / Ca2+Signaling Pathway. Therefore, in certain embodiments, molecules in GSK-3 pathways, Wnt pathways, and other pathways specified or unspecified and identified to affect the GSK-3, are all targets for the GSK-3 activation and subjects of this invention.

[0219] Non-limiting examples of drugs discoveried as Wnt / -catenin pathway inhibitors that antagonize, or inhibit, the action of the Wnt and accordingly activate GSK-3; include IWP-4, Rh4, M2912, KY-05009, XAV-939, Foscenvivint (ICG-001 ), Capmatinib (INCB28060), Resibufogenin, Isoquercitrin, JW55, RCM-1 , MSAB, IWP-2, KY021 11 , WIKI4, CCT251545, Prodigiosin, IQ-1 , NCB-0846, PNU-74654, LF3, iCRT14, Adavivint (SM04690), PRI-724, Triptonide, M435-1279, lndirubin-3'-oxime, Laduviglusib (CHIR- 99021 ), Laduviglusib (CHIR-99021 ) HCI, L-Quebrachitol, Methyl Vanillate, KY19382 (A3051 ), CGP 57380, Isoxazole 9 (ISX-9), CP21 R7 (CP21 ), Tegatrabetan (BC-2059), iCRT3, WAY-316606, WAY-26261 1 , KY1220, TMTD (Tetramethylthiuram disulfide), Heparan Sulfate, Foxy-5, Benzimidazole scaffold, SRI37892, ZINC05972969, Fz7-21 , Benzothiazole scaffold, GNF-13331 , LGK974, Piperidine-maleimide scaffold, Cordycepin, Anticancer bioactive peptide, Dehydroxyhispolon methyl ether, SSTC3, Chlorquinaldol, KYA1797K, BMP7v, Sulindac, 4[3-Hydroxywithanolide E, HGC33-SFB- NP, VALD-3, FL1 18, Prednisolone, 3-CI-AHPC, IWP-2, RBM5, Hsa_circ_0004018, Lanatoside C, TIPE1 , Salinomycin, IC-2, Epigallocatechin-3-gallate, Benzyl isothiocyanate, Phenethylisothiocyanate, Atrial natriuretic peptide, Pyrvinium Thiazolidinediones, SphK1 inhibitor II, SP600125, FH535, Cell adhesion molecule 1 , Probenecid, Ciclopirox, E-cadherin ,WP9QY, Collagen XVIII, N-butyloxycarbonyl hexapeptide, Phosphoprotein phosphatase-2A, XAV939, Tsukushi, HDAC-inhibitor, SM08502, IWR-1 , XAV939, DK419, BC029135, ETC-1922159 ,PARP1 inhibitors, Celecoxib, 2,5-dimethyl-celecoxib, indoesunate, Artesunate , Indomethacin, Ethacrynic acid, Pimozide, Cyclosporin A; Agents / phytochemicals targeting the Wnt pathway, 19-tert-butyldiphenylsilyl-8, 17-epoxy andrographolide, 11a, 12a-epoxyleukamenin E, YW2065, Esculetin, Silibinin, Mesalamine, resveratrol, Anthocyanins / anthocyanidins, Crocin, Potato glycoalkaloids, Triptolide, Decane tetracyclic triterpenes, Maclurin, ginsenosides, salidroside, Z-Ajoene; Wnt antagonist miRNAs: MiR-377-3p, MiR-506, MiR-148a, Small interfering RNA against 'A / TRh MiR-.RR4 MiR-20b, MiR-216a, MiR-

[0220] 30

[0221] SUBSTITUTE SHEET (RULE 26) 375-3p, MiR-624-5p, MiR-376c, and pharmaceutically acceptable salts, hydrates and pharmaceutically active enantiomers thereof. Each possibility represents a separate embodiment of the invention.

[0222] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, of the modulation of insulin, through action of molecules involved in insulin patways (e.g. IGF-1 R (insulin receptor PI3K-akt aktivator) inhibitors). Non-limiting examples of IGF- 1 R inhibitors includes Linsitinib, Ceritinib , Picropodophyllin, BMS-754807 , BMS- 536924, GSK1838705A, GSK1904529A, Ganitumab , Dalotuzumab, BMS-536924, BMS-754807, GSK1904529A, GSK1838705A, NVP-AEW541 , AZD-3463, Ceritinib dihydrochloride, Ceritinib (LDK378), NVP-TAE 226, NVP-AEW541 , NVP-ADW742, AG1024, NVP-ADW742, XL228, AZ7550 Mesylate, PQ401 , Indirubin Derivative E804, NBI-31772, l-OMe-Tyrphostin AG 538, Chromeceptin, NBI-31772 hydrate, Ceritinib-d7, AZ7550 hydrochloride, AZ7550, Robatumumab, AZ7550-d5 , Lonigutamab, IGF-1 R inhibitor-2, Istiratumab, Picropodophyllotoxin-d6, Lonigutamab ugodotin , AZ12253801 , MID-1 , Ginsenoside Rg5, Dioscoreae Nipponicae Rhizoma Extract, Luminespib (NVP- ALIY922), Linsitinib (OSI-906), AG-1024, SBI-477, Nordihydroguaiaretic acid (NDGA), Picropodophyllin (PPP), PQ 401 , NT157, Brigatinib (AP26113)

[0223] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, of the modulation of PI3K- AKT. Non-limiting examples of PI3K inhibitors includes Lupenone, Parsaclisib (INCB050465), IHMT-PI3K5-372, PI3K / mTOR Inhibitor-2, (E)-Akt inhibitor-IV, PIK-108, Dioscoreae Nipponicae Rhizoma Extract, Trichosanthis Pericarpium Extract, Tripterygium wilfordii Extract, Dichroa febrifuga Extract, SKI-V, Cafestol, Dactolisib (BEZ235), PI-103, Pictilisib (GDC-0941 ), ZSTK474, LY294002, XL147 analogue, TGX-221 , PIK-90, PIK-75 HCI, YM201636, IC-87114, Amarogentin, TG100-1 15, GSK1059615, Rigosertib (GN-01910), AS-605240, AZD6482, Voxtalisib (XL765) Analogue, PIK-293, Idelalisib, PIK-294, Buparlisib (BKM120), Quercetin Dihydrate, Quercetin (NSC 9221 ), Gedatolisib (PKI-587), A66, NU7441 (KU-57788), Omipalisib (GSK2126458), AS-252424, AS-604850, CAY10505, Apitolisib (GDC-0980), CH5132799, PKI-402, PF-04691502, BGT226 (NVP-BGT226) maleate, Wortmannin (KY 12420), Fimepinostat (CUDC-907), 3-Methyladenine (3-MA), Copanlisib (BAY 80-6946), Alpelisib (BYL719), TG100713, NU7026, Trigonelline, Cinobufagin, Resibufogenin, Loureirin A, Zeaxanthin, Hispidulin, Solasodine, Notoginsenoside R1 , Lanatoside C, acalisib (GS-9820), Gallein, GNE-477, GNE-493, MTX-211 , VS-5584 (SB2343), CZC24832, Duvelisib (IPI-145), TaselisibZ^D^ iPi-. nR3, HS-173, PI-3065,

[0224] 31

[0225] SUBSTITUTE SHEET (RULE 26) Pilaralisib (XL147), Voxtalisib (XL765), PF-4989216, SAR405, PIK-III, AZD8186, GNE- 317, AMG319, Nemiralisib, GSK2292767, AZD8835, VPS34-IN1 , GSK2636771 , KU- 0060648, Deguelin, GDC-0326, Paxalisib (GDC-0084), umbralisib (TGR-1202), Samotolisib (LY3023414), Eganelisib (IPI-549), VPS34 inhibitor 1 (Compound 19), Seletalisib (UCB-5857), Serabelisib (TAK-1 17), SF2523, Autophinib, Inavolisib (GDC- 0077), Tenalisib (RP6530), Selective PI3K5 Inhibitor 1 (compound 7n), Bimiralisib (PQR309), leniolisib (CDZ 173), Parsaclisib (INCB050465) Hydrochloride, ME-401 , SRX3207, Pectolinarin, Oroxin B; and Akt inhibitors includes MK-2206 2HCI, Perifosine (KRX-0401 ), GSK690693, Ipatasertib (GDC-0068), Capivasertib (AZD5363), PF- 04691502, AT7867, Triciribine (NSC 154020), CCT128930, A-674563, PHT-427, A- 443654, Miransertib, (ARQ-092), BAY1 125976, Borussertib, Miransertib (ARQ 092) HCI, Akti-1 / 2, Uprosertib (GSK2141795)Afuresertib (GSK2110183), AT13148, Oridonin (NSC- 250682), Miltefosine, Honokiol (NSC 293100), TIC10 Analogue, BIA, a-Linolenic acid, SPP-86, Hematein, RPI-1 , Urolithin B, Cinobufagin, Daphnoretin, Loureirin A, Trigonelline, ML-9 HCI, ABTL-0812, Alobresib (GS-5829), Praeruptorin A, Oroxin B, SC66, Usnic acid, Scutellarin, Astragaloside IV, Deguelin, TIC10 (ONC201 ), Methyl- Hesperidin, and others

[0226] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, of the modulation of MAPK-MAPKAP-K1 . Non-limiting examples of MAPK-MAPKAP-K1 inhibitors includes Dilmapimod (SB-681323), p38-a MAPK-IN-1 , Falnidamol, SKF- 86002, Chitosan oligosaccharide, Pulsatillae Extract, Suberect spatholobus stem Extract, Weigela Grandiflora Fortune Extract, Dichroa febrifuga Extract, TA-01 , SB 242235, SD169, R1487, AUDA, Adezmapimod (SB203580), SB202190 (FHPI), Neflamapimod (VX-745), Ralimetinib (LY2228820) dimesylate, Doramapimod (BIRB 796), PH-797804, TAK-715, 3,4',5-Trimethoxy-trans-stilbene, 3'-Hydroxypterostilbene, Trans-Zeatin, PD 169316, Berberine chloride hydrate, VX-702, SD 0006, TA-02, SEA0400, Skepinone-L, Losmapimod (GW856553X), ML141 , SB239063, Pexmetinib (ARRY-614), BMS-582949, Pamapimod, UM-164, Xanthatin, Mulberroside A, Praeruptorin A, sappanone A, Asiatic Acid, Metformin, 5'-N-Ethylcarboxamidoadenosine (NECA), Largeleaf Gentian Root Extract, Rotundic acid, Panax notoginseng Root Extract, Panax notoginseng Rhizoma Extract, Radix Scrophulariae Extract, NDMC101 , Metformin HCI, Berberine chloride (NSC 646666).

[0227] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, of the modulation of mTOR. Non-limiting examples of mTOR inhibitors includes MTI-31 ,

[0228] 32

[0229] SUBSTITUTE SHEET (RULE 26) JR-AB2-011 , PI3K / mT0R Inhibitor-2, mTOR inhibitor-1 , Dactolisib (BEZ235), Ridaforolimus (Deforolimus, MK-8669), PI-103, Rapamycin (AY-22989), Temsirolimus (CCI-779), Everolimus (RAD001 ), KU-0063794, WYE-354, GSK1059615, Voxtalisib (XL765) Analogue, AZD8055, Nitazoxanide (NSC 697855)Torkinib (PP242), Palomid 529 (P529), Chrysophanic Acid, PP121 , OSI-027, Gedatolisib (PKI-587), NU7441 (KU- 57788), Omipalisib (GSK2126458), WYE-125132 (WYE-132), WYE-687, WAY-600, Apitolisib (GDC-0980), PF-04691502, BGT226 (NVP-BGT226) maleate, Vistusertib (AZD2014), Sapanisertib (MLN0128), Torin 2, Torin 1 , Astragaloside IV, Lanatoside C, Compound 401 , GNE-477, GNE-493, XL388, Zotarolimus (ABT-578), 4EGI-1 , MHY- 1685, Voxtalisib (XL765), Onatasertib (CC 223), ETP-46464, Paxalisib (GDC- 0084)CZ415, Samotolisib (LY3023414), SF2523, Bimiralisib (PQR309), PQR620, ABTL- 0812.

[0230] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, of the modulation of Trk Receptor inhibitors (tyrosine kinase receptor (Trk)-PI3K-Akt. Non-limiting examples of Trk inhibitors includes ANA-12, 7,8-Dihydroxyflavone, N- Acetyl-5-hydroxytryptamine, LM22A-4, Taletrectinib (DS-6051 b), PF-06273340, BMS- 754807, Altiratinib, CH7057288, Sitravatinib (MGCD516), GNF-5837, BMS-935177, LM22B-10, Entrectinib (RXDX-101 ), Belizatinib (TSR-011 ).

[0231] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, of the modulation of COX-1 and COX-2 Inhibitors. Non-limiting examples of COX- 1 and COX-2 Inhibitors includes Rutaecarpine, Deracoxib, Valdecoxib, Rofecoxib, Carprofen, Celecoxib (SC 58635), Lumiracoxib, Tolfenamic Acid, NS-398 (NS398), Nimesulide, Madecassic acid, Ginsenoside Rd, Myrislignan, StylopineHederagenin, Jaceosidin, Mavacoxib, Oroxin B, Pectolinarigenin, Guaiacol, Marmesin, Niflumic acid, Sulfasalazine (NSC 667219), Dehydroevodiamine, Etoricoxib, Dexamethasone Sodium Phosphate, Ginsenoside Rb3, Asaraldehyde, 4-Hydroxyphenylpyruvic acid, NE 52- QQ57, Desmethyl Celecoxib, 3-Carene, FK-3311 , Lornoxicam, Ketorolac tromethamine salt, S-(+)-Ketoprofen, Meclofenamate SodiumAmfenac Sodium Monohydrate, Diclofenac Sodium, Indometacin Sodium, Resveratrol (SRT501 ), Ketorolac, Naproxen Sodium, SC-560, Indomethacin (NSC-77541 ), Ibuprofen (NSC 256857), ZaltoprofenXanthohumol, Oxaprozin, Aspirin (NSC 27223), Mefenamic Acid, Suprofen, Nepafenac, Salicin, Ketoprofen, Bromfenac Sodium.

[0232] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, of the modulation of COX-1 and COX-2 by supplements. Non-limiting examples of COX-

[0233] 33

[0234] SUBSTITUTE SHEET (RULE 26) 1 and COX-2 modulating supplements includes Ajoene , Alpha Lipoic Acid , Anthocyanins (like Bilberry or Blueberry Extract), Apigenin , Artichoke Extract Astaxanthin , Astragalus , Bacopa , Beetroot Powder , Berberine , Bitter Melon , Black Catechu , Black Cohosh, Black Seed, Boswellia, Bromelain, Butyrate, Caffeine, Capsicum (contrains Capsaicin), Carnosol Cat's Claw, Celery Seed, Chaga, Chamomile Extract, Chinese Sage (Danshen), Chinese Skullcap (Baicalin) Chinese Yew, Chrysin (Passion Flower), CoQ10, Cordyceps, Curcumin, Daidzein, Devil's Claw, DHA / EPA Dogwood Fruit, EGCG, Echinacea, Emodin (Rumex), Epimedium (Horny Goat Weed / lcariin), Figwort, Genistein, Ginkgo Biloba, Glossy Privet, Glucosamine, Glutathione, Grape Seed Extract, Gynostemma Hesperedin, Honokiol (Magnolia), Hops, Horseradish Extract, Jasmine, Ketones, Licorice, Lion's Mane P, Luteolin, Lycopene, Magnesium, Maitake Mushroom, Milk Thistle, Moringa, N-Acetyl-Cysteine, Narigenin Nettle, Nicotine (Anatabine), Olive Leaf (Hydroxytyrosol), Panax Ginseng (Korean), Perilla, Pterostilbene, PQQ, Pycnogenol, Quercetin, Rehmannia, Reishi, Resveratrol, Rhodiola Rosea, Rosmarinic Acid, Selenium Shiitake, Sodium Benzoate (found in carbonated drinks, vinegar, fruit juices, pickles, etc), Spirulina, Sulforaphane, St. Johns Wort (Hyperforin), Taxifolin, Theanine, Thunder God Vine, Tulsi (Holy Basil), Ursolic Acid, Valerian, Vitamin B1 , Vitex, White Willow, Wormwood, Zinc, and others.

[0235] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, of the modulation of The toll-like receptor (TLR) family. Non-limiting examples of The TLR family Inhibitors includes ABR-238901 , Saponaria Officinalis Extract, MD2-TLR4-IN- 1 , E6446, Ginsenoside Rb1 , Chloroquine diphosphate, Hydroxychloroquine Sulfate (NSC 4375), MD2-IN-1 , TLR2-IN-C29, E6446 dihydrochlorideAMG-9810, Chloroquine (NSC-187208), Resatorvid (TAK-242), IRAK4-IN-2, Cu-CPT22, Schaftoside.

[0236] In certain embodiments, GSK-3 activation may result in, either directly or indirectly of the effects of the Calcium blocker family. Non-limiting examples of the Calcium blocker includes Amlodipine, Aranidipine, Barnidipine, Benidipine, Cilnidipine, Clevidipine, Efonidipine Felodipine, Isradipine, Lacidipine, Lercanidipine, Manidipine, Nicardipine, Nifedipine, Nilvadipine, Nimodipine, Nisoldipine, Nitrendipine, Pranidipine, Fendiline, Gallopamil, Verapamil, mibefradil, bepridil, flunarizine, fluspirilene, fendiline, Gabapentinoids, such as gabapentin and pregabalin, Ziconotide,

[0237] Naturally occurring compounds and elements such as magnesium have also been shown to act as calcium channel blockers when administered orally.

[0238] 34

[0239] SUBSTITUTE SHEET (RULE 26) In addition, BAPTA-AM, which is an intracellular calcium chelator, is a modulator of Ca2+-mediated signaling. Similarly, the other Ca2+- chelators such as EGTA, EDTA, tetracyclin and others, are also modulator of Ca2+-mediated signaling.

[0240] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, of the effects of the Norepinephrine-dopamine pathways. Non-limiting examples of the Norepinephrine-dopamine reuptake inhibitor includes Amphetamine, Benzatropine, Methylphenidate, Mazindol, Benzphetamine, Cocaine, BupropionLisdexamfetamine, Dextroamphetamine, Metamfetamine, Vanoxerine, Nomifensine, Dexmethylphenidate, Sibutramine, Solriamfetol, Serdexmethylphenidate, GBR-12783, Amineptine, Bupropion, Desoxypipradrol, Dexmethylphenidate, Difemetorex, Diphenylprolinol, Ethylphenidate, Fencamfamine, Fencamine, Lefetamine, Methylenedioxypyrovalerone, Methylphenidate, Nomifensine, 0-2172, Phenylpiracetam, Pipradrol, Prolintane, Pyrovalerone, Solriamfetol, Tametraline, WY-46824.

[0241] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, of the effects of the cAMP-PKA pathways. Non-limiting examples of the cAMP inhibitor includes ST034307, ESI-05, Bithionol, Fipexide hydrochloride, NE 52-QQ57, ESI-09, HJC0350, SQ22536, PACAP 1 -27, PACAP 6-38; and PKA inhibitors includes Bisindolylmaleimide IV, GSK690693, Staurosporine (AM-2282), Fasudil (HA-1077) HCI, H 89 2HCI, Daphnetin, A-674563, HA-100 dihydrochloride, H-1 152 dihydrochloride, AT13148, ML-7 HCI.

[0242] According to some embodiments of the invention, the GSK-3 activator is formulated for oral delivery .

[0243] In certain embodiments the composition for oral delivery is formulated for sustained release .

[0244] A subject in need of such treatment or prevention a therapeutically effective amount and frequency of administration of each drug will be evaluated after pharmacological properties and amount of effect of each drug are specified.

[0245] In another embodiments of the invention, after determining the duration of action of the GSK-3 activators on the proteasome enzymes, the clinical application intervals of the relevant drug are determined.

[0246] In certain embodiments, it is the selection and administration of drugs that do not affect different molecules beyond their protesome activity effect.

[0247] 35

[0248] SUBSTITUTE SHEET (RULE 26) In certain embodiments, an the GSK-3 activator is administered to a subject prior to stressor. Wherein it is the accumulation of potentially toxic un / misfolded proteins as well as protein aggregates referred to as stressor. In addition, the proteasome impairment also referred to as stressor dependent on the accumulation of potentially toxic un / misfolded proteins as well as protein aggregates or independent. Therefore, in certain embodiments, the present agent / composition is administered to the subject which is a person 25-year-old or older.

[0249] In certain embodiments, the present agent / composition is administered to the subject throughout life.

[0250] In certain embodiments, the present agent / composition is administered to the subject which is a person younger than 25-year-old.

[0251] In general, an Wnt pathway inhibitor or GSK-3 activator agent may be or comprise a compound of any chemical class (e.g., a small molecule, metal, nucleic acid, polypeptide, lipid and / or carbohydrate). In some embodiments, an Wnt pathway inhibitor or GSK-3 activator agent is or comprises an antibody or antibody mimic. In some embodiments, an Wnt pathway inhibitor or GSK-3 activator agent is or comprises a nucleic acid agent (e.g., an antisense oligonucleotide, a siRNA, a shRNA, etc) or mimic thereof. In some embodiments, an Wnt pathway inhibitor or GSK-3 activator agent is or comprises a small molecule. In some embodiments, an activating agent is or comprises a naturally-occurring compound (e.g., small molecule). In some embodiments, an Wnt pathway inhibitor or GSK-3 activator agent has a chemical structure that is generated and / or modified by the hand of man. In general, an Wnt pathway inhibitor or GSK-3 activator agent increases level or activity of one or more target entities present in and / or produced by a cell or organism, in here, the targets are trypsin, chemotrypin and caspase like actvities of ptotesome. In some embodiments, a target entity is or comprises a polypeptide. In some embodiments, a target entity is or comprises a nucleic acid (e.g., a nucleic acid that encodes or regulates [e.g., by altering expression and / or activity of] a polypeptide). In some embodiments, a target entity is or comprises a carbohydrate. In some embodiments, a target entity is or comprises a lipid. In some embodiments, a target entity is or comprises an enzyme. In some embodiments, a target entity is or comprises a polypeptide involved in cellular trafficking.

[0252] 36

[0253] SUBSTITUTE SHEET (RULE 26) Preventing and / or inhibiting the biological function of the GSK-3 can be effected at the protein level but may also be effected at the genomic and / or the transcript level using a variety of molecules which interfere with transcription and / or translation of a receptor.

[0254] Therefore, non-limiting examples of activators for those that act directly on GSK-3 or those that act indirectly through different pathways that can be used according to some embodiments of the invention include small molecules, antibodies, inhibitory peptides, enzymes that cleave the polypeptide, aptamers homologous recombination agents, site specific endonucleases and RNA silencing agents.

[0255] The GSK-3 activator agents of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.

[0256] Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.

[0257] In certain embodiments, GSK-3 activator agents described above is formulated for injection. In certain embodiments the GSK-3 activator agents are formulated for sustained release.

[0258] The scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description

[0259] The Geroscience Hypothesis posits that fundamental ageing mechanisms are ‘root cause’ contributors to the increasing burden of disorders and diseases with advancing age that are responsible for the bulk of morbidity, mortality and health costs in the developed and developing worlds. These fundamental ageing processes include: (1 ) chronic low grade ‘sterile’ (absence of bacteria, fungi, etc.) inflammation often accompanied by fibrosis, 2) macromolecular dysfunction (e.g. DNA damage, telomere uncapping, protein misfolding and aggregation, decreased proteasome activity, increased advanced oxidation-glycation end-products, lipotoxicity and accumulation of

[0260] 37

[0261] SUBSTITUTE SHEET (RULE 26) bioactive lipids) and organelle dysfunction (altered nuclear membranes related to deficient lamin B, mitochondrial dysfunction leading to reduced fatty acid metabolism, higher glucose utilization, depletion of NAD+ and increased ROS generation, etc.), 3) stem, progenitor and immune cell dysfunction (including altered proliferative capacity and dysdifferentiation with failure to develop into functional mature cells, declines in ‘geroprotective’ factors [e.g. a-Klotho], contributing to stem and progenitor cell dysfunction) and 4) cellular senescence. Unitary Theory of Fundamental Aging Processes hypothesizes that these fundamental ageing processes may be interlinked. Therefore, targeting any one fundamental ageing process (e.g. decreased proteasome activity, protein misfolding, cellular senescence) genetically or with drugs should affect many or perhaps all of the rest. Indeed, consistent with the Unitary Theory, senescent cells contribute to inflammation, fibrosis, DNA damage, development of protein aggregates, failed autophagy, lipotoxicity, mitochondrial dysfunction, depletion of NAD+, ROS generation and stem, progenitor and immune cell dysfunction (Austad, 2016).

[0262] Therefore, in another embodimend the present invention provides a medicament for ameliorating onset and / or progression and even treatment of the ageing and aging associated diseases by targeting more than one fundamental ageing process, including protein misfolding and aggregation, decreased proteasome activity, increased oxidated proteins, advanced glycation end-products (AGEs), lipotoxicity and accumulation of bioactive lipids and organelle dysfunction (mitochondrial and autophagy-lysosome disfunction), stem progenitor dysfunction, depletion of NAD+, cellular senescence comprising the step of administering a therapeutically effective amount of an GSK-3 activator or a pharmaceutically acceptable salt or prodrug thereof.

[0263] DETAILED DESCRIPTION OF THE INVENTION

[0264] The accumulation of unfolded, misfolded, or damaged proteins severely impairs the function of organelles and cells and has been recognized as a crucial factor in aging and a wide variety of diseases.

[0265] During ageing, oxidized proteins appear to aggregate and accumulate to abnormally high levels. Such large aggregates, including amyloid, amorphous, or native-like assemblies, have links with a number of human diseases and physiological processes including ageing and ageing related diseases.

[0266] 38

[0267] SUBSTITUTE SHEET (RULE 26) The term “protein aggregate” as used herein refers is to any association of two or more protein molecules in a non-native conformation. Aggregates cover a range of structures, from amorphous assemblies to highly ordered fibrils (amyloid) with cross-b structure. The propensity of a specific protein to aggregate is governed primarily by the chemical properties of its amino acid sequence, the conformational stability of its folded state, and its cellular concentration. The extremely high total protein concentration in cells results in excluded-volume effects (macromolecular crowding) and substantially increases the tendency of non-native protein molecules to aggregate compared with dilute solutions.

[0268] It is well known that total rates of protein degradation are reduced as an organism ages. It is also known that a decline in proteasome activity has been broadly implicated in ageing and age associated diseases, including neurodegeneration.

[0269] Impairment of proteostasis is now being recognized as a basic mechanism by which chronic protein misfolding and toxic aggregation cause cellular dysfunction, facilitating the manifestation and progression of numerous neurodegenerative, other aggregatedeposition diseases, and aging and associated diseases (Dobson et al 2015; Chiti and Dobson 2017).

[0270] Since oxidatively modified proteins are known to be more susceptible to proteolytic degradation by the proteasome than native proteins, it seems obvious that the proteolytic activitiy of the proteasome is required more and more with increasing age. In contrast, it was known that the proteasome activity is progressively decreased with increasing age particularly by accumulating oxidized and cross-linked cellular proteins.

[0271] The proteasome is the cell’s first defense mechanism against accumulating proteotoxic stresses induced by oxidative damage.

[0272] Therefore, timely removal of oxidatively damaged proteins is of critical importance to maintain normal cellular homeostasis and viability (Hipp etal., 2014).

[0273] The present invention is based on finding that GSK-3 modulations (increase or decrease in activity) affects the proteasome activities including chemotrypsin, trypsin and caspaselike activities. The present invention demonstrated that direct inhibition of the GSK-3 decrease the proteasome activities including Chemotrypsin Trypsin, and caspase-like dramatically (Fig. 3A-C). In addition, the present invention demonstrates that silencing the GSK-3 expression decreases the proteasome activities (Fig. 10 A-C). Importantly, the present invention demonstrated that the increase in GSK-3 activity increase the proteasome activity (Fig.4 C-E). The invention orovides the more direct finding that GSK-

[0274] 39

[0275] SUBSTITUTE SHEET (RULE 26) 3 increases proteasome activities is that overexpression of GSK-3 in the HepG2 and T98G cells increases the cell’s proteasome activities (Fig.9 A-F).

[0276] Present invention states that GSK-3 modulation may result in, either directly (e.g. BIO, Lithium, etc.) or indirectly by the modulation of Wnt, insulin, PI3K- AKT, MAPK- MAPKAP-K1 , mTOR- S6K1 , cAMP-PKA, the toll-like receptor (TLR) family, Calcium, Reelin, Norepinephrine-dopamine, inflammation and other pathways that have been shown to activate GSK-3 and accordingly proteasome activities (Chemotrypsin, trypsin, and caspase-like activity) increase.

[0277] Therefore, without wishing to be bound by any theory or mechanism of action, the present invention claims that the GSK-3 modulation change the proteasome activities including chemotrypsin, trypsin and caspase-like activities.

[0278] The invention claims and provides that Wnt activation inhibits the proteasome activities including chemotrypsin, trypsin and caspase-like by inhibiting GSK-3 (Fig. 4 A, B, E). In addition, the invention claims and provides that inhibition of Wnt pathway increases the proteasome activities including chemotrypsin, trypsin and caspase-like activities by activating the GSK-3 (Fig. 4 C, D, and E).

[0279] The decline of the total rates of protein degradation contributes to a catastrophic imbalance in proteostasis and accumulation of oxidatively damaged and / or misfolded proteins. Therefore, the present invention provides compositions and methods for treatment of the diseases caused by the oxidatively damaged and / or protein-misfolding disorders by increasing the proteasome activity.

[0280] The present invention encompasses the finding that activation of proteasome by GSK-3 aktivators, through increased levels and / or increased activity, can provide effective treatment for, and even prophylaxis of, certain proteinopathies.

[0281] The present invention specifically encompasses the insight that, in some instances, increased chemotrypsin, trypsin and caspase-like activities of proteasome can provide effective treatment (and / or prophylaxis) of certain proteinopathies.

[0282] Thus, the present invention provides, in one aspect, a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer thereof, for use in treating the oxidatively damaged and / or protein-misfolding diseases. A range of proteins involved in these

[0283] 40

[0284] SUBSTITUTE SHEET (RULE 26) processes (e.g., transthyretin, insulin, [3-2-microglobulin, superoxide dismutase) are natively folded. However the vast majority of them involved in protein-aggregate disorders are particularly those that are relatively small, are intrinsically disordered protein (IDPs). Disorder is mostly found in intrinsically disordered regions (IDRs) within an otherwise well-structured protein. The term IDP therefore includes proteins that contain IDRs as well as fully disordered proteins. Intrinsically disordered systems can also be generated following proteolysis from larger proteins that are otherwise folded, such as the amyloid-p peptide and the amyloidogenic fragment of gelsolin. Because of their lack of stable 3D structure, IDPs are extremely sensitive to their environment, much more so than ordered proteins. Also, this lack of fixed structure is often associated with extreme binding promiscuity of IDPs. The best known examples of amyloidogenic IDPs include amyloid p (Ap) peptides, tau (AD), a-synuclein (Parkinson’s disease (PD) and other synucleinopathies), TAR DNA-binding protein 43 (TDP-43), fused in sarcoma (FUS) protein (amyotrophic lateral sclerosis (ALS)), and huntingtin (Huntington’s disease). A number of human functional amyloids (cytoplasmic polyadenylation elementbinding protein (CPEB), T-cell-restricted intracellular antigen-1 (TIA-1 ), premelanosome protein 17 (Pmel17), secretory peptide hormones), and cell cycle related proteins including p53, p27, p21 ( cell cycle, apoptosis).

[0285] Morever, twenty-thirty percent of cellular proteins are classified as IDPs and as many as 41 % of the eukaryotic proteome is predicted to contain IDRs. Several intrinsically disordered or unknown structured peptides or proteins forming intracellular or extracellular amyloid, nonamyloid, and amyloid-like fibrils deposits in human diseases and even during natural aging. Table 2 provides a list of several intrinsically disordered or unknown structured peptides or proteins forming intracellular or extracellular amyloid, nonamyloid, and amyloid-like fibrils deposits in human diseases.

[0286] Thus, the present invention provides, in one aspect, a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer which increase the proteasome activation and accordingly degrades the tested IDPs p53, p21 , pTau, which are the above determined IDP proteins (Fig. 4 C-E, Fig. 6 A-C, Fig. 7 A-H).

[0287] In some embodiments, the present invention provides a proteasome activation by increasing GSK-3 activation as a new therapeutic approach to target proteotoxic

[0288] 41

[0289] SUBSTITUTE SHEET (RULE 26) disorders which are related to the amyloidogenic intrinsically disordered proteins aforementioned above and others.

[0290] Therefore, the present invention provides activation of proteasome in aged individuals, who are the major victim of proteotoxic disorders and diseases. Therefore, the present invention targets proteasome, which is one of the major target in preventing of aging which is associated proteotoxic disorders which is often associated with multiple human diseases. Furhermore, the present invention provides that targeting protesome is effective in treating and preventing of aging.

[0291] According to an aspect of some embodiments of the present invention there is provided an GSK-3 activator for use in treating aging and / or aging related conditions or diseases dependent protesome trypsin, chymotrypsin, and caspase-like activities decrease.

[0292] Therefore, the present invention provides compositions and methods not only treat diseases, but more importantly, prevent the causes of diseases which is associated with malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins.

[0293] In another embodiment, the present invention demonstrated that GSK-3 activators prevented cell senesence as a result of the experiment with p-galactosidase staining and cell proliferation assay of primary fibroblast cells (Fig.1 1 A-D) .

[0294] The present invention also demonstrated that modulations of GSK-3 affects the life span of C. elegans worms. The present invention demonstrated that at day 20, 2 times less worms survived in the group that received the GSK-3 inhibitors, compared to the group with the no-treatment (Fig. 12A and B). The present invention further demonstrates that the worm’s locomotor activities decreased dramatically in the presence of GSK-3 inhibitors BIO and SKL2001 (Fig. 12B).

[0295] In another embodiment, the present invention demonstrated that at day 22, almost 2 times more worms survived in the group that received the GSK-3 activator, celecoxib, compared to group with the no-treatment (Fig.12 C and D). In another embodiment, the present invention further demonstrates that the worm’s locomotor activities increase in the presence of GSK-3 activator, celecoxib compared to group with the no-treatment (Fig.12 D).

[0296] The age-related reduction in fat oxidation may promote the accumulation of total and central body fat. Adipogenesis and lipid accumulation during aging have a great impact

[0297] 42

[0298] SUBSTITUTE SHEET (RULE 26) on the aging process and the pathogenesis of chronic, age-related diseases. Therefore, in the presence of BIO and control C. elagans groups on 20th days, the amount of fat in the organism was investigated by Nile Red staining. The results of the invention show that, on the 20th day, lipid accumulation in the C. elagans group treated with BIO was more than 6-fold higher than the C. elegans grown in the medium without a drug (Figs 12 E and F). Further, present invention provides that lipid accumulation in the C. elagans group treated with Celecoxib was significantly less compared to the C. eleagans grown in medium without a drug (Figs 12 G and H).

[0299] NAD+ / NADH and NADP+ / NADPH are involved in various biological processes in mammalian cells. Although NAD+ and NADP+ are synthesised in sufficient amounts under normal conditions, shortage in their supply due to over consumption and their decreased synthesis has been observed with increasing age and under certain disease conditions. Several studies have proved that in a wide range of tissues, such as liver, skin, muscle, pancreas, and fat, the level of NAD+, NADP+ decreases with age. Therefore the amount of NADP+ was investigated in C. elagans treated with GSK-3 inhibitor or activator. It was found that 2 times less NADP+ detected in the C. elagans treated with GSK-3 inhibitor, BIO compared to the C. elegans without a drug (Fig. 12 I) and 2 times more NADP+ was detected in the C. elagans treated with celecoxib, compared to the C. elegans without a drug on the 20th day ( Fig. 12 J).

[0300] Therefore, present invention provide a mediciment increase in both the healthspan and lifespan.

[0301] Further, the present invention provides compositions and methods effective in ameliorating onset and I or progression of the ageing. In particular the compositions of the present invention diminish or prevent symptoms of the ageing through increasing the proteasom activity.

[0302] Therefore, the present invention provides compositions and methods for treatment of aging which is associated with malfunctioning of the protein homeostasis network and interferes with crucial signaling pathways and is often associated with multiple human diseases.

[0303] Oxygen free radicals and other oxidants are causing potential danger for intracellular proteins during the lifetime of cells and organisms. The degradation of non-functional, oxidized proteins is an essential part of the antioxidant defenses of cells. The major

[0304] 43

[0305] SUBSTITUTE SHEET (RULE 26) proteolytic system responsible for the removal of oxidized cytosolic proteins is the proteasomal system (Grune, 2010).

[0306] According to an aspect of some embodiments of the present invention, there is provided an GSK-3 activator for use in detoxifying the cells with oxidatively damaged proteins by inducing the activity of the proteasome complex which is capable of directly targeting oxidatively damaged proteins to detoxify the cell.

[0307] According to an aspect of some embodiments of the present invention provides compositions and methods effective in ameliorating onset and / or progression of the ageing which is associated with malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins.

[0308] Therefore, the present invention provides compositions and methods which prevents the malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins, which are shown as the most important cause of aging, and provides prolongation of life.

[0309] Many literature exists that on increased amounts of oxidized proteins in skeletal muscle, heart, skin, liver, lymphocytes and other tissues of various animal species during aging. Therefore, the present invention provides compositions and methods which maintain and increase muscle mass, strength and performance. In addition, the irreversible loss of cardiomyocytes due to oxidative stress is the main cause of heart dysfunction following ischemia / reperfusion injury and ageing-induced cardiomyopathy. Therefore, the present invention provides compositions and methods which prevents heart diseases by maintaining and / or improving the performance of the heart muscle, and is effective in ameliorating onset and I or progression of the heart dysfunction following ischemia / reperfusion injury and ageing-induced cardiomyopathy.

[0310] The term "proteostasis", or "protein homeostasis", refers to the concentration, conformation, binding interactions, e.g., quaternary structure, and location of proteins making up the proteome. Proteostasis is influenced by the chemistry of protein folding / misfolding and by numerous regulated networks of interacting and competing biological pathways that influence protein synthesis, folding, conformation, binding interactions, trafficking, disaggregation and degradation.

[0311] Protein aggregates are observed in a variety of different types of disorders, diseases, and / or conditions, including cognitive impairment disorders, proliferative diseases,

[0312] 44

[0313] SUBSTITUTE SHEET (RULE 26) inflammatory diseases, cardiovascular diseases, immunologic diseases, ocular diseases, mitochondrial diseases, neurodegenerative diseases, lysosomal storage diseases, and aging and associated diseases.

[0314] Increasing proteolytic capacity provides an alternative approach to maintaining proteostasis.

[0315] Therefore, the present invention encompasses the finding that activation of proteasome by the GSK-3, through increased levels and / or increased activity, can provide effective treatment for, and even prophylaxis of, certain proteinopathies.

[0316] For example, the present invention provides novel insights into proteasome activity and its effects on protein degredation, and demonstrates that GSK-3 activating pathways linked to proteasome function regulate levels of protein amount in various contexts, specifically including primary cell culture, and C. elegans. The present invention specifically encompasses that increased chemotrypsin, trypsin and caspase-like activities of proteasome by the GSK-3 activation can provide effective treatment (and / or prophylaxis) of certain proteinopathies which cause cellular dysfunction, facilitating the manifestation and progression of numerous neurodegenerative, other aggregatedeposition diseases, even aging and associated diseases. Some embodiments of the present invention are applicable to all proteinopathies.

[0317] The present invention provides an enhancement of proteolytic capacity by increasing proteasome activity by using of at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer. The present invention, therefore, provides a medicament for treating the diseases caused by chronic protein misfolding and toxic aggregation.

[0318] In addition to the natural formation of misfolded proteins, the oxidative damage is known to be one of the most important factor on the protein misfolding (Dobson et al 2015; Chiti and Dobson 2017).

[0319] Oxidative stress can lead to the non-specific post-translational modifications of proteins and contributes to protein aggregation.

[0320] Proteins are one of the major targets of oxygen free radicals and other reactive species. A constant accumulation of oxidized proteins takes place during aging.

[0321] Upon oxidative damage, proteins unfold and expose hydrophobic regions which makes them prone to aggregation (Reichmann et al. 20181 ).

[0322] 45

[0323] SUBSTITUTE SHEET (RULE 26) Therefore, the present invention provides compositions and methods not only treat diseases, but more importantly, prevent the causes of diseases which is associated with malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins.

[0324] The failure of cells to maintain proteostasis contributes to the toxic effects of protein aggregates in numerous diseases and is also a major driver of the aging process. Beyond counteracting the toxic effects of aggregating disease proteins, enhancing proteostasis capacity also extends lifespan. Conversely, the chronic presence of aggregates can suppress the ability of cells to respond adequately to stress, supporting the view that protein aggregation is a major driver of the aging process. A decline in proteasome activity during aging would explain why aging is a key risk factor for protein aggregation. Conversely, there is evidence that aggregation is not the result of a malfunctioning UPS (ubiquin proteasome system) but is actually its cause. This view is supported by findings that the expression of structurally unrelated aggregation-prone proteins prevents other proteins from being proteasomally degraded (Chiti and Dobson 2017).

[0325] Modulation of protein concentration via regulation of the proteolytic machineries has long been validated as promising milieu for the development of treatments for ageing and ageing related different human diseases such as neurodegeneration, cancer, autoimmunity and others.

[0326] Therefore, clearance of misfolded proteins is critical for cell survival because misfolding alters a protein’s three-dimensional structure, impairing its biological activities and increasing its propensity to form toxic aggregates.

[0327] Therefore, it has become important to investigate chemical structures and / or methods that will maintain and / or increase proteosis and thus ameliorate onset and / or progression and even treatment of the ageing and aging associated diseases.

[0328] The method of the invention comprises administering to the subject a therapeutically effective amount of an GSK-3 activator effective in increasing the activity of proteasome. The invention is directed to means and methods effective in protecting the onset and / or progression and even treatment of the ageing.

[0329] 46

[0330] SUBSTITUTE SHEET (RULE 26) The terms "treating” and “treatment” as used herein refer to abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially delaying the appearance of clinical symptoms of a condition, substantially ameliorating clinical symptoms of a condition or substantially preventing the appearance of clinical symptoms. For example, in relation to aging, the term "treat" may mean to relieve or alleviate susceptibility to infection, risk of heat stroke or hypothermia, thinning of the bones of spines, bones breaks, joint changes (ranging from minor stiffness to severe arthritis), loss of muscle mass and strength (sarcopenia), stooping posture, slowed and limited movement, hand strength and mobility decrease include, "hand and finger strength and ability to control submaximal pinch force and maintain a steady precision pinch posture, manual speed, and hand sensation, frailty, a syndrome of decreased strength, physical activity, physical performance and energy, VO2 max and maximum heart rate decline, constipation, urinary incontinence, slowing of thought, memory, and thinking, reduced reflexes and coordination and difficulty with balance, decrease in visual acuity, diminished peripheral vision, hearing loss, wrinkling and sagging skin, whitening or graying of hair, weight loss, in part due to loss of muscle tissue, losing strength in the ciliary muscle of the eyes which leads to difficulty focusing on close objects, or presbyopia, menopause typically occurs between 44 and 58 years of age, loss of arterial elasticity and as a result causes the stiffness of the vasculature, atherosclerosis which leads to cardiovascular disease (for example stroke and heart attack) which globally is the most common cause of death.

[0331] In relation to aging, the term "protect" is used herein to mean prevent delay or treat, or all, as appropriate, development or continuance or aggravation of conditions related to aging of human body systems. Following are examples of how aging affects some of our major body systems;

[0332] Cells, organs and tissues: Cells become less able to divide, The telomere shortening, oxidasied products accumulation, connective tissue stiffness between the cells, the decrease in maximum functional capacity of many organs.

[0333] Heart and blood vesse / s.The increase in the thickness wall of the heart gets thicker. Heart muscle become less efficient (working harder to pump the same amount of blood). The aorta (the body's main artery) becomes thicker, stiffer, and less flexible. Many of the body's arteries, including arteries supplying blood to the heart and brain, slowly develop atherosclerosis, although the condition never becomes severe in some people

[0334] 47

[0335] SUBSTITUTE SHEET (RULE 26) Vital signs: It is harder for the body to control its temperature. Heart rate takes longer to return to normal after exercise.

[0336] Bones, muscles, joints: Bones become thinner and less strong. Joints become stiffer and less flexible. The cartilage and bone in joints starts to weaken. Muscle tissue becomes less bulky and less strong

[0337] Digestive system: The movement of food through the digestive system becomes slower. The stomach, liver, pancreas, and small intestine make smaller amounts of digestive juices

[0338] Brain and nervous system: The number of nerve cells in the brain and spinal cord decreases. The number of connections between nerve cells decreases. Abnormal structures, known as amyloids, plaques and tangles, may form in the brain. Cognitive impairment (such as impairment of memory and / or orientation) or impairment of global functioning (overall functioning, including activities of daily living) and / or slow down or reverse the progressive deterioration in global or cognitive impairment.

[0339] Eyes and Ears: The retinas get thinner, the irises get stiffer, The lenses become less clear. The walls of the ear canal get thinner. The eardrums get thicker.

[0340] Skin, nails, and hair: Skin gets thinner and becomes less elastic. Sweat glands produce less sweat. Nails grow more slowly. Hairs get gray and some no longer grow

[0341] According to the present invention, all of the molecular and phenotypic changes that occur after the use of GSK-3 activators, noted in the following results of the studies, were the result of GSK-3’s increasing protesome activity, unless otherwise stated. Protesome activation basically comprises activation of 20S / 26S proteasome and its functions including trypsin, chemotrypsin and caspase-like activities.

[0342] The contribution of oxidative stress in age-related organ changes seems generally agreed that increases in ROS accompany aging, leading to functional alterations, increased incidence of disease, and a reduction in life span (Hipp et all 2014).

[0343] The proteasome is the cell’s first defense mechanism against accumulating proteotoxic stresses induced by oxidative damage (Korovila et al. 2017; Shang et al. 1997; Grune, 2000; McNaought et al. 2001 , Njoman and Tepe 2019).

[0344] Therefore, the present invention provides compositions and methods effective in ameliorating onset, progression, and even prevention of the ageing. In particular the compositions of the present invention diminish or prevent symptoms of the ageing through maintaining proteosis by increasing the proteasom activity. In addition present

[0345] 48

[0346] SUBSTITUTE SHEET (RULE 26) invention demonstrate that that usage of GSK-3 activators not only decrease the ageing and aging associated diseases but also increase life span. In another words, the present invention provides an increase lifespan together with healthspan.

[0347] In simple terms, life span is the number of years in life, whereas healthspan is the quality of life. Healthspan covers the amelioration, preventation, and / or correction of the changes in the body systems that occur with age and the clinical findings related to these, as specified in the above paragraphs.

[0348] The present invention showed that GSK-3 inhibitors both BIO, SK2001 increased cell senesence as a result of the experiment with p-galactosidase staining of primary fibroblast cells (Fig. 1 1 C and D). In addition The present invention also showed that GSK-3 inhibitors decreased the proliferation abilities of primary fibroblast cells (Fig. 1 1 A and B).

[0349] The present invention also demonstrated that modulations of GSK-3 affects the life span of C. elegans worms. The present invention demonstrated that at day 20, 2 times less worms survived in the group that received the GSK-3 inhibitors, both BIO and SKL2001 compared to group with the no-treatment (Fig. 12 A and B).

[0350] In another embodiment, the present invention demonstrated that at day 22, almost 2 times more worms survived in the group that received the GSK-3 activator, celecoxib, compared to group with the no-treatment (Fig. 12 C). The present invention further demonstrates that the worm’s locomotor activities decreased dramatically in the presence of GSK-3 inhibitors BIO and SKL2001 (Fig. 12B). In another embodiment, the present invention further demonstrates that the worm’s locomotor activities increase in the presence of GSK-3 activator, celecoxib, compared to group with the no-treatment (Fig 12 D).

[0351] Coenzyme I (nicotinamide adenine dinucleotide, NAD+ / NADH) and coenzyme II (nicotinamide adenine dinucleotide phosphate, NADP+ / NADPH) are involved in various biological processes in mammalian cells. Although NAD+ and NADP+ are synthesised in sufficient amounts under normal conditions, shortage in their supply due to over consumption and their decreased synthesis has been observed with increasing age and under certain disease conditions. Several studies have proved that in a wide range of tissues, such as liver, skin, muscle, pancreas, and fat, the level of NAD+, NADP+ decreases with age. The ratio of NAD+ / NADH and NADP+ / NADPH indicates the cellular

[0352] 49

[0353] SUBSTITUTE SHEET (RULE 26) redox state. A decrease in this ratio affects the cellular anaerobic glycolysis and oxidative phosphorylation functions, which reduces the ability of cells to produce ATP (She et al. 2021 ).

[0354] The molecule exists in cells in reduced (NADPH) and oxidized (NADP+) forms reflecting the redox state of the cell. An important cellular role for NADPH is to provide the reducing power for reductive biosynthesis of macromolecules including fatty acids and complex lipids, proteins, and nucleotides. NADPH also plays an important role in the control of cellular redox state. In this latter function, NADPH provides reducing equivalents for reduction of oxidized glutathione (GSSG) to the reduced form (GSH), a reaction catalyzed by glutathione reductase. GSH is an important intracellular reductant and plays an important role in cellular anti-oxidant defense.

[0355] Therefore the amount of NADP+ was investigated in C. elagans treated with GSK-3 inhibitor or activator. It was found that 2 times more NADP+ was detected in the C. elagans treated with celecoxib compared to the C. elegans without a drug (Fig. 12 J) and more than 2 times less NADP+ detected in the C. elagans treated with GSK-3 inhibitor, BIO compared to the C. elegans without a drug on the 20th day (Fig 12 I).

[0356] Therefore, present invention provide a mediciment increase in both the healthspan and lifespan.

[0357] The age-related reduction in fat oxidation may promote the accumulation of total and central body fat. Adipogenesis and lipid accumulation during aging have a great impact on the aging process and the pathogenesis of chronic, age-related diseases.

[0358] In above studies, we have shown that GSK-3 activator increase the life span of C. elegans, as well as increase their mucle strength, which are markers of the aging, dramatically. In addition, the present invention demonstrated that the amount of lipid droplets in muscle tissues of C. elegans treated with a GSK-3 inhibitor was significantly more than the non-treated controls (Fig 12 E and F). The present invention also demonstrated that the amount of lipid droplets in muscle tissues of C. elegans treated with a GSK-3 activator was significantly less than in the non-treated controls (Fig. 12 G and H).

[0359] Depending on the context, autophagy lysosome pathway and the proteasome share common substrates as well as regulatory factors. Both systems intersect and

[0360] 50

[0361] SUBSTITUTE SHEET (RULE 26) communicate at multiple points to coordinate and balance their actions in proteostasis and homeostasis of organelles.

[0362] The most important concern that may occur as consequence of decreased protesome activity is the accumulation of potentially toxic un / misfolded proteins as well as protein aggregates. The proteasome impairment will eventually affect the vital function of cytosolic processes including autophagy and all other organelles including mitochondria and lysosome due to the accumulation of unfolded and damaged proteins.

[0363] Unitary Theory of Fundamental Aging Processes hypothesizes that fundamental ageing processes include: (1) chronic low grade ‘sterile’ (absence of bacteria, fungi, etc.) inflammation often accompanied by fibrosis, 2) macromolecular dysfunction (e.g. protein misfolding and aggregation, decreased proteasome activity, DNA damage, telomere uncapping, increased advanced glycation end-products (AGEs), lipotoxicity and accumulation of bioactive lipids) and organelle dysfunction (altered nuclear membranes related to deficient lamin B, mitochondrial dysfunction leading to reduced fatty acid metabolism, higher glucose utilization, depletion of NAD+ and increased ROS generation, etc.), 3) stem, progenitor and immune cell dysfunction (including altered proliferative capacity and dysdifferentiation with failure to develop into functional mature cells, declines in ‘geroprotective’ factors [e.g. a-Klotho], contributing to stem and progenitor cell dysfunction) and 4) cellular senescence may be interlinked. It was hypothesed that targeting any one fundamental ageing process (indicated above) genetically or with drugs should affect many or perhaps all of the rest (Austad 2016).

[0364] Therefore, as stated in this invention, the homeostasis of proteins provided by a GSK-3 activator by activating the proteasome plays a major role in the preventation of the fundamental ageing process. In another embodimend the present invention provides a medicament for ameliorating onset and / or progression and even treatment of the ageing and aging associated diseases by targeting more than one fundamental ageing process, including protein misfolding and aggregation, decreased proteasome activity, increased oxidated proteins, AGEs, lipotoxicity and accumulation of bioactive lipids and organelle dysfunction (mitochondrial and autophagy-lysosome disfunction), stem progenitor dysfunction, depletion of NAD+, cellular senescence comprising the step of administering a therapeutically effective amount of an GSK-3 activator or a pharmaceutically acceptable salt or prodrug thereof.

[0365] 51

[0366] SUBSTITUTE SHEET (RULE 26) Continuous turnover of intracellular proteins is essential for the maintenance of cellular homeostasis and for the regulation of multiple cellular functions. All intracellular proteins undergo continuous synthesis and degradation. This constant protein turnover, among other functions, helps reduce, to a minimum, the time a particular protein is exposed to the hazardous cellular environment, and consequently, the probability of being damaged or altered. At a first sight, this constant renewal of cellular components before they lose functionality may appear a tremendous waste of cellular resources. However, it is well justified considering the detrimental consequences that the accumulation of damaged intracellular components has on cell function and survival. Furthermore, protein degradation rather than mere destruction is indeed a recycling process, as the constituent amino acids of the degraded protein are reutilized for the synthesis of new proteins. The rates at which different proteins are synthesized and degraded inside cells are different and can change in response to different stimuli or under different conditions. This balance between protein synthesis and degradation also allows cells to rapidly modify intracellular levels of proteins to adapt to changes in the extracellular environment. Proper protein degradation is also essential for cell survival under conditions resulting in extensive cellular damage. In fact, activation of the intracellular proteolytic systems occurs frequently as part of the cellular response to stress. In this role as ‘quality control’ systems, the proteolytic systems are assisted by proteasome, which ultimately determine the fate of the oxidatively damaged / unfolded protein.

[0367] The ubiquitin-proteasome system is now accepted as the main intracellular proteolytic system and malfunctioning of these this system can contribute to different aspects of the phenotype of aging and to the pathogenesis of some age-related diseases.

[0368] The age-related decline in proteolytic activity has been observed in almost all organisms analyzed, and specific defects in the different proteolytic systems with age have been reported. Keeping in mind the myriad of intracellular functions in which protein degradation participates, it is not surprising that the consequences of the age-related alterations in the proteolytic systems are widespread and contribute to a broad variety of pathologies.

[0369] Many literature exists that on increased amounts of oxidized proteins in skeletal muscle, heart, skin, liver, lymphocytes and other tissues of various animal species.

[0370] Age related cardiovascular diseases, disorders, and / or conditions are a leading cause of deaths worldwide. By the time that cardiovascular heart problems are usually detected,

[0371] 52

[0372] SUBSTITUTE SHEET (RULE 26) the disease is usually quite advanced, having progressed for decades, and often too advanced to allow successful prevention of major permanent disability.

[0373] In general, cardiovascular disease may be a disease which involves the heart and / or blood vessels, arteries, and occasionally veins. In some embodiments, the disease is a vascular disease. Exemplary particular proteinopathic cardiovascular diseases, disorders, and / or conditions may include myocardial ischemia, myocardial infarction, coronary heart disease, an acute coronary symptom, unstable angina pectoris or stable angina pectoris, stroke, ischemic stroke, vascular hyperplasia, cardiac hypertrophy, congestive heart failure, restenosis, arteriosclerosis, atherosclerosis, vasculitis, polyarteritis nodosa, myocarditis, hypertension, inflammation or autoimmune disease associated atherosclerosis or restenosis. In addition the irreversible loss of cardiomyocytes due to oxidative stress is the main cause of heart dysfunction following ischemia / reperfusion injury and ageing-induced cardiomyopathy (Jian et al. 2005; Giordano 2005; Eltzschig and Eckle 201 1 ).

[0374] Therefore, the present invention provides compositions and methods which prevents heart diseases mentioned above by maintaining proteosis by increasing the proteasom activity and accordingly maintaining and / or improving the performance of the heart muscle, and is effective in ameliorating onset and I or progression of the heart dysfunction following ischemia / reperfusion injury and ageing-induced cardiomyopathy.

[0375] Aging is a major determinant for the high prevalence of metabolic syndrome. One major threat with the ever-rising aging population with metabolic syndrome is the prevalence of aging- associated cardiovascular morbidity and mortality such as atherosclerotic vascular dysfunction. Ample of clinical evidence has suggested much higher mortality of myocardial infarction or stroke in patients premature aging.

[0376] Although a number of theories have been articulated for the relationship between premature aging and metabolic syndrom, nowadays, the accepted view is the impairment of protein homeostasis and protein quality control. The accumulating proteotoxic stresses induced by oxidative damage and related decrease in proteasome activities are the main cause protein homeostasis and protein quality control.

[0377] Therefore, in another embodimen the present invention provides a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable

[0378] 53

[0379] SUBSTITUTE SHEET (RULE 26) salt, hydrate or pharmaceutically active enantiomer thereof, for use in preventing the metabolic syndrome by regulating protein homeostasis and protein quality control.

[0380] The changes in lipid metabolism with age that contribute to increased plasma free fatty acid concentrations or increased nonoxidative disposal cause may contribute to various metabolic derangements including, obesity, accumulation of total and central body fat, insulin resistance, inflammation, loss of muscle mass and strength. Collectively, changes in lipid metabolism with age that contribute to increased plasma free fatty acid concentrations or increased nonoxidative disposal contribute to increased risk for the development of diabetes and cardiovascular disease. A reduction in the size and / or oxidative capacity of the metabolically-active muscle mass is probably a more likely determinant of reduced fat oxidation. Therefore, the preservation of muscle mass and activity during aging prevents the metabolic syndrome by preventing changes in lipid metabolism.

[0381] In addition, muscle mass is the processing center of glucose metabolism in the whole body, participating in 80% of glucose uptake and treatment in the whole body. Imbalance of muscle mass metabolism strongly influences glucose homeostasis and insulin sensitivity throughout the body, which can cause SkM inflammation, induce oxidative stress muscle mass, and damage muscle mass health. In addition to participating in insulin-related glucose metabolism, muscle mass also participates in multiple metabolic pathways of the body, including lipid metabolism.

[0382] As indicated above the present invention demonstrated that locomotor activities of both C. elegans treated with GSK-3 inhibitor were significantly decreased compared to the controls (Fig. 12 B) and lipid droplet amount 6 folds increased compared to the control C. elegans (Fig. 12 E and F). In addition, the present invention demonstrated that the amount of lipid droplets in muscle tissues of C. elegans with GSK-3 activator was significantly less than in the non-treated controls (Fig. 12 G and H) and locomotor activities of both C. elegans treated with GSK-3 activator were significantly increased compared to the controls ( Fig. 12 D).

[0383] The aging associated with malfunctioning of the lipid-protein homeostasis network and interferes with crucial signaling pathways and is often associated with multiple human diseases.

[0384] 54

[0385] SUBSTITUTE SHEET (RULE 26) Thus, the present invention provides, in one aspect, a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer thereof, for use in preventing the metabolic syndrome by increasing muscle mass and activity and accordingly regulates lipid metabolism.

[0386] In addition, the present invention provides, in one aspect, a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer thereof, for use in preventing the obesity and related diseases which occur in conjunction with metabolic syndrome caused by the changes in lipid metabolism with age.

[0387] Therefore, the present invention encompasses the finding that activation of proteasome by GSK-3 activator, through increased levels and / or increased activity, is useful in the prevention, amelioration and / or treatment of disorders of the metabolism influencing body weight, in particular in the treatment of obese subjects, in particular in the treatment of human subjects.

[0388] In accordance with this invention it is also envisaged that GSK-3 activator or a pharmaceutically acceptable salt or a prodrug of GSK-3 activator antagonists is employed in the medical intervention of secondary disorders related to a (pathological) increase of body weight. These 'secondary disorders' may comprise, but are not limited to diabetes type 2, high blood pressure (hypertension), cardiovascular diseases, cancer, problems with sexual function and disorder of the muscular or bone system.

[0389] With an increase in age, the muscle mass declines at a rate of about 1-2% per year greatly increasing the risk of muscle disease including (i) mitochondrial dysfunction, which causes various muscle pathologies such as sarcopenia and muscular dystrophy, (ii): inflammatory myopathy caused by inflammation and oxidative stress, such as dermatomyositis, polymyositis, necrotizing autoimmune myositis, and sporadic inclusion body myositis, and (iii) chronic diseases that cause SkM damage, such as type 2 diabetes, obesity, chronic kidney disease, and chronic obstructive pulmonary disease. These syndromes often lead to a decline in the quality of life of patients over time and increase patient mortality.

[0390] Thus, the present invention provides a method for use in preventing and / or treating muscle diseases mentioned above.

[0391] 55

[0392] SUBSTITUTE SHEET (RULE 26) The present invention, in another aspect, provides compositions and methods which maintain and / or decrease the aging of skin and hair by decreasing accumulation of oxidized protein, lipids and inflamation. Therefore, present invention according to an aspect of some embodiments of the present invention there is provided an GSK-3 activator for use in detoxifying the cells with oxidatively damaged proteins and lipids by inducing the activity of the proteasome complex which is usable in cosmetics including hair whitening, skin wrinkles and age spots on the skin.

[0393] Furthermore, the present invention provides compositions and methods which maintain and increase the sternness characteristics. The term “sternness” is a property of a cell- namely, the property of having a certain gene or genes whose expression makes possible both the potential for self-renewal and the potential for multilineage differentiation. The Sternness, accepted, is ‘the highest degree of plasticity of a cell, within the repertoire of cell types present in the organism’.

[0394] It was shown by Kapetanou et al. and Sahin that the proteasome activation enhances sternness and lifespan of human mesenchymal stem cells (Kapetanou etal,2017; Sahin, Patent No:PCT / TR2022 / 050106).

[0395] Therefore, in another embodiement, the present invention provides compositions and methods which maintain and increase the sternness characteristics which is the potential for self-renewal and for multilineage differentiation and lineage reprogramming of stem cells.

[0396] With an increase in age, the physiological activity of muscle stem cells decreases and the regeneration capacity of SkM declines and the efficiency of muscle repair decreases, and this is accompanied by a decrease quality and strength of muscles, and irreversible muscle loss which seriously affect the quality of life of the elderly.

[0397] Therefore, the present invention provides compositions and methods which maintain and increase the sternness characteristics and prevent a decrease quality and strength of muscles, irreversible muscle loss, and muscle diseases which seriously affect the quality of life of the elderly by increasing proteasome activity.

[0398] The effects of the present invention is also not limited to muscle tissue, but also the invention provides compositions and methods which maintain and increase the sternness characteristics and prevent aging and associated diseases by ensuring the continuation of the regenerative character of all tissues including neurons.

[0399] 56

[0400] SUBSTITUTE SHEET (RULE 26) Ocular pathologies of high incidence, such as age-related macular degeneration, cataracts, glaucoma, and diabetic retinopathy which are of multifactorial origin and are associated with genetic, environmental factors, age, and oxidative stress, among others, oxidative stress is one of the most influential in ocular diseases. The most important concern that may occur as consequence of decreased protesome activity is the accumulation of potentially toxic un / misfolded proteins as well as protein aggregates. The proteasome impairment will eventually affect the vital function of cytosolic processes including autophagy and all other organelles due to the accumulation of unfolded and damaged proteins. Alteration of the normal functioning of autophagy processes can interrupt organelle turnover, leading to the accumulation of cellular debris and causing physiological dysfunction of the eye.

[0401] Ocular pathologies of high incidence, such as age-related macular degeneration (AMD) is characterized by accumulation of extracellular deposits, namely drusen, along with progressive degeneration of photoreceptors and adjacent tissues. The protein composition of drusen includes apolipoproteins and oxidized proteins. Chronic inflammation, lipid deposition, oxidative stress and impaired extracellular matrix maintenance are strongly implicated in AMD pathogenesis.

[0402] According to an aspect of some embodiments of the present invention there is provided a GSK-3 activator for use in treating or preventing ocular pathologies related with impaired protein organel turnover by increasing the proteasome activity and, accordingly, it acts by regulating autophagy-lysosome pathway (Fleckenstein et al. 2021 ; Fernandez- Albarral et al. 2021 ; Blasiak et al. 2021 ).

[0403] The accumulating evidences show that proteasome dysfunction is connected with (auto)inflammation and autoimmunity (Brehm and Kruger, 2015). The autoimmune responses arised against protein aggregations caused by oxidatively damaged and / or misfolded proteins often accompanied by altered cytokine patterns, such as diabetes or Sjogren syndrome.

[0404] Importantly one of the crucial problem that arise in the functional deficiencies of proteasome activity is the increase in the functional susceptibility to infections, especially viral, late recovery, and the emergence of autoimmunity after infections. For example; LMP7 (PSMB8) knockout mice are physically undistinguishable from wild-type mice, but they are more susceptible to some infections, and pathogen clearance is prolonged or

[0405] 57

[0406] SUBSTITUTE SHEET (RULE 26) inadequate. The immunoproteasome (IP) deficiency was further associated with severe heart muscle injury with large inflammatory lesions and severe myocardial tissue damage in a mouse model for Coxsackie virus B3-induced myocarditis. This protective role is also evidenced by studies showing that IP-deficient mice severely suffer from impaired stress responses, survival, and / or clearance rates upon infection or inflammation or develop severe LPS-induced hepatitis. Moreover, IP dysfunction is connected with (auto)inflammation and autoimmunity, often accompanied by altered cytokine patterns, such as diabetes or Sjogren syndrome ((Brehm and Kruger, 2015). Several previously described autoinflammatory syndromes, such as Nakajo-Nishimura syndrome (NNS), joint contractures, muscle atrophy, microcytic anemia and panniculitis- induced lipodystrophy (JMP) syndrome, Japanese autoinflammatory syndrome with lipodystrophy (JASL), and chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature (CANDLE), were are now classified as a spectrum of diseases named proteasome-associated autoinflammatory syndrome (PRAAS). The multiple inflammatory developments include nonspecific lymphadenopathy, hepatosplenomegaly, autoimmune hemolytic anemia, hypertriglyceridemia, and lipodystrophy.

[0407] In certain embodiments, proteinopathic inflammatory diseases, disorders, and / or conditions may include one or more of inflammatory pelvic disease, urethritis, skin sunburn, sinusitis, pneumonitis, encephalitis, meningitis, myocarditis, nephritis, osteomyelitis, myositis, hepatitis, gastritis, enteritis, dermatitis, gingivitis, appendicitis, pancreatitis, cholocystitus, irritable bowel syndrome, ulcerative colitis, glomerulonephritis, dermatomyositis, scleroderma, vasculitis, allergic disorders including asthma such as bronchial, allergic, intrinsic, extrinsic and dust asthma, particularly chronic or inveterate asthma (e.g. late asthma airways hyper-responsiveness) and bronchitis, chronic obstructive pulmonary disease, multiple sclerosis, rheumatoid arthritis, disorders of the gastrointestinal tract, including, without limitation, Coeliac disease, proctitis, eosinophilic gastro-enteritis, mastocytosis, pancreatitis, Crohn's disease, ulcerative colitis, food-related allergies which have effects remote from the gut, e.g. migraine, rhinitis and eczema. Conditions characterised by inflammation of the nasal mucus membrane, including acute rhinitis, allergic, atrophic thinitis and chronic rhinitis including rhinitis caseosa, hypertrophic rhinitis, rhinitis purulenta, rhinitis sicca and rhinitis medicamentosa; membranous rhinitis including croupous, fibrinous and pseudomembranous rhinitis and scrofoulous rhinitis, seasonal rhinitis including rhinitis

[0408] 58

[0409] SUBSTITUTE SHEET (RULE 26) nervosa (hay fever) and vasomotor rhinitis, sarcoidosis, farmer's lung and related diseases, fibroid lung and idiopathic interstitial pneumonia, acute pancreatitis, chronic pancreatitis, and adult respiratory distress syndrome, and / or acute inflammatory responses (such as acute respiratory distress syndrome and ischemia / reperfusion injury).

[0410] The other examples of immune-mediated responses and diseases include, rejection following transplantation of synthetic or organic grafting materials, cells, organs or tissue to replace all or part of the function of tissues, such as heart, kidney, liver, bone marrow, skin, cornea, vessels, lung, pancreas, intestine, limb, muscle, nerve tissue, duodenum, small-bowel, pancreatic-islet-cell, including xenotransplants, etc.; treatment of graft- versus-host disease, autoimmune diseases, such as rheumatoid arthritis, systemic lupus erythematosus, thyroiditis, Hashimoto's thyroiditis, multiple sclerosis, myasthenia gravis, type I diabetes uveitis, juvenile-onset or recent-onset diabetes mellitus, uveitis, Graves' disease, psoriasis, atopic dermatitis, Crohn's disease, ulcerative colitis, vasculitis, autoantibody mediated diseases, aplastic anemia, Evan's syndrome, autoimmune hemolytic anemia, and the like; and further to treatment of infectious diseases causing aberrant immune response and / or activation, such as traumatic or pathogen induced immune dysregulation, including for example, that which are caused by hepatitis B and C infections, HIV, Staphylococcus aureus infection, viral encephalitis, sepsis, parasitic diseases wherein damage is induced by an inflammatory response (e.g., leprosy). Other immune-mediated responses and diseases relate to graft vs host disease (especially with allogenic cells), rheumatoid arthritis, systemic lupus erythematosus, psoriasis, atopic dermatitis, Crohn's disease, ulcerative colitis and / or multiple sclerosis.

[0411] Examples also include, diseases caused or worsened by the host's own immune response. For example, autoimmune diseases such as multiple sclerosis, lupus erythematosus, psoriasis, pulmonary fibrosis, and rheumatoid arthritis and diseases in which the immune response contributes to pathogenesis such as atherosclerosis, inflammatory diseases, osteomyelitis, ulcerative colitis, Crohn's disease, and graft versus host disease (GVHD) often resulting in organ transplant rejection. Additional exemplary inflammatory disease states include fibromyalgia, osteoarthritis, sarcoidosis, systemic sclerosis, Sjogren's syndrome, inflammations of the skin (e.g., psoriasis), glomerulonephritis, proliferative retinopathy, restenosis, and chronic inflammations.

[0412] The present invention provides an enhancement of proteolytic capacity by increasing proteasome activity by using of at least nsK-. antivatnr nr a pharmaceutically

[0413] 59

[0414] SUBSTITUTE SHEET (RULE 26) acceptable salt, hydrate or pharmaceutically active enantiomer that ameliorate onset and / or progression and even treatment of the autoimmune responses arised against protein aggregations caused by oxidatively damaged and / or misfolded proteins.

[0415] The present invention provides methods and compositions related to diverse group of neurodegenerative proteinopathies that are linked to D-serin increase.

[0416] D-serine (DS), an endogenous D-amino acid, is produced by serine racemase (SR) in glial cells and neurons. SR converts the free form of L-serine into DS. The free DS functions as a co-agonist of NMDA receptor in the brain, retina, keratinocytes and in chondrocytes. Incorporation of D-serine causes significant changes in the functional properties of many proteins that are detrimental to humans. Racemization of serine residues is known to occur in beta-amyloid senile plaques of Alzheimer’s disease (AD), human lens protein a- crystallin, human myelin basic protein, osteoarthritic articular and meniscal cartilages, the funnel-web spider toxin, egg ovalbumin and in skin. In addition to serine isomerization, SR also performs a, ^-elimination reaction with both L-serine and D-serine to produce pyruvate and ammonia (Rani et al. 2020).

[0417] One of the main features of the NMDA receptor is that its activation requires simultaneous binding of its agonist glutamate and co-agonist glycine. DS binds to NMDA receptor at the glycine site with three-fold higher affinity than glycine and the efficacy of DS to activate the NMDA receptor is 10 times higher in comparison to glycine. Hyperactivation of the NMDA receptor takes place in excess of DS.

[0418] The hyperactivity of the NMDA receptor is involved in many neurological diseases such as Alzheimer’s disease, amyotrophic lateral sclerosis, epilepsy, neuropathic pain, and cerebral ischemia.

[0419] Therefore, the inhibition of SR is another way to regulate the NMDA receptor transmission and is the only way to prevent serine isomerization occurring in proteins in certain pathological conditions including the AD. SR inhibition is proven to be neuro- protective in many situations.

[0420] Therefore, in another aspect, present invention demonstrates that increased protesome activity in the presence of GSK-3 activator decrease the serin racemesa in cell (Fig. 6 A), which decrease L-to-D-serin conversion, which will be effective in preventing or treating diseases of cerebral ischemia, traumatic brain injury, peripheral neuropathy, cerebral ischemia, choroidal neovascularization, Hyperactivity brain syndrome, Long-term

[0421] 60

[0422] SUBSTITUTE SHEET (RULE 26) Sequelaes of concussion, Seizure, retinal ganglion cell loss in diabetics, chronic social defeat stress, and other neurodegeneratif diseases.

[0423] And importantly, in another aspect, present invention provides compositions and methods which act as neuro-protective in neurological diseases.

[0424] The term “neuro-protective activity” as used herein refers to the effects of reducing or ameliorating nervous insult, and protecting or reviving neuronal cells that have suffered nervous insult . As used herein, the term “nervous insult” refers to any damage to neuronal cell or tissue resulting from various causes such as metabolic, toxic, neurotoxic and chemical causes. Also it refers to aging, which is the process of accumulating all of these causes (Darric et al. 2019).

[0425] Recent evidences show that astrocytic d-serine promote neuronal degeneration in Alzheimer's disease. The present invention provides compositions and methods which reduce the toxic effects of astrocytes by decreasing serin racemesa. Therefore, present inventions further provide a decrease in microvascular damage in diabetic retinopathy, synaptic damage after traumatic brain injury, neuronal over-activation, choroidal neovascularization, the pathologic symptoms of Alzheimer's disease, and neurodegeneration (Balu et al 2019).

[0426] In another aspect, present invention demonstrates that increased protesome activity in the presence of GSK-3 activator decrease serin racemesa, which decrease L-to-D-serin conversion, which will be effective in preventing or treating schizophrenia and other psychological diseases (Kishi and Iwata 2013).

[0427] According to an aspect of some embodiments of the present invention demonstrated that a GSK-3 activator decrease phosphorylated tau (pTau) by increasing the proteasome activation (Fig 6A). Tau is one of the major components of microtubule (MTN) networks in neurons, and its abnormal phosphorylation and aggregation are closely related to the impairment of axonal transport (Weng and He 2021 ).

[0428] MTNs are crucial for neurons, as the neuronal signaling and protein turnover between cell bodies and axons highly rely on the axonal transport along MTNs. The function of MTNs can be regulated by tau protein. Through binding to the microtubules, tau modulates the stability and dynamics of microtubules. Abnormal phosphorylation of tau interrupts its binding to microtubules and leads to disruption of MTNs. In this sense, the

[0429] 61

[0430] SUBSTITUTE SHEET (RULE 26) accumulation of p-Tau, a salient feature in AD, may impede the normal functioning of MTNs and cause a series of catastrophic cascades (Weng and He 2021 )..

[0431] Tauopathies are neurodegenerative disorders characterized by the presence of filamentous deposits, consisting of hyperphosphorylated tau protein, in neurons and glia. Abnormal tau phosphorylation and deposition in neurons and glial cells is one of the major features in tauopathies.

[0432] This term is now used to identify a group of diseases with widespread Tau pathology in which Tau accumulation appears to be directly associated with pathogenesis. Major neurodegenerative tauopathies includes sporadic and hereditary diseases characterized by filamentous tau deposits in brain and spinal cord. In the majority of tauopathies, glial, and neuronal tau inclusions are the sole or predominant CNS lesions. Exemplary such tauopathies include amytrophic lateral sclerosis (ALS), parkinsonism, argyrophilic grain dementia, diffuse neurofibrillary tangles with calcification, frontotemporal dementia linked to chromosome 17, corticobasal degeneration, Pick's disease, progressive supranuclear palsy, progressive subcortical gliosis, and tangle only dementia.

[0433] Additionally, tauopathies characterize a large group of diseases, disorders and conditions in which significant filaments and aggregates of tau protein are found. Exemplary such diseases, disorders, and conditions include sporadic and / or familial Alzheimer's Disease, amyotrophic lateral sclerosis / parkinsonism-dementia complex (ALS-FTDP), argyrophilic grain dementia, dementia pugilistica, diffuse neurofibrillary tangles with calcification, Down syndrome, frontotemporal dementia, parkinsonism linked to chromosome 17 (FTDP-17), Gerstmann-Straussler-Scheinker disease, Hallervorden- Spatz disease, inclusion body myositis, Creutzfeld-Jakob disease (CJD), multiple system atrophy, NiemannPick disease (NPC), Pick's disease, prion protein cerebral amyloid angiopathy, progressive supranuclear palsy (PSP), subacute sclerosing panencephalitis, tangle-predominant Alzheimer's disease, coiticobasal degeneration, (CBD), myotonic dystrophy, non-guanamian motor neuron disease with neurofibrillary tangles, postencephalitic parkinsonism, prion protein cerebral amyloid angiopathy, progressive subcortical gliosis, subacute sclerosing panencephalitis, and tangle-only dementia.

[0434] Neurodegenerative diseases where Tau pathology is found in conjunction with other abnormal protein lesions may be considered secondary tauopathies. Examples include AD and certain diseases where prion protein or a-synuclein are aggregated. Although

[0435] 62

[0436] SUBSTITUTE SHEET (RULE 26) tau is probably not the initial pathological factor, tau aggregates contribute to the final degeneration.

[0437] Alzheimer’s disease (AD) is a neurodegenerative disorder affecting numerous people around the world. It is the most common cause of dementia (Alzheimer’s Association, 2020) and the number of its victims continues to expand as the population ages. It has now become the sixth leading cause of death in the United States (Alzheimer’s Association, 2020). Although the pathogenesis and treatment of AD are under extensive scrutiny, the field has not achieved great gains yet. Intracellular aggregates primarily consisting of phosphorylated Tau (p-Tau) are one of the hallmarks in AD (Alzheimer’s Association, 2020; Weng and He, 2021 ). Pathological proteinopathy is also recognized as a subset of the proteinacious lesions detected in neurodegeneration with brain iron accumulate type I, amyotrophic lateral sclerosis / Parkinson's dementia complex of Guam, multiple systems atrophy, and familial AD.

[0438] The proteasome system maintains intracellular proteostasis by degrading abnormal or redundant proteins. Ever-mounting evidence suggests that proteasome activity deficits contribute to pTau accumulation. And increasing proteasome activity attenuates tau pathology (Boselli 2017). Indeed, the present invention demonstrates that increased protesome activity in the presence of GSK-3 activator decrease pTau amount.

[0439] Therefore, in one aspect present invention provides compositions and methods which prevent and / or treat diseases mentioned above caused by the tauopathy. pTau transgenic mice show disrupted mitochondrial dynamics and impaired mitophagy. The studies reveal that aggregation of APP and its cleavage product, Ap, and pTau leads to deficiencies in autophagy and mitophagy (Bussian et al. 2018). Therefore, in the presence of GSK-3 activator, as demonstrated by this invention, establishment of protein homeostosis should be ensured before the emergence of pathologies such as deficiencies in autophagy and mitophagy by the emergency of the pTau and other cleavage products.

[0440] Cognitive impairment and dementia are commonly defined as a progressive decline in cognitive function due to damage or disease in the body beyond what is expected from normal aging. Dementia is described as a loss of mental function, involving problems with memory, reasoning, attention, language, and problem solving. Higher level functions

[0441] 63

[0442] SUBSTITUTE SHEET (RULE 26) are typically affected first. Dementia interferes with a person's ability to function in normal daily life.

[0443] The cognitive impairment or dementia may stem from any etiology. Particular diseases that are associated with cognitive impairment or dementia include, but are not limited to, neurodegenerative diseases, neurological diseases, psychiatric disorders, genetic diseases, infectious diseases, metabolic diseases, cardiovascular diseases, vascular diseases, aging, trauma, malnutrition, childhood diseases, chemotherapy, autoimmune diseases, ocular diseases, and inflammatory diseases.

[0444] The present invention provides methods that prevents, reduces or even treats the cognitive impairment and dementia in normal aging and cognitive impairment and dementia stem from any etiology.

[0445] In one aspect present invention provides compositions and methods which prevent and / or treat renal diseases caused by accumulation of oxidatively damaged and / or misfolded proteins.

[0446] In another aspect present invention provides compositions and methods which prevent and / or treat renal insuficiencies caused by aging, hyperlipidemia, hypertension, smoking, diabetes, obesity and other factors which cause oxidative damage to proteins (Cauli et al. 2014). Therefore, the present invention ameliorate and / or treat acute and chronic kidney disease.

[0447] The unfolded protein response (UPR) is an adaptive cellular program used by eukaryotic cells to cope with protein misfolding stress (Madden et al. 2019; Hsu et al. 2019). The UPR is a pro-survival mechanism triggered by accumulation of unfolded or misfolded proteins in the endoplasmic reticulum (ER), a condition referred to as ER stress. Over the past decade, evidence has emerged supporting a role for the UPR in the establishment and progression of several cancers. In addition several literatures connects cancer chemotherapy resistance mechanisms and activation of the UPR (Madden et al. 2019; Hsu et al. 2019).

[0448] The present invention provides methods that prevents, reduces or even treats the cell proliferative diseases by reducing or preventing the unfolded protein accumulation and subsequently UPR.

[0449] In general, cell proliferative disorders, diseases, and / or conditions encompass a variety of conditions characterized by aberrant cell growth, preferably abnormally increased

[0450] 64

[0451] SUBSTITUTE SHEET (RULE 26) cellular proliferation. For example, proteionopathic cell proliferative diseases, disorders, and / or conditions include, but are not limited to, cancer, immune-mediated responses and diseases (e.g., transplant rejection, graft vs host disease, immune reaction to gene therapy, autoimmune diseases, pathogen-induced immune dysregulation, etc.), certain circulatory diseases, and certain neurodegenerative diseases.

[0452] According to the invention, the term “cell proliferative disorders” also refers to cancer diseases. The terms “cancer disease” or “cancer” (medical term: malignant neoplasm) refer to a class of diseases in which a group of cells display uncontrolled growth (division beyond the normal limits), invasion (intrusion on and destruction of adjacent tissues), and sometimes metastasis (spread to other locations in the body via lymph or blood). These three malignant properties of cancers differentiate them from benign tumors, which are self-limited, and do not invade or metastasize. Most cancers form a tumor, i.e. a swelling or lesion formed by an abnormal growth of cells (called neoplastic cells or tumor cells), but some, like leukemia, do not. Examples of cancers include, but are not limited to, carcinoma, leukemias and lymphomas such as cutaneous T-cell lymphomas (CTCL), peripheral T-cell lymphomas, lymphomas associated with human T-cell lymphotropic virus (HTLV) such as adult T-cell leukemia / lymphoma (ATLL), B-cell lymphoma, acute lymphocytic leukemia, acute nonlymphocytic leukemias, chronic lymphocytic leukemia, chronic myelogenous leukemia, acute myelogenous leukemia, Hodgkin's disease, non-Hodgkin's lymphomas, multiple myeloma, myelodysplastic syndrome, mesothelioma, common solid tumors of adults such as head and neck cancers (e.g., oral, laryngeal and esophageal), genitourinary cancers (e.g., prostate, bladder, renal, uterine, ovarian, testicular, rectal and colon), lung cancer, breast cancer, liver cancer, colon cancer, cancer of the small intestine, pancreatic cancer, melanoma and other skin cancers, stomach cancer, neoplasms of the central nervous system (CNS), neuroectodermal cancer, spinal axis tumors, glioma, meningioma, and pituitary adenoma liver cancer and thyroid cancer, and / or childhood solid tumors such as brain tumors, neuroblastoma, retinoblastoma, Wilms' tumor, bone tumors, and soft-tissue sarcomas. The term “cancer” according to the invention also comprises cancer metastases.

[0453] The present invention further provides, in another aspect, a method for treating different forms of cancer, in which protein homeostasis network is disturbed including increased protein synthesis, and misfolded protein production, accumulation of both misfolded protein aggregates, as well as apoptosis signaling proteins in cancer cells. Present

[0454] 65

[0455] SUBSTITUTE SHEET (RULE 26) invention, in another aspect, provides a method for preventing chemotherapy resistance mechanisms caused by UPR.

[0456] This can change the sensitivity of cancer cells to antineoplastic drugs (Madden et al. 2019; Hsu et al. 2019).

[0457] Previous studies have shown that inhibition of proteasome activity inhibits telomerase activity (Shalem-Cohavi etal, 2019).The shortening of telomere length is one of metabolic derangements compromise the normal aging process (such as loss of muscle mass and strength) .

[0458] Therefore, in another aspect, the present invention provides that GSK-3 activator increase telomerase activity by increasing the activity of proteasome. Consequently, present invention provides a method that ameliorate / correct metabolic derangments and this compromise the normal aging process. Present invention further provides that GSK- 3 activator delays cell senescence by increasing telomerase activity which provides prolongation of life (Shalem-Cohavi et al. 2019).

[0459] GSK-3 activators as senolytic drugs

[0460] Mammalian cells have the exceptional ability to adapt to perturbations in the extracellular and intracellular environments. Perturbations in a cell’s microenvironment promote the activation of metabolic and molecular changes to ensure cell survival. Despite these adaptive mechanisms, chronic or severe, irreparable damage will terminate the damaged cell to preserve an organism’s life. The termination of a damaged cell refers to the end of the normal physiological status of the cell. This can happen through cellular division inactivation, a state known as senescence, or by the elimination of the damaged cells, a process known as regulated cell death. The cell cycle regulator p53 has a key role in controlling the decision to activate pro-apoptotic regulators in response to severe damage or to regulate p21 Cip1 transcription to induce senescence in response to a milder but still damaging insult Therefore, when the damage is severe enough but is not lethal, cells switch to a permanent, non-proliferating state. Intra and extracellular signals that can contribute to cells’ entering the senescent cell fate mainly include signals related to tissue or cellular damage and / or cancer development. These include protein aggregates, misfolded proteins, failed protein removal through decreased proteasome activity, presence of AGEs due to the reaction of reducing sugars with amino groups in proteins (e.g. Haemoglobin A1 c is an AGE), saturated lipids and other bioactive lipids (bradykines, certain prostaglandins, etc.)rQQctive metabolites (e.g. ROS, hypoxia or

[0461] 66

[0462] SUBSTITUTE SHEET (RULE 26) hyperoxia), DNA damage, telomeric uncapping or dysfunction, exposure to extracellular DNA, oncogene activation, replicative stress or inducers of proliferation (such as growth hormone / IGF-1 ), inflammatory cytokines (e.g. TNFa). Therefore, cellular senescence is a complex stress response that causes an essentially irreversible arrest of cell proliferation and development of a multicomponent senescence-associated secretory phenotype (SASP).

[0463] The SASP consists of a myriad of cytokines, chemokines, growth factors, and proteases that initiate inflammation, wound healing, and growth responses in nearby cells. In young healthy tissues, the SASP is typically transient and tends to contribute to the preservation or restoration of tissue homeostasis. However, senescent cells increase with age, and a chronic SASP is known or suspected to be a key driver of many pathological hallmarks of aging, including chronic inflammation, tumorigenesis, and impaired stem cell renewal (Saez- Atienzar and Masliah 2020).

[0464] These inducers activate one or more senescence-promoting transcription factor cascades, in some cases involving p16INK4a-retinoblastoma protein (Rb), in others, p53 and p21 CIP1 , both of these pathways, or other pathways.

[0465] Data from several laboratories, strongly support the idea that senescent cells and the SASP drive multiple age-related phenotypes and pathologies, including atherosclerosis, osteoarthritis, cancer metastasis, cardiac dysfunction, myeloid skewing, kidney dysfunction, and overall decrements in health span.

[0466] SASP is one of the three main features of senescent cells, the other two features being arrested cell growth, and resistance to apoptosis. Senescent cells are highly metabolically active, producing large amounts of SASP, which is why senescent cells consisting of only 2% or 3% of tissue cells can be a major cause of aging-associated diseases. SASP factors cause non-senescent cells to become senescent. SASP factors induce insulin resistance. SASP disrupts normal tissue function by producing chronic inflammation, induction of fibrosis and inhibition of stem cells. Chronic inflammation associated with aging has been termed inflammaging, although SASP may be only one of the possible causes of this condition. Chronic inflammation due to SASP can suppress immune system function, which is one reason elderly persons are more vulnerable to COVID-19.

[0467] SASP induces an UPR in the cell because of an accumulation of unfolded proteins, resulting in proteotoxic impairment of cell function (Saez- Atienzar and Masliah 2020.

[0468] 67

[0469] SUBSTITUTE SHEET (RULE 26) Ablation of senescent cells (senolytic therapy) has been postulated as a promising therapeutic approach to target the ageing phenotype and, thus, to prevent, delay or mitigate ageing-related, and many other diseases. The aim with senolytic compounds is to rejuvenate organisms by selectively killing senescent cells and their efficacy is based on the ability of senescent cells to resist apoptosis. These cells exhibit upregulation of pro-survival pathways to protect themselves from the damaging (and pro-apoptotic) effect of the SASP. To date, six pro-survival pathways have been detected in senescent cells: the BCL-2-BCL-xL pathway, the MDM2-p53-p21 Cip1-serpine elements pathway, ephrins-dependence receptors-tyrosine kinases, the PI3K-AKT-ceramide metabolic pathway, the hypoxia inducible factor 1a (HIF-1a) pathway and the SP-90-dependent pathway. Senolytic compounds interfere with these pro-survival pathways to let senescent cells die by apoptosis (Saez- Atienzar and Masliah 2020.

[0470] Clearing already formed senescent cells, many of which harbour oncogenic mutations or cause cancer-promoting inflammation due to their SASP, prevents or delays cancer development. Indeed, senolytic drugs, agents that selectively eliminate senescent cells, delay development of multiple forms of cancer in old mice as well as cancer-prone, DNA repair-deficient Ercc17D mice.

[0471] Furthermore, although capacity for cells to become senescent is a cancer defence mechanism, already formed, chronically persisting senescent cells can accelerate cancer growth because of suppression of immune responses, growth factors in the SASP, production of proteases that can interfere with encapsulation of tumours and therefore can enhance spread of cancer, and promotion of mesenchymal transition of cells. Thus, targeting transcription factor cascades that allow cells to become senescent can exacerbate cancer development, whilst clearing already formed senescent cells with senolytics can prevent cancer development, growth and spread (Saez- Atienzar and Masliah 2020; Thoppil and Riabowol 2020).

[0472] Therefore p53, p21 , pRb, BCL-2, AKT, SP-90 and others involved in these pathways are target of the Senolytic compounds (Saez- Atienzar and Masliah 2020; Thoppil and Riabowol 2020).

[0473] The present invention demonstrate that GSK-3 activator increase the proteasome activity and cause a decrease in p21 , p53, and pAkt which are the major target molecules of the senolytic drugs (Fig, 6 A-D; Fig. 7 A-H) .

[0474] 68

[0475] SUBSTITUTE SHEET (RULE 26) According to some embodiments, the present invention provides, in one aspect, a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer thereof, for use in ablation of senescent cells which has been postulated as a promising therapeutic approach to target the ageing phenotype and, thus, to prevent, delay or mitigate ageing-related diseases

[0476] Therefore, According to an aspect of some embodiments of the present invention there is provided a GSK-3 activator for use in treating ageing which is caused by cellular senescence and associated with increasing risk for developing multiple chronic diseases, the geriatric syndromes, impaired physical resilience and mortality.

[0477] Amongst the diseases with emerging evidence for a causal contribution of cellular senescence or benefits of senolytics include, but are not limited to, Diabetes / Obesity, metabolic diseases, Cardiac dysfunction, congestive heart failure, myocardial infarction, Vascular hyporeactivity / calcification, AV fistulae, Frailty, Age-related muscle loss (Sarcopenia), arthritis, osteoporosis, falls, Chemotherapy complications, Radiation complications, Cancers, Bone marrow transplant complications, Organ transplantation complications, Myeloma / MGUS (monoclonal gammopathy of undetermined significance), Age-related cognitive dysfunction, other dementias, Alzheimer’s disease, Parkinson’s disease, Amyotrophic lateral sclerosis, Ataxia, Obesity-related neuropsychiatric dysfunction, Renal dysfunction, Urinary incontinence, Osteoporosis, Osteoarthritis, Age-related intervertebral disc disease, Idiopathic pulmonary fibrosis, Hyperoxic lung damage, Chronic obstructive pulmonary disease, Tobacco, Hepatic steatosis, Cirrhosis, Primary biliary cirrhosis, Progerias, Pre-eclampsia, Macular degeneration, Glaucoma, Cataracts, blindness, Prostatic hypertrophy, incontinence, Psoriasis, Healthspan, Lifespan and many others. (Kirkland and Tchkonia, 2020)

[0478] The accumulation of unfolded, misfolded, or damaged proteins severely impairs the function of organelles. Several reports indicate that one of the first detectable consequences of proteasome dysfunction concerns mitochondria, which develop deleterious alterations in their proteome. Mitochondria are the cellular power plants that produce energy through oxidative phosphorylation. They also directly contact most (if not all) other cytosolic organelles (e.g., ER, plasma membrane, and peroxisomes) to generate specialized networks that control several cellular functions like Ca2+ homeostasis, lipid synthesis, and apoptosis. Importantly, dysfunctional mitochondria are also the major source for oxidative stresrtk,-'oiinh ab rrant production of ROS, which

[0479] 69

[0480] SUBSTITUTE SHEET (RULE 26) has profound implications for the pathogenesis of various diseases, in particular neurodegenerative disorders and cancer, as well as aging (Pan et al. 2021 ).

[0481] The mitochondria are involved in a range of other processes, such as signaling, cellular differentiation, cell death, as well as the control of the cell cycle and cell growth. Given their entral role in cell metabolism, damage and subsequent dysfunction in mitochondria is an important factor in a wide range of human diseases and may play role in the aging process.

[0482] The protesome pathway preserve mitochondrial plasticity and quality by controlling several levels of mitochondrial dynamics. These activities and processes are tightly interconnected. During moderate stress, as a first line of defense against mitochondrial dysfunction, the UPS is in charge of outer membrane PQC and the degradation of damaged proteins in a process called outer mitochondrial membrane-associated degradation (OMMAD). Moreover, the UPS directly controls mitochondrial dynamics by degrading proteins involved in mitochondrial fusion and fission processes.

[0483] Therefore the present invention can provide effective treatment for, reduction of symtoms and even prophylaxis of, certain mitochondrial diseases, directly or indirectly, including, Mitochondrial myopathy, Diabetes mellitus and deafness, Leber's hereditary optic neuropathy, Leigh syndrome, subacute sclerosing encephalopathy, Neuropathy, ataxia, retinitis pigmentosa, ptosis, progressive symptoms of dementia, Myoneurogenic gastrointestinal encephalopathy, MERRF syndrome(Myoclonus Epilepsy with Ragged Red Fibers),, MELAS syndrome (Mitochondrial Encephalopathy, Lactic Acidosis and Stroke-like episodes), Mitochondrial DNA depletion syndrome, Huntington's disease, cancer, Alzheimer's disease, Parkinson's disease, bipolar disorder, schizophrenia, aging and senescence, anxiety disorders, Alper syndrome, Lowe syndrome, Luft syndrome, Menke's kinky hair syndrome, Zellweger syndrome, mitochondrial myopathy, and rhizomelic chondrodysplasia punctata.

[0484] Endoplasmic reticulum is an organelle that performs various functions such as lipid and protein synthesis, protein folding, calcium homeostasis. In this organelle, an increase and accumulation in unfolded or misfolded proteins disrupts functions of the organelle and causes endoplasmic reticulum stress. The complex signalling pathways triggered by ER stress constitute the UPR (unfolded protein response). Endoplasmic reticulum stress is seen in neurodegenerative diseases, metabolic diseases, arteriosclerosis, diabetes

[0485] 70

[0486] SUBSTITUTE SHEET (RULE 26) mellitus and obesity. Endoplasmic reticulum stress is also associated with cancer (Ding et al. 2007; Roussel 2013).

[0487] The present invention provides, in one aspect ,a pharmaceutical composition comprising at least one GSK-3 activator or a pharmaceutically acceptable salt, hydrate or pharmaceutically active enantiomer thereof, for use in treating a the endoplasmic reticulum (ER) related diseases, directly or indirectly, including by decreasing ER stress. Metabolic diseases including, Insulin resistance, Arteriosclerosis, Diabetes mellitus, Obezite, alcoholic and non-alcoholic fatty liver disease, hyperlipidemia; cancers including Leukemia, multiple myeloma, breast cancer, prostate tumor; immun system related diseases including, viral infections, Bacterial infections, Vitiligo, rheumatoid arthritis, and type 1 diabetes. Many neurological diseases are known to be associated with ER stress, including cerebral ischaemia, sleep apnea, Alzheimer’s disease, multiple sclerosis, amyotrophic lateral sclerosis, the prion diseases, Parkinson’s and Huntington’s diseases and familial encephalopathy with neuroserpin inclusion bodies.

[0488] Autophagy lysosome pathway is another degradation pathway in which cytoplasmic components, such as protein aggregates and damaged organelles are degraded and recycled for maintaining normal cellular homeostasis. In this pathway cytoplasmic materials are delivered to lysosomes, sequestered into autophagosome, which subsequently fuse with lysosomes, where the cargo is degraded.

[0489] Depending on the context, autophagy and the proteasome share common substrates as well as regulatory factors. Both systems intersect and communicate at multiple points to coordinate and balance their actions in proteostasis and homeostasis of organelles (Liu et al. 2020; Ding et al. 2007; Feldman et al. 2019).

[0490] The most important concern that may occur as consequence of decreased protesome activity is the accumulation of potentially toxic un / misfolded proteins as well as protein aggregates. The proteasome impairment will eventually affect the vital function of autophagy and cytosolic processes and all other organelles due to the accumulation of unfolded and damaged proteins (Dikic 2017; Pohl and Dikic 2019, Kocaturk and Gozuacik, 2018).

[0491] The present invention encompasses the finding that activation of proteasome by GSK-3 activator, through increased levels and / or increased activity, can provide effective treatment for, and even prophylaxis of, certain autophagy related human diseases, such as adult neurodegenerative disorders includino Parkinson's disease, Amyotrophic lateral

[0492] 71

[0493] SUBSTITUTE SHEET (RULE 26) schlerosis, Frontotemporal dementia, Neuronal ceroid lipofuscinosis, Fulminant neurodegeneration, Dementia with Lewy bodies; pediatric Neurodevelopmental disorders including Spinocerebellar ataxia, Cortical atrophy and epilepsy, Childhoodonset neurodegeneration, BPAN, Spastic quadriplegia and brain abnormalities, Primary microcephaly, Hereditary spastic paraplegia, Ataxia with spasticity, Rett syndrome, Joubert syndrome, Leukoencephalopathy, Adolescent-onset dystonia, CEDNIK syndrome, Pelizaeus-Merzbacher-like disorder, West syndrome; Hereditary neuropathies including Sensory and autonomic neuropathy type II, Charcot-Marie-Tooth disease, Sensory and autonomic neuropathy type IF, Distal hereditary motor neuronopathy; Ophthalmological diseases including Primary open-angle glaucoma, Cataracts; Cardiac and skeletal myopathies including Danon’s cardiomyopathy, Distal myopathy with rimmed vacuole, Dilated cardiomyopathy, Sporadic inclusion body myositis, X-linked myopathy with excessive autophagy; Inflammatory disorders including Crohn’s disease, Ulcerative colitis, Childhood asthma; Autoimmune diseases including Systemic lupus erythematous, Diabetes, Other autoimmune diseases; Infectious diseases including M. tuberculosis, M. leprae; Skeletal disorders including Osteopetrosis, Paget’s disease of the bone, Kashin-Beck disease; Congenital multisystem disorders including Global developmental abnormalities, Vici’s syndrome, Zellweger's syndrome, Glycosylation disorder with autophagy defects, Zimmerman- Laband syndrome, Hermansky-Pudlak syndrome, Multisystem proteinopathy.

[0494] The present invention encompasses the finding that activation of proteasome by GSK-3, prevents the malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins which are associated with lysosome dysfunctions. The present invention encompasses the finding that activation of proteasome by a GSK-3 activator, through increased levels and / or increased activity, can provide effective treatment for, and even prophylaxis of, certain Lysosomal Storage Diseases. Lysosomal storage diseases include Gaucher disease, Fabry disease, Niemann-Pick disease, Hunter syndrome, Glycogen storage disease II (Pompe disease), Tay-Sachs disease.

[0495] Importantly, in any case, attempts to improve proteostasis pharmacologically have to be at an early stage of disease before the manifestation of severe cellular dysfunction. Indeed, present invention demonstrated that starting treatment early is more effective in increasing life expectancy than starting late (Salomon et al. 2012; Halminen et al. 2021 ).

[0496] 72

[0497] SUBSTITUTE SHEET (RULE 26) Present invention states that modulation of GSK-3 can occur directly through GSK-3 activators agents which may be or comprise a compound of any chemical class (e.g., a small molecule, metal, nucleic acid, polypeptide, lipid and / or carbohydrate) which increases level and / or activity of its target entity to a point within a predetermined range of a reference level and / or activity.

[0498] In certain embodiments, GSK-3 activators may be compounds that directly increase the activity or amount of GSK-3.

[0499] In certain embodiments, the direct action of GSK-3 activators may occur due to conformational changes on GSK-3 or due to conformational changes that occur due to phosphorylations in the GSK-3 protein.

[0500] In certain embodiments, GSK-3 activators agents may be or comprise a compound binds directly or indirectly (i.e., by binding with a physically distinct entity that binds to the target) to its target.

[0501] In certain embodiments, GSK-3 activators agents may be or comprise a compound does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the target through other action (e.g., binding to a regulatory site in a nucleic acid that increases expression of the target; activation or inhibition of an enzyme that modifies the target and alters its activity, direct expression of GSK-3 nucleotide with or without help of the plasmid vector systems, etc).

[0502] In certain embodiments, GSK-3 activators agents may be or comprise several natural molecules include Differentiation-inducing- factor-1 and 3 (DIF-1 , 3), a\\-trans retinoic acid (RA), Resveratrol, Diferuloylmethane (curcumin), berberine (BBR) Berberiscoptes, Troglitazone and others.

[0503] In certain embodiments, along with natural products, GSK-3 activators agents may be or comprise several molecules include the identification of molecules that will increase GSK-3 activity with the help of computer-assisted drug technology.

[0504] In certain embodiments, GSK-3 activators agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with GSK-3, but increases level and / or activity of the GSK-3 through action of molecules involved in different pathways (eg. Wnt / b-catenin, Insulin and other growth signaling molecules related pathways, PI3K / Akt, MAPKAP-K1 , mTOR- S6K1 , cAMP-PKA, tyrosine kinase receptor (Trk)-PI3K-Akt, Norepinephrine-dopamine, inflamation, COX-1 and 2 related, calcium signaling, and other pathways).

[0505] 73

[0506] SUBSTITUTE SHEET (RULE 26) Therefore, present invention states that modulation of GSK-3 can occur directly through GSK-3, or indirectly by molecules that modulate the pathways including, Wnt / b-catenin, Insulin and other growth signaling molecules related pathways, PI3K / Akt, MAPKAP-K1 , mTOR- S6K1 , cAMP-PKA, tyrosine kinase receptor (Trk)-PI3K-Akt, Norepinephrinedopamine pathways, COX-1 and 2 related pathways, calcium signaling pathways, inflamation related pathways, and other pathways.

[0507] In certain embodiments, compounds that modulate GSK-3 activation by affecting molecules in different pathways can be any chemicals agents (e.g., a small molecule, metal, nucleic acid, polypeptide, lipid and / or carbohydrate), an antibody or antibody mimic, a nucleic acid agent (e.g., an antisense oligonucleotide, a siRNA, a shRNA, etc.) or mimic thereof, a naturally-occurring compound (e.g., small molecule), a chemical structure that is generated and / or modified by humans.

[0508] In certain embodiments, compound affecting the GSK-3 may be related to a molecule or molecules involved in both the canonical or non-canonical Wnt / b-catenin signaling pathway.

[0509] In certain embodiments, GSK-3 activators relates to compounds which are in vivo and / or in vitro capable to block, either completely or partially, the action and / or function of the canonical Wnt / b-catenin signaling pathway, in which, several natural extracellular Wnt molecules are involved, including the wnt proteins, Fz-related protein sFRP, Wnt inhibitory factor 1 , sclerostin, Wise, DKK1 , LRP5 / 6, Waifl , APCDD1 , Cerberus, IGFBP, Shisa, Tikil and others.

[0510] In certain embodiments, GSK-3 activators relates to compounds which are in vivo and / or in vitro capable to block, either completely or partially, the action and / or function of the non-canonical Wnt / b-catenin signaling pathway, including Wnt planer cell polarity pathway, Wnt-JNK signaling pathway, Wnt / Ror receptor pathway, Wnt-GSK3MT pathway, Wnt-aPKC pathway, Wnt-RYK pathway, and Wnt-mTOR pathway may or may not transduce calcium-dependent (Ca2+ / CaMKII) cell signaling.

[0511] Thus, in certain embodiments, molecules in GSK-3 pathways, Wnt pathways, and other pathways indicated or unspecified and capable of affecting GSK-3 are all targets for GSK-3 activation.

[0512] Non-limiting examples of drugs discoveried as Wnt / -catenin pathway inhibitors that antagonize, or inhibit, the action of the Wnt and accordingly activate GSK-3; include IWP-4, Rh4, M2912, KY-05009, XAV-939, Foscenvivint (ICG-001 ), Capmatinib

[0513] 74

[0514] SUBSTITUTE SHEET (RULE 26) (INCB28060), Resibufogenin, Isoquercitrin, JW55, RCM-1 , MSAB, IWP-2, KY021 11 , WIKI4, CCT251545, Prodigiosin, IQ-1 , NCB-0846, PNU-74654, LF3, iCRT14, Adavivint (SM04690), PRI-724, Triptonide, M435-1279, lndirubin-3'-oxime, Laduviglusib (CHIR- 99021 ), Laduviglusib (CHIR-99021 ) HCI, L-Quebrachitol, Methyl Vanillate, KY19382 (A3051 ), CGP 57380, Isoxazole 9 (ISX-9), CP21 R7 (CP21 ), Tegatrabetan (BC-2059), iCRT3, WAY-316606, WAY-26261 1 , KY1220, TMTD (Tetramethylthiuram disulfide), Heparan Sulfate, Foxy-5, Benzimidazole scaffold, SRI37892, ZINC05972969, Fz7-21 , Benzothiazole scaffold, GNF-13331 , LGK974, Piperidine-maleimide scaffold, Cordycepin, Anticancer bioactive peptide, Dehydroxyhispolon methyl ether, SSTC3, Chlorquinaldol, KYA1797K, BMP7v, Sulindac, 4[3-Hydroxywithanolide E, HGC33-SFB- NP, VALD-3, FL1 18, Prednisolone, 3-CI-AHPC, IWP-2, RBM5, Hsa_circ_0004018, Lanatoside C, TIPE1 , Salinomycin, IC-2, Epigallocatechin-3-gallate, Benzyl isothiocyanate, Phenethylisothiocyanate, Atrial natriuretic peptide, Pyrvinium Thiazolidinediones, SphK1 inhibitor II, SP600125, FH535, Cell adhesion molecule 1 , Probenecid, Ciclopirox, E-cadherin ,WP9QY, Collagen XVIII, N-butyloxycarbonyl hexapeptide, Phosphoprotein phosphatase-2A, XAV939, Tsukushi, HDAC-inhibitor, SM08502, IWR-1 , XAV939, DK419, BC029135, ETC-1922159 ,PARP1 inhibitors, Celecoxib, 2,5-dimethyl-celecoxib, indoesunate, Artesunate , Indomethacin, Ethacrynic acid, Pimozide, Cyclosporin A; Agents / phytochemicals targeting the Wnt pathway, 19-tert-butyldiphenylsilyl-8, 17-epoxy andrographolide, 11a, 12a-epoxyleukamenin E, YW2065, Esculetin, Silibinin, Mesalamine, resveratrol, Anthocyanins / anthocyanidins, Crocin, Potato glycoalkaloids, Triptolide, Decane tetracyclic triterpenes, Maclurin, ginsenosides, salidroside, Z-Ajoene; Wnt antagonist miRNAs: MiR-377-3p, MiR-506, MiR-148a, Small interfering RNA against WNT8b, MiR-384, MiR-20b, MiR-216a, MiR- 375-3p, MiR-624-5p, MiR-376c, and pharmaceutically acceptable salts, hydrates and pharmaceutically active enantiomers thereof. Each possibility represents a separate embodiment of the invention.

[0515] Non-limiting examples of the Wnt antagonist also include anti-receptor antibodies, antiligand antibodies, inhibitory nucleic acids, etc.

[0516] Each possibility represents a separate embodiment of the invention.

[0517] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, from the modulation of insulin, through action of molecules involved in insulin patways (e.g. IGF-1 R (insulin receptor-PI3K-Akt pathway) inhibitors). Non-limiting examples of

[0518] 75

[0519] SUBSTITUTE SHEET (RULE 26) IGF-1 R inhibitors includes Linsitinib, Ceritinib , Picropodophyllin, BMS-754807 , BMS- 536924, GSK1838705A, GSK1904529A, Ganitumab , Dalotuzumab, BMS-536924, BMS-754807, GSK1904529A, GSK1838705A, NVP-AEW541 , AZD-3463, Ceritinib dihydrochloride, Ceritinib (LDK378), NVP-TAE 226, NVP-AEW541 , NVP-ADW742, AG1024, NVP-ADW742, XL228, AZ7550 Mesylate, PQ401 , Indirubin Derivative E804, NBI-31772, l-OMe-Tyrphostin AG 538, Chromeceptin, NBI-31772 hydrate, Ceritinib-d7, AZ7550 hydrochloride, AZ7550, Robatumumab, AZ7550-d5 , Lonigutamab, IGF-1 R inhibitor-2, Istiratumab, Picropodophyllotoxin-d6, Lonigutamab ugodotin , AZ12253801 , MID-1 , Ginsenoside Rg5, Dioscoreae Nipponicae Rhizoma Extract, Luminespib (NVP- ALIY922), Linsitinib (OSI-906), AG-1024, SBI-477, Nordihydroguaiaretic acid (NDGA), Picropodophyllin (PPP), PQ 401 , NT157, Brigatinib (AP26113)

[0520] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, from the modulation of PI3K- AKT. Non-limiting examples of PI3K inhibitors includes Lupenone, Parsaclisib (INCB050465), IHMT-PI3K5-372, PI3K / mTOR Inhibitor-2, (E)-Akt inhibitor-IV, PIK-108, Dioscoreae Nipponicae Rhizoma Extract, Trichosanthis Pericarpium Extract, Tripterygium wilfordii Extract, Dichroa febrifuga Extract, SKI-V, Cafestol, Dactolisib (BEZ235), PI-103, Pictilisib (GDC-0941 ), ZSTK474, LY294002, XL147 analogue, TGX-221 , PIK-90, PIK-75 HCI, YM201636, IC-87114, Amarogentin, TG100-1 15, GSK1059615, Rigosertib (GN-01910), AS-605240, AZD6482, Voxtalisib (XL765) Analogue, PIK-293, Idelalisib, PIK-294, Buparlisib (BKM120), Quercetin Dihydrate, Quercetin (NSC 9221 ), Gedatolisib (PKI-587), A66, NU7441 (KU-57788), Omipalisib (GSK2126458), AS-252424, AS-604850, CAY10505, Apitolisib (GDC-0980), CH5132799, PKI-402, PF-04691502, BGT226 (NVP-BGT226) maleate, Wortmannin (KY 12420), Fimepinostat (CUDC-907), 3-Methyladenine (3-MA), Copanlisib (BAY 80-6946), Alpelisib (BYL719), TG100713, NU7026, Trigonelline, Cinobufagin, Resibufogenin, Loureirin A, Zeaxanthin, Hispidulin, Solasodine, Notoginsenoside R1 , Lanatoside C, acalisib (GS-9820), Gallein, GNE-477, GNE-493, MTX-211 , VS-5584 (SB2343), CZC24832, Duvelisib (IPI-145), Taselisib (GDC 0032), IPI-3063, HS-173, PI-3065, Pilaralisib (XL147), Voxtalisib (XL765), PF-4989216, SAR405, PIK-III, AZD8186, GNE- 317, AMG319, Nemiralisib, GSK2292767, AZD8835, VPS34-IN1 , GSK2636771 , KU- 0060648, Deguelin, GDC-0326, Paxalisib (GDC-0084), umbralisib (TGR-1202), Samotolisib (LY3023414), Eganelisib (IPI-549), VPS34 inhibitor 1 (Compound 19), Seletalisib (UCB-5857), Serabelisib (TAK-1 17), SF2523, Autophinib, Inavolisib (GDC- 0077), Tenalisib (RP6530), Selective PIQIZinhibitor 1 foomnound 7n), Bimiralisib

[0521] 76

[0522] SUBSTITUTE SHEET (RULE 26) (PQR309), leniolisib (CDZ 173), Parsaclisib (INCB050465) Hydrochloride, ME-401 , SRX3207, Pectolinarin, Oroxin B; and Akt inhibitors includes MK-2206 2HCI, Perifosine (KRX-0401 ), GSK690693, Ipatasertib (GDC-0068), Capivasertib (AZD5363), PF- 04691502, AT7867, Triciribine (NSC 154020), CCT128930, A-674563, PHT-427, A- 443654, Miransertib, (ARQ-092), BAY1 125976, Borussertib, Miransertib (ARQ 092) HCI, Akti-1 / 2, Uprosertib (GSK2141795)Afuresertib (GSK21 10183), AT13148, Oridonin (NSC- 250682), Miltefosine, Honokiol (NSC 293100), TIC10 Analogue, BIA, a-Linolenic acid, SPP-86, Hematein, RPI-1 , Urolithin B, Cinobufagin, Daphnoretin, Loureirin A, Trigonelline, ML-9 HCI, ABTL-0812, Alobresib (GS-5829), Praeruptorin A, Oroxin B, SC66, Usnic acid, Scutellarin, Astragaloside IV, Deguelin, TIC10 (ONC201 ), Methyl- Hesperidin

[0523] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, from the modulation of MAPK-MAPKAP-K1. Non-limiting examples of MAPK-MAPKAP-K1 inhibitors includes Dilmapimod (SB-681323), p38-a MAPK-IN-1 , Falnidamol, SKF- 86002, Chitosan oligosaccharide, Pulsatillae Extract, Suberect spatholobus stem Extract, Weigela Grandiflora Fortune Extract, Dichroa febrifuga Extract, TA-01 , SB 242235, SD169, R1487, AUDA, Adezmapimod (SB203580), SB202190 (FHPI), Neflamapimod (VX-745), Ralimetinib (LY2228820) dimesylate, Doramapimod (BIRB 796), PH-797804, TAK-715, 3,4',5-Trimethoxy-trans-stilbene, 3'-Hydroxypterostilbene, Trans-Zeatin, PD 169316, Berberine chloride hydrate, VX-702, SD 0006, TA-02, SEA0400, Skepinone-L, Losmapimod (GW856553X), ML141 , SB239063, Pexmetinib (ARRY-614), BMS-582949, Pamapimod, UM-164, Xanthatin, Mulberroside A, Praeruptorin A, sappanone A, Asiatic Acid, Metformin, 5'-N-Ethylcarboxamidoadenosine (NECA), Largeleaf Gentian Root Extract, Rotundic acid, Panax notoginseng Root Extract, Panax notoginseng Rhizoma Extract, Radix Scrophulariae Extract, NDMC101 , Metformin HCI, Berberine chloride (NSC 646666).

[0524] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, effects of the modulation of mTOR and the downstream S6K1 kinase. Non-limiting examples of mTOR inhibitors includes MTI-31 , JR-AB2-01 1 , PI3K / mTOR Inhibitor-2, mTOR inhibitor-1 , Dactolisib (BEZ235), Ridaforolimus (Deforolimus, MK-8669), PI-103, Rapamycin (AY-22989), Temsirolimus (CCI-779), Everolimus (RAD001 ), KU-0063794, WYE-354, GSK1059615, Voxtalisib (XL765) Analogue, AZD8055, Nitazoxanide (NSC

[0525] 77

[0526] SUBSTITUTE SHEET (RULE 26) 697855)Torkinib (PP242), Palomid 529 (P529), Chrysophanic Acid, PP121 , OSI-027, Gedatolisib (PKI-587), NU7441 (KU-57788), Omipalisib (GSK2126458), WYE-125132 (WYE-132), WYE-687, WAY-600, Apitolisib (GDC-0980), PF-04691502, BGT226 (NVP- BGT226) maleate, Vistusertib (AZD2014), Sapanisertib (MLN0128), Torin 2, Torin 1 , Astragaloside IV, Lanatoside C, Compound 401 , GNE-477, GNE-493, XL388, Zotarolimus (ABT-578), 4EGI-1 , MHY-1685, Voxtalisib (XL765), Onatasertib (CC 223), ETP-46464, Paxalisib (GDC-0084)CZ415, Samotolisib (LY3023414), SF2523, Bimiralisib (PQR309), PQR620, ABTL-0812

[0527] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, the effects of the modulation of Trk Receptor inhibitors (tyrosine kinase receptor (Trk)- PI3K-Akt. Non-limiting examples of Trk inhibitors includes ANA-12, 7,8- Dihydroxyflavone, N-Acetyl-5-hydroxytryptamine, LM22A-4, Taletrectinib (DS-6051 b), PF-06273340, BMS-754807, Altiratinib, CH7057288, Sitravatinib (MGCD516), GNF- 5837, BMS-935177, LM22B-10, Entrectinib (RXDX-101 ), Belizatinib (TSR-01 1 )

[0528] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, the effects of COX-1 and COX-2 Inhibitors. Non-limiting examples of COX-1 and COX- 2 Inhibitors includes Rutaecarpine, Deracoxib, Valdecoxib, Rofecoxib, Carprofen, Celecoxib (SC 58635), Lumiracoxib, Tolfenamic Acid, NS-398 (NS398), Nimesulide, Madecassic acid, Ginsenoside Rd, Myrislignan, StylopineHederagenin, Jaceosidin, Mavacoxib, Oroxin B, Pectolinarigenin, Guaiacol, Marmesin, Niflumic acid, Sulfasalazine (NSC 667219), Dehydroevodiamine, Etoricoxib, Dexamethasone Sodium Phosphate, Ginsenoside Rb3, Asaraldehyde, 4-Hydroxyphenylpyruvic acid, NE 52-QQ57, Desmethyl Celecoxib, 3-Carene, FK-3311 , Lornoxicam, Ketorolac tromethamine salt, S-(+)- Ketoprofen, Meclofenamate SodiumAmfenac Sodium Monohydrate, Diclofenac Sodium, Indometacin Sodium, Resveratrol (SRT501 ), Ketorolac, Naproxen Sodium, SC-560, Indomethacin (NSC-77541 ), Ibuprofen (NSC 256857), ZaltoprofenXanthohumol, Oxaprozin, Aspirin (NSC 27223), Mefenamic Acid, Suprofen, Nepafenac, Salicin, Ketoprofen, Bromfenac Sodium.

[0529] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, directly the modulation of COX-1 and COX-2 by supplements. Non-limiting examples of COX-1 and COX-2 modulating supplements includes Ajoene , Alpha Lipoic Acid , Anthocyanins (like Bilberry or Blueberry Extract), Apigenin , Artichoke Extract Astaxanthin , Astragalus , Bacopa , Beetroot Powder , Berberine , Bitter Melon , Black

[0530] 78

[0531] SUBSTITUTE SHEET (RULE 26) Catechu , Black Cohosh, Black Seed, Boswellia, Bromelain, Butyrate, Caffeine, Capsicum (contrains Capsaicin), Carnosol Cat's Claw, Celery Seed, Chaga, Chamomile Extract, Chinese Sage (Danshen), Chinese Skullcap (Baicalin) Chinese Yew, Chrysin (Passion Flower), CoQ10, Cordyceps, Curcumin, Daidzein, Devil's Claw, DHA / EPA Dogwood Fruit, EGCG, Echinacea, Emodin (Rumex), Epimedium (Horny Goat Weed / lcariin), Figwort, Genistein, Ginkgo Biloba, Glossy Privet, Glucosamine, Glutathione, Grape Seed Extract, Gynostemma Hesperedin, Honokiol (Magnolia), Hops, Horseradish Extract, Jasmine, Ketones, Licorice, Lion's Mane P, Luteolin, Lycopene, Magnesium, Maitake Mushroom, Milk Thistle, Moringa, N-Acetyl-Cysteine, Narigenin Nettle, Nicotine (Anatabine), Olive Leaf (Hydroxytyrosol), Panax Ginseng (Korean), Perilla, Pterostilbene, PQQ, Pycnogenol, Quercetin, Rehmannia, Reishi, Resveratrol, Rhodiola Rosea, Rosmarinic Acid, Selenium Shiitake, Sodium Benzoate (found in carbonated drinks, vinegar, fruit juices, pickles, etc), Spirulina, Sulforaphane, St. Johns Wort (Hyperforin), Taxifolin, Theanine, Thunder God Vine, Tulsi (Holy Basil), Ursolic Acid, Valerian, Vitamin B1 , Vitex, White Willow, Wormwood, Zinc

[0532] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, from the modulation of the toll-like receptor (TLR) family. Non-limiting examples of the TLR family Inhibitors includes ABR-238901 , Saponaria Officinalis Extract, MD2-TLR4-IN-1 , E6446, Ginsenoside Rb1 , Chloroquine diphosphate, Hydroxychloroquine Sulfate (NSC 4375), MD2-IN-1 , TLR2-IN-C29, E6446 dihydrochlorideAMG-9810, Chloroquine (NSC- 187208), Resatorvid (TAK-242), IRAK4-IN-2, Cu-CPT22, Schaftoside.

[0533] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, directly the effects of the Calcium blocker family. Non-limiting examples of the Calcium blocker includes Amlodipine, Aranidipine, Azelnidipine, Barnidipine, Benidipine, Cilnidipine, Clevidipine, Efonidipine Felodipine, Isradipine, Lacidipine, Lercanidipine, Manidipine, Nicardipine, Nifedipine, Nilvadipine, Nimodipine, Nisoldipine, Nitrendipine, Pranidipine, Fendiline, Gallopamil, Verapamil, mibefradil, bepridil, flunarizine, fluspirilene, fendiline, Gabapentinoids, such as gabapentin and pregabalin, Ziconotide,

[0534] Naturally occurring compounds and elements such as magnesium have also been shown to act as calcium channel blockers when administered orally.

[0535] In addition, BAPTA-AM, which is an intracellular calcium chelator, is a modulator of Ca2+-mediated signaling. Similarly, the other Ca2+- chelators such as EGTA, EDTA, tetracyclin and others, are also modulator of Ca2+-mediated signaling.

[0536] 79

[0537] SUBSTITUTE SHEET (RULE 26) In certain embodiments, GSK-3 activation may result in, either directly or indirectly, the effects of the Norepinephrine-dopamine pathways. Non-limiting examples of the Norepinephrine-dopamine reuptake inhibitor includes Amphetamine, Benzatropine, Methylphenidate, Mazindol, Benzphetamine, Cocaine, Bupropion, Lisdexamfetamine, Dextroamphetamine, Metamfetamine, Vanoxerine, Nomifensine, Dexmethylphenidate, Sibutramine, Solriamfetol, Serdexmethylphenidate, GBR-12783, Amineptine, Bupropion, Desoxypipradrol , Dexmethylphenidate , Difemetorex , Diphenylprolinol, Ethylphenidate, Fencamfamine , Fencamine , Lefetamine , Methylenedioxypyrovalerone, Methylphenidate , Nomifensine , 0-2172, Phenylpiracetam , Pipradrol, Prolintane Pyrovalerone , Solriamfetol, Tametraline , WY-46824.

[0538] In certain embodiments, GSK-3 activation may result in, either directly or indirectly, the effects of the cAMP-PKA pathways. Non-limiting examples of the cAMP inhibitor includes ST034307, ESI-05, Bithionol, Fipexide hydrochloride, NE 52-QQ57, ESI-09, HJC0350, SQ22536, PACAP 1 -27, PACAP 6-38; and PKA inhibitors includes Bisindolylmaleimide IV, GSK690693, Staurosporine (AM-2282), Fasudil (HA-1077) HCI, H 89 2HCI, Daphnetin, A-674563, HA-100 dihydrochloride, H-1 152 dihydrochloride, AT13148, ML-7 HCI.

[0539] In certain embodiments, GSK-3 activators relates to compounds which are in vivo and / or in vitro capable to modulate, either completely or partially, the action and / or function of a molecule or molecules involved in the inflamation related pathways. Non-limiting examples of the inflamation related pathways inhibitor includes, Tiragolumab (anti- TIGIT), Vibostolimab (anti-TIGIT), Magrolimab (anti-CD47), Omalizumab (anti-lgE), Antimouse CD8a-lnVivo, Lupenone, Ophiopogonin D, Oxysophocarpine, Luteolin-7-0- glucuronide, Linalyl Acetate, Carrageenan, Ginkgetin, Chebulagic acid, Fucoidan, MNITMT, ABR-238901 , Xanthium Sibiricum Extract, Fritillaria Cirrhosa Seed Extract, Andrographis Herba Extract, Pheretima Extract, Erycibes Caulis Extract, Rabdosiae Rubescentis Herba Extract, Cissus Quadrangularis Extract, Penthorum Chinense Pursh Extract, Hainan Nightshade Fruit Extract, Red Bean Extract, Red Raspberry Extract, Knoxia Valerianoides Extract, Piper Nigrum Seed Extract, Viscum Coloratum Extract, Polygala Fallax HemsL Rhizome Extract, Oriental Paperbush flower Extract, Radix Tinosporae Extract, Rhizoma Fagopyri Dibotryis Extract, Fineleaf Schizonepeta Herb Extract, Camu Camu fruit Extract, Sophora alopecuroides seed Extract, Rhizoma Anemones Raddeanae Extract, Piper betle L. Extract, Tamarindus indica seed Extract,

[0540] 80

[0541] SUBSTITUTE SHEET (RULE 26) Hibiscus sabdariffa flower Extract, Chinese Starjasmine stem Extract, Myrrh Extract, Ecliptae Herba Extract, Vitex negundo seed Extract, Oyster Shell Extract, Boat-fruited sterculia seed Extract, Rhizoma homalomenae Extract, Acmella oleracea Extract, Radix rubiae Extract, Celery Extract, Celery seed Extract, Ash bark Extract, Artemisia annua Extract, Cyclocarya paliurus Extract, Fringed pink Extract, Evodia Lepta Bark Extract, Phellinus linteus Extract, Double coptis chinensis Extract, Cymbopogon Citratus Extract, Scepteridium Ternatum Extract, Epimedium Brevicornu Extract, Jasminum Nudiflorum Extract, Houttuynia Cordata Extract, Ulmus Pumila Bark Extract, Oenothera Biennis Extract, Blueberry Fruit Extract, Coriolus Versicolor Extract, Euphorbia Helioscopia Extract, Fritillariae Thunbergii Bulbus, ExtractUnripe Bitter Orange Extract, Stalactitum Extract, Glabrous Sarcandra Herb Extract, Lithospermum Erythrorhizon Extract, Viola Philphica Munda Extract, Ardisia Japonica Extract, Radix Asteris Extract, TMN355, Ginkgolide J, Cafestol, Cyclosporine, Sulfasalazine (NSC 667219), Bestatin (NK421 ), Prednisone (NSC-10023), Phenylbutazone, Cyclosporin A (NSC 290193), Tenoxicam, Bindarit (AF 2838), Pentosan Polysulfate Sodium, Perflubron, Demethylzeylasteral CT- 96), Diammonium Glycyrrhizinate, Sinomenine hydrochloride, Eucalyptol, Isopsoralen, Flufenamic acid, Ganoderic acid A, Pimecrolimus, Diflorasone, Bendazac, Loxoprofen Sodium, Saikosaponin A, Tiaprofenic acid, PMX-53, Z-Guggulsterone, TAPI-1 , Atractylenolide I, GI254023X, Sanguinarine, Incensole acetate, Salvianolic acid A, Trilobatin, Sweroside, Corilagin, Eleutheroside E, Peiminine, GYY4137, Ipilimumab (anti- CTLA-4), Rituximab (anti-CD20), Eupolyphage sinensis Walker Extract, Pranlukast, ARA290, Idramantone, Latanoprost, Bupleurum Extract, Glossy privet fruit Extract, Grapefruit Extract, Methylprednisolone (NSC-19987), Prednisolone (NSC-9900), Roquinimex, Laquinimod, Amlexanox (AA-673), Thymopentin, Balsalazide, Actarit, Lentinan, Dicloxacillin Sodium hydrate, Methylprednisolone Acetate, VGX-1027, Y-320, Avadomide (CC-122), Ossirene, Iberdomide (CC220), 2-Hydroxybenzylamine, Betamethasone sodium phosphate, Mometasone Furoate Hydrate, Benzoylmesaconine, Strictosamide, Herbacetin, Dihydroberberine, Cornuside, Isorhapontigenin, Hinokiflavone, Glaucocalyxin A, 14-Deoxy-11 ,12-didehydroandrographolide, Neotuberostemonine, H-Leu-Leu-OMe Hydrochloride, Tris(2-butoxyethyl) phosphate, Donkey-hide gelatin Extract, Pygeum Topengii Bark Extract, Spinach Extract, Platycladi Cacumen Extract, Cymbidium Extract, Tribulus Terrestris Extract, Cirsii Japonic! Herba Extract, Angelica Sinensis Extract, Kochiae Fructus Extract, Malvae Fructus Extract, Spirodelae Herba Extract, Devil's Claw Extract, Pinus Pinaster Bark Extract, Terminalia

[0542] 81

[0543] SUBSTITUTE SHEET (RULE 26) Chebula Extract, Polygoni Multiflori Root Extract, Juglandis Semen Extract, Black Bone Rattan extract, Nigella Sativa Extract (Seed), Scutellariae rhizome Extract, Chinese Fevervine Herb Extract, Larva of a Silkworm with Batrytis Extract, Abrus mollis Extract, Calendula officinalis flower Extract, Exocarpium Citri Rubrum Extract, Symphytum officinale Extract, Selaginella Extract, Sophora flavescens Extract, Coltsfoot Extract, Raphanus sativus seed Extract, Coriaria Root Extract, Mango leaf Extract, Spicate clerodendranthus Extract, Ternate buttercup root Extract, Rose hip Extract, Buddleja Officinalis Extract, Momordicae Semen Extract, Agaric Extract, Hibiscus mutabilis flower Extract, Papaya Leaf Extract, Hibiscus syriacus flower Extract, Oregano Extract, Radix Peucedani Extract, Ramulus Mori Extract, Elaeagnus angustifolia Extract, Amomum villosum Extract, Sophora tonkinensis Extract, Arnica montana Extract, Lonicerae Flos Extract, Corni Fructus Extract, Phytolaccae Radix Extract, Snake Gallbladder Extract, Belamcandae Rhizoma Extract, Lycopodii Herba Extract, Rehmanniae Radix Extract, Panax notoginseng Extract, Rumex madaio Makino Extract, Vaccariae semen Extract, Clematis chinensis Extract, Crinum Asiaticum Extract, Lactuca sativa Extract, Glaucescent Fissistigma Root Extract, Zaocys dhumnades Extract, Daphne genkwa Sieb.et Zucc. Extract, Ficus hirta Vahl Extract, Panax quinquefolium Extract, Epimedium Extract, Opuntia dillenii Extract, Periploca Sepium Extract, Justicia Gendarussa Extract, Flos Inulae Extract, Saussurea Involucrata Extract, Surgentodoxa Cuneata Extract, Urtica Fissa Extract, Solidago Decurrens Extract, Coix Lacryma-Jobi Seed Extract, Semen Pruni Extract, Cockroach Extract, Gardenia Fruit Extract, Umbellate Pore Fungus Extract, Echinacea Extract (flower), Imiquimod (R-837), Tranilast (SB 252218), Flurbiprofen, Mesalamine (5-ASA), Fenoprofen Calcium, Levamisole hydrochloride, Oxymatrine, Rutin, Sinomenine, Gastrodin, Lappaconite HBr, Rheic Acid, Geniposide, Geniposidic acid, Tempol, Fenoprofen calcium hydrate, Diclofenac Potassium, Pidotimod, Lupeol, Umbelliferone, 4-Biphenylacetic acid, Balsalazide disodium, Picroside II, Dehydroandrographolide Succinate Potasium Salt, Ligustrazine hydrochloride, Sophoricoside, Secoisolariciresinol diglucoside, Methyl gallate, Gentisic acid, Bakuchiol, Quercitrin, Echinocystic acid, Eleutheroside B, Muscone, Lysionotin, Scopoletin, Bornyl acetate, Astragalus polyphenols, Baccatin m , Astilbin, Tetramethylpyrazine, Veratric acid, Batyl alcohol, Oxaceprol, Halcinonide, Benzydamine HCI, Teriflunomide, Coumarin, Sasapyrine, 2-Ethoxybenzamide, Loxoprofen, Escin, Eugenol, Thymoquinone, 5-Acetylsalicylic acid, Tolmetin, Aceclofenac, 4- Methylesculetin, Isoprinosine, Benorylate, Isoxepac, Clonixin, Citral, Thymol, Isovanillic

[0544] 82

[0545] SUBSTITUTE SHEET (RULE 26) acid, ATP, Ufenamate, Acacetin, Sodium gualenate, Ferulic acid methyl ester, Curculigoside, Verbascoside, Aucubin, Curcurbitacin HA, Monotropein, Amodiaquine hydrochloride, Hydrocortisone acetate, Fenamic acid, Chelidonic acid, Iguratimod, Lodoxamide Tromethamine, Tryptanthrin, Fosfosal, Diclofenac Epolamine, N- Acetylcysteine amide, p-Coumaric acid ethyl ester, Cortisone, Trans-Tranilast, [3- Caryophyllene, Diclofenac acid, (±)-a-Bisabolol, Arachidonic acid, Ethyl pyruvate, Picolinic acid (PCL 016), Pipecolic acid, Salicylamide, Talniflumate, Ibuprofen piconol, Tinoridine hydrochloride, Eicosapentaenoic Acid, Adelmidrol, Methylprednisolone sodium succinate, Etofenamate, CORM-3, C-DIM12, Cl-amidine, Stearyl Glycyrrhetinate, Paulownin, Quillaic acid, 20S-Ginsenoside Rg3, 20S-Ginsenoside Rh2, Isovitexin, (20R)Ginsenoside Rh2, Tenacissoside H, Calycosin, 6-Shogaol, Asperuloside, Auraptene, Irisflorentin, Pectolinarin, Sinigrin, Hydroxy safflor yellow A, Pseudoprotodioscin, Trillin, Nootkatone, Buddlejasaponin IVb, Rhapontin, Rhoifolin, Corynoline, Calycosin-7-O-beta-D-glucoside, 10-Gingerol, Senegenin, Dehydrodiisoeugenol, Orientin, Fraxinellone, Ginsenoside CK, Kaempferitrin, Ononin, Wogonoside, Chikusetsusaponin Iva, Scutellarein, Eriodictyol, Apigetrin, Carnosol, Isoacteoside, 20(S)-Ginsenoside Rh1 , Punicalagin, Harpagide, Neochlorogenic acid, Solasonine, Anwuligan, Neoandrographolide, Ziyuglycoside II, Poncirin, Columbin, Harpagoside, Phellodendrine, Xanthotoxol, Macranthoidin A, Tussilagone, Ruscogenin, Forsythoside B, Notopterol, Oroxylin A, Jujuboside A, Esculentoside A, Stylopine hydrochloride, Dipotassium glycyrrhizinate, Santalol, Schisandrin C, Berberrubine, Isofraxidin, Narirutin, Protosappanin B, Phellodendrine chloride, Tiliroside, Isoliensinine, Homoorientin, Skimmin, Decursin, Ginsenoside Rc, Koumine, Demethoxycurcumin, Peimine, Genkwanin, Casticin, Astragalin, Linarin, Isoliquiritin, Fraxin, Kirenol, Corylin, Platycodin D, Methylprotodioscin, Micheliolide, Germacrone, , Atractylenolide III, Forsythoside A, ( 20R)-Ginsenoside Rh1 , Alnustone, Sophocarpine Monohydrate, Sesamoside, Sauchinone, Angoroside C, Beta-Elemonic acid, Liensinine, Homoplantaginin, Trifolirhizin, Tabersonine, Tomatidine Hydrochloride, Dehydrocorydalin, Tubeimoside II, Echinatin, Kaurenoic acid, Naringenin chaicone, Acetylharpagide, Praeruptorin D, Madecassic acid, 1 ,3-Dicaffeoylquinic acid, Uvaol, Anisodamine Hydrobromide. Each possibility represents a separate embodiment of the invention.

[0546] As used herein, the term “modulate” refers to altering activity either by inhibiting (i.e. antagonist) or by activating (i.e. agonist activity and / or exoression of a receptor.

[0547] 83

[0548] SUBSTITUTE SHEET (RULE 26) According to specific embodiments, modulates activity and / or expression is inhibits activity and / or expression.

[0549] According to specific embodiments, modulates activity and / or expression is activates activity and / or expression.

[0550] In certain embodiments, a therapeutically effective dose of the selected GSK-3 activator may be adjusted depending on conditions of the disease / disorder to be treated or prophetically treated, the age, body weight, general health conditions, sex, and diet of the subject, dose intervals, administration routes, excretion rate, and combinations of drugs. An initial dose of the present agent may be larger, followed by one or more smaller maintenance doses. Other ranges are possible, depending on the subject's response to the treatment. An initial dose may be the same as, or lower or higher than subsequently administered doses.

[0551] The present agent / composition may be administered daily, weekly, biweekly, several times daily. The duration and frequency of treatment may depend upon the subject's response to treatment.

[0552] In certain embodiments, a subject may be administered 1 dose, 2 doses, 3 doses, 4 doses, 5 doses, 6 doses or more of the present agent / composition.

[0553] The number and frequency of doses may be determined based on the subject's response to administration of the composition, e.g., if one or more of the patient's symptoms improve and / or if the subject tolerates administration of the composition without adverse reaction.

[0554] In certain embodiments, the present agent / composition is administered at least once a day, at least twice a day, at least three times per day, or more.

[0555] In certain embodiments, the present agent / composition is administered to a subject prior to stressor. Wherein it is the accumulation of potentially toxic un / misfolded proteins as well as protein aggregates referred to as stressor. In addition, the proteasome impairment also referred to as stressor dependent on the accumulation of potentially toxic un / misfolded proteins as well as protein aggregates or independent. Therefore in certain embodiments, the present agent / composition is administered to the subject which is a person 25-year-old, 26-year-old, 27-year-old, 28-year-old, 29-year-old, 30-year-old, 31 -year-old, 32-year-old, 33-year-old, 34-year-old, 35-year-old, 36-year-old, 37-year-old, 38-year-old, 39-year-old, 40-year-old, 41 -year-old, 42-year-old, 43-year-old, 44-year-old, 45-year-old, 46-year-old, 47-year-old, 48-year-old, 49-year-old, 50-year-old, 51 -year-old, 52-year-old, 53-year-old, 54-year-old, 55-y^r-old. 56-vear-old. 57-year-old, 58-year-old,

[0556] 84

[0557] SUBSTITUTE SHEET (RULE 26) 59-year-old, 60-year-old, 61 -year-old, 62-year-old, 63-year-old, 64-year-old, 65-year-old, 66-year-old, 67-year-old, 68-year-old, 69-year-old, 70-year-old, 71 -year-old, 72-year-old, 73-year-old, 74-year-old, 75-year-old, 76-year-old, 77-year-old, 78-year-old, 79-year-old, 80-year-old, 81 -year-old, 82-year-old, 83-year-old, 84-year-old, 85-year-old, 86-year- old, 87-year-old, 88-year-old, 89-year-old, 90-year-old, 91 -year-old, 92-year-old, 93-year- old, 94-year-old, 95-year-old, 96-year-old, 97-year-old, 98-year-old, 99-year-old, 100- year-old, or older.

[0558] In certain embodiments, the present agent / composition is administered to the subject which is a person younger than 25-year-old.

[0559] In certain embodiments, the present agent / composition is administered to the subject throughout life.

[0560] A subject of this invention can be a mammal and in particular embodiments is a human, which can be an infant, a child, an adult or an elderly adult. The terms “subject” and “individual” are used interchangeably and relate to mammals. For example, mammals in the context of the present invention are humans, non-human primates, domesticated animals such as dogs, cats, sheep, cattle, goats, pigs, horses etc.

[0561] The present agent or composition may be administered to a subject alone, or may be administered to a subject in combination with one or more other treatments / agents.

[0562] In certain embodiments, combination therapy means simultaneous administration of the agents in the same dosage form, simultaneous administration in separate dosage forms, or separate administration of the agents.

[0563] In certain embodiments, the second agent / treatment is used as adjunctive therapy to the present agent or composition. In certain embodiments, the treatment includes a phase wherein treatment with the second agent / treatment takes place after treatment with the present agent or composition has ceased. In certain embodiments, the treatment includes a phase where treatment with the present agent or composition and treatment with the second agent / treatment overlap. Combination therapy can be sequential or can be administered simultaneously. In either case, these drugs and / or therapies are said to be "co-administered."

[0564] In certain embodiments, a subject is treated concurrently (or concomitantly) with the present agent or composition and a second agent. The present agent and the other pharmaceutically active agent(s) may be administered together or separately and, when

[0565] 85

[0566] SUBSTITUTE SHEET (RULE 26) administered separately this may occur simultaneously or sequentially in any order. The amounts of the present agent and the other pharmaceutically active agent(s) and the relative timings of administration will be selected in order to achieve the desired combined therapeutic effect.

[0567] In certain embodiments, a composition provided herein and a second agent are administered to a subject in a sequence and within a time interval such that the composition provided herein can act together with the other agent to provide an increased benefit than if they were administered otherwise.

[0568] The present invention provides that GSK-3 activating compound activate the effects of proteasome 20S / 26S subunits including chemotrypsin, trypsin and caspase-like activities.

[0569] The term "activating agent", as used herein, refers to an agent that increases level and / or activity of a target entity as compared with its level and / or activity under comparable conditions absent the activating agent. For example, an activating agent can increase level and / or activity of a target entity by at least about 5%, including at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%> or more, as compared with its level and / or activity under comparable conditions absent the activating agent. In some embodiments, an activating agent increases level and / or activity of its target entity to a point within a predetermined range of a reference level and / or activity. In some embodiments, a reference level and / or activity is the level and / or activity observed with a wild type version of the target entity in its natural context. In some embodiments, an activating agent binds directly to its target. In some embodiments, an activating agent binds indirectly (i.e. , by binding with a physically distinct entity that binds to the target). In some embodiments, an activating agent does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the target through other action (e.g., binding to a regulatory site in a nucleic acid that increases expression of the target; activation or inhibition of an enzyme that modifies the target and alters its activity, etc) as in wnt inhibitors and other compounds effective in different patway mentioned above. In some embodiments, an activating agent stabilizes and / or increases half-life of its target entity. In some embodiments, an activating agent stabilizes its target entity in a particular three-dimensional conformation. In some embodiments, an activating agent competes with an inhibitor for binding to tarnpt ntitv in cnme embodiments, an

[0570] 86

[0571] SUBSTITUTE SHEET (RULE 26) activating agent prevents or reduces aggregation of the target entity. In some embodiments, an activating agent stabilizes interaction of its target entity with another entity (e.g., a substrate protein, RNA, or DNA, a small molecule, peptide, or carbohydrate). In some embodiments, an activating agent binds to a target entity and increases the interaction of that target entity with another entity as compared with its interaction under comparable conditions absent the activating agent. In some embodiments, an activating agent-mediated increase in interaction of a target entity with another entity increases level and / or activity of that target entity as compared with its level and / or activity under comparable conditions absent the activating agent. In some embodiments, an activating agent binds to a target entity and decreases interaction of that target entity with another entity as compared with its interaction under comparable conditions absent the activating agent. In some embodiments, an activating agent- mediated decrease in interaction of the target entity with another entity increases level and / or activity of that target entity as compared with its level and / or activity under comparable conditions absent the activating agent.

[0572] In general, an activating agent may be or comprise a compound of any chemical class (e.g., a small molecule, metal, nucleic acid, polypeptide, lipid and / or carbohydrate) or natural products. In some embodiments, an activating agent is or comprises an antibody or antibody mimic. In some embodiments, an GSK-3 activating agent is or comprises a nucleic acid agent (e.g., an antisense oligonucleotide, a siRNA, a shRNA, etc) which inhibits the molecules involes in the Wnt patway. In some embodiments, an activating agent is or comprises a small molecule. In some embodiments, an activating agent is or comprises a naturally-occurring compound (e.g., DIF-1 , 3, all-frans retinoic acid (RA), Resveratrol, curcumin, berberine, and others ). In some embodiments, an activating agent has a chemical structure that is generated and / or modified by the hand of man. In general, an activating agent increases level or activity of one or more target entities present in and / or produced by a cell or organism. In some embodiments, a target entity is or comprises a polypeptide. In some embodiments, a target entity is or comprises a nucleic acid (e.g., a nucleic acid that encodes or regulates [e.g., by altering expression and / or activity of] a polypeptide). In some embodiments, a target entity is or comprises a carbohydrate. In some embodiments, a target entity is or comprises a lipid. In some embodiments, a target entity is or comprises an enzyme. In some embodiments, a target entity is or comprises a polypeptide involved in cellular trafficking.

[0573] 87

[0574] SUBSTITUTE SHEET (RULE 26) Activating the biological function of an GSK-3 protein can be effected at the protein level but may also be effected at the genomic and / or the transcript level using a variety of molecules which interfere with transcription and / or translation of a molecule.

[0575] It is also possible to increase the function of GSK-3 by increasing amount of GSK-3 protein amount. Expressing GSK-3 nucleic acid in the vector system or mRNA format is also within the scope of the present invention. The coloning and expression of GSK-3 in the vector system as a whole cDNA nucleotide or partial cDNA nucleotide is also within the scope of the present invention.

[0576] According to the invention, a nucleic acid or nucleic acid molecule refers to a nucleic acid which is preferably deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). According to the invention, nucleic acids comprise genomic DNA, cDNA, mRNA, recombinantly prepared and chemically synthesized molecules. According to the invention, a nucleic acid may be in the form of a single-stranded or double-stranded and linear or covalently closed circular molecule.

[0577] In a preferred embodiment, a nucleic acid molecule according to the invention is a vector. The term “vector” is used here in its most general meaning and comprises any intermediate vehicles for a nucleic acid which, for example, enable said nucleic acid to be introduced into prokaryotic and / or eukaryotic host cells and, where appropriate, to be integrated into a genome. Such vectors are preferably replicated and / or expressed in the cell. Vectors comprise plasmids, phagemids or virus genomes. The term “plasmid”, as used herein, generally relates to a construct of extrachromosomal genetic material, usually a circular DNA duplex, which can replicate independently of chromosomal DNA.

[0578] In a preferred embodiment of the present invention is the use of the recombinant virus techniques. They provide a useful alternative to non-viral methods, which have low transfer efficiencies in certain cell types — for example, primary culture and epithelial cells. The most frequently used vectors are retroviral, lentiviral or adenoviral; however, others include adeno associated virus (AAV), herpes virus, vaccinia virus, and several RNA viruses.

[0579] Viral techniques of gene transfer use the method of entry and integration with the host genome used by the wild-type organism.

[0580] Although adenoviral vectors are useful in transient assays, retroviral vectors stably integrate into the dividing target cell genome so that the introduced gene is passed on and expressed in all daughter cells.

[0581] 88

[0582] SUBSTITUTE SHEET (RULE 26) A promoter of the vector may be “inducible” and initiate transcription in response to an inducer, or may be “constitutive” if transcription is not controlled by an inducer, (e.g., as described in Sambrook et al., eds., “Molecular Cloning: A Laboratory Manual,” 3nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001 ).

[0583] The term “recombinant” in the context of the present invention means “made through genetic engineering”. Preferably, a “recombinant object” such as a recombinant nucleic acid in the context of the present invention is not occurring naturally.

[0584] As a nucleic acid, in particular DNA, for expression of more than one peptide or protein, either of a nucleic acid type in which the different peptides or proteins are encoded in different nucleic acid molecules or a nucleic acid type in which the peptides or proteins are encoded in the same nucleic acid molecule can be used.

[0585] The term “expression” is used according to the invention in its most general meaning and comprises the production of RNA and / or peptides or proteins, e.g. by transcription and / or translation. With respect to RNA, the term “expression” or “translation” relates in particular to the production of peptides or proteins. It also comprises partial expression of nucleic acids. Moreover, expression can be transient, stable, and / or stable-inducible.

[0586] The term “translation” according to the invention relates to the process in the ribosomes of a cell by which a strand of messenger RNA directs the assembly of a sequence of amino acids to make a peptide or protein.

[0587] Terms such as “enhancement of expression”, “enhanced expression” or “overexpression” mean in the context of the present invention that the amount of peptide or protein expressed by a given number of vector molecules is higher than the amount of peptide or protein expressed by the same number of vector molecules.

[0588] In one embodiment, terms such as “enhancement of expression”, “enhanced expression” or “increased expression” mean in the context of the present invention that the amount of peptide or protein expressed by a given number of vector molecules and within a given period of time is higher than the amount of peptide or protein expressed by the same number of vector molecules and within the same period of time.

[0589] In certain embodiments, a composition provide GSK-3 activation indirectly by inhibiting a molecule involved in the GSK-3 patway such as Wnt pathway.

[0590] Therefore, non-limiting examples of antagonist that can be used according to some embodiments of the invention include small molecules, antibodies, peptides, enzymes

[0591] 89

[0592] SUBSTITUTE SHEET (RULE 26) that cleave the polypeptide, aptamers homologous recombination agents, site specific endonucleases and RNA silencing agents.

[0593] According to specific embodiments, the antagonistic agent is an antibody. According to specific embodiments, the antagonistic antibody specifically binds at least one of the molecules involved in the pathways (eg. Wnt / b-catenin, Insulin and other growth signaling molecules related pathways, PI3K / Akt, MAPKAP-K1 , mTOR- S6K1 , cAMP- PKA, tyrosine kinase receptor (Trk)-PI3K-Akt, Norepinephrine-dopamine pathways, COX-1 and 2 related pathways, calcium signaling pathways, inflamation related pathways, and other pathways) in which GSK-3 activated.

[0594] Down-regulation at the nucleic acid level is typically effected using a nucleic acid agent, having a nucleic acid backbone, DNA, RNA, mimetics thereof or a combination of same. The nucleic acid agent may be encoded from a DNA molecule or provided to the cell per se.

[0595] Thus, the antagonist of some embodiments of the invention can be an RNA silencing agent. As used herein, the phrase “RNA silencing” refers to a group of regulatory mechanisms [e.g . RNA interference (RNAi), transcriptional gene silencing, post - transcriptional gene silencing, quelling, co-suppression, and translational repression] mediated by RNA molecules which result in the inhibition or "silencing” of the expression of a corresponding protein - coding gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi.

[0596] As used herein, the term “RNA silencing agent” refers to an RNA which is capable of specifically inhibiting or “silencing” the expression of a target gene (e.g., molecules in the wnt pathway). In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g, the full translation and / or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include noncoding RNA molecules, for example RNA duplexes comprising paired strands, as well as precursor RNAs from which such small non-coding RNAs can be generated.

[0597] Exemplary RNA silencing agents include dsRNAs such as siRNAs, miRNAs and shRNAs.

[0598] In one embodiment, the RNA silencing agent is capable of inducing RNA interference.

[0599] In another embodiment, the RNA silencing agent is capable of mediating translational repression.

[0600] 90

[0601] SUBSTITUTE SHEET (RULE 26) RNA interference refers to the process of sequence specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs).

[0602] Following is a detailed description on RNA silencing agents that can be used according to specific embodiments of the present invention.

[0603] The strands of a double-stranded interfering RNA (e.g., an siRNA) may be connected to form a hairpin or stem-loop structure (e.g., an shRNA. Thus, as mentioned, the RNA silencing agent of some embodiments of the invention may also be a short hairpin RNA (shRNA).

[0604] The term “shRNA”, as used herein, refers to an RNA agent having a stem-loop structure, comprising a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 1 1 .

[0605] It will be appreciated that, and as mentioned here in above, the RNA silencing agent of some embodiments of the invention need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and nonnucleotides and preparation methods.

[0606] According to another embodiment the RNA silencing agent may be a miRNA.

[0607] The term “microRNA”, “miRNA”, and “miR” are synonymous and refer to a collection of non-coding single stranded RNA molecules of about 19-28 nucleotides in length, which regulate gene expression (e.g. MiR-375-3p- Directly inhibit the expression of FZD8 to block the Wnt / p-catenin pathway; MiR-376c targets Wnt-3, etc.)

[0608] Antisense is a single stranded RNA designed to prevent or inhibit expression of a gene by specifically hybridizing to its mRNA. Downregulation of a receptor can be effected using an antisense polynucleotide encoding the receptor or the receptor subunit.

[0609] The prior art teaches of a number of delivery strategies which can be used to efficiently deliver oligonucleotides into a wide variety of cell types [see, Molecular Cloning: A Laboratory Manual, 3nd Edition, Sambrook and Russel eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2001 ; Brown TA (Genomes. 2nd edition. Oxford, Wiley-Liss:2002; Auld et al. -The assay Guidance Manual; https : / / www. ncbi . n I m . n i h .g ov / books / )]

[0610] 91

[0611] SUBSTITUTE SHEET (RULE 26) Nucleic acid agents can also operate at the DNA level as summarized below.

[0612] Suppressing the biological function of a protein which has a role in activation of the GSK-3 can also be achieved by inactivating the gene via introducing targeted mutations involving loss-of function alterations (e.g. point mutations, deletions and insertions) in the gene structure.

[0613] As used herein, the phrase "loss-of-function alterations ’’refers to any mutation in the DNA sequence of a gene which results in downregulation of the expression level and / or activity of the expressed product, i.e. , the mRNA transcript and / or the translated protein. Non-limiting examples of such loss-of-function alterations include a missense mutation, i.e., a mutation which changes an amino acid residue in the protein with another amino acid residue and thereby abolishes the effects of the protein; a nonsense mutation, i.e., a mutation which introduces a stop codon in a protein, e.g., an early stop codon which results in a shorter protein devoid of the enzymatic activity; a frame shift mutation, i.e., a mutation, usually, deletion or insertion of nucleic acid (s) which changes the reading frame of the protein, and may result in an early termination by introducing a stop codon into a reading frame (e.g., a truncated protein, devoid of the enzymatic activity), or in a longer amino acid sequence (e.g., a readthrough protein) which affects the secondary or tertiary structure of the protein and results in a non-functional protein, devoid of the enzymatic activity of the non-mutated polypeptide; a readthrough mutation due to a frame-shift mutation or a modified stop codon mutation (i.e., when the stop codon is mutated into an amino acid codon), with an abolished enzymatic activity; a promoter mutation, i.e., a mutation in a promoter sequence, usually 5' to the transcription start site of a gene, which results in down-regulation of a specific gene product; a regulatory mutation, i.e., a mutation in a region upstream or downstream, or within a gene, which affects the expression of the gene product; a deletion mutation, i.e., a mutation which deletes coding nucleic acids in a gene sequence and which may result in a frame-shift mutation or an in-frame mutation (within the coding sequence, deletion of one or more amino acid codons; an insertion mutation, i. e., a mutation which inserts coding or noncoding nucleic acids into a gene sequence, and which may result in a frame-shift mutation or an in-frame insertion of one or more amino acid codons; an inversion, i.e., a mutation which results in an inverted coding or non-coding sequence; a splice mutation i.e., a mutation which results in abnormal splicing or poor splicing; and a duplication mutation, i.e., a mutation which results in a duplicated coding or non-coding sequence, which can be in-frame or can cause a frame-shift.

[0614] 92

[0615] SUBSTITUTE SHEET (RULE 26) Methods of introducing nucleic acid alterations to a gene of interest are well known in the art including site specific recombinases (e.g. the Cre recombinase and the Flp recombinase), PB transposases (e.g. Sleeping Beauty, piggyBac, Tol2 or Frog Prince), genome editing by engineered nucleases (e .g. mega nucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR / Cas system) and genome editing using recombinant adeno-associated virus (rAAV) platform. The GSK-3 activating agents of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.

[0616] The term “pharmaceutical composition” as used herein refers to any composition comprising at least one pharmaceutically active ingredient and at least one pharmaceutically acceptable carrier. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

[0617] Herein, the terms "pharmaceutically acceptable carrier” and a “physiologically acceptable carrier” which may be interchangeably used refer to a non-toxic solid, semisolid or liquid filler, carrier diluent or excipient of any type that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.

[0618] Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, and subcutaneous .

[0619] In certain embodiments, GSK-3 activating agents described above are formulated for oral delivery. In certain embodiments, GSK-3 activating agents described above is formulated for injection. In certain embodiments the GSK-3 activating agents are formulated for sustained release.

[0620] Sustained release allows delivery of a specific drug at a programmed rate that leads to drug delivery for a prolonged period of time. Sustained release by adjusting the speed of drug release can keep the concentration of the drug at a constant level in the blood or target tissue. When the drug is dissolved in the aqueous body fluid, it can be easily transported with the fluid to the target receptors. Some studies have shown that one method to achieve sustained drug release is by preventing drug molecules from entering completely the aqueous environment for a manageable period of time. This inhibition

[0621] 93

[0622] SUBSTITUTE SHEET (RULE 26) can be recognized by adjusting the degradation speed of a carrier, or by adjusting the diffusion rate of drug molecules over an insoluble polymer matrix or shell.

[0623] Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push - fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended insuitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

[0624] For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

[0625] The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.

[0626] Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, orsynthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

[0627] The pharmaceutical composition of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides .

[0628] 94

[0629] SUBSTITUTE SHEET (RULE 26) Pharmaceutical compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., ageing and ageing related diseases ) or increase the life span of the subject.

[0630] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0631] For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

[0632] Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized.

[0633] Dosage amount and interval may be adjusted individually to provide that levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations .

[0634] A pharmaceutically active prodrug of the GSK-3 activating agents may be used. As used herein the term “prodrug” refers to (i) an inactive form of a drug that exerts its effects after metabolic processes within the body convert it to a usable or active form, or (ii) a substance that gives rise to a pharmacologically active metabolite, although not itself active (i.e. an inactive precursor).

[0635] The terms “comprises”, “comprising”, “includes”, “including”, “having" and their conjugates mean “including but not limited to” .

[0636] 95

[0637] SUBSTITUTE SHEET (RULE 26) The term "consisting of’ means “including and limited to".

[0638] The term “consisting essentially (mainly) of” means that the composition, method or structure may include additional ingredients, steps and / or parts, but only if the additional ingredients, steps and / or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

[0639] As used herein, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a compound” or “at least one compound” may include a plurality of compounds, including mixtures thereof.

[0640] The Geroscience Hypothesis posits that fundamental ageing mechanisms are ‘root cause’ contributors to the increasing burden of disorders and diseases with advancing age that are responsible for the bulk of morbidity, mortality and health costs in the developed and developing worlds. These fundamental ageing processes include: (1 ) macromolecular dysfunction (e.g. protein misfolding and aggregation, decreased proteasome activity, DNA damage, telomere uncapping, increased AGEs, lipotoxicity and accumulation of bioactive lipids) and organelle dysfunction (altered nuclear membranes related to deficient lamin B, mitochondrial dysfunction leading to reduced fatty acid metabolism, higher glucose utilization, depletion of NAD+ and increased reactive oxygen species [ROS] generation, etc.), 2) chronic low grade ‘sterile’ (absence of bacteria, fungi, etc.) inflammation often accompanied by fibrosis, 3) stem, progenitor and immune cell dysfunction (including altered proliferative capacity and dysdifferentiation with failure to develop into functional mature cells, declines in ‘geroprotective’ factors [e.g. a-Klotho], contributing to stem and progenitor cell dysfunction) and 4) cellular senescence.

[0641] Unitary Theory of Fundamental Aging Processes hypothesizes that these fundamental ageing processes may be interlinked. Therefore, targeting any one fundamental ageing process (e.g. decreased proteasome activity, protein misfolding-aggregation, depletion of NAD+, cellular senescence) genetically or with drugs should affect many or perhaps all of the rest. Indeed, consistent with the Unitary Theory, senescent cells contribute to inflammation, fibrosis, DNA damage, development of protein aggregates, failed autophagy, lipotoxicity, mitochondrial dysfunction, depletion of NAD+, ROS generation and stem, progenitor and immune cell dysfunction.

[0642] 96

[0643] SUBSTITUTE SHEET (RULE 26) Therefore, in another embodimend the present invention provides a medicament for ameliorating onset and / or progression and even treatment of the ageing and aging associated diseases by targeting more than one fundamental ageing process, including protein misfolding and aggregation, decreased proteasome activity, increased oxidated proteins, AGEs, lipotoxicity and accumulation of bioactive lipids and organelle dysfunction (mitochondrial and autophagy-lysosome disfunction), stem progenitor dysfunction, depletion of NAD+, cellular senescence comprising the step of administering a therapeutically effective amount of an GSK-3 activator or a pharmaceutically acceptable salt or prodrug thereof.

[0644] The present invention and its embodiments have been described in detail. However, the scope of the present invention is not intended to be limited to the particular embodiments of any process, manufacture, composition of matter, compounds, means, methods, and / or steps described in the specification. Various modifications, substitutions, and variations can be made to the disclosed material without departing from the spirit and / or essential characteristics of the present invention. Accordingly, one of ordinary skill in the art will readily appreciate from the disclosure that later modifications, substitutions, and / or variations performing substantially the same function or achieving substantially the same result as embodiments described herein can be utilized according to such related embodiments of the present invention. Thus, the following claims are intended to encompass within their scope modifications, substitutions, and variations to processes, manufactures, compositions of matter, compounds, means, methods, and / or steps disclosed herein.

[0645] As used herein the term "method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

[0646] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the

[0647] 97

[0648] SUBSTITUTE SHEET (RULE 26) invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elments.

[0649] Various embodiments and aspects of the present invention as delineated herein above and as claimed in the claims section below find experimental support in the following examples. They should, in no way be construed, however, as limiting the broad scope of the invention.

[0650] EXAMPLES

[0651] GSK-3 inhibitors prevent the degradetion of p21 and p53 of the cell proteins,

[0652] In the present invention, it has been found that GSK-3 inhibitors (BIO) cause an increase of the p21 time dependent, (Fig. 1 A) and concentration dependent (Fig. 1 B) of the HepG2 cell line. Another well-known GSK-3 inhibitor, Lithium chloride, has also been observed to increase the amount of p21 protein. However, the increase in p21 in the presence of Lithium chloride was much less than the increase in the presence of BIO (Fig. 1 C). It is known that these cellular proteins including p21 , p53 are classified as amyloidogenic IDPs and as many as 41 % of the eukaryotic proteome is predicted to contain IDRs. Therefore, in the next experiment the effects of GSK-3 inhibitors (BIO) on p53 degredation were examined. Similar to the p21 , p53 was also increased in the cells in the presence of BIO or Lithium (similar to p21 experiment Lithium only slightly increased p53 amount, data was not shown). (Fig. 2A)

[0653] BIO also prevenst the degradetion phosphorylated Tau (p-Tau- pSer199) and Serine racemase (SerRac)

[0654] Tau is a major axonal microtubule-associated protein. Abnormal phosphorylation of tau interrupts its binding to microtubules and leads to the disruption of MTNs. Intracellular aggregates primarily consisting of phosphorylated tau (p-tau) are one of the hallmarks of Alzheimer’s disease (AD), the accumulation of p-Tau, a salient feature in AD, may impede the normal functioning of MTNs and cause a series of catastrophic cascades. In addition Tau is also classified as amyloidogenic IDPs. Results of the study showed that the GSK-3 inhibitor, BIO increased the amount of pTau (similar to p21 experiment Lithium only slightly increased pTau amount, data was not shown).

[0655] 98

[0656] SUBSTITUTE SHEET (RULE 26) Serine racemase (SerRac) converts the free form of L-serine into D-serine (DS) in the mammalian brain. The DS functions as a co-agonist of NMDAR. The over- activation of the NMDA receptor leads to many neurological disorders like stroke, amyotrophic lateral sclerosis, and AD. BIO prevented the degradetation SerRac (Fig 2C). The Figure 2 shows only the results of HepG cells and BIO. Similar results were obtained in T98G cell line.

[0657] GSK-3 inhibitors decrease proteasome activity

[0658] It is known that these cellular proteins including p21 , p53, and pTau are classified as amyloidogenic IDPs and as many as 41 % of the eukaryotic proteome is predicted to contain IDRs. It is also known that IDRs containing proteins are mostly regulated by the proteasome. Therefore, next the GSK-3 inhibitors on the proteosome activity were tested.

[0659] A commonly used method to measure proteasome activity is to make use of fluorogenic substrates. In this type of experiment small peptides are linked to a 7-Amino-4- methylcoumarin (AMC) group. Upon cleavage of this group by proteases such as the proteasome the AMC group becomes fluorescent and this signal can be measured overtime. These types of experiments are almost always performed with cell lysates or purified proteasome. Data from these types of experiments may therefore not be relevant in more complex environments such as whole cells or the situation in vivo (Sahin, Patent No:PCT / TR2022 / 050106). Indeed, using AMC with cell lysate did not provide results similar to test results completed in vivo described below (AMC results were not shown).

[0660] Therefore, we used “the Cell-Based Proteasome luciferase systems (Promega)” which is the method applied in a living cell using cell permeable versions of fluorogenic substrates. We demonstrated that GSK-3 inhibitors, both BIO and Lithium, decrease the proteasome activity of trypsin, chemotrypsin and caspase-like activities (Fig. 3 A, B, and C) in HepG cell. The most dramatic derease occured in the presence of BIO in the HepG2 cell compared to the presence of Lithim (the results of HepG experiment was shown only, similar results were obtained in the T98G cells).

[0661] Wnt pathway modulators affect proteasome activity of chemotrypsin, trypsin, and caspase like activities.

[0662] 99

[0663] SUBSTITUTE SHEET (RULE 26) In the present invention, we claimed that GSK-3 modulation and consequent proteasome modulation may be directly mediated by molecules (eg, BIO, Lithium, etc.) or indirectly as a result of modulation of Wnt, insulin, PI3K- AKT, MAPK-MAPKAP-K1 , mTOR- S6K1 , cAMP-PKA, the toll-like receptor (TLR) family, Calcium, Reelin, Norepinephrine-dopamine, inflammation, and other pathways, which have been shown to modulate GSK-3.

[0664] In the Wnt / b-catenin signaling pathway a Wnt induced inhibition of the GSK-3 has been well described. In addition, it has been described that in the absence of a Wnt stimulus theGSK-3 activation increases. Therefore, we investigated the effects of the previously described Wnt agonist (SKL2001 ) and Wnt inhibitors (IWP-2 and CCT251545) chemicals on the proteasome activities including chemotrpsin, trypsin and caspase-like activity. It is found that SKL2001 , wnt activator, decreased proteasome activities as much as the direkt inhibitor of GSK-3, BIO (Fig. 4A, B, and E). On the other hand, Wnt inhibitors, IWP-2 and CCT251545, significantly increased the proteasome activities (Fig. 4 C, D, and E)).

[0665] Wnt pathway activator increase the p21 , p53 , pTau of the cell proteins.

[0666] In the next experiment, we investigated the effects of SKL2001 , wnt activator, on the protein amounts including the p21 , p53, and pTau to see the effects of the protesome inhibition caused by SKL2001 . SKL2001 increases p21 amount dramatically both time and dose dependent (Fig. 5A and B). SKL2001 increased p53 and pTau amount dramatically as much as direct GSK-3 inhibitor, BIO (Fig. 5C).

[0667] Wnt pathway inhibitors (IWP-2 and CCT251545) decrease the p21 , p53 , pTau, ser race of the cell proteins and this reduction is prevented in the presence of GSK-3 inhibitor, BIO.

[0668] In the next experiment, we investigated the effects of IWP-2 and CCT251545, wnt inhibitors, on the protein amounts including the p21 , p53, pTau, and SerRace to see the effects of the protesome activation caused by IWP-2 and CCT251545. IWP-2 and CCT251545 decrease the amount of p21 , p53, pTau, and SerRace (Fig. 6A and C). In the next experiment, we investigated how inhibition of GSK-3 by BIO affects the reducing effect by IWP-2 and CCT251545 on p21 .

[0669] 100

[0670] SUBSTITUTE SHEET (RULE 26) Results showed that the GSK-3 inhibitor prevented the reducing effect by IWP-2 and CCT251545 on p21 (Fig. 6B and C). Therefore, the results indicate that effects of the wnt inhibitors, IWP-2 and CCT251545, take place through GSK-3. In addition IWP-2 decreased the pAkt similar to the Wortmannin (Fig. 6 D and E)

[0671] Diclofenac, curcumin, celecoxib, BAPTA-AM, Piroxicam, Cyclosporin, and VitD3 which inhibit wnt signal through different pathways, increase proteasome activities and provide p21 , p53, pTau degradation.

[0672] In here, we aimed to see the effects of the celecoxib ( COX-2 inhibitor and nonsterodial anti-inflammatory drug (NSAID), Diclofenac (NSAID), Piroxicam (non-selective COX inhibitor) (Jain et al 2017), BAPTA-AM ( calcium chelator), cyclosporin A (calcineurin inhibitor in the calcineurin-phosphatase-pathway), curcumin (modulate the PI3K / Akt, MAPKs, JAK / STAT patways), and VitD3 (repressor of Wnt / B-catenin pathway) (Larriba et al 2013) on the proteasome activitiy of chemotrypsin. Although the aformentioned drugs affect different molecules in different pathways, it has been determined in previous studies that all drugs inhibit the wnt / b-catenin pathway. Results showed that all drugs mentioned significantly increase the proteasome activity of chemotrypsin (Fig. 7A).

[0673] In the next experiment, we investigated the effects of Diclofenac, curcumin, celecoxib, Piroxicam, Cyclosporin, and VitD3 on the protein amounts including the p21 and p53, to see the effects of the protesome activation caused by these drugs. Results showed that Diclofenac, curcumin, BAPTA-AM, celecoxib, Piroxicam, Cyclosporin, and VitD3 decrease the p21 and p53 amounts in a dose dependent manner (Fig. 7 B-H)

[0674] Proteasome inhibitors prevent the degredation of p21, p53, and pTau proteins caused by GSK-3 activation

[0675] Further experiements showed that the presence of protesome inhibitor, Mg 132, prevent or decrease the degredation of p21 , p53, and pTau caused by the Celecoxib (Fig. 8). These results also indicate that the degredation of p21 , p53, and pTau is related to the proteosome system.

[0676] GSK-3 overexpression increases the proteasome activity and increases the degredation of proteins.

[0677] To more directly determine the effect of GSK-3 on the proteasome, GSK-3 wt and GSK- 3 K85A (described as kinase inactive mutant) (Eldar-Finkelman et al 1996) cDNAs were cloned into the doxacillin-inducible Retroviral vector system and stably inserted into

[0678] 101

[0679] SUBSTITUTE SHEET (RULE 26) HepG2 and TA98G cells. GSK-3 expression in cells in the presence and absence of doxycycline and accordingly proteasome activities including Chemotrypsin and Caspaselike activities were investigated. The results show that expression of both GSK-3 wt and GSK-3 K85A increases proteasome activities in the HepG2 and T98G cell lines (Fig. 9 A-F). Interestingly, the GSK-3 K85A increase caused more proteasome activity increase than the GSK-3 wt increase. When we searched the literature for the effects of GSK-3 K85A described as kinase death, it was determined that it did not create dramatic changes compared to GSK-3 wt in the different set of the experiments (Zhang et al 2016). Another important point is that since GSK-3 K85A expression is higher in the cell, there may be a difference in proteasome activity in cells expressing wt GSK-3 or GSK-3 K85A. On the other hand, the fact that the change in proteasome activities tends to increase in both cells may indicate that the increase in the proteasome activity may not have arisen as a result of changes occuring in the continuation of the GSK-3 pathway of the GSK-3 mutation. Therefore, the GSK-3 K85A mutation may not play a role in the increase in proteasome activity, but this may be due to the increased amount of GSK-3 protein directly activating more protesome.

[0680] In the next experiement, we investigated the effects of the overexpression of GSK-3 wt and GSK-3 K85A on the protein amounts including the p21 , p53, and pTau to see the effects of the protesome activation. Results showed that overexpression of GSK-3 wt and GSK-3 K85A decrease p21 , p53, pTau amount 24 hours after induction of HepG2 containing Retro-XTet-On-GSK-3 wt or Retro-XTet-On-GSK-3 K85A (Fig. 9 G and H) siRNA-mediated GSK-3 siliencing decrease proteasome activity and increase p21 , p53, and pTau protein amounts.

[0681] In the next study, we further confirmed the effects of GSK-3 on proteasome activity and degredation of the proteins with siRNA-mediated GSK-3 siliencing experiment. For this purpose pLKO.1 -GSK3p contruct was transfected into the HepG2 and T98G. Cell expressing siGSK-3 and control cells were examined for the proteasome activity and changes in the p21 , p53, and pTau protein amounts.

[0682] We showed that a decrease in the GSK-3 amount in the cell caused a significant decrease in the chemotyrpsin activity of the cell (Fig. 10 A-C) (only HepG2 results were shown). In addition the amounts of the proteins p21 , p53, and pTau increased in the cell having siGSK-3 constract compared to the control cell, similar to the results of the BIO inhibited GSK-3 experiment (Fig. 10 D).

[0683] 102

[0684] SUBSTITUTE SHEET (RULE 26) Effects of GSK-3 inhibitors on aging and aging related phenotypes

[0685] The proteolytic machineries have long been validated as the main factor in the clearance of misfolded proteins, accordingly deficiencies in this mechanism are known to cause ageing and ageing related different human diseases such as neurodegeneration, cancer, and autoimmunity, ageing and ageing related diseases

[0686] The proteasome is the cell’s first defense mechanism against accumulating proteotoxic stresses induced by oxidative damage.

[0687] Because the ability to mount homeostatic adaptive responses declines with age, resulting in the decline of overall protein homeostasis, measuring the adaptive response to oxidative stress and the elimination of damaged proteins by the proteasome may potentially provide useful biomarkers and prognostic data to streamline therapeutics for aging patients.

[0688] Therefore, in the next experiments, the effects of GSK-3 inhibitors, which inactivate the proteasome activty, on aging of cells and organisms were investigated.

[0689] Effects of GSK-3 inhibitors on aging and aging related phenotypes on primary fibroblast cells

[0690] First, primary human fibroblast cells were divided into three as control, GSK3 inhibitor, BIO, and Wnt activator, SKL2001 added to cells at the 4th passage and followed under the same condution until the 10th passage.

[0691] Cellular senescence is defined as a complete and irreversible loss of replicative capacity in primary somatic cells. (Hayflick 1961 ). Therefore, cell counting and MTT assay are used as an indicator of cell viability and proliferation in cells set up at passage 8. It is found that the proliferation was more than 5 folds in the control cells compared to treated with BIO or SKL2001 (Fig. 1 1 A and B).

[0692] One of the other major feature of senescent cell is an increase in Senesence-associated p-galactosidase (SA p-gal) activity. Therefore, cellular senescence were investigated by SA p-gal staining in cells at passage 10. It is found that cells treated with BIO or SKL2001 have more than 10 folds more SA (3-gal stained cells compared to the control cells, P<0, 00001 (Fig. 11 C and D).

[0693] Effects of GSK-3 inhibitors on aging and aging related phenotypes (survavial, movement, lipid accumulation and NADP+ amount) on C. elegans

[0694] 103

[0695] SUBSTITUTE SHEET (RULE 26) C. elegans is a free-living multicellular organism. Clear age-dependent human like physiological changes at the tissue, cellular, and molecular levels make C. elegans a valuable model for research in the field of aging and life span studies (Ambros, 2006). Accordingly, it was investigated how GSK-3 inhibitor BlO and wnt inhibitor, SKL2001 affact the life span of C. elegans. The use of drugs in the C. elegans related studies has been applied in different ways. The drugs were either applied to the LB medium with bacteria OP50, before spreading onto Nematode Growth Medium (NGM) plates (LB medium method), or to the NGM with live (NGM live method) or dead bacteria (NGM dead method), or spotting the drug solution to the surface of plates directly (spot dead method), or growing the worms in liquid medium (liquid growing method) (Ambros, 2006). Liquid growing method achieved the best absorption efficiency in worms. Therefore in this invention all the experiements related with the C. elegans were completed in liquid medium. In order to understand the effectivennes of the drug according to the onset time, the drugs was added to the medium on the 7th day in a 24- day period and the number of viable worms were determined on the 18th and 20nd day.

[0696] The results show that on 20th day, almost 2 times more C. elegans survived in control than the warms with presence of BIO or SKL2001 (Fig. 12 A and B).

[0697] In C. elegans, features associated with aging could result in less active, uncoordinated movements, torpor, and accumulation of auto-fluorescent deposits in cells. Therefore, the movements of the C. elegans grown at 20°C on standart nemadote growth medium( NGM) plates shaked at constant speed at 200 rpm were recorded for 5 minutes on the 14th, 18th, and 20th days. All C. elegans in plate well were individually followed and counted by three different eyes (Fig. 12B). One of the basic movement of C. elegans in liquid is crawling while the other is swimming. Previously described that swimming is more energetically demanding for C. elegans than the crawling motion. In addition it was stated that having the ability to swim is related to locomotory fatigue, muscle mitochondrial oxidation, a transcriptional oxidative stress response, and changes in carbohydrate and fat metabolism. It was also known that the swimming ability of C. elegans is also related to pharyngeal, intestinal, neuronal functions and strong muscle into old age. The result shows that the number of C. elegans that can swim is 3 times less in plate with GSK-3 inhibitors (BIO and SKL2001 ) than in plate without drug (P< 0,0001 ) (Fig. 12B).

[0698] 104

[0699] SUBSTITUTE SHEET (RULE 26) The age-related reduction in fat oxidation may promote the accumulation of total and central body fat. Adipogenesis and lipid accumulation during aging have a great impact on the aging process and the pathogenesis of chronic, age-related diseases. Therefore, in the presence of BIO and control C. elagans groups on 20th days, the amount of fat in the organism was investigated by Nile Red staining. The results of the invention show that, on the 20th day, lipid accumulation in the C. elagans group treated with BIO was more than 6-fold higher than the C. elegans grown in the medium without a drug (Figs 12 E and F).

[0700] Coenzyme I (nicotinamide adenine dinucleotide, NAD+ / NADH) and coenzyme II (nicotinamide adenine dinucleotide phosphate, NADP+ / NADPH) are involved in various biological processes in mammalian cells. Although NAD+ and NADP+ are synthesised in sufficient amounts under normal conditions, shortage in their supply due to over consumption and their decreased synthesis has been observed with increasing age and under certain disease conditions. Several studies have proved that in a wide range of tissues, such as liver, skin, muscle, pancreas, and fat, the level of NAD+ decreases with age. The ratio of NAD+ / NADH and NADP+ / NADPH indicates the cellular redox state. A decrease in this ratio affects the cellular anaerobic glycolysis and oxidative phosphorylation functions, which reduces the ability of cells to produce ATP (She et al. 2021 ).

[0701] The molecule exists in cells in reduced (NADPH) and oxidized (NADP+) forms reflecting the redox state of the cell. An important cellular role for NADPH is to provide the reducing power for reductive biosynthesis of macromolecules including fatty acids and complex lipids, proteins, and nucleotides. NADPH also plays an important role in the control of cellular redox state. In this latter function, NADPH provides reducing equivalents for reduction of oxidized glutathione (GSSG) to the reduced form (GSH), a reaction catalyzed by glutathione reductase. GSH is an important intracellular reductant and plays an important role in cellular anti-oxidant defense.

[0702] Therefore, the amount of NADP+ were investigated in C. elagans. The results of the study show that, on the 20th day, 2-folds lesss NADP+ was detected in C. elagans grown in medium with BIO compared to the C. elegans grown in medium without BIO (Fig. 12 1).

[0703] 105

[0704] SUBSTITUTE SHEET (RULE 26) Effects of Celecoxib, GSK-3 activator, on aging and aging related phenotypes (survival, movement, lipid accumulation and NADP+ amount) on C. elegans

[0705] Experiment followed the same as the experiement in which GSK-3 inhibitors is used as described above. In here, C. elegans with Celecoxib compared with the control C. elagans (no drugs). The results show that on 22th day, significantly more C. elegans survived in Celecoxib containing plate than the warms in control plates (Fig. 12 C and D).

[0706] The movements of the C. elegans were examined on the day 22th. The result shows that the number of C. elegans that can swim is 2 times more in plate with Celecoxib than in plate without drug (P< 0,01 ) (Fig. 12 D).

[0707] The age-related reduction in fat oxidation may promote the accumulation of total and central body fat. Adipogenesis and lipid accumulation during aging have a great impact on the aging process and the pathogenesis of chronic, age-related diseases. Therefore, in the presence of Celecoxib and control C. elagans groups on 22th days, the amount of fat in the organism was investigated by Nile Red staining. The results of the invention show that, on the 22th day, lipid accumulation in the C. elagans group treated with Celecoxib was significantly less compared to the C. eleagans grown in medium without a durg (Figs 12 G and H).

[0708] In addition the amount of NADP+ were investigated in C. elagans. The results of the study show that, on the 22th day, significantly more NADP+ was detected in C. elagans grown in medium with celecoxib compared to the C. elegans grown in medium without celecoxib (Fig. 12 J).

[0709] GSK3 activators as a senolytic drug group

[0710] In addition to functions mentioned above, another function of GSK3 activators is that they can be a senolytic group of drug.

[0711] Ablation of senescent cells have been postulated as a promising therapeutic approach to target the ageing phenotype and, thus, to prevent, delay or mitigate ageing-related diseases. The aim with senolytic compounds is to rejuvenate organisms by selectively killing senescent cells and their efficacy is based on the ability of senescent cells to resist apoptosis. These cells exhibit upregulation of senescence-promoting transcription factor cascades, in some cases involving p16INK4a-retinoblastoma protein (Rb), in others, p53 and p21 CIP1 , or the both of these

[0712] 106

[0713] SUBSTITUTE SHEET (RULE 26) pathways, or other pathways. As shown in this invention above (Fig. 6 and 7), GSK-3 activators decrease the amount of p21 , p53 and pAktl .

[0714] MATERIALS AND METHODS

[0715] Cells

[0716] HepG2, hepatocelluar carcinoma cell line and T98G human glioblastoma cell line were used in these experiments. The cells were grown in DMEM supplemented with 10% FBS, 1 % Pen / Strep, 1% L-glutamine. Human primary bone marrow mesenchymal stem / stromal cells (BM-MSCs) (Cat. No: PCS-500-012™) and Human primary dermal fibroblasts (DFs) (Cat. No: PCS-201 -012™) (ATCC, Manassas, VA, USA) were gift by Dr. Ekim Taskiran; passage 3 cells were used. Human Umbilical Cord Mesenchymal Stromal Cell (HUCMSCs ) was gift by Dr. Ozgur Cinar and Dr. Ferda T. Celikkan. Human HUCMSCs was isolated, propagated and banked in accordance with a cGMP protocol (Can et al. 2015). HUCMSCs were grown in DMEM / F12, 10% FBS, 1% Pen / Strep, 1 % L-glutamine. Passage 3 cells were used in the experiments. All cells were incubated at 37 °C, 5% CO2 conditions.

[0717] Antibodies p21 , Akt1 , and pAktl (Cell signalling); p53, p62, Serine racemase, retinoblastoma protein (Rb, phospho pRb„ GFP, APP695 (beta-amyloid precursor protein), GAPDH, B- actin (Santa cruz); tau, pSer199 tau (Thermo fisher scientific); LC3 (Sigma Aldrich). All antibodies were used in accordance with the manufacturer’s recommendations.

[0718] Chemicals and Kits

[0719] Mg132, RA190, Gliotoxin , Capzimin (Santa cruz); Lactacystine, Suc-LLVY-AMC, P005091 , Vialin A, Spautin A, ML 323 SKPIN C1 , SZL-P1 -41 1 , SMER3, C1 , NCC697923, PYR41 , IU1 (Cayman Cehimacal); Memantine hydrochloride, dizocilpine maleate (MK-801 ), Worthmannin, MK2206, cycloheximide, Cell Proliferation Kit (MTT) (Sigma-Aldrich); Z-LLE-AMC, and Ac-RLR-AMC Ac-RLR-AMC (AdipoGen Life science); Cell-Based Proteasome luciferase systems (Promega); Senescence [3-Galactosidase Staining (Cell signalling); OxyBlot-Protein Oxidation Detection Kit (EMD Millipor); Leupeptin, N-Ethylmaleimide, Nile red, Melanin and lipofuscin stain (with Nile blue), Amyloid Staining Kit (Improved Stores Congo red), NADP(H) Content Assay Kit

[0720] 107

[0721] SUBSTITUTE SHEET (RULE 26) (Solarbio). All chemicals and kits were used in accordance with the manufacturer’s recommendations and different uses were indicated

[0722] Western blot analysis.

[0723] Tissues or cell pellets were lysed in 20 mM Tris (pH 7.5), 150 mM NaCI, 1 mM EDTA, 1 mM EGTA, and1 % Triton X-100 in the presence of a protease inhibitor cocktail (Cell Signalling Tech. Massachusetts, USA). Fifty micrograms of lysate was resolved on 8%- 12% Bis-Tris PAGE gels (Invitrogen) and transferred to nitrocellulose membranes (BioRad California, USA). The membranes were blocked at room temperature for 1 ,5 h in phosphate-buffered saline (PBS) supplemented with 5% skim milk and 0.1 % Tween-20 and incubated overnight at 4C° with primary antibody. Antibodies described were used for immunoblotting.

[0724] Proteasome activity assay.

[0725] The activity of the 26S proteasome was measured by following steps. Aliquots of 2 X 106 cells were lysed with glass beads (Sigma) at 4°C in lysis buffer containing 50 mM Tris-HCI (pH 7.5), 5 mM MgCI2, 1 mM DTTand 250 mM sucrose, and the protein concentration of cleared supernatants was measured by BCA protein assay reagent (Pierce). Ten micrograms of total protein was diluted with 26S proteasome assay buffer in a 96-well microtiter plate (BD Falcon), and incubated with fluorogenic substrates including Suc-LLVY-AMC, Z-LLE-AMC, and Ac-RLR-AMC Ac-RLR-AMC (Cayman- U.S.A.) were used to measure chymotrypsin, caspase-, and trypsin-like proteasome activity, respectively. Fluorescence released by AMC fluorescence was monitored on a microplate fluorometer (Biotek instrument -synergy HT) every 5 min at 37 °C for 1 h..

[0726] Proteasome activity assay using the Cell-Based Proteasome luciferase systems (Promega) which is the method applied in a non-lysate living cell. For a 96-well plate format, 8x103 cells per well were seeded. 24 hours later medium was changed with NMDAR blocker containing medium. Two hours later the Proteasome-Glo™ Cell-Based Reagent was preapared according to the kit protocol and 10OpI of Proteasome-Glo Cell- Based Reagent was added to each 1 OOpI of sample and appropriate controls as needed. After incubation at room temperature for a minimum of 10 minutes the luminescence of each sample were measured in a plate-reading luminometer (Biotek instrument (Synergy HT)) as directed by the manufacturer.

[0727] 108

[0728] SUBSTITUTE SHEET (RULE 26) Overexpression of GSK-3 wt and GSK-3 K85A mutant using the Retro-X Tet-On Advanced Inducible Expression System

[0729] The GSK-3 wt and GSK-3 K85A mutant cDNAs were PCR amplified from the cDNA obtained from the Tag5Amyc-GSK3b WT (Tag5Amyc-GSK3b WT Tag5Amyc-GSK3b WT was a gift from Mien-Chie Hung (Addgene plasmid # 16260 ; addgene:16260 ; RRID:Addgene_16260)and HA GSK3 beta K85A pcDNA3 (HA GSK3 beta K85A pcDNA3 was a gift from Jim Woodgett (Addgene plasmid # 14755 ; http: / / n2t.net / addgene:14755 ; RRID:Addgene_ 14755) using the sense primer 5’- GCCACCATGTCAGGGCGGCCCAGAAC -3’ and the anti-sense primer 5’- TCAGGTGGAGTTGGAAGCTGATG -3’. GSK-3 wt and GSK-3 K85A mutant cDNAs were cloned into pBSK-clo2D which is cut by EcoRV restriciton enzyme (SibEnzyme , E059). GSK-3 CDNAs were obtained from the pBSK-clo2D vector by cutting with with BamHI. pRetroX-Tight-Pur retroviral vector was cut by BamHI restriction enzyme and dephospharylated and ligated with GSK-3 cDNAs with compatible cohasive end. After the oriantation construct was determined, pRetroX-Tight-Pur-GSK-3 wt and pRetroX- Tight-Pur- HA GSK3 beta K85A were reproduced in large volumes using DH5a E. Coli.

[0730] Subsequently, similarly as described above, viruses containing pRetroX-Tight-Pur-GSK- 3 wt cDNA or pRetroX-Tight-Pur- GSK-3 K85A mutant were obtained. The previously established rtTA expressing HepG2 and T98G cells were infected with these viruses, and infected clones were selected by 0,5-3 mg / ml puromycin (P9620-Sigma-Aldrich) for 6 days. Infected clones were maintained in the presence of 250 ng / ml puromycin. The expresssion of GSK-3 was followed by western blot.

[0731] Silencing GSK-3 with the help of siRNA-GSK-3 system.

[0732] For this purpose pLKO.1 -GSK3[3 (pLKO.1 -GSK3[3-#2 was a gift from Alex Toker (Addgene plasmid # 32497 ; http: / / n2t.net / addgene:32497 ; RRID:Addgene 32497) was transfected with the lentivirus helper plasmids into Hek293T and 48 hours later lentivirus containing medium used to infection of HepG2 cell.

[0733] Preparation of liquid culture of C. elegans

[0734] C. elegans strains used in this study were gift from Dr. Deniz Aksoy, Faculty of Sciency- Trakya University-Turkey. Preparation of liquid culture of C. elegans was prepared according to the Stiernagle, T. Maintenance of C. elegans (February 1 1 , 2006), WormBook, http: / / www.wormbook.org. Animals were grown on nematode growth

[0735] 109

[0736] SUBSTITUTE SHEET (RULE 26) medium (NGM) (50mM NaCI, 2% agar, 2.5% peptone, 5mg / L cholesterol, 1 .OmM CaCI2, 1 .OmM MgSO4, 25mM potassium phosphate, pH 6.0) seeded with Escherichia coli OP50 at 20°C using standard methods.

[0737] Synchronization and sterilization of worms

[0738] For this purpose, the method described by Sulston, J. & Hodgkin, J. was followed. (See, Methods, in: Wood, W.B. (ed.) The Nematode Caenorhabditis elegans. (1988) Cold Spring Harbor Laboratory, Cold Spring Harbor: 587-606.; Solis, G.M., Petrascheck, M. Measuring Caenorhabditis elegans Life Span in 96 Well Microtiter Plates. 201 1 , J. Vis. Exp. (49))

[0739] Two-3 days old worms with eggs growing in NGM were transferred to 50ml flask using S-medium. After centrifugation, worms were treated with 20% Alkaline Hypochlorite Solution and the eggs were transferred to the S-medium after washing with S-medium.

[0740] Concentrated E. coli OP50 was used as a food source.

[0741] Animals were incubated for 2 days at 20°C until the animals reach the L4 stage.

[0742] To sterilize the animals 300 pL of a 6 mM Fluorodeoxyuridine (FUDR) stock solution was added to 10ml medium. During the monitoring of their life span , the worms were kept by shaking at aconstant speed of 200rpm. Locomotor activities of the worms were recorded and available.

[0743] Statistical analysis.

[0744] All of the data are expressed as the means ± standard errors of the means. For all of the analyses, P values were obtained from Student’s t-test (unpaired, two tailed) or Spearman rank-correlation tests. All of the graphs were generated using GraphPad Prism and / or Microsoft Excel.

[0745] The data are based on the results of at least three independent experiments. The error bars show the standard deviations. P values less than 0.05 were considered significant.

[0746] The figures of the drawing are for illustration purposes only, not for limitation.

[0747] Fig 1 A-B shows that GSK-3 inhibitors BIO (6-bromoindirubin-3-oxime) increase the amount of cell cycle related protein p21 , time and concentration-dependent. C. Effects of GSK-3 inhibitor, Lithium on the p21 protein.

[0748] Fig. 2 A-C shows the effects of BIO on the p53, pTau and Serine Recamase proteins.

[0749] 110

[0750] SUBSTITUTE SHEET (RULE 26) Fig. 3 A-C shows the protesome activity of whole cell using the Cell-Based Proteasome luciferase systems (Promega) in HepG2 cell treated with BIO and Lithium and control. A. shows the chemotrypsin-proteasome activity in whole cell using the Cell-Based Proteasome luciferase systems (Promega). B. shows the Caspase-like proteasome activity in whole cell using the Cell-Based Proteasome luciferase systems. C. shows the Trypsin activity of protesome of whole cell using the Cell-Based Proteasome luciferase systems.

[0751] Fig. 4 A-E. shows the protesome activity of whole cell using the Cell-Based Proteasome luciferase systems (Promega) in HepG2 cell treated with an activator of Wnt / p-catenin, SKL2001 and inhibitors of of Wnt / p-catenin, CCTP25 and IWP-2. A. shows the chemotrypsin proteasome activity in whole cell using the Cell-Based Proteasome luciferase systems in HepG2 cell treated with SKL2001. B. shows the Caspase-like proteasome activity in whole cell using the Cell-Based Proteasome luciferase systems in HepG2 cell treated with SKL2001 C. shows the the chemotrypsin-proteasome activity in whole cell using the Cell-Based Proteasome luciferase systems in HepG2 cell treated with CCTP25 or IWP-2. D. shows the the Caspase-like proteasome activity in whole cell using the Cell-Based Proteasome luciferase systems in HepG2 cell treated with CCTP25 or IWP-2. E. shows the the Trypsin proteasome activity in whole cell using the Cell- Based Proteasome luciferase systems in HepG2 cell treated with SKL2001 , CCTP25 or IWP-2.

[0752] Fig. 5 A-C. shows the effects of SKL2001 (activator of Wnt / p-catenin) on the cell cycle related proteins p21 , p53, and pTau. A. SKL2001 increase p21 time-dependent. B. Concentration-dependent effects of SKL2001 on p21 protein. C. Effects of SKL2001 on p53 and pTau proteins.

[0753] Fig. 6 A-E. shows that inhibitors of Wnt / p-catenin, IWP-2 and CCT251545, decrease p21 , p53, pTau, SerRace, and pAkt proteins and decreasing effect of IWP-2 and CCT251545 prevented by GSK-3 inhibitor BIO. A. IWP-2 decrease p21 , p53, pTau, SerRace proteins in HepG2 cell. B. BIO prevents the decreasing effect of IWP-2 on p21 . C. CCT251545 decrease p21 protein in HepG2 cell and BIO prevent the decreasing effect of CCT251545 on p21. D. IWP-2 decreases the pAktl . E. Wortmannin decrease pAkt ill

[0754] SUBSTITUTE SHEET (RULE 26) Fig. 7 A-H. The effects of some drugs, previously defined as Wnt / p-catenin inhibitor and / or GSK-3 activator, Diclofenac (Cox-1 NSAID), Celecoxib (COX-2 inhibitor), Piroxicam (non selectiv COX inhibitor), Curcumin (natural diatery supplement), Cyclosporin A (calcineurin inhibitor)), Vit D3, on the proteasome activity and p21 and p53 proteins amounts. A. Effects of Diclofenac, Celecoxib, BAPTA-AM, Piroxicam, Curcumin, Cyclosporin A, Vit D3 on Chemotrypsin activity of proteasome. B, C, D, E, F, G, H show the effects of the Diclofenac, Celecoxib, BAPTA-AM, Piroxicam, Curcumin, Cyclosporin A, and Vit D3 on p21 and p53 amounts respectively.

[0755] Fig. 8. Proteasome inhibitor, MG-132, prevent the degredation effect of the Celecoxib.

[0756] Fig. 9 A-H. The effects of overexpression of GSK-3 wt and GSK-3 K85A mutant on the protesome activation and accordingly on protein amounts including the p21 , p53, and pTau. GSK-3 wt and GSK-3 K85A (described as kinase inactive mutant) cDNAs were cloned into the doxacillin-inducible Retroviral vector system and stably inserted into HepG2 and TA98G cells. A and B show the expression amount of GSK-3 wt and GSK-3 K85A in HepG2 cells conditionally expressing GSK-3. C and D show that expression of both GSK-3 wt and GSK-3 K85A increases cemotrypsin proteasome activities in the T98G and HepG2 cells. E and F show that expression of both GSK-3 wt and GSK-3 K85A increases caspase-like proteasome activities in the T98G and HepG2 cells. G. show that expression of GSK-3 wt decrease the p21 , p53, and pTau in the HepG2 cells. H. show that expression of GSK-3 K85A decrease the p21 , p53, and pTau in the HepG2 cells.

[0757] Fig.10 A-D. The effects of GSK-3 wt silencing on the protesome activation and accordingly on protein amounts including the p21 , p53, and pTau. Lentiviral cloned siGSK-3 transfected in HepG2 cells and the effects of decreased GSK-3 on proteasome activities and the p21 , p53, and pTau amounts were investigated. A. The expression amount of GSK-3 in HepG2 containing siGSK-3. B and C. The effects of GSK-3 wt siliencing on the chemotrypsin and caspase-like protesome activaties respectively. D. The effects of GSK-3 wt siliencing on the p21 , p52, and pTau proteins.

[0758] Fig. 11 A-D. The effects of GSK-3 inhibitors, BIO and SKL2001 on on the cell viability and proliferation of human primary fibroblast. A and B. The proliferation of human primary fibroblast was investigated by cell counting and MTT assay on day 7, respectively (p < 0.0001 ). C. shows the effect of BIO and SKL2001 on Senesence-SA -

[0759] 112

[0760] SUBSTITUTE SHEET (RULE 26) gal activity in cells at passage 10th. Human fibroblast cells were divided into three plates. BIO or SKL2001 added groups at the 4th passage and followed under the same condution until the 10th passage. D. shows quantification of SA (3-gal stained cells. Fifty cells from the each well marked by freehand selection after adjasting colour treshold colour to B&W, colour space to RGB and dark background and density measured using Imagej program and mean values of control, ketamin and memantine treated cells were compared (p< 0.0002).

[0761] Fig. 12 A-J. the effects of GSK-3 inhibitors, BIO and SKL2001 and GSK-3 activator Celecoxib, on life span, motility and fat metobolism of C. elegans. A. shows that both BIO and SKL2001 decrease the life span of C. elegans (p=0,001 ). The mean lifespan values calculated by a log-rank (Kaplan-Meier) statistical test. B. shows basic movements including crawling and swimming of C. elegans kept in liquid NGM with and without BIO and SKL2001 . Follow-up of the recordings made on the 14th, 18th, and 20th days showed that non-moving C. elegans were 2 times more in C. elegans receiving BIO or SKL2001 than those receiving no drugs (n=3 plates from each of 2 different experiments, P=0,001 ) in each of the counting. The number of C. elegans that can swim is 2 times less in liquid NGM with BIO or SKL2001 than in liquid NGM without drugs (P= 0,001 ). C. shows that GSK-3 activator Celecoxib increase the life span of C. elegans (p<0,01 ). The mean lifespan values calculated by a log-rank (Kaplan-Meier) statistical test. D. shows basic movements including crawling and swimming of C. elegans kept in liquid NGM with and without Celecoxib. Follow-up of the recordings made on the day 22 days showed that non-moving C. elegans were almost 2 times less in controls than those receiving Celecoxib (n=3 plates from each of 2 different experiments, P<0,01 ) in the counting. The number of C. elegans that can swim is 2 times more in liquid NGM with Celecoxib than in liquid NGM without drugs (P< 0,001 ). E and F. Lipid amount was determined by Nile Red staining on C. elgans receiving BIO and controls at the day of 20. Sixty C. elegans from the each groups marked by freehand selection after adjasting colour treshold colour to B&W, colour space to RGB and dark background and density measured using Image J software (http: / / rsbweb.nih.gov / ij / ) and mean values of control, and BIO treated cells were compared and P - values were calculated using a two-tailed , two - independent sample Student's t - test (P<0,0001 ). G and H. Lipid amount was determined in Celocoxib treated C. elegans and control on the 22th day by Nile Red staining . Sixty C. elegans from the each groups marked by freehand selection after adjasting colour treshold colour to sn^m tn RCR and dark background and

[0762] 113

[0763] SUBSTITUTE SHEET (RULE 26) density measured using Image J software (http: / / rsbweb.nih.gov / ij / ) and mean values of control, and celecoxib treated worms were compared and P - values were calculated using a two-tailed , two - independent sample Student's t - test (P< 0,01 ). I. shows the amount of NADP+ in C. elagans grown in medium with BIO compared to the C. elegans grown in medium without BIO, on the 20th day, P<0,001 . J. shows the amount of NADP+ in C. elagans grown in medium with Celecoxib compared to the C. elegans grown in medium without drugs, on the 22th day, P<0,001 .

[0764] REFERENCES:

[0765] Aiken CT, Kaake RM, Wang X, and Huang L.

[0766] Oxidative Stress-Mediated Regulation of Proteasome Complexes. Molecular & Cellular

[0767] Proteomics 10:10. 2011

[0768] Alzheimer’s Association-

[0769] Ambros V.

[0770] Maintenance of C. elegans. Theresa Stiernagle, Caenorhabditis Genetics Center, University of Minnesota, Minneapolis, MN 55455 USA. (February 11, 2006), WormBook, ed.

[0771] Ariumi Y, Turelli P, Masutani M, Trono D.

[0772] DNA damage sensors ATM, ATR, DNA-PKcs, and PARP-1 are dispensable for human immunodeficiency virus type 1 integration. J Virol. 2005 Mar . 79(5):2973-8.

[0773] Auld et al.

[0774] The assay Guidance Manual; https: / / www.nebi.nl .nih.gov / books /

[0775] Austad S.N.

[0776] The Geroscience Hypothesis: Is It Possible to Change the Rate of Aging?.

[0777] In: Sierra F., Kohanski R. (eds) (2016) Advances in Geroscience.

[0778] Balu DT, Pantazopoulos H, Huang CCY, Muszynski K, Harvey TL, Uno Y, Rorabaugh JM, Galloway CR, Botz-Zapp C, Berretta S, Weinshenker D, Coyle JT.

[0779] Neurotoxic astrocytes express the d-serine synthesizing enzyme, serine racemase, in Alzheimer's disease. Neurobiol Dis. 2019 Oct;130:104511

[0780] Blasiak J, Szczepanska J, Fila M, Pawlou,cLra E. Kaarniranta K.

[0781] 114

[0782] SUBSTITUTE SHEET (RULE 26) Potential of Telomerase in Age-Related Macular Degeneration-Involvement of Senescence, DNA Damage Response and Autophagy and a Key Role of PGC-1 alpha. Int J Mol Sci. 2021 Jul 3;22(13):7194.

[0783] Boselli M, Lee BH, Robert J, Prado MA, Min SW, Cheng C, Silva MC, Seong C, Elsasser S, Hatle KM, Gahman TC, Gygi SP, Haggarty SJ, Gan L, King RW, Finley D.

[0784] An inhibitor of the proteasomal deubiquitinating enzyme LISP14 induces tau elimination in cultured neurons. J Biol Chem. 2017 Nov 24;292(47):19209-19225.

[0785] Brehm A and Kruger E

[0786] Dysfunction in protein clearance by the proteasome: impact on autoinflammatory diseases. Semin Immunopathol (2015) 37:323-333

[0787] Breydo L, Redington JM, Uversky VN

[0788] Effects of Intrinsic and Extrinsic Factors on Aggregation of Physiologically Important Intrinsically Disordered Proteins. International Review of Cell and Molecular Biology, Volume 329 # 2017 Elsevier Inc. ISSN 1937-6448

[0789] Brown TA

[0790] Genomes. 2nd edition. Oxford, Wiley-Liss:2002

[0791] Bussian TJ, Aziz A, Meyer CF, Swenson BL, van Deursen JM, and Baker DJ

[0792] Clearance of senescent glial cells prevents tau-dependent pathology and cognitive decline. Nature. 2018 October ; 562(7728): 578-582.

[0793] Caliskan H, Akat F, Tatar Y, Zaloglu N, Dursun AD, Bastug M, Ficicilar H.

[0794] Effects of exercise training on anxiety in diabetic rats. Behav Brain Res. 2019 Dec 30;376:112084.

[0795] Caliskan H, Akat F, Omercioglu G, Bastug G, Ficicilar H, Bastug M.

[0796] Aerobic exercise has an anxiolytic effect on streptozotocin induced diabetic rats. Acta Neurobiol Exp (Wars). 2020;80(3):245-255.

[0797] Can A, Ulus AT, Cinar O, Topal Celikkan F, Simsek E, Akyol M, Canpolat U, Erturk M, Kara F, llhan O

[0798] Human Umbilical Cord Mesenchymal Stromal Cell Transplantation in Myocardial Ischemia (HUC-HEART Trial). A Study Protocol of a Phase 1 / 2, Controlled and Randomized Trial in Combination with Coronary Artery Bypass Grafting. Stem Cell Rev Rep. 2015 Oct;11(5):752-60.

[0799] Cary DC, Peterlin BM.

[0800] Proteasomal Inhibition Potentiates Latent HIV Reactivation. AIDS Res Hum Retroviruses. 2020 Gct;36(10):800-807

[0801] Cauli O, Gonzalez-Usano A, Cabrera-Pastor A, Gimenez-Garzo C, Lopez-Larrubia P, Ruiz-Sauri A, Hernandez-Rabaza V, Duszczyk M, Malek M, Lazarewicz JW, Carratala A, Urios A, Miguel A, Torregrosa I, Carda C, Montoliu C, Felipo V.

[0802] 115

[0803] SUBSTITUTE SHEET (RULE 26) Blocking NMDA receptors delays death in rats with acute liver failure by dual protective mechanisms in kidney and brain. Neuromolecular Med. 2014 Jun;16(2):360-75.

[0804] Chiti F and Dobson CM

[0805] Protein Misfolding, Amyloid Formation, and Human Disease: A Summary of

[0806] Progress Over the Last Decade. Annu. Rev. Biochem. 2017.86:27-68.

[0807] Chondrogianni N, Voutetakis K, Kapetanou M, Delitsikoua V, Papaevgenioua N, Sakellari M, Lefaki M, Filippopoulou K, Gonos E.

[0808] Proteasome activation:An innovative promising approach for delaying aging and retarding age-related diseases. Ageing Research Reviews 23

[0809] (2015) 37-55

[0810] Collins GA and Goldberg AL.

[0811] The Logic of the 26S Proteasome. Cell. 2017 May 18; 169(5): 792-806.

[0812] Cull-Candy S, Brickley S and Farrant M

[0813] NMDA receptor subunits: diversity, development and disease . Curr Opin Neurobiol 2001 jun;11(3):327-35.

[0814] Davies KJA

[0815] Degradation of oxidized proteins by the 20S proteasome. Biochimie 83 (2001) 301-310

[0816] Dikic I

[0817] Proteasomal and Autophagic Degradation Systems. Annu. Rev. Biochem. 2017. 86:193-224

[0818] Ding WX, Ni HM, Gao W, Yoshimori T, Stolz DB, Ron D, and Yin XM.

[0819] Linking of Autophagy to Ubiquitin-Proteasome System Is Important for the Regulation of Endoplasmic Reticulum Stress and Cell Viability. AJP August 2007, Vol. 171, No. 2

[0820] Das J

[0821] Repurposing of Drugs-The Ketamine Story. J. Med. Chem. 2020 Nov 25;63(22):13514- 13525

[0822] Dobson CM

[0823] The Amyloid Phenomenon and Its Links with Human Disease. Annu. Rev. Biochem. 2017.86:27-68.

[0824] Du J, Li XH, and Li YJ

[0825] Glutamate in peripheral organs: Biology and pharmacology. European Journal of

[0826] Pharmacology 784 (2016) 42-48

[0827] Eltzschig HK, Eckle T

[0828] Ischemia and reperfusion-from mechanism to translation. Nat Med (2011) 17: 1391 - 1401).

[0829] Feldmann LK, Prieult F, Felzen V, Thai SC, Engelhard K, Behl C, and Mittmann T

[0830] 116

[0831] SUBSTITUTE SHEET (RULE 26) Proteasome and Autophagy-Mediated Impairment of Late Long-Term Potentiation (I- LTP) after Traumatic Brain Injury in the Somatosensory Cortex of Mice. Int. J. Mol. Sci. 2019, 20, 3048

[0832] Fernandez-AI barrel JA, de Julian-Lopez E, Soler-Dominguez C, de Hoz R, Lopez- Cuenca I, Salobrar-Garcia E, Ramirez JM, Pinazo-Duran MD, Salazar JJ, The Role of Autophagy in Eye Diseases. Ramirez Al. Life (Basel). 2021 Feb 27;11 (3):189.

[0833] Fleckenstein M, Keenan TDL, Guymer RH, Chakravarthy U, Schmitz-Valckenberg S, Klaver CC, Wong WT, Chew EY..

[0834] Age-related macular degeneration . Nat Rev Dis Primers 2021 May 6;7(1):31.

[0835] Futerman et al.

[0836] U.S. Pat. Nos US 201710273917 A1 and date Sep. 28, 2017 (Patent)

[0837] Gao Z, Gammoh N, Wong PM, Bromage HE, Tempst P and Jiang X

[0838] Processing of autophagic protein LC3 by the 20S proteasome. Autophagy 6:1, 126- 137; January 1, 2010;

[0839] Gan J, Leestemaker Y, Sapmaz A and Ovaa H

[0840] Highlighting the Proteasome: Using Fluorescence to Visualize Proteasome Activity and Distribution. Frontiers in Molecular Biosciences 2019 Mar 22;6:14

[0841] Giordano FJ

[0842] Oxygen, oxidative stress, hypoxia, and heart failure. J Clinlnvest (2005) 115: 500 - 508)

[0843] Glass, C. K., Saijo, K., Winner, B., Marchetto, M. C.& Gage, F. H.

[0844] Mechan...

Claims

CLAIMS1. A composition for use in increasing the proteasome activity and / or regulating the protein homeostasis network, wherein the composition comprise GSK-3 activators and a pharmaceutically acceptable carrier.

2. The composition for use according to claim 1 , wherein the GSK-3 activators activate or increase the GSK-3 amount and thereby cause the activity of the proteasome (20S and / or 26S) to rise above basal levels.

3. The composition for use according to claims 1 and 2, wherein the GSK-3 activators activate or increase the GSK-3 amount and thereby increase the proteasome activities including chemotrypsin, trypsin, and caspase-like activities.

4. The composition for use according to claims 1 to 3, wherein the GSK-3 activator activates the proteasome activities either UPS (Ubiquitin-ATP-Dependent Proteolysis) dependent and / or UPS independent.

5. The composition for use according to claim 1 , wherein the GSK-3 includes both GSK-3P and / or GSK-3a6. The composition for use according to claim 1 , wherein said GSK-3 activator agents comprise a compound of any chemical class (e.g., a small molecule, metal, nucleic acid, polypeptide, lipid and / or carbohydrate) which increases level and / or activity of GSK-3P and / or GSK-3a entity to a point within a predetermined range of a reference level.

7. The composition for use according to claim 1 , wherein the GSK-3 activators activate GSK-3 by binding to target directly or indirectly (i.e., by binding with a physically distinct entity that binds to the target) to its target.

8. The composition for use according to claim 1 , wherein the GSK-3 activators increase the activity or amount of GSK-3 which may occur due to conformational changes on GSK-3 or due to conformational changes that occur due to phosphorylations in the GSK-3 protz'i"124SUBSTITUTE SHEET (RULE 26)9. The composition for use according to claim 1 , wherein the GSK-3 activators may be or comprise a compound that does not interact physically, either directly or indirectly, with its target, but increases the level and / or activity of the target through other actions (e.g., binding to a regulatory site in a nucleic acid that increases expression of the target; activation or inhibition of an enzyme that modifies the target and alters its activity, direct expression of GSK-3 nucleotide with or without help of the plasmid vector systems, etc).

10. The composition for use according to claim 1 , wherein the GSK-3 activators comprise a compound which is in vivo and / or in vitro capable to increase the action and / or function of the GSK-3, are several natural molecules include Differentiation-inducing- factor-1 and 3 (DIF-1 , 3), a\\-trans retinoic acid (RA), Resveratrol, Diferuloylmethane (curcumin), berberine (BBR) Berberiscoptes, Troglitazone and others.

11. The composition for use according to claim 1 , wherein the GSK-3 activator agents may be or comprise a several molecules have been specified or not specified that increase the activity of GSK-3 with the help of computer-aided drug technology.

12. The composition for use according to claim 1 , wherein the GSK-3 activator agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through action of molecules involved in different pathways (eg. Wnt / p-catenin, Insulin and other growth signaling molecules related pathways, PI3K / Akt, MAPKAP-K1 , mTOR- S6K1 , cAMP-PKA, tyrosine kinase receptor (Trk)-PI3K-Akt, Norepinephrine-dopamine pathways, COX-1 and 2 related pathways, calcium signaling pathways, inflamation related pathways, and others).

13. The composition for use according to claim 12, wherein said compounds that modulate GSK-3 activation by affecting molecules in different pathways can be any chemicals agents (e.g., a small molecule, metal, nucleic acid, polypeptide,125SUBSTITUTE SHEET (RULE 26)lipid and / or carbohydrate), an antibody or antibody mimic, a nucleic acid agent (e.g., an antisense oligonucleotide, a siRNA, a shRNA, etc.) or mimic thereof, a naturally-occurring compound (e.g., small molecule), a chemical structure that is generated and / or modified by humans.

14. The composition for use according to claim 12, wherein compound affecting the GSK-3 may be related to a molecule or molecules involved in the canonical or non-canonical Wnt / p-catenin signaling pathway.

15. The composition for use according to claim 14, wherein compound affecting the GSK-3 may be related to a molecule or molecules involved in the canonical Wnt / b-catenin signaling pathway, in which, several natural extracellular Wnt molecules the wnt proteins, Fz-related protein sFRP, Wnt inhibitory factor 1 , sclerostin, Wise, DKK1 , LRP5 / 6, Waifl , APCDD1 , Cerberus, IGFBP, Shisa, Tikil and others are involved.

16. The composition for use according to claim 14, wherein said compound affecting the GSK-3 may be related to a molecule or molecules involved in the non- canonical Wnt / b-catenin signaling pathway including Wnt planer cell polarity pathway, Wnt-JNK signaling pathway, Wnt / Ror receptor pathway, Wnt-GSK3MT pathway, Wnt-aPKC pathway, Wnt-RYK pathway, Ca2+ / CaMKII- calciumdependent cell signaling, and Wnt-mTOR pathways.

17. The composition for use according to claim 1 -16, molecules in GSK-3 pathways, Wnt pathways, and other pathways specified or unspecified and identified to affect the GSK-3, are all targets for the GSK-3 activation.

18. The composition for use according to claim 12 to 17, wherein GSK-3 activator agents may be or comprise a compound of any chemical class increases level and / or activity of the GSK-3 through other actions of molecules involved in the Wnt / p-catenin pathway includes, but not limited to, IWP-4, Rh4, M2912, KY- 05009, XAV-939, Foscenvivint (ICG-001 ), Capmatinib, MSAB, (INCB28060), Resibufogenin, Isoquercitrin, JW55, RCM-1 , IWP-2, KY021 1 1 , WIKI4, CCT251545, Prodigiosin, IQ-1 , NCB-0846, PNU-74654, LF3, iCRT14, Adavivint (SM04690), PRI-724, Triptonide, M435-1279, lndirubin-3'-oxime, Laduviglusib126SUBSTITUTE SHEET (RULE 26)(CHIR-99021 ), Laduviglusib (CHIR-99021 ) HCI, L-Quebrachitol, Methyl Vanillate, KY19382 (A3051 ), CGP 57380, Isoxazole 9 (ISX-9), CP21 R7 (CP21 ), Tegatrabetan (BC-2059), ICRT3, WAY-316606, WAY-26261 1 , KY1220, TMTD (Tetramethylthiuram disulfide), Heparan Sulfate, Foxy-5, Benzimidazole scaffold, SRI37892, ZINC05972969, Fz7-21 , Benzothiazole scaffold, GNF-13331 , LGK974, Piperidine-maleimide scaffold, Cordycepin, Anticancer bioactive peptide, Dehydroxyhispolon methyl ether, SSTC3, Chlorquinaldol, KYA1797K, BMP7v, Sulindac, 4[3-Hydroxywithanolide E, HGC33-SFB-NP, VALD-3, FL1 18, Prednisolone, 3-CI-AHPC, IWP-2, RBM5, Hsa_circ_0004018, Lanatoside C, TIPE1 , Salinomycin, IC-2, Epigallocatechin-3-gallate, Benzyl isothiocyanate, Pyrvinium, SphK1 Phenethylisothiocyanate, Atrial natriuretic peptide, Thiazolidinediones, inhibitor II, SP600125, FH535, Cell adhesion molecule 1 , Probenecid, Ciclopirox, E-cadherin ,WP9QY, Collagen XVIII, N-butyloxycarbonyl hexapeptide, Phosphoprotein phosphatase-2A, XAV939, Tsukushi, HDAC- inhibitor, SM08502, IWR-1 , XAV939, DK419, BC029135, ETC-1922159 ,PARP1 inhibitors, Celecoxib, 2,5-dimethyl-celecoxib, indoesunate, Artesunate , Indomethacin, Ethacrynic acid, Pimozide, Cyclosporin, and others.

19. The composition for use according to claim 12 to 17, wherein GSK-3 activator agents may be or comprise any agents / phytochemicals targeting the Wnt / p- catenin pathway which increase level and / or activity of the GSK-3 includes, but not limited to, 19-tert-butyldiphenylsilyl-8, 17-epoxy andrographolide, 11a, 12a- epoxyleukamenin E, YW2065, Esculetin, Silibinin, Mesalamine, resveratrol, Anthocyanins / anthocyanidins, Crocin, Potato glycoalkaloids, Triptolide, Decane tetracyclic triterpenes, Maclurin, ginsenosides, salidroside, Z-Ajoene, and pharmaceutically acceptable salts, hydrates and pharmaceutically active enantiomers thereof, each possibility represents a separate embodiment of the invention.

20. The composition for use according to claim 12 to 17, wherein GSK-3 activators agents may be or comprise Wnt antagonist miRNAs, which increase level and / or activity of the GSK-3 includes, but not limited to, MiR-377-3p, MiR-506, MiR- 148a, Small interfering RNA against WNT8b, MiR-384, MiR-20b, MiR-216a, MiR- 375-3p, MiR-624-5p, MiR-376c, and pharmaceutically acceptable salts, hydrates and pharmaceutically active enantiomers thereof.127SUBSTITUTE SHEET (RULE 26)21. The composition for use according to claim 12 to 17, wherein GSK-3 activators agents may be or comprise Wnt antagonist which also include antibodies against to the molecule which involved in Wnt pathway, such as anti-receptor antibodies, anti-ligand antibodies, and inhibitory nucleic acids, etc.

22. The composition according to claims 12 and 13, wherein said GSK-3 activator agents may be or comprise a compound of any chemical class that does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through action of molecules involved in the modulation of insulin, through action of molecules involved in insulin patways (e.g. IGF-1 R (insulin receptor PI3K-akt pathways).

23. The composition for use according to claim 22, wherein GSK-3 activator comprise insulin receptor-PI3K-Akt pathways inhibitors, which increase level and / or activity of the GSK-3 includes, but not limited to, Linsitinib, Ceritinib , Picropodophyllin, BMS-754807 , BMS-536924, GSK1838705A, GSK1904529A, Ganitumab , Dalotuzumab, BMS-536924, BMS-754807, GSK1904529A, GSK1838705A, NVP-AEW541 , AZD-3463, Ceritinib dihydrochloride, Ceritinib (LDK378), NVP-TAE 226, NVP-AEW541 , NVP-ADW742, AG1024, NVP- ADW742, XL228, AZ7550 Mesylate, PQ401 , Indirubin Derivative E804, NBI- 31772, l-OMe-Tyrphostin AG 538, Chromeceptin, NBI-31772 hydrate, Ceritinib- d7, AZ7550 hydrochloride, AZ7550, Robatumumab, AZ7550-d5 , Lonigutamab, IGF-1 R inhibitor-2, Istiratumab, Picropodophyllotoxin-d6, Lonigutamab ugodotin , AZ12253801 , MID-1 , Ginsenoside Rg5, Dioscoreae Nipponicae Rhizoma Extract, Luminespib (NVP-AUY922), Linsitinib (OSI-906), AG-1024, SBI-477, Nordihydroguaiaretic acid (NDGA), Picropodophyllin (PPP), PQ 401 , NT157, Brigatinib (AP261 13)24. The composition for use according to claims 12 and 13, wherein GSK-3 activator agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through action of molecules involved in PI3K-Akt pathways (e.g. PI3K inhibitors) includes, but not limited to Lupenone, Parsaclisib (INCB050465), IHMT-PI3K5-372, PI3K / mTOR Inhibitor-2, (E)-Akt inhibitor-IV, PIK-108, Dioscoreae Nipponicae Rhizoma Extract, Trichosanthis Pericarpium128SUBSTITUTE SHEET (RULE 26)Extract, Tripterygium wilfordii Extract, Dichroa febrifuga Extract, SKI-V, Cafestol, Dactolisib (BEZ235), PI-103, Pictilisib (GDC-0941 ), ZSTK474, LY294002, XL147 analogue, TGX-221 , PIK-90, PIK-75 HCI, YM201636, IC-87114, Amarogentin, TG100-115, GSK1059615, Rigosertib (ON-01910), AS-605240, AZD6482, Voxtalisib (XL765) Analogue, PIK-293, Idelalisib, PIK-294, Buparlisib (BKM120), Quercetin Dihydrate, Quercetin (NSC 9221 ), Gedatolisib (PKI-587), A66, NU7441 (KU-57788), Omipalisib (GSK2126458), AS-252424, AS-604850, CAY10505, Apitolisib (GDC-0980), CH5132799, PKI-402, PF-04691502, BGT226 (NVP- BGT226) maleate, Wortmannin (KY 12420), Fimepinostat (CUDC-907), 3- Methyladenine (3-MA), Copanlisib (BAY 80-6946), Alpelisib (BYL719), TG100713, NU7026, Trigonelline, Cinobufagin, Resibufogenin, Loureirin A, Zeaxanthin, Hispidulin, Solasodine, Notoginsenoside R1 , Lanatoside C, acalisib (GS-9820), Gallein, GNE-477, GNE-493, MTX-21 1 , VS-5584 (SB2343), CZC24832, Duvelisib (IPI-145), Taselisib (GDC 0032), IPI-3063, HS-173, PI- 3065, Pilaralisib (XL147), Voxtalisib (XL765), PF-4989216, SAR405, PIK-III, AZD8186, GNE-317, AMG319, Nemiralisib, GSK2292767, AZD8835, VPS34- IN1 , GSK2636771 , KU-0060648, Deguelin, GDC-0326, Paxalisib (GDC-0084), umbralisib (TGR-1202), Samotolisib (LY3023414), Eganelisib (IPI-549), VPS34 inhibitor 1 (Compound 19), Seletalisib (UCB-5857), Serabelisib (TAK-1 17), SF2523, Autophinib, Inavolisib (GDC-0077), Tenalisib (RP6530), Selective PI3K5 Inhibitor 1 (compound 7n), Bimiralisib (PQR309), leniolisib (CDZ 173), Parsaclisib (INCB050465) Hydrochloride, ME-401 , SRX3207, Pectolinarin, Oroxin B; and others.

25. The composition for use according to claims 12 and 13, wherein GSK-3 activator agents may be or comprise a compound of any chemical class which increases level and / or activity of the GSK-3 through actions of molecules involved in PI3K-akt pathways (e.g. Akt inhibitors) includes, but not limited to, MK-2206 2HCI, Perifosine (KRX-0401 ), GSK690693, Ipatasertib (GDC-0068), Capivasertib (AZD5363), PF-04691502, AT7867, Triciribine (NSC 154020), CCT128930, A-674563, PHT-427, A-443654, Miransertib, (ARQ-092),BAY1 125976, Borussertib, Miransertib (ARQ 092) HCI, Akti-1 / 2, Uprosertib (GSK2141795)Afuresertib (GSK21 10183), AT13148, Oridonin (NSC-250682), Miltefosine, Honokiol (NSC 293100), TIC10 Analogue, BIA, a-Linolenic acid,129SUBSTITUTE SHEET (RULE 26)SPP-86, Hematein, RPI-1 , Urolithin B, Resibufogenin, Cinobufagin, Daphnoretin, Loureirin A, Trigonelline, ML-9 HCI, ABTL-0812, Alobresib (GS-5829), Praeruptorin A, Oroxin B, SC66, Usnic acid, Scutellarin, Astragaloside IV, Deguelin, TICK) (ONC201 ), Methyl-Hesperidin, and others.

26. The composition for use according to claims 12 and 13, wherein GSK-3 activator agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through action of molecules involved in MAPKAP-K1 pathways (e.g. p38 MAPK inhibitors) includes, but not limited to, Dilmapimod (SB-681323), p38-a MAPK-IN-1 , Falnidamol, SKF-86002, Chitosan oligosaccharide, Pulsatillae Extract, Suberect spatholobus stem Extract, Weigela Grandiflora Fortune Extract, Dichroa febrifuga Extract, TA-01 , SB 242235, SD169, R1487, AUDA, Adezmapimod (SB203580), SB202190 (FHPI), Neflamapimod (VX-745), Ralimetinib (LY2228820) dimesylate, Doramapimod (BIRB 796), PH-797804, TAK-715, 3,4',5-Trimethoxy-trans-stilbene, 3'- Hydroxypterostilbene, Trans-Zeatin, PD 169316, Berberine chloride hydrate, VX- 702, SD 0006, TA-02, SEA0400, Skepinone-L, Losmapimod (GW856553X), ML141 , SB239063, Pexmetinib (ARRY-614), BMS-582949, Pamapimod, UM- 164, Xanthatin, Mulberroside A, Praeruptorin A, sappanone A, Asiatic Acid, Metformin, 5'-N-Ethylcarboxamidoadenosine (NECA), Largeleaf Gentian Root Extract, Rotundic acid, Panax notoginseng Root Extract, Panax notoginseng Rhizoma Extract, Radix Scrophulariae Extract, NDMC101 , Metformin HCI, Berberine chloride (NSC 646666), and others.

27. The composition for use according to claims 12 and 13, wherein GSK-3 activator agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through actions of molecules involved in mTOR pathways (e.g. mTOR and the downstream S6K1 kinase inhibitors) includes, but not limited to, MTI-31 , JR-AB2-011 , PI3K / mTOR Inhibitor-2, mTOR inhibitor-1 , Dactolisib (BEZ235), Ridaforolimus (Deforolimus, MK-8669), PI-103, Rapamycin (AY- 22989), Temsirolimus (CCI-779), Everolimus (RAD001 ), KU-0063794, WYE-354, GSK1059615, Voxtalisib (XL765) Analogue, AZD8055, Nitazoxanide (NSC130SUBSTITUTE SHEET (RULE 26)697855)Torkinib (PP242), Palomid 529 (P529), Chrysophanic Acid, PP121 , OSI- 027, Gedatolisib (PKI-587), NU7441 (KU-57788), Omipalisib (GSK2126458), WYE-125132 (WYE-132), WYE-687, WAY-600, Apitolisib (GDC-0980), PF- 04691502, BGT226 (NVP-BGT226) maleate, Vistusertib (AZD2014), Sapanisertib (MLN0128), Torin 2, Torin 1 , Astragaloside IV, Lanatoside C, Compound 401 , GNE-477, GNE-493, XL388, Zotarolimus (ABT-578), 4EGI-1 , MHY-1685, Voxtalisib (XL765), Onatasertib (CC 223), ETP-46464, Paxalisib (GDC-0084)CZ415, Samotolisib (LY3023414), SF2523, Bimiralisib (PQR309), PQR620, ABTL-0812, and others.

28. The composition for use according to claims 12 and 13, wherein GSK-3 activator agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through actions of molecules involved in Trk Receptor pathways (e.g. Trk Receptor inhibitors) includes, but not limited to, ANA-12, 7,8- Dihydroxyflavone, N-Acetyl-5-hydroxytryptamine, LM22A-4, Taletrectinib (DS- 6051 b), PF-06273340, BMS-754807, Altiratinib, CH7057288, Sitravatinib (MGCD516), GNF-5837, BMS-935177, LM22B-10, Entrectinib (RXDX-101 ), Belizatinib (TSR-01 1 ).

29. The composition for use according to claims 12 and 13, wherein GSK-3 activator agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through actions of molecules involved in COX-1 and COX-2 pathways (e.g. COX-1 and COX-2 inhibitors) includes, but not limited to, Rutaecarpine, Deracoxib, Valdecoxib, Rofecoxib, Carprofen, Celecoxib (SC 58635), Lumiracoxib, Tolfenamic Acid, NS-398 (NS398), Nimesulide, Madecassic acid, Ginsenoside Rd, Myrislignan, StylopineHederagenin, Jaceosidin, Mavacoxib, Oroxin B, Pectolinarigenin, Guaiacol, Marmesin, Niflumic acid, Sulfasalazine (NSC 667219), Dehydroevodiamine, Etoricoxib, Dexamethasone Sodium Phosphate, Ginsenoside Rb3, Asaraldehyde, 4-Hydroxyphenylpyruvic acid, NE 52-QQ57, Desmethyl Celecoxib, 3-Carene, FK-331 1 , Lornoxicam, Ketorolac tromethamine salt, S-(+)-Ketoprofen, Meclofenamate SodiumAmfenac Sodium Monohydrate, Diclofenac Sodium, Indometacin Sodium, Resveratrol131SUBSTITUTE SHEET (RULE 26)(SRT501 ), Ketorolac, Naproxen Sodium, SC-560, Indomethacin (NSC-77541 ), Ibuprofen (NSC 256857), ZaltoprofenXanthohumol, Oxaprozin, Aspirin (NSC 27223), Mefenamic Acid, Suprofen, Nepafenac, Salicin, Ketoprofen, Bromfenac Sodium, and others.

30. The composition for use according to claim 12 and 29, wherein GSK-3 activator agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through actions of supplements and supplemental molecules involved in COX-1 and COX-2 pathways includes, but not limited to, Ajoene, Alpha Lipoic Acid, Anthocyanins (like Bilberry or Blueberry Extract), Apigenin, Artichoke Extract Astaxanthin, Astragalus, Bacopa, Beetroot Powder, Berberine, Bitter Melon, Black Catechu, Black Cohosh, Black Seed, Boswellia, Bromelain, Butyrate, Caffeine, Capsicum (contrains Capsaicin), Carnosol Cat's Claw, Celery Seed, Chaga, Chamomile Extract, Chinese Sage (Danshen), Chinese Skullcap (Baicalin) Chinese Yew, Chrysin (Passion Flower), CoQ10, Cordyceps, Curcumin, Daidzein, Devil's Claw, DHA / EPA Dogwood Fruit, EGCG, Echinacea, Emodin (Rumex), Epimedium (Horny Goat Weed / lcariin), Figwort, Genistein, Ginkgo Biloba, Glossy Privet, Glucosamine, Glutathione, Grape Seed Extract, Gynostemma Hesperedin, Honokiol (Magnolia), Hops, Horseradish Extract, Jasmine, Ketones, Licorice, Lion's Mane P, Luteolin, Lycopene, Magnesium, Maitake Mushroom, Milk Thistle, Moringa, N-Acetyl-Cysteine, Narigenin Nettle, Nicotine (Anatabine), Olive Leaf (Hydroxytyrosol), Panax Ginseng (Korean), Perilla, Pterostilbene, PQQ, Pycnogenol, Quercetin, Rehmannia, Reishi, Resveratrol, Rhodiola Rosea, Rosmarinic Acid, Selenium Shiitake, Sodium Benzoate (found in carbonated drinks, vinegar, fruit juices, pickles, etc), Spirulina, Sulforaphane, St. Johns Wort (Hyperforin), Taxifolin, Theanine, Thunder God Vine, Tulsi (Holy Basil), Ursolic Acid, Valerian, Vitamin B1 , Vitex, White Willow, Wormwood, Zinc31. The composition for use according to claims 12 and 13, wherein GSK-3 activator agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through actions of molecules involved in the Calcium related132SUBSTITUTE SHEET (RULE 26)pathways (e.g. the Calcium blocker family) includes, but not limited to, Amlodipine, Aranidipine, Barnidipine, Benidipine, Cilnidipine, Clevidipine, Efonidipine, Felodipine, Isradipine, Lacidipine, Lercanidipine, Manidipine, Nicardipine, Nifedipine, Nilvadipine, Nimodipine, Nisoldipine, Nitrendipine, Pranidipine, Fendiline, Gallopamil, Verapamil, mibefradil, bepridil, flunarizine, fluspirilene, fendiline, Gabapentinoids, such as gabapentin and pregabalin, Ziconotide, naturally occurring compounds and elements such as magnesium, and others.

32. The composition for use according to claim 12, wherein GSK-3 activator agents may be or comprise a compound of any chemical class increases level and / or activity of the GSK-3 through actions of molecules involved in the Calcium related pathways (e.g. the Calcium chelators) includes, but not limited to, BAPTA-AM, EGTA, and others33. The composition for use according to claim 12, wherein GSK-3 activator agents may be or comprise a compound of any chemical class increases level and / or activity of the GSK-3 through actions of a chemical molecule or molecules and supplemental molecules involved in the inhibition of the inflamation related pathways includes, but not limited to, Tiragolumab (anti-TIGIT), Vibostolimab (anti-TIGIT), Magrolimab (anti-CD47), Omalizumab (anti-lgE), Anti-mouse CD8a- InVivo, Lupenone, Ophiopogonin D, Oxysophocarpine, Luteolin-7-O-glucuronide, Linalyl Acetate, Carrageenan, Ginkgetin, Chebulagic acid, Fucoidan, MNITMT, ABR-238901 , Xanthium Sibiricum Extract, Fritillaria Cirrhosa Seed Extract, Andrographis Herba Extract, Pheretima Extract, Erycibes Caulis Extract, Rabdosiae Rubescentis Herba Extract, Cissus Quadrangularis Extract, Penthorum Chinense Pursh Extract, Hainan Nightshade Fruit Extract, Red Bean Extract, Red Raspberry Extract, Knoxia Valerianoides Extract, Piper Nigrum Seed Extract, Viscum Coloratum Extract, Polygala Fallax Hemsl. Rhizome Extract, Oriental Paperbush flower Extract, Radix Tinosporae Extract, Rhizoma Fagopyri Dibotryis Extract, Fineleaf Schizonepeta Herb Extract, Camu Camu fruit Extract, Sophora alopecuroides seed Extract, Rhizoma Anemones Raddeanae Extract, Piper betle L. Extract, Tamarindus indica seed Extract, Hibiscus sabdariffa flower Extract, Chinese Starjasmine stem Extract, Myrrh Extract,133SUBSTITUTE SHEET (RULE 26)Ecliptae Herba Extract, Vitex negundo seed Extract, Oyster Shell Extract, Boat- fruited sterculia seed Extract, Rhizoma homalomenae Extract, Acmella oleracea Extract, Radix rubiae Extract, Celery Extract, Celery seed Extract, Ash bark Extract, Artemisia annua Extract, Cyclocarya paliurus Extract, Fringed pink Extract, Evodia Lepta Bark Extract, Phellinus linteus Extract, Double coptis chinensis Extract, Cymbopogon Citratus Extract, Scepteridium Ternatum Extract, Epimedium Brevicornu Extract, Jasminum Nudiflorum Extract, Houttuynia Cordata Extract, Ulmus Pumila Bark Extract, Oenothera Biennis Extract, Blueberry Fruit Extract, Coriolus Versicolor Extract, Euphorbia Helioscopia Extract, Fritillariae Thunbergii Bulbus, ExtractUnripe Bitter Orange Extract, Stalactitum Extract, Glabrous Sarcandra Herb Extract, Lithospermum Erythrorhizon Extract, Viola Philphica Munda Extract, Ardisia Japonica Extract, Radix Asteris Extract, TMN355, Ginkgolide J, Cafestol, Cyclosporine, Sulfasalazine (NSC 667219), Bestatin (NK421 ), Prednisone (NSC-10023), Phenylbutazone, Cyclosporin A (NSC 290193), Tenoxicam, Bindarit (AF 2838), Pentosan Polysulfate Sodium, Perflubron, Demethylzeylasteral (T-96), Diammonium Glycyrrhizinate, Sinomenine hydrochloride, Eucalyptol, Isopsoralen, Flufenamic acid, Ganoderic acid A, Pimecrolimus, Diflorasone, Bendazac, Loxoprofen Sodium, Saikosaponin A, Tiaprofenic acid, PMX-53, Z- Guggulsterone, TAPI-1 , Atractylenolide I, GI254023X, Sanguinarine, Incensole acetate, Salvianolic acid A, Trilobatin, Sweroside, Corilagin, Eleutheroside E, Peiminine, GYY4137, Ipilimumab (anti-CTLA-4), Rituximab (anti-CD20), Eupolyphage sinensis Walker Extract, Pranlukast, ARA290, Idramantone, Latanoprost, Bupleurum Extract, Glossy privet fruit Extract, Grapefruit Extract, Methylprednisolone (NSC-19987), Prednisolone (NSC-9900), Roquinimex, Laquinimod, Amlexanox (AA-673), Thymopentin, Balsalazide, Actarit, Lentinan, Dicloxacillin Sodium hydrate, Methylprednisolone Acetate, VGX-1027, Y-320, Avadomide (CC-122), Ossirene, Iberdomide (CC220), 2-Hydroxybenzylamine, Betamethasone sodium phosphate, Mometasone Furoate Hydrate, Benzoylmesaconine, Strictosamide, Herbacetin, Dihydroberberine, Cornuside, Isorhapontigenin, Hinokiflavone, Glaucocalyxin A, 14-Deoxy-11 ,12- didehydroandrographolide, Neotuberostemonine, H-Leu-Leu-OMe Hydrochloride, Tris(2-butoxyethyl) phosphate, Donkey-hide gelatin Extract, Pygeum Topengii Bark Extract, Spinach Extract, Platycladi Cacumen Extract, Cymbidium Extract,134SUBSTITUTE SHEET (RULE 26)Tribulus Terrestris Extract, Cirsii Japonici Herba Extract, Angelica Sinensis Extract, Kochiae Fructus Extract, Malvae Fructus Extract, Spirodelae Herba Extract, Devil's Claw Extract, Pinus Pinaster Bark Extract, Terminalia Chebula Extract, Polygoni Multiflori Root Extract, Juglandis Semen Extract, Black Bone Rattan extract, Nigella Sativa Extract (Seed), Scutellariae rhizome Extract, Chinese Fevervine Herb Extract, Larva of a Silkworm with Batrytis Extract, Abrus mollis Extract, Calendula officinalis flower Extract, Exocarpium Citri Rubrum Extract, Symphytum officinale Extract, Selaginella Extract, Sophora flavescens Extract, Coltsfoot Extract, Raphanus sativus seed Extract, Coriaria Root Extract, Mango leaf Extract, Spicate clerodendranthus Extract, Ternate buttercup root Extract, Rose hip Extract, Buddleja Officinalis Extract, Momordicae Semen Extract, Agaric Extract, Hibiscus mutabilis flower Extract, Papaya Leaf Extract, Hibiscus syriacus flower Extract, Oregano Extract, Radix Peucedani Extract, Ramulus Mori Extract, Elaeagnus angustifolia Extract, Amomum villosum Extract, Sophora tonkinensis Extract, Arnica montana Extract, Lonicerae Flos Extract, Corni Fructus Extract, Phytolaccae Radix Extract, Snake Gallbladder Extract, Belamcandae Rhizoma Extract, Lycopodii Herba Extract, Rehmanniae Radix Extract, Panax notoginseng Extract, Rumex madaio Makino Extract, Vaccariae semen Extract, Clematis chinensis Extract, Crinum Asiaticum Extract, Lactuca sativa Extract, Glaucescent Fissistigma Root Extract, Zaocys dhumnades Extract, Daphne genkwa Sieb.et Zucc. Extract, Ficus hirta Vahl Extract, Panax quinquefolium Extract, Epimedium Extract, Opuntia dillenii Extract, Periploca Sepium Extract, Justicia Gendarussa Extract, Flos Inulae Extract, Saussurea Involucrata Extract, Surgentodoxa Cuneata Extract, Urtica Fissa Extract, Solidago Decurrens Extract, Coix Lacryma-Jobi Seed Extract, Semen Pruni Extract, Cockroach Extract, Gardenia Fruit Extract, Umbellate Pore Fungus Extract, Echinacea Extract (flower), Imiquimod (R-837), Tranilast (SB 252218), Flurbiprofen, Mesalamine (5-ASA), Fenoprofen Calcium, Levamisole hydrochloride, Oxymatrine, Rutin, Sinomenine, Gastrodin, Lappaconite HBr, Rheic Acid, Geniposide, Geniposidic acid, Tempol, Fenoprofen calcium hydrate, Diclofenac Potassium, Pidotimod, Lupeol, Umbelliferone, 4-Biphenylacetic acid, Balsalazide disodium, Picroside II, Dehydroandrographolide Succinate Potasium Salt, Ligustrazine hydrochloride, Sophoricoside, Secoisolariciresinol diglucoside, Methyl gallate, Gentisic acid, Bakuchiol, Quercitrin, Echinocystic acid,135SUBSTITUTE SHEET (RULE 26)Eleutheroside B, Muscone, Lysionotin, Scopoletin, Bornyl acetate, Astragalus polyphenols, Baccatin m , Astilbin, Tetramethylpyrazine, Veratric acid, Batyl alcohol, Oxaceprol, Halcinonide, Benzydamine HCI, Teriflunomide, Coumarin, Sasapyrine, 2-Ethoxybenzamide, Loxoprofen, Escin, Eugenol, Thymoquinone, 5- Acetylsalicylic acid, Tolmetin, Aceclofenac, 4-Methylesculetin, Isoprinosine, Benorylate, Isoxepac, Clonixin, Citral, Thymol, Isovanillic acid, ATP, Ufenamate, Acacetin, Sodium gualenate, Ferulic acid methyl ester, Curculigoside, Verbascoside, Aucubin, Curcurbitacin HA, Monotropein, Amodiaquine hydrochloride, Hydrocortisone acetate, Fenamic acid, Chelidonic acid, Iguratimod, Lodoxamide Tromethamine, Tryptanthrin, Fosfosal, Diclofenac Epolamine, N-Acetylcysteine amide, p-Coumaric acid ethyl ester, Cortisone, Trans-Tranilast, [3-Caryophyllene, Diclofenac acid, (±)-a-Bisabolol, Arachidonic acid, Ethyl pyruvate, Picolinic acid (PCL 016), Pipecolic acid, Salicylamide, Talniflumate, Ibuprofen piconol, Tinoridine hydrochloride, Eicosapentaenoic Acid, Adelmidrol, Methylprednisolone sodium succinate, Etofenamate, CORM-3, C- DIM12, Cl-amidine, Stearyl Glycyrrhetinate, Paulownin, Quillaic acid, 20S- Ginsenoside Rg3, 20S-Ginsenoside Rh2, Isovitexin, (20R)Ginsenoside Rh2, Tenacissoside H, Calycosin, 6-Shogaol, Asperuloside, Auraptene, Irisflorentin, Pectolinarin, Sinigrin, Hydroxy safflor yellow A, Pseudoprotodioscin, Trillin, Nootkatone, Buddlejasaponin IVb, Rhapontin, Rhoifolin, Corynoline, Calycosin-7- O-beta-D-glucoside, 10-Gingerol, Senegenin, Dehydrodiisoeugenol, Orientin, Fraxinellone, Ginsenoside CK, Kaempferitrin, Ononin, Wogonoside, Chikusetsusaponin Iva, Scutellarein, Eriodictyol, Apigetrin, Carnosol, Isoacteoside, 20(S)-Ginsenoside Rh1 , Punicalagin, Harpagide, Neochlorogenic acid, Solasonine, Anwuligan, Neoandrographolide, Ziyuglycoside II, Poncirin, Columbin, Harpagoside, Phellodendrine, Xanthotoxol, Macranthoidin A, Tussilagone, Ruscogenin, Forsythoside B, Notopterol, Oroxylin A, Jujuboside A, Esculentoside A, Stylopine hydrochloride, Dipotassium glycyrrhizinate, Santalol, Schisandrin C, Berberrubine, Isofraxidin, Narirutin, Protosappanin B, Phellodendrine chloride, Tiliroside, Isoliensinine, Homoorientin, Skimmin, Decursin, Ginsenoside Rc, Koumine, Demethoxycurcumin, Peimine, Genkwanin, Casticin, Astragalin, Linarin, Isoliquiritin, Fraxin, Kirenol, Corylin, Platycodin D, Methylprotodioscin, Micheliolide, Germacrone, , Atractylenolide III, Forsythoside A, ( 20R)-Ginsenoside Rh1 , Alnustone, Sophocarpine Monohydrate,136SUBSTITUTE SHEET (RULE 26)Sesamoside, Sauchinone, Angoroside C, Beta-Elemonic acid, Liensinine, Homoplantaginin, Trifolirhizin, Tabersonine, Tomatidine Hydrochloride, Dehydrocorydalin, Tubeimoside II, Echinatin, Kaurenoic acid, Naringenin chaicone, Acetylharpagide, Praeruptorin D, Madecassic acid, 1 ,3-Dicaffeoylquinic acid, llvaol, Anisodamine Hydrobromide.

34. The composition for use according to claim 12, wherein GSK-3 activation may result, either directly or indirectly, from the modulation of the toll-like receptor (TLR) family, includes, but not limited to, ABR-238901 , Saponaria Officinalis Extract, MD2-TLR4-IN-1 , E6446, Ginsenoside Rb1 , Chloroquine diphosphate, Hydroxychloroquine Sulfate (NSC 4375), MD2-IN-1 , TLR2-IN-C29, E6446 dihydrochlorideAMG-9810, Chloroquine (NSC-187208), Resatorvid (TAK-242), IRAK4-IN-2, Cu-CPT22, Schaftoside.

35. The composition for use according to claim 12, wherein GSK-3 activator agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through actions of molecules involved in the Norepinephrine-dopamine pathways (e.g. Norepinephrine-dopamine reuptake inhibitors) includes, but not limited to, Amphetamine, Benzatropine, Methylphenidate, Mazindol, Benzphetamine, Cocaine, Bupropion, Lisdexamfetamine, Dextroamphetamine, Metamfetamine, Vanoxerine,Nomifensine, Dexmethylphenidate, Sibutramine, Solriamfetol, Amineptine, Serdexmethylphenidate, GBR-12783, Bupropion, Desoxypipradrol Dexmethylphenidate , Difemetorex , Diphenylprolinol, Ethylphenidate, Fencamfamine , Fencamine , Lefetamine , Methylenedioxypyrovalerone, Methylphenidate , Nomifensine , 0-2172, Phenylpiracetam , Pipradrol, Prolintane Pyrovalerone , Solriamfetol, Tametraline , WY-46824.

36. The composition for use according to claim 12, wherein GSK-3 activator agents may be or comprise a compound of any chemical class does not interact physically, either directly or indirectly, with its target, but increases level and / or activity of the GSK-3 through actions of molecules involved in the cAMP-PKA pathways (e.g. cAMP-PKA inhibitors) includes, but not limited to, ST034307, ESI-137SUBSTITUTE SHEET (RULE 26)05, Bithionol, Fipexide hydrochloride, NE 52-QQ57, ESI-09, HJC0350, SQ22536, PACAP 1 -27, PACAP 6-38; and PKA inhibitors includes Bisindolylmaleimide IV, GSK690693, Staurosporine (AM-2282), Fasudil (HA-1077) HCI, H 89 2HCI, Daphnetin, A-674563, HA-100 dihydrochloride, H-1 152 dihydrochloride, AT13148, ML-7 HCI.

37. The composition for use according to claims 1 to 36, in which the compound selected from GSK-3 activators directly or indirectly activates the 20S / 26S proteasome system.

38. The composition for use according to claims 1 to 37, in which the compound selected from GSK-3 activators activate the proteasome 20S subunits including chymotrypsin-like, trypsin-like and caspase-like effects.

39. The composition for use according to claims 1 to 38, in which the compound selected from GSK-3 activators activate the 20S / 26S proteasome activities either Ubiquitin-ATP-Dependent or Ubiquitin-ATP-lndependent ways.

40. The composition for use according to claims 1 to 39, wherein GSK-3 activator provides compositions and methods by increasing the proteasome activity for treating the malfunctioning of the protein homeostasis network due to aging- related reduction in proteasome activity.

41. The composition for use according to claims 1 to 39, wherein GSK-3 activator provides compositions and methods by increasing the proteasome activity for treating the malfunctioning of the protein homeostasis network that occurs due to decreased trypsin, chymotrypsin, and caspase-like proteasome activities.

42. The composition for use according to claims 1 to 39, wherein GSK-3 activator provides compositions effective in preventing, treating or curing ageing through increasing the proteasome activity and regulating the protein homeostasis network.

43. The composition for use according to claims 1 -39, in which the usage of GSK-3 activators provides compositions e^^iv^ in inrr asinri both the longevity and138SUBSTITUTE SHEET (RULE 26)lifespan by increasing the proteasome activity and regulating the protein homeostasis network.

44. The composition for use according to claims 1 to 39, wherein GSK-3 activator provides compositions effective in ameliorating onset and / or the progression of ageing and age related common health conditions which are selected from the group consisting of hearing loss, cataracts and refractive errors, back and neck pain and osteoarthritis, chronic obstructive pulmonary disease, diabetes, depression and dementia, congestive heart failure, myocardial infarction, strokes, most cancers, renal dysfunction, chronic lung diseases, osteoporosis, arthritis, blindness frailty, sarcopenia, falls, incontinence, mild cognitive impairment, dementias, and many others.

45. The composition for use according to claims 1 to 39, in which the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity which is effective in protecting, diminishing or treating the symptoms of ageing related symptoms which are selected from the group including, relieve or alleviate susceptibility to infection, risk of heat stroke or hypothermia, thinning of the bones of spines, bones breaks, joint changes (ranging from minor stiffness to severe arthritis), loss of muscle mass and strength (sarcopenia), stooping posture, slowed and limited movement, hand strength and mobility decrease include, "hand and finger strength and ability to control submaximal pinch force and maintain a steady precision pinch posture, manual speed, and hand sensation, frailty, a syndrome of decreased strength, physical activity, physical performance and energy, VO2 max and maximum heart rate decline, constipation, urinary incontinence, slowing of thought, memory, and thinking, reduced reflexes and coordination and difficulty with balance, decrease in visual acuity, diminished peripheral vision, hearing loss, wrinkling and sagging skin, whitening or graying of hair, weight loss, in part due to loss of muscle tissue, losing strength in the ciliary muscle of the eyes which leads to difficulty focusing on close objects, or presbyopia, menopause typically occurs between 44 and 58 years of age, loss of arterial elasticity and as a result causes the stiffness of the vasculature, atherosclerosis which leads to cardiovascular disease (for example stroke and heart attack) which globally is the most common cause of death.139SUBSTITUTE SHEET (RULE 26)46. The composition for use according to claims 1 to 39, wherein said that the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity which is effective in the protection from age related symptoms to the major body systems including, Cells, organs and tissues: cells become less able to divide, the telomere shortening, oxidized products accumulation, connective tissue stiffness between the cells, the decrease in maximum functional capacity of many organs; Heart and blood vessels: the increase in the thickness of the wall of the heart, heart muscles become less efficient (working harder to pump the same amount of blood), the aorta (the body's main artery) becomes thicker, stiffer, and less flexible, many of the body's arteries, including arteries supplying blood to the heart and brain, slowly develop atherosclerosis, although the condition never becomes severe in some people; Vital signs: it is harder for the body to control its temperature, the heart rate takes longer to return to normal after exercise; bones, muscles, joints: bones become thinner and less strong, joints become stiffer and less flexible, the cartilage and bone in joints starts to weaken, muscle tissue becomes less bulky and less strong; digestive system: the movement of food through the digestive system becomes slower, the stomach, liver, pancreas, and small intestine make smaller amounts of digestive juices; Brain and nervous system: the number of nerve cells in the brain and spinal cord decreases, the number of connections between nerve cells decreases, abnormal structures, known as amyloids, plaques and tangles, may form in the brain, cognitive impairment (such as impairment of memory and / or orientation) or impairment of global functioning (overall functioning, including activities of daily living) and / or slow down or reverse the progressive deterioration in global or cognitive impairment, age related emotional anxiety; Eyes and Ears: the retinas get thinner, the irises get stiffer, the lenses become less clear, the walls of the ear canal get thinner, the eardrums get thicker; Skin, nails, and hair: skin gets thinner and becomes less elastic, sweat glands produce less sweat, nails grow more slowly, hairs get gray and some no longer grow.140SUBSTITUTE SHEET (RULE 26)47. The composition for use according to claims 1 to 39, in which the use of GSK-3 activators provides compositions and methods that increase both the health span and the lifespan.

48. The composition for use according to claims 1 to 39, in which the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity which is effective in not only treating diseases, but more importantly, preventing the cause of diseases which is associated with the malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins.

49. The composition for use according to claims 1 to 39, in which the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity for treating the oxidatively damaged and / or protein-misfolding diseases related to the amyloidogenic intrinsically disordered proteins are selected from the group consisting of Amyloid-Ppeptide, a-Synuclein, Prion protein, Microtubule-associated protein tau, Huntingtin exon 1 , ABri peptide, ADan peptide, Fragments of immunoglobulin light chains, Fragments of immunoglobulin heavy chains, serum amyloid A protein (SAA), Transthyretin, [32 microglobulin, apolipoprotein A-l, II, IV, C-l, II, Lysozyme (LYS), Fragments of fibrinogen a- chain, N-term truncated cystatin C, Islet amyloid polypeptide (IAPP), Calcitonin, Atrial natriuretic factor (ANF), N-term fragments of prolactin (PRL), Insulin, Lactotransferrin, Pulmonary, surfactant-associated protein C, Leukocyte cell- derived chemotaxin-2, Galectin 7, Corneodesmosin, C-term fragments of kerato- epithelin (pig-h3), Semenogelin-1 (SGI), Proteins S100A8 / A9, Enfuvirtide, Neurogenic locus notch homolog protein 3, Immunoglobulin (Ig) heavy chains, Ig light chains, Fibronectin, TAR DNA-binding protein 43, RNA-binding protein FUS, [Cu-Zn] superoxide dismutase (SOD1 ), Complement C1 q subcomponent, Immunoglobulin A, Alanine:glyoxylate aminotransferase, Immunoglobulin M (IgM), Immunoglobulin G, Uromodulin, or Tamm-Horsfall urinary glycoprotein, Ataxin-1 , Hemoglobin, a1 -Antitrypsin, Ferritin light chain, Actin, Receptorinteracting serine / threonine-protein kinase 1 / 3 (RIP1 / RIP3), Fragments of prostatic acid phosphatase and semenogelins, DRPLA protein, P / Q-type calcium141SUBSTITUTE SHEET (RULE 26)channel, Somatostatin 14, a1 A subunit, CPEB, Pmel17 fragments, p53, P21 / Cip1 , P27 / Kip1 (cell cycle, apoptosis).

50. The composition for use according to claims 1 to 39, in which the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity which prevents the malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins, accordingly provides prolongation of life.

51. The composition for use according to claims 1 to 39, in which the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity which allows the prevention or treatment of aging which is associated proteotoxic disorders which is often associated with multiple human diseases.

52. The composition for use according to claims 1 to 39, in which the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity which is used in detoxifying the cells with oxidatively damaged proteins by directly targeting oxidatively damaged proteins to detoxify the cell.

53. The composition for use according to claims 1 to 39 and 52, in which the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity which maintains and increases muscle mass, strength and performance by reducing the amounts of oxidized proteins.

54. The composition for use according to claims 1 to 39 and 53, in which the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity which provides an increase in locomotor activities and accordingly health span in subject.

55. The composition for use according to claims 1 to 39, wherein said the usage of GSK-3 activators herein provides compositions and methods for regulating glucose and fat oxidation by maintaining and increasing muscle mass, strength and performance.142SUBSTITUTE SHEET (RULE 26)56. The composition for use according to claims 1 to 39 and 53, wherein said the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity which maintains and increases muscle mass, strength and performance which prevents metabolic syndromes including (i) mitochondrial dysfunction, which causes various Skeletal muscle (SkM) pathologies such as sarcopenia and muscular dystrophy , (ii): inflammatory myopathy caused by inflammation and oxidative stress, such as dermatomyositis, polymyositis, necrotizing autoimmune myositis, and sporadic inclusion body myositis, and (iii) chronic diseases that cause SkM damage, such as type 2 diabetes, obesity, chronic kidney disease, and chronic obstructive pulmonary disease which are the syndromes that often lead to a decline in the quality of life for patients over time and increase patient mortality.

57. The composition for use according to claims 1 to 39, wherein GSK-3 activators provides compositions and methods by increasing the proteasome activity which prevents and / or treats heart diseases by maintaining and / or improving the performance of the heart muscle, and is effective in ameliorating onset and I or progression of the heart dysfunction following ischemia I reperfusion injury and ageing-induced cardiomyopathy due to oxidative stress which is the main cause of heart dysfunction following ischemia / reperfusion injury and ageing-induced cardiomyopathy.

58. The composition for use according to claims 1 to 39, wherein the GSK-3 activators provides compositions and methods by increasing the proteasome activity which prevents and / or treats the adipogenesis and lipid accumulation during aging by maintaining and / or improving the performance of the lipid-protein homeostasis network.

59. The composition for use according to claims 1 to 39, wherein the GSK-3 activators provides compositions and methods for the effective treatment of, and even prophylaxis of, obesity and obesity associated disorders including cardiovascular diseases, insulin resistance, diabetes mellitus, dyslipidemia through adjusting the malfunctioning of the protein homeostasis network143SUBSTITUTE SHEET (RULE 26)including accumulation of oxidatively damaged and / or misfolded proteins by the activation of the proteasome.

60. The composition for use according to claims 1 to 39, wherein GSK-3 activators provides compositions and methods by increasing the proteasome activity which prevents and / or treats the renal diseases (acute and chronic kidney diseases) caused by an increase in oxidatively damaged and / or misfolded proteins due to aging, hyperlipidemia, hypertension smoking, diabetes, obesity and other factors in a patient, or for treating or reducing the likelihood of disease onset in a patient in need thereof, comprising administering to said subject an effective amount of an GSK-3 activators.

61. The composition for use according to claims 1 to 39, wherein GSK-3 activators provides compositions and methods by increasing the proteasome activity which prevents and / or treats the cell proliferative diseases, including cancer.

62. The composition for use according to claim 61 , wherein said cell proliferative diseases encompass a variety of conditions characterized by aberrant cell growth, preferably abnormally increased cellular proliferation, such as proteionopathic cell proliferative diseases, disorders, and / or conditions that include, but are not limited to, cancer, cancer metastasis, immune-mediated responses and diseases (e.g., transplant rejection, graft vs host disease, immune reaction to gene therapy, autoimmune diseases, pathogen-induced immune dysregulation, etc.), certain circulatory diseases, and certain neurodegenerative diseases.

63. The composition for use according to claims 61 , and 62, wherein said cancer diseases are selected from the group consisting of but are not limited to, carcinoma, leukemias and lymphomas such as cutaneous T-cell lymphomas, peripheral T-cell lymphomas, lymphomas associated with human T-cell lymphotropic virus such as adult T-cell leukemia / lymphoma, B-cell lymphoma, acute lymphocytic leukemia, acute nonlymphocytic leukemias, chronic lymphocytic leukemia, chronic myelogenous leukemia, acute myelogenous leukemia, Hodgkin's disease, non-Hodgkin's lymphomas, multiple myeloma,144SUBSTITUTE SHEET (RULE 26)myelodysplastic syndrome, mesothelioma, common solid tumors of adults such as head and neck cancers (e.g., oral, laryngeal and esophageal), genitourinary cancers (e.g., prostate, bladder, renal, uterine, ovarian, testicular, rectal and colon), lung cancer, breast cancer, liver cancer, colon cancer, cancer of the small intestine, pancreatic cancer, melanoma and other skin cancers, stomach cancer, neoplasms of the central nervous system, neuroectodermal cancer, spinal axis tumors, glioma, meningioma, and pituitary adenoma liver cancer and thyroid cancer, and / or childhood solid tumors such as brain tumors, neuroblastoma, retinoblastoma, Wilms' tumor, bone tumors, and soft-tissue sarcomas, as well as their metastases.

64. The composition for use according to claims 1 to 39, and 61 , in which the usage of GSK-3 activators provides compositions and methods by increasing the proteasome activity that prevents, reduces or even treats the cell proliferative diseases by reducing or preventing the un / misfolded protein accumulation and subsequently Unfolded Protein Response (UPR) which accompanies cancer.

65. The composition for use according to claims 1 to 39 and 64, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity which increases the sensitivity of cancer cells to antineoplastic drugs by decreasing UPR.

66. The composition for use according to claims 1 to 39, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity which prevents and / or treats the diseases that are accompanied by endoplasmic reticulum (ER) stress in a patient, or treating or reducing the likelihood of disease onset in a patient.

67. The composition for use according to claim 66, wherein said ER stress related diseases are selected from the group consisting of metabolic diseases including, insulin resistance, arteriosclerosis, diabetes mellitus, obesity, alcoholic and nonalcoholic fatty liver disease, hyperlipidemia; cancers including Leukemia, multiple myeloma, breast cancer, prostate tumor; immune system related diseases including, viral infections, bacterial infections, vitiligo, rheumatoid arthritis, type 1145SUBSTITUTE SHEET (RULE 26)diabetes and many neurological diseases are known to be associated with ER stress, including cerebral ischaemia, sleep apnea, Alzheimer’s disease, multiple sclerosis, amyotrophic lateral sclerosis, the prion diseases, Parkinson’s and Huntington’s diseases and familial encephalopathy with neuroserpin inclusion bodies.

68. The composition for use according to claims 1 to 39, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity which prevents and / or treats the diseases that are accompanied by autophagy dysfunctions associated with the malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins69. The composition for use according to claim 68, wherein said the diseases associated with by autophagy dysfunctions are selected from the group consisting of but are not limited to, adult neurodegenerative disorders including Parkinson's disease, amyotrophic lateral sclerosis, frontotemporal dementia, neuronal ceroid lipofuscinosis, fulminant neurodegeneration, dementia with Lewy bodies; pediatric neurodevelopmental disorders including spinocerebellar ataxia, cortical atrophy and epilepsy, childhood-onset neurodegeneration, BPAN, spastic quadriplegia and brain abnormalities, primary microcephaly, Hereditary spastic paraplegia, Ataxia with spasticity, Rett syndrome, Joubert syndrome, Leukoencephalopathy, Adolescent-onset dystonia, CEDNIK syndrome, Pelizaeus-Merzbacher-like disorder, West syndrome; Hereditary neuropathies including Sensory and autonomic neuropathy type II, Charcot-Marie-Tooth disease, Sensory and autonomic neuropathy type IF, distal hereditary motor neuropathy; ophthalmological diseases including Primary open-angle glaucoma, cataracts; cardiac and skeletal myopathies including Danon’s cardiomyopathy, distal myopathy with rimmed vacuole, dilated cardiomyopathy, sporadic inclusion body myositis, X-linked myopathy with excessive autophagy; inflammatory disorders including Crohn’s disease, ulcerative colitis, childhood asthma; autoimmune diseases including systemic lupus erythematous, diabetes, other autoimmune diseases; infectious diseases including M. tuberculosis, M. leprae; skeletal disorders including osteopetrosis, Paget’s disease of the bone, Kashin- Beck disease; congenital multisystem disorders including global developmental146SUBSTITUTE SHEET (RULE 26)abnormalities, Vici’s syndrome, Zellweger's syndrome, glycosylation disorder with autophagy defects, Zimmerman-Laband syndrome, Hermansky-Pudlak syndrome, multisystem proteinopathy.

70. The composition for use according to claims 1 to 39, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity which prevents and / or treats the diseases that are accompanied by lysosome dysfunctions associated with the malfunctioning of the protein homeostasis network due to decrease in the proteasome activity including accumulation of oxidatively damaged and / or misfolded proteins71. The composition for use according to claim 70, wherein said the diseases associated with lysosome dysfunctions are selected from the group consisting of but are not limited to, Gaucher disease, Fabry disease, Niemann-Pick disease, Hunter syndrome, Glycogen storage disease II (Pompe disease), Tay-Sachs disease.

72. The composition for use according to claims 1 to 39, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity which prevents and / or treats the diseases that are accompanied by dysfunctional certain mitochondrial diseases, directly or indirectly, associated with the malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins in a patient.

73. The composition for use according to claim 72, wherein said the diseases associated with mitochondria dysfunctions are selected from the group consisting of but are not limited to, Mitochondrial myopathy, Diabetes mellitus, deafness, Leber's hereditary optic neuropathy, Leigh syndrome, subacute sclerosing encephalopathy, Neuropathy, ataxia, retinitis pigmentosa, ptosis, progressive symptoms of dementia, Myoneurogenic gastrointestinal encephalopathy, MERRF syndrome (Myoclonus Epilepsy with Ragged Red Fibers), MELAS syndrome (Mitochondrial Encephalopathy, Lactic Acidosis and Stroke-like episodes), Mitochondrial DNA depletion syndrome, Huntington's disease, cancer, Alzheimer's disease, Parkinson's disease, bipolar disorder, schizophrenia, aging147SUBSTITUTE SHEET (RULE 26)and senescence, anxiety disorders, Alper syndrome, Lowe syndrome, Luft syndrome, Menke's kinky hair syndrome, Zellweger syndrome, mitochondrial myopathy, and rhizomelic chondrodysplasia punctata.

74. The composition for use according to claims 1 to 39, wherein the GSK-3 activator decreases carbonylated and carbomylated proteins by increasing the proteasome activity which is responsible for the structural changes that lead to the exposure of abnormally destructured areas on the protein surface generating neo antigens, which are responsible for proteinopathic inflammatory diseases, disorders, and / or conditions and autoimmunity, directly or indirectly, associated with the malfunctioning of the protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins in a patient.

75. The composition for use according to claims 1 to 39, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity which prevents and / or treats the diseases that are accompanied by the immunoproteasome deficiency.

76. The composition for use according to claim 75, wherein said the immunoproteasome deficiency related diseases which are associated with carbonylated and carbomylated proteins are selected from the group consisting of but are not limited to, altered cytokine patterns, diabetes, Sjogren syndrome, Nakajo-Nishimura syndrome, joint contractures, muscle atrophy, microcytic anemia and panniculitis-induced lipodystrophy syndrome, Japanese auto inflammatory syndrome with lipodystrophy, and chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature, were are now classified as a spectrum of diseases named proteasome-associated autoinflammatory syndrome.

77. The composition for use according to claims 1 to 39, and 76, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity which prevents and / or treats the diseases that are accompanied by proteinopathic inflammatory diseases, disorders, and / or conditions and autoimmunity, directly or indirectly, associated with the malfunctioning of the148SUBSTITUTE SHEET (RULE 26)protein homeostasis network including accumulation of oxidatively damaged and / or misfolded proteins in a patient.

78. The composition for use according to claim 77, wherein said the proteinopathic inflammatory diseases, disorders, and / or conditions are selected from the group consisting of but are not limited to, inflammatory pelvic disease, urethritis, skin sunburn, sinusitis, pneumonitis, encephalitis, meningitis, myocarditis, nephritis, osteomyelitis, myositis, hepatitis, gastritis, enteritis, dermatitis, gingivitis, appendicitis, pancreatitis, cholecystitis, irritable bowel syndrome, ulcerative colitis, glomerulonephritis, dermatomyositis, scleroderma, vasculitis, allergic disorders including asthma such as bronchial, allergic, intrinsic, extrinsic and dust asthma, particularly chronic or inveterate asthma (e.g. late asthma airways hyper-responsiveness) and bronchitis, chronic obstructive pulmonary disease, multiple sclerosis, rheumatoid arthritis, disorders of the gastrointestinal tract, including, without limitation, Coeliac disease, proctitis, eosinophilic gastroenteritis, mastocytosis, pancreatitis, Crohn's disease, ulcerative colitis, food- related allergies which have effects remote from the gut, e.g. migraine, rhinitis and eczema and conditions characterized by inflammation of the nasal mucus membrane, including acute rhinitis, allergic, atrophic rhinitis and chronic rhinitis including rhinitis caseosa, hypertrophic rhinitis, rhinitis purulenta, rhinitis sicca and rhinitis medicamentosa, membranous rhinitis including croupous, fibrinous and pseudomembranous rhinitis and scrofoulous rhinitis, seasonal rhinitis including rhinitis nervosa (hay fever) and vasomotor rhinitis, sarcoidosis, farmer's lung and related diseases, fibroid lung and idiopathic interstitial pneumonia, acute pancreatitis, chronic pancreatitis, and adult respiratory distress syndrome, and / or acute inflammatory responses (such as acute respiratory distress syndrome and ischemia / reperfusion injury).

79. The composition for use according to claim 77, wherein said the autoimmunity related other diseases, disorders, and / or conditions that include rejection following transplantation of synthetic or organic grafting materials, cells, organs or tissue to replace all or part of the function of tissues, such as heart, kidney, liver, bone marrow, skin, cornea, vessels, lung, pancreas, intestine, limb, muscle, nerve tissue, duodenum, small-bowel, pancreatic-islet-cell, including149SUBSTITUTE SHEET (RULE 26)xenotransplants, etc.; treatment of graft-versus-host disease, autoimmune diseases, such as rheumatoid arthritis, systemic lupus erythematosus, thyroiditis, Hashimoto's thyroiditis, multiple sclerosis, myasthenia gravis, type I diabetes uveitis, juvenile-onset or recent-onset diabetes mellitus, uveitis, Graves' disease, psoriasis, atopic dermatitis, auto-antibody mediated diseases, aplastic anemia, Evan's syndrome, autoimmune hemolytic anemia, and the like; and further treatment of infectious diseases causing aberrant immune response and / or activation, such as traumatic or pathogen induced immune dysregulation, including for example, that which are caused by hepatitis B and C infections, HIV, Staphylococcus aureus infection, viral encephalitis, sepsis, parasitic diseases wherein damage is induced by an inflammatory response (e.g., leprosy). Other immune-mediated responses and diseases relate to graft vs host disease (especially with allogenic cells), rheumatoid arthritis, systemic lupus erythematosus, psoriasis, atopic dermatitis, Crohn's disease, ulcerative colitis and / or multiple sclerosis.

80. The composition for use according to claims 1 to 39, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity for the effective treatment of, and even prophylaxis of neurodegenerative diseases are selected from the group consisting of neurodegeneration caused by pathological insults including anticancer treatments, cerebral ischemia, traumatic brain injury, peripheral neuropathy, cerebral ischemia, choroidal neovascularization, retinal ganglion cell loss, long-term Sequelaes of concussion, decreasing neurotoxic effects of astrocytes in Alzheimer's disease, seizure and others through adjusting the malfunctioning of the protein homeostasis network including the accumulation of oxidatively damaged and / or misfolded proteins by the activation of the proteasome.

81. The composition for use according to claim 48, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity which is used in detoxifying the cells with oxidatively damaged proteins and lipids by directly targeting oxidatively damaged proteins to detoxify the cell which prevents and / or treats the symptoms of skin aging including skin wrinkles, sagging skin,150SUBSTITUTE SHEET (RULE 26)age spots on the skin, wrinkling, whitening or graying of hair and hair loss, therefore, is usable in cosmetics.

82. The composition for use according to claims 1 to 39, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity which prevents and / or treats the ocular pathologies including age-related macular degeneration, cataracts, glaucoma, and diabetic retinopathy which are associated with oxidative stress which is one of the most influential in ocular diseases, directly affecting the processes of autophagy activity which may occur as a consequence of decreased proteasome activity is the accumulation of potentially toxic un / misfolded proteins as well as protein aggregates.

83. The composition for use according to claims 1 to 39, wherein the GSK-3 activator decreases L-to-D-serine conversion by decreasing serine racemase by increasing an activity of the proteasome to above basal levels, comprising a compound selected from the group consisting of GSK-3 activators and a pharmaceutically acceptable carrier.

84. The composition for use according to claim 83, wherein said decrease in L-to-D- -serine conversion which has a role in neurodegenerative diseases caused by any nervous insults comprise selected from the group consisting of cerebral ischemia, traumatic brain injury, peripheral neuropathy, cerebral ischemia, choroidal neovascularization, hyperactivity brain syndrome, retinal ganglion cell loss, long-term sequelae of concussion, seizure, retinal ganglion cell loss in diabetics, chronic social defeat stress, chemotoxicity related neurodegeneration and other neurodegenerative diseases.

85. The composition for use according to claim 83, wherein said that GSK-3 activators decrease serine racemase by increasing the proteasome activity which prevents and / or treats the growth of colorectal cancer by decreasing Serine racemase which enhances the growth of colorectal cancer by producing pyruvate from serine.151SUBSTITUTE SHEET (RULE 26)86. The composition for use according to claim 83, wherein said that GSK-3 activator blockers decrease serine racemase which prevents or treats many neuronal diseases by reducing the toxic effects of astrocytes in a different way.

87. The composition for use according to claim 86, wherein said neuronal diseases related with the toxic effects of astrocytes are selected from the group consisting of a microvascular damage in diabetic retinopathy, synaptic damage after traumatic brain injury, neuronal over-activation, choroidal neovascularization, the pathologic symptoms of Alzheimer's disease, and neurodegeneration.

88. The composition for use according to claim 83, wherein said that GSK-3 activators decrease serine racemase by increasing the proteasome activity which prevents and / or treats schizophrenia and other psychological diseases since serine racemase plays roles in the pathogenesis of these diseases.

89. The composition for use according to claims 1 to 39, wherein the GSK-3 activator provides compositions and methods by increasing the proteasome activity which is effective in protecting, diminishing or treating depression, acute psychosis, anxiety, insomnia, confusion and migraine.

90. The composition for use according to claims 1 to 39, wherein the GSK-3 activator decrease the accumulation of pTau proteins in a cell which cause tauopathy related diseases including neuronal and / or non-neuronal cells.

91. The composition for use according to claim 90, wherein said neurodegenerative tauopathies includes sporadic and hereditary diseases characterized by filamentous tau deposits in the brain and spinal cord, such as amytrophic lateral sclerosis, parkinsonism, argyrophilic grain dementia, diffuse neurofibrillary tangles with calcification, frontotemporal dementia linked to chromosome 17, corticobasal degeneration, Pick's disease, progressive supranuclear palsy, progressive subcortical gliosis, and tangle only dementia, argyrophilic grain dementia, dementia pugilistica, diffuse neurofibrillary tangles with calcification, Down syndrome, frontotemporal dementia, parkinsonism linked to chromosome 17, Gerstmann-Straussler-Scheinker disease, Hallervorden-152SUBSTITUTE SHEET (RULE 26)Spatz disease, inclusion body myositis, Creutzfeld-Jakob disease, multiple system atrophy, NiemannPick disease, Pick's disease, prion protein cerebral amyloid angiopathy, progressive supranuclear palsy, subacute sclerosing panencephalitis, tangle-predominant Alzheimer's disease, coiticobasal degeneration, myotonic dystrophy, non-guanamian motor neuron disease with neurofibrillary tangles, postencephalitic parkinsonism, prion protein cerebral amyloid angiopathy, progressive subcortical gliosis, subacute sclerosing panencephalitis, and tangle-only dementia.

92. The composition for use according to claim 90, wherein said non-neuronal tauopathies includes diseases related to the disrupted mitochondrial dynamics and impaired mitophagy, and autophagy by the emergency of the pTau and other cleavage products.

93. The composition for use according to claim 92, wherein said diseases related to the disrupted mitochondrial dynamics and impaired mitophagy are selected from the group consisting of but are not limited to, mitochondrial myopathy, diabetes mellitus, deafness, Leber's hereditary optic neuropathy, Leigh syndrome, subacute sclerosing encephalopathy, neuropathy, ataxia, retinitis pigmentosa, ptosis, progressive symptoms of dementia, myoneurogenic gastrointestinal encephalopathy, MERRF syndrome (Myoclonus Epilepsy with Ragged Red Fibers),, MELAS syndrome (Mitochondrial Encephalopathy, Lactic Acidosis and Stroke-like episodes), Mitochondrial DNA depletion syndrome, Huntington's disease, cancer, Alzheimer's disease, Parkinson's disease, bipolar disorder, schizophrenia, aging and senescence, anxiety disorders, Alper syndrome, Lowe syndrome, Luft syndrome, Menke's kinky hair syndrome, Zellweger syndrome, mitochondrial myopathy, and rhizomelic chondrodysplasia punctata.

94. The composition for use according to claims 1 to 39, wherein the GSK-3 activator provides compositions and methods effective in protecting, diminishing or treating the diseases in which the functional deficiencies of the proteasome activity is decreased including viral infection, late recovery, and the emergence of autoimmunity after infections.153SUBSTITUTE SHEET (RULE 26)95. The composition for use according to claim 94, wherein said viral diseases are selected from the group consisting of but are not limited to, HCV, HIV, prions, and other infections, especially protease enzyme related viral infection agents.

96. The composition for use according to claims 1 to 39, wherein the GSK-3 activator increases proteasome activity which provides that the stem cells maintains and increase the sternness and lifespan characteristics which is the potential for self-renewal and for multilineage differentiation and lineage reprogramming of stem cells.

97. The composition for use according to claim 96, wherein said maintaining and increasing the sternness and lifespan characteristics that prevent a decrease in quality and strength of muscles, irreversible muscle loss, and muscle diseases which seriously affect the quality of life.

98. The composition for use according to claim 97, in which the effects of the present invention are also not limited to muscle tissue, but also the invention provides compositions and methods which maintain and increase the sternness characteristics and prevent aging and associated diseases by ensuring the continuation of the regenerative character of all tissues including neurons.

99. The composition for use according to claim 96 to 98, wherein said that the invention provides compositions and methods which maintain and increase the sternness characteristics which provide prevention of the symptoms associated with ageing and age related symptoms to the major body systems described in the claims 45 and 46 in another way.

100. The composition for use according to claims 1 to 39, wherein the use of GSK-3 activators increases proteasome activity resulting in an increase in telomerase activity and consequently telomere length.

101. The composition for use according to claim 100, the present invention further provides that GSK-3 activators delays cell senescence by increasing the154SUBSTITUTE SHEET (RULE 26)telomerase activity which provides prolongation of longevity, lifespan, and health span in a different way.

102. The composition for use according to claims 1 to 39, wherein GSK-3 activators cause a decrease in p21 , p53, and pAktl which are the major target molecules of the senolytic drugs which are used in the ablation of senescent cells.

103. The composition for use according to claims 101 and 102, wherein said that GSK-3 activator provides compositions and methods which are used in the ablation of senescent cells for the use of treating ageing which is caused by cellular senescence and associated with increasing risk for developing multiple chronic diseases, the geriatric syndromes, impaired physical resilience and mortality.

104. The composition for use according to claim 103, wherein said that GSK-3 activators, provides compositions and methods which are used in the ablation of senescent cells which has been a therapeutic approach to target the ageing phenotype and, thus, to treat, prevent, delay or mitigate aging and ageing-related diseases include diabetes / obesity, metabolic diseases, cardiac dysfunction, congestive heart failure, myocardial infarction, vascular hyporeactivity / calcification, AV fistulae, frailty, Age-related muscle loss (Sarcopenia), arthritis, osteoporosis, falls, chemotherapy complications, radiation complications, cancers, bone marrow transplant complications, organ transplantation complications, Myeloma / MGLIS (monoclonal gammopathy of undetermined significance), age-related cognitive dysfunction, other dementias, Alzheimer’s disease, Parkinson’s disease, Amyotrophic lateral sclerosis, ataxia, obesity- related neuropsychiatric dysfunction, renal dysfunction, urinary incontinence, osteoporosis, osteoarthritis, age-related intervertebral disc disease, idiopathic pulmonary fibrosis, hyperoxic lung damage, chronic obstructive pulmonary disease, tobacco, hepatic steatosis, cirrhosis, primary biliary cirrhosis, preeclampsia, macular degeneration, glaucoma, cataracts, blindness, prostatic hypertrophy, incontinence, psoriasis, Health span, Lifespan and many others.155SUBSTITUTE SHEET (RULE 26)105. The composition for use according to claims 1 to 39, 96, 100, and 102, in which the present invention provides a medicament for ameliorating onset and / or progression and even treatment of ageing and age associated diseases by targeting more than one “fundamental ageing processes” include: 1) macromolecular dysfunction (e.g. decreased proteasome activity, protein misfolding and aggregation, telomere uncapping, increased advanced oxidationglycation end-products, lipotoxicity, DNA damage, and accumulation of bioactive lipids) and organelle dysfunction (altered nuclear membranes related to deficient lamin B, mitochondrial dysfunction leading to reduced fatty acid metabolism, higher glucose utilization, depletion of NAD+ and increased ROS generation, etc.), 2) stem, progenitor and immune cell dysfunction (including altered proliferative capacity and dysdifferentiation with failure to develop into functional mature cells, declines in ‘geroprotective’ factors [e.g. a-Klotho], contributing to stem and progenitor cell dysfunction), 3) cellular senescence and linked 4) chronic low grade ‘sterile’ (absence of bacteria, fungi, etc.) inflammation.

106. The composition for use according to claim 105, wherein said that “Unitary Theory of Fundamental Aging Processes” hypothesizes that by targeting any one fundamental ageing process (indicated above) genetically or with drugs should affect many or perhaps all of the rest, therefore, the method of claims 1 to 39, 96, 100, and 102, in which the present invention provides a medicament (GSK-3 activators) for ameliorating onset and / or progression and even a treatment for ageing and age associated diseases that target more than one fundamental ageing processes (indicated above).

107. The composition for use according to claims 1 to 106, in which the usage of GSK activators provides compositions and methods, in which the therapeutically effective dose of the GSK-3 activator may be adjusted depending on conditions of the disease / disorder to be treated or prophetically treated, the age and related symptoms, body weight, general health conditions, sex, and diet of the subject, dose intervals, administration routes, excretion rate, and combinations of drugs.

108. The composition for use according to claim 107, wherein said the therapeutically effective dose of the GSK-3 activating agents and effective dose156SUBSTITUTE SHEET (RULE 26)for all possible unlimited compounds acting as GSK-3 activator may be adjusted depending on conditions of the disease / disorder to be treated or prophetically treated, the age and related symptoms, body weight, general health conditions, sex, and diet of the subject, dose intervals, administration routes, excretion rate, and combinations of drugs.

109. The composition for use according to claim 108, wherein GSK-3 activator is administered to the subject throughout life.

110. The composition for use according to claims 107 to 109, wherein GSK-3 activator is administered to the subject at least 3 or 4 times a day to keep proteasome activity above the basal level.

111. The composition for use according to claims 107 to 109, wherein GSK-3 activators are preferably administered to the subject to improve proteostasis pharmacologically should preferably be started at an early age before the malfunctioning of the protein homeostasis and the manifestation of severe cellular dysfunctions.

112. The composition for use according to claims 107 to 11 1 , wherein GSK-3 activators are administered to the subject which can be a mammal and in particular embodiments is a human, which can be an infant, a child, an adult or an elderly adult, in addition the terms “subject” and “individual” are used interchangeably and relate to mammals, such as, mammals in the context of the present invention are humans, non-human primates, domesticated animals such as dogs, cats, sheep, cattle, goats, pigs, horses etc.

113. The composition for use according to claims 107 to 112, wherein GSK-3 activators maybe administered to the subject with suitable routes, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.157SUBSTITUTE SHEET (RULE 26)114. The composition for use according to claims 107 to 113, wherein GSK-3 activators and / or the agents of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.

115. The composition for use according to claims 107 to 114, wherein GSK-3 activators and / or the agents of some embodiments of the invention can be administered to an organism with drug carriers that provide sustained or controlled release of a drug with a low dosing frequency.

116. The composition for use according to claims 107 to 115, wherein GSK-3 activators and / or the agents of some embodiments of the invention can be administered to an organism pulsatile or stimuli-responsive drug release way.158SUBSTITUTE SHEET (RULE 26)

Images