T cell receptors directed against cancer-associated antigens and uses thereof

Abstract

Novel nucleic acid compositions, vector systems, modified cells, and pharmaceutical compositions that encode or express T cell receptor components directed against cancer-associated antigens (such as preferentially expressed antigen of melanoma (PRAME) and CCCTC-binding factor (CTCFL) are provided herein. These novel components may be used to enhance an immune response in a subject diagnosed with a PRAME associated disease or condition or a CTCFL associated disease or condition, such as a hematological malignancy or a solid tumor. Associated methods for treating such subjects are also provided herein.

Description

[0001] T CELL RECEPTORS DIRECTED AGAINST CANCER-ASSOCIATED ANTIGENS AND USES THEREOF

[0002] Novel nucleic acid compositions, vector systems, modified cells, and pharmaceutical compositions that encode or express T cell receptor components directed against cancer- associated antigens (such as preferentially expressed antigen of melanoma (PRAME) and CCCTC-binding factor (CTCFL)) are provided herein. These novel components may be used to enhance an immune response in a subject diagnosed with a PRAME associated disease or condition, or a CTCFL associated disease or condition, such as a hematological malignancy or a solid tumor. Associated methods for treating such subjects are also provided herein.

[0003] Ovarian cancer (OVCA) is the fifth most lethal cancer type among women. [1] Due to lack of specific symptoms, 58% of the OVCA patients are diagnosed at an advanced or metastatic stage, with 5-year survival rates of only 30%, compared to about 80% for earlier stages. [2] OVCA is heterogeneous, with five different histotypes of which high-grade serous ovarian cancer (HGSC) is the most frequent type covering 70% of all ovarian cancers. [3] Although the late-stage patients initially respond well to the standard treatment, debulking surgery and platinum- and taxane- based chemotherapy, or more recently to (ADP-ribose) polymerase inhibitors (PARPi), recurrent disease and treatment resistance emerge in the majority of patients. [4-6] Immunotherapies, e.g. infusion of tumor infiltrating lymphocytes (TILs), anti-cancer vaccination, and treatment with immune checkpoint inhibitors such as anti-PD1 , have been explored in ovarian cancer patients, as have adoptive T-cell based therapies using chimeric antigen receptors (CARs) or T-cell receptors (TCRs).[7-9] With both CAR-T and TCR-T cells, promising clinical results have been achieved, mainly in B-cell malignancies, but also more recently in solid tumors. [10-14] CARs are restricted to target epitopes of extracellular proteins, with limited options for ovarian cancer. However, with TCRs more targets are possible, since peptides derived from both intra- and extracellular proteins that are presented in human leukocyte antigen (HLA) are possible targets.

[0004] OVCA is classified as an immunogenic tumor, with CD8+ T-cell rich tumors associating with prolonged survival. [15, 16] On the other hand, immune escape mechanisms, such as HLA downregulation and increased expression of immune inhibitory molecules, correlate with poor survival.

[0017] For immune-infiltrated tumors (‘hot’ tumors), immune checkpoint inhibitors or infusion of TILs are considered good treatment strategies. However, in the majority of ovarian tumors the tumor mutation burden (TMB) is low, resulting in limited T-cell infiltration, lack of antitumor- reactive T cells, and consequently ‘cold’ tumors. [17, 18] For those ‘cold’ tumors, adoptive T-cell based therapies with TCR-T cells targeting tumor-associated antigens (TAAs) are considered promising solutions. [8]

[0005] In clinical trials with OVCA patients, TCRs targeting cancer-testis antigens (CTAs) NY-ESO-1, MAGE-A4 and more recently PRAME have been investigated. [8] However, in order to treat a broader patient population, more TCRs specific for additional peptides derived from different TAAs binding in various HI_A class I molecules are essential, especially as escape variants with outgrowth of antigen-negative tumors occur, and most of the investigated TCRs are HLA-A*02:01 restricted.

[0006] Accordingly, there is a need for improved and additional means for treating OVCA.

[0007] Brief summary of the disclosure

[0008] As described herein, the inventors sought to find stringent tumor-specific TAAs in ovarian cancer and high-affinity TCRs targeting these targets. Ideal TAAs are highly and homogenously expressed in ovarian tumors, without expression in healthy tissues. Co-expression in tissues from reproductive organs is allowed, as expression in the reproductive compartment does not form a lethal toxicity risk for ovarian cancer patients. In addition, consistent protein expression or options to induce expression in case of variable expression are required. For example, DNA- demethylating agents have shown the potential to induce the expression of some CTAs. [19, 20] T cells targeting TAAs can be found in the T-cell repertoire of either healthy individuals or patients. If TAAs are also expressed in healthy tissues, self-tolerance occurs in the autologous- HI_A (auto- HLA) T-cell repertoire during the negative selection, as mechanism to centrally delete high-avidity self-reactive T cells. Self-tolerance can be circumvented by searching for TAA-specific T cells in the allogeneic-HI_A (allo-HLA) T-cell repertoire, as previously demonstrated for several B-cell restricted antigens and WT1. [21-23]

[0009] By combining mRNA-seq datasets of healthy and tumor tissues, the inventors identified PRAME, CTCFL and CLDN6 as stringent tumor-specific TAA targets with high expression in ovarian cancer and at least 20 fold lower expression in all healthy tissues of risk. The inventors subsequently identified naturally expressed peptides derived from the selected targets in the HLA class I ligandome of OVCA patient samples as well as cell lines. For the identified peptides, the inventors surprisingly isolated high-avidity T-cell clones from the allo-HI_A T-cell repertoire of 25 healthy individuals. Using large panels of OVCA patient samples, OVCA cell lines and healthy cell subsets, the inventors advantageously identified two novel PRAME TCRs and one novel CTCFL TCR with potent and specific anti-tumor reactivity against OVCA cells (in recognition and killing assays). These TCRs are promising candidates for the treatment of patients with ovarian cancer and are an essential expansion to HLA-A*02:01 restricted PRAME TCRs.

[0010] The differentially expressed genes, naturally expressed peptides and TCRs identified herein can advantageously be used to improve the use of T-cell based therapies in patients with OVCA. For example, the TCRs identified herein have been shown by the present inventors to be specific and safe, as they do not react with cells expressing minimal or no PRAME TAAs as discussed in the Examples section in more detail.

[0011] Accordingly, the invention provides an isolated nucleic acid composition that encodes a cancer- associated antigen-specific binding protein having a TCR a chain variable (Va) domain and a TCR p chain variable (VP) domain, the composition comprising:

[0012] (i) a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:3, or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ I D NO:6, or a functional fragment thereof, wherein the CDR3 sequences together specifically bind to PRAME; or

[0013] (ii) a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 17, or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 20, or a functional fragment thereof, wherein the CDR3 sequences together specifically bind to PRAME; or

[0014] (iii) a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:31 , or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:34, or a functional fragment thereof, wherein the CDR3 sequences together specifically bind to CTCFL.

[0015] Suitably:

[0016] (i) the CDR3 of the Va domain may comprise or consist of the amino acid sequence of SEQ ID NO: 3, and the CDR3 of the Vp domain may comprise or consist of the amino acid sequence of SEQ ID NO:6; or

[0017] (ii) the CDR3 of the Va domain may comprise or consist of the amino acid sequence of SEQ ID NO: 17, and the CDR3 of the Vp domain may comprise or consist of the amino acid sequence of SEQ ID NQ:20; or (iii) the CDR3 of the Va domain may comprise or consist of the amino acid sequence of SEQ ID NO: 31 , and the CDR3 of the Vp domain may comprise or consist of the amino acid sequence of SEQ ID NO:34.

[0018] Suitably:

[0019] (i) the Va domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 7; and the p domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 9; or

[0020] (ii) the Va domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 21 ; and the Vp domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 23; or

[0021] (iii) the Va domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 35; and the Vp domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 37.

[0022] Suitably, the cancer-associated antigen may be a PRAME antigen or a CTCFL antigen. In other words, the antigen may be derived from PRAME or CTCFL.

[0023] Suitably, the cancer-associated antigen may comprise an amino acid sequence selected from the group consisting of: LYVDSLFFL (SEQ ID NO: 43), SPSVSQLSVL (SEQ ID NO: 44) and KLHGILVEA (SEQ ID NO: 45).

[0024] Suitably, the encoded binding protein may be capable of specifically binding to a peptide: H LA complex selected from the group consisting of: a LYVDSLFFL:HLA-A*24:02 complex, a SPSVSQLSVL:HLA-B*07:02 complex, and a KLHGILVEA:HLA-A*02:01 complex.

[0025] Suitably, the nucleic acid sequence may be codon optimised for expression in a host cell, optionally wherein the host cell is a human cell.

[0026] Suitably, the nucleic acid composition may further comprise a TCR a chain constant domain and / or a TCR p chain constant domain.

[0027] Suitably, the encoded binding protein may comprise a TCR, an antigen binding fragment of a TCR, a chimeric antigen receptor (CAR), a T-engager or an ImmTAC. Suitably, the antigen binding fragment of a TCR may be a single chain TCR (scTCR) or a chimeric TCR dimer in which the antigen binding fragment of the TCR is linked to an alternative transmembrane and intracellular signalling domain.

[0028] The invention also provides a vector system comprising a nucleic acid composition according to the invention.

[0029] Suitably, the vector may be a plasmid, a viral vector, or a cosmid, optionally wherein the vector is selected from the group consisting of a retrovirus, lentivirus, adeno-associated virus, adenovirus, vaccinia virus, canary poxvirus, herpes virus, minicircle vector and synthetic DNA or RNA.

[0030] The invention also provides a modified cell comprising a nucleic acid composition according to the invention, or a vector system according to the invention.

[0031] Suitably, the modified cell may be selected from the group consisting of a CD8 T cell, a CD4 T cell, an NK cell, an NK-T cell, a gamma-delta T cell, a hematopoietic stem cell, an inducible pluripotent stem cell, a progenitor cell, a T cell line and a NK-92 cell line.

[0032] Suitably, the modified cell may be a human cell.

[0033] The invention also provides a pharmaceutical composition comprising a nucleic acid composition according to the invention, a vector system according to the invention, or a modified cell according to the invention, and a pharmaceutically acceptable excipient, adjuvant, diluent and / or carrier.

[0034] The invention also provides a pharmaceutical composition according to the invention for use in inducing or enhancing an immune response in human subject diagnosed with a PRAME associated disease or condition or a CTCFL associated disease or condition.

[0035] The invention also provides a pharmaceutical composition according to the invention for use in stimulating a cell mediated immune response to a target cell population or tissue in a human subject.

[0036] The invention also provides a pharmaceutical composition according to the invention for use in providing anti-tumor immunity to a human subject. The invention also provides a pharmaceutical composition according to the invention for use in treating an human subject having a disease or condition associated with an elevated level of H LA- restricted PRAME antigen or an elevated level of H LA-restricted CTCFL antigen.

[0037] A pharmaceutical composition described herein for use in treating or preventing a PRAME associated disease or condition or a CTCFL associated disease or condition in a subject is also provided.

[0038] A method of treating or preventing a PRAME associated disease or condition or a CTCFL associated disease or condition in a subject is also provided, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.

[0039] Suitably, the method may induce or enhance a cell mediated immune response in the subject.

[0040] A method of inducing or enhancing an immune response in human subject diagnosed with a PRAME associated disease or condition or a CTCFL associated disease or condition is also provided, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.

[0041] A method of stimulating a cell mediated immune response to a target cell population or tissue in a human subject is also provided, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.

[0042] A method of providing anti-tumor immunity to a human subject is also provided, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.

[0043] A method of treating a human subject having a disease or condition associated with an elevated level of H LA-restricted PRAME antigen or an elevated level of H LA- restricted CTCFL antigen is also provided, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.

[0044] Use of a pharmaceutical composition described herein in the manufacture of a medicament for treating or preventing a PRAME associated disease or condition or a CTCFL associated disease or condition in a subject is also provided. Use of a pharmaceutical composition described herein in the manufacture of a medicament for use in inducing or enhancing an immune response in human subject diagnosed with a PRAME associated disease or condition or a CTCFL associated disease or condition is also provided.

[0045] Use of a pharmaceutical composition described herein in the manufacture of a medicament for use in in stimulating a cell mediated immune response to a target cell population or tissue in a human subject is also provided.

[0046] Use of a pharmaceutical composition described herein in the manufacture of a medicament for use in providing anti-tumor immunity to a human subject is also provided.

[0047] Use of a pharmaceutical composition described herein in the manufacture of a medicament for use in treating an human subject having a disease or condition associated with an elevated level of H LA-restricted PRAME antigen or an elevated level of H LA-restricted CTCFL antigen is also provided.

[0048] Suitably, the human subject may have at least one tumor.

[0049] Suitably, the subject may have been diagnosed with a PRAME associated disease or condition or a CTCFL associated disease or condition.

[0050] Suitably, the PRAME associated disease or condition or the CTCFL associated disease or condition may be a hematological malignancy or a solid tumor.

[0051] Suitably, the hematological malignancy may be selected from the group consisting of: Multiple myeloma, plasma cell leukemia, Acute lymphoblastoid leukemia (ALL), Acute myeloid leukemia (AML), and B cell lymphoma, optionally wherein the B cell lymphoma is selected from the group consisting of: Diffuse large B cell lymphoma (DLBCL), High grade B cell lymphoma, Mantel cell lymphoma (MCL), Follicular lymphoma (FL) and Burkitt Lymphoma.

[0052] Suitably, the solid tumor may be selected from the group consisting of: Melanoma, Uveal melanoma, Ovarian Carcinoma, Uterine carcinoma, Testicular tumors, Lung carcinoma, Lung squamous cell carcinoma, Thymoma , Synovial sarcoma, Kidney carcinoma, Breast carcinoma, Sarcoma, Bladder carcinoma, Mesothelioma, Pancreatic carcinoma, Prostate carcinoma, Colorectal carcinoma, Cervical carcinoma and Stomach carcinoma. Suitably, the solid tumour may be selected from the group consisting of: ovarian carcinoma, synovial sarcoma, uterine carcinoma, lung carcinoma, melanoma and uveal melanoma.

[0053] Suitably, the solid tumour may be ovarian carcinoma.

[0054] The invention also provides a method of generating a binding protein that is capable of specifically binding to a peptide containing a cancer-associated antigen and does not bind to a peptide that does not contain the cancer-associated antigen, comprising contacting a nucleic acid composition according to the invention with a cell under conditions in which the nucleic acid composition is incorporated and expressed by the cell, wherein the cancer-associated antigen is a PRAME antigen or a CTCFL antigen.

[0055] Suitably, the method may be ex vivo.

[0056] The invention also provides an isolated nucleic acid sequence comprising or consisting of the nucleotide sequence of any one of SEQ ID NOs: 8, 10, 12, 14, 22, 24, 26, 28, 36, 38, 40 or 42.

[0057] The invention also provides an isolated nucleic acid sequence comprising or consisting of the nucleotide sequence of any one of SEQ ID NOs: 8, 10, 12, 14, 22, 24, 26, 28, 36, 38, 40 or 42 for use in therapy.

[0058] Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps.

[0059] Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

[0060] Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

[0061] Various aspects of the invention are described in further detail below. Brief description of the Figures

[0062] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which:

[0063] Figure 1 shows differential gene expression analysis reveals genes associated with High- Grade Serous Ovarian Carcinoma. (A) Scheme depicting the analysis strategy, as described in material and methods. (B) Plot displaying the three DE genes identified for ovarian cancer (FC > 20; adj. p-val < 0.05). All other genes on the plot are non-DE genes and genes without protein coding ability. (C) Boxplots depicting PRAME, CTCFL and CLDN6 expression in OVCA (TCGA data, n = 30) and the 9 healthy tissue types with highest gene expression (HPA and / or GTEx data, n = 5-25). Overlapping healthy tissue types within the HPA and GTEx were combined, if possible. Boxplots extend from first to third quartile, the horizontal line represent the median expression value. The whiskers represent minimum and maximum expression. The upper and lower red dashed lines represent the median expression value and the 20 times lower expression value, respectively. (Adj. p-val: false discovery rate adjusted p-value, DE: differentially expressed, FDR: fold discovery rate, GTEx: genotype-tissue expression, HPA: human protein atlas, Log2- CPM: Iog2-transformed counts per million, minimum log2FC: Iog2 fold change, TCGA: Tissue cancer genome atlas).

[0064] Figure 2 shows Identification of PRAME, CTCFL and CLDN6 peptides and T-cell clones. (A) PRAME, CTCFL (TvX) and CLDN6 mRNA gene expression in 14 OVCA patient samples (12 solid tumor tissues and 2 malignant ascites samples (OVCA-L23 and OVCA-L25)), and 9 OVCA cell lines. Expression was measured by RT-qPCR and is shown as percentage relative to the three HKGs GUSB, VPS29 and PSMB4, which was set at 100%. (B) Example of three OVCA- derived peptides identified in our HLA ligandome analyses. Shown are the mass spectra of the eluted peptides, including the gene, peptide sequence and HLA restriction. All eluted peptides were validated by comparing tandem mass spectra of eluted peptides and synthetic peptides, as shown in Figure 9. (C) Representative flow cytometry plots of the pMHC-multimer enriched cell population in 1 of the 25 healthy donors. Shown is the gating strategy of the single-cell sorted population (depicted in circles), gated on CD8 (Alx700) +, pMHC-multimer (PE) + and CD4 / CD14 / CD19 (FITC) -. (D) Examples of recognition patterns based on IFN- production (ng / mL) of selected and excluded T-cell clones during the first T-cell screenings. T-cell clones were cocultured with Raji cells transduced with various HLA alleles, combined with loading of OVCA peptides (1 pM) or transduction of OVCA genes (E:T=1 :6). Excluded 1 - 4 represent T- cell clones lacking potency and / or specificity. (HKGs: housekeeping genes, OVCA: primary ovarian cancer sample). Figure 3 shows recognition patterns of the selected T-cell clones recognizing PRAME or CTCFL positive tumor cells, without substantial peptide or HLA cross-reactivity. Recognition patterns based on IFN- / production (ng / mL) after overnight coculture assays with (A) PRAME or CTCFL positive tumor cell lines, (B) PRAME or CTCFL-negative tumor cell lines and healthy cell subsets, and (C) 25 EBV-LCLs, expressing all frequent HLA alleles (with an allele frequency > 1%) present in the Caucasian population. The HLA allele in (C) is depicted if an HLA allele is recognized by the T-cell clone, meeting the requirement that all EBV-LCLs with this HLA allele are recognized. All cell lines in panel (A) and (B) express the HLA allele that presents the targeted peptide, either wildtype or the HLA allele was introduced by transduction (+A2, +A24, +B7). Percentage relative PRAME or CTCFL expression is depicted, as determined by RT-qPCR. Bars represent averaged duplicate values and are representative of two independent experiments. (EBV-LCL: Epstein-Barr virus transformed lymphoblastoid cell lines).

[0065] Figure 4 shows three PRAME TCR-T cells recognize PRAME positive OVCA cells and mature DCs. The three PRAME TCRs and clinically tested HSS3 TCR were constructed, introduced via retroviral transduction in CD8+ cells of four different donors and purified. (A) Representative flow cytometry plots of purified CM and PRAME TCR-T cells, and their parental PRAME T-cell clones stained with murine TCR (mTCR) and the PRAME-specific pMHC-mult. (B) IFN-y production (ng / mL) of TCR-T cells and their parental T-cell clones cocultured overnight with Raji cells (transduced with HLA-A2, A24 or B7) loaded with titrated peptide concentrations (E:T = 1 :6). (C) IFN- production of TCR-T cells cocultured with OVCA cells (E:T = 1 :6). All OVCA cells express the HLA allele that presents the targeted peptide, either wildtype or the HLA allele was introduced by transduction. Patient derived malignant ascites sample OVCA-L23 (wildtype HLA- A2) was either passage 0 (included for TCR DSK3 and HSS3) or passage 10 transduced with HLA-A24 or B7 (included for all TCRs). (D) IFN- / production of TCR-T cells cocultured with several healthy cell subsets (E:T = 1 :4 for keratinocytes, fibroblasts, PTECs and CD14+, 1 :6 for CD19+ cells). Cell subsets were isolated from multiple HLA-A2+, A24+ and / or B7+ donors. (C-D) Percentage relative PRAME expression is depicted, as determined by RT-qPCR. Bars represent mean and symbols depict averaged duplicate values from four different donors, included in two independent experiments. (E:T: effectortarget ratio, imDCs and mDCs: immature and mature dendritic cells, pMHC-mult: peptide MHC-multimers, PTECs: proximal tubular epithelial cells, OVCA: primary ovarian carcinoma sample).

[0066] Figure 5 shows PRAME TCR-T cells kill OVCA cells, without harming PRAME- or HLA- negative cells. Purified PRAME TCR-T cells were tested for cytotoxic capacity in a 6-hour51Cr- release assay at E:T ratio 10:1 against (A) primary OVCA patient samples and OVCA cell lines, and (B) PRAME negative cells (Raji and imDCs), or target HLA negative cells (COV362.4). Except for COV362.4, all target cells expressed the target HLA alleles. COV318 and OVCAR-3 (wildtype HLA-A2+ and B7+) were transduced with HLA-A24. Raji cells were transduced with HLA-A2, A24 or B7. Patient derived malignant ascites sample OVCA-L23 (wildtype HI_A-A2+) was either passage 0 (included for TCR DSK3 and HSS3) or passage 10 transduced with HLA-A24 or B7 (included for TCR 16.3C1 and 8.10C4). imDCs were isolated from PBMCs of a HLA-A2+, A24+ and B7+ donor. Percentage relative PRAME expression is depicted, as determined by RT-qPCR. Cytotoxic capacity of PRAME TCR- and CMV TCR-T cells were compared using a paired t-test (two-sided). Mean and SD of technical triplicates are depicted for four donors in two independent experiments. (E:T: effector: target ratio, ns: not significant, imDCs: immature dendritic cells, OVCA: primary ovarian carcinoma sample).

[0067] Figure 6 shows CTCFL TCR-T cells recognize and kill (DAC-treated) CTCFL positive OVCA cells. The 39.2E12CTCFL / KLH / A2TCR was constructed, introduced via retroviral transduction in CD8+ cells of four different donors and purified. (A) Representative flow cytometry plots of purified CMV and CTCFL TCR-T cells, and the parental CTCFL T-cell clone stained with murine TCR (mTCR) and the CTCFL-specific pMHC-mult. (B) IFN-y production (ng / mL) of the TCR-T cells and parental T-cell clone cocultured overnight with Raji cells transduced with HLA-A*02:01 and loaded with titrated peptide concentrations (E:T = 1:6). (C-F) IFN- production of TCR-T cells cocultured with (C) single cells of primary OVCA-L11 passage 0 (E:T 1 : 6) , (D) healthy cell subsets of multiple donors (E:T = 1 :4 for fibroblasts, PTECs and CD14+, and 1 :6 for CD19+ cells), (E) 7 days 1 pM DAC or DMSO treated tumor cells (E:T = 1 :6), and (F) 7 days 1 pM DAC or DMSO treated fibroblasts. Bars represent mean and symbols depict averaged duplicate values from three or four different donors in two independent experiments. (G) Cytotoxic capacity of CTCFL TCR-T cells in a 6-hour51Cr-release assay against Raji cells loaded with the KLH (SEQ ID NO: 45) peptide, and COV413b and SK-OV-3 treated with 7 days 1 pM DAC or DMSO. Mean and SD depict technical triplicates from four different donors in two independent experiments, at E:T ratio 10:1. (B-G) All target cells express HLA-A*02:01 , either wildtype or the HLA allele was introduced by transduction (Raji, SK-OV-3, A2780). Percentage relative CTCFL (TvX) expression is depicted, as determined by RT-qPCR. (D) IFN-y production of CTCFL TCR- and CMV TCR-T cells compared using a paired t-test (two-sided). (E-G) IFN-y production and cytotoxicity of CTCFL TCR-T cells cocultured with DMSO and DAC-treated cells, or Raji cells loaded with and without peptide, compared using a paired t-test (two-sided), (ns: not significant, DAC: 5-aza-2'- deoxycytidine, imDCs and mDCs: immature and mature dendritic cells, pMHC-mult: peptide MHC-multimers, PTECs: proximal tubular epithelial cells, OVCA: primary ovarian carcinoma sample). Figure 7 shows PRAME, CTCFL and CLDN6 expression in OVCA and healthy tissues. Boxplots depicting (A) PRAME, (B) CTCFL, and (C) CLDN6 expression in ovarian cancer (TCGA data, n=30) and across 51 (GTEx data, n=6-20) and 32 (HPA data, n=3-5) healthy tissue types, respectively. Grey boxplots represent healthy reproductive tissues. Dark grey boxplots represent ovarian tumors, and white boxplots represent all remaining healthy tissues.. Boxplots extend from first to third quartile, the horizontal line represent the median expression value. The whiskers represent the minimum and maximum expression value (1 .5 IQR from the first and third quartile). Outliers are defined as being 1.5*IQR or more above the third or below the first quartile, respectively. The upper and lower dashed lines represent the median expression value and the 20 times lower expression value, respectively. [CLDN6: claudin-6, CTCFL: CCCTC-binding factor, FemRPS: female reproductive system, GTEx: Genotype-tissue expression, HPA: Human protein atlas, HSOvCa: high-grade serous ovarian carcinoma, IQR: interquartile range, Iog2- CPM: Iog2-transformed counts per million, MaRPS: male reproductive system, PRAME: preferentially expressed antigen of melanoma, TCGA: Tissue cancer genome atlas].

[0068] Figure 8 shows PRAME, CTCFL and CLDN6 expression in tumor samples. Boxplots depicting (A) PRAME, (B) CTCFL, and (C) CLDN6 expression across 33 different tumor types (TCGA data, n=30). Dark colored and grey boxplots represent ovarian tumor and all other tumor types, respectively. Boxplots extend from first to third quartile, where the horizontal line represent the median expression value. The whiskers represent the minimum and maximum expression value (1.5 IQR from the first and third quartile). Outliers are defined as being 1.5*IQR or more above the third or below the first quartile, respectively. [AML: acute myeloid leukemia, CLDN6: claudin-6, CTCFL: CCCTC-binding factor, DLBCL: diffuse large B-cell lymphoma, IQR: interquartile range, Iog2-CPM: Iog2-transformed counts per million, PRAME: preferentially expressed antigen of melanoma, TCGA: Tissue cancer genome atlas].

[0069] Figure 9 shows examples of mass spectra comparisons of eluted (top) and synthetic (bottom) peptides. (A) Mass spectra comparison of peptide SPSVSQLSVL (SEQ ID NO: 44), derived from PRAME presented in HLA-B*07:02. (B) Mass spectra comparison of peptide KLHGILVEA (SEQ ID NO: 45), derived from CTCFL presented in HLA-A*02:01. *The mass spectra of the eluted peptide with a BMI of 43, also eluted from K562+A2, is not available for publication. (C) Mass spectra comparison of peptide VLTSGIVFV (SEQ ID NO: 73), derived from CLDN6 presented in HLA-A*02:01. (BMI: best Mascot ion score).

[0070] Figure 10 shows location of peptides and used primers in aligned CTCFL variants. (A)

[0071] Protein sequence alignment of the 15 protein variants derived from the CTCFL gene isoforms due to alternative splicing, according to the UniProt database.

[0030] The canonical sequence is selected as reference sequence, differences with the reference sequence are depicted in white. Shown are the identified CTCFL peptides, the primer specific for the canonical sequence (CTCFL TvX) and the primer specific for variant 13 (CTCFL Tv13). (B) Zoom in of the selection marked in (A). (C) CTCFL expression measured by RT-qPCR using primer TvX and Tv13. Shown is percentage relative expression to the three HKGs GUSB, VPS29 and PSMB4, which was set at 100%. HKGs: housekeeping genes.

[0072] Figure 11 shows peptide-specificity and target gene recognition summarized for the 56 isolated T-cell clones. Summary graphs with IFN-y production (ng / mL) of the 56 isolated T-cell clones recognizing both target cells loaded with peptides (1 pM) and target cells transduced with the target gene. Each graph shows the five most potent T-cell clones per specificity for (A) six PRAME peptides and (B) three CTCFL peptides. The number of T-cell clones shown and the total number isolated are given between brackets. *No T-cell clones recognizing transduced CLDN6 were identified, the five best T-cell clones recognizing peptide-loaded cells are shown in (C). In all target cells the HLA allele that presents the targeted peptide is introduced by transduction (+A2, +A24, +B7). Bars depict averaged duplicate values and the four T-cell clones finally selected for TCR transduction are colored.

[0073] Figure 12 shows PRAME, CTCFL and CLDN6 expression in primary OVCA patient samples and healthy cell subsets (RT-qPCR). PRAME, CTCFL (TvX) and CLDN6 mRNA gene expression in primary OVCA patient samples and various healthy cell subsets. Expression was measured by RT-qPCR and is shown as percentage relative to the three KKGs GUSB, VPS29 and PSMB4, which was set at 100%. (OVCA: primary ovarian cancer patient sample, imDCs and mDCs: immature and mature dendritic cells, HKGs: housekeeping genes, PBECs: primary bronchus epithelial cells, PTECs: proximal tubular epithelial cells.)

[0074] Figure 13 shows recognition and killing of peptide-loaded tumor cell lines by the PRAME TCR-T cells. Recognition and killing of unloaded and peptide-loaded OVCA cell lines by the PRAME TCR-T cells and CMV TCR-T cells. All experiments were performed simultaneously, data is shown for one donor, but representative for two donors. (A) IFN-y production (ng / mL) of the TCR-T cells cocultured overnight with three OVCA cell lines (E:T = 1 :6), showing mean and SD of technical duplicates. Percentage killed cells (E:T = 10:1 and 1 :1) measured in a 6-hour51Cr- release assay, showing mean and SD of technical triplicates. All OVCA cell lines are wildtype A2+ and B7+, and A24 is introduced by transduction. (B) IFN-y production and killing of OVCA cell lines loaded with the QLL / A2 peptide (200 nM), LYV / A24 peptide (200 nM), SLL / A2 peptide (200 nM) and SPS / B7 peptide (1000 nM). Figure 14 shows recognition and killing of peptide-loaded tumor cell lines by the CTCFL TCR-T cells. Recognition and killing of unloaded and peptide-loaded target cells by the CTCFL TCR-T cells and CMV TCR-T cells. All experiments were performed simultaneously, data is shown for one donor, but representative for two donors. (A) IFN-y production (ng / mL) of the TCR- T cells cocultured overnight with 1 pM DAC or DMSO treated target cells (E:T = 1 :6), showing mean and SD of technical duplicates. And percentage killed cells (E:T = 10:1 and 1 :1) measured in a 6-hour51Cr-release assay, showing mean and SD of technical triplicates. COV413b is wildtype A2+ and Raji and SK-OV-3 are transduced with A2. (B) IFN-y production and killing of the same target cells loaded with the KLH / A2 peptide (200 nM). (DAC: 5-aza-2'-deoxycytidine, E:T: effector: target ratio).

[0075] Figure 15 shows increased recognition and killing of DAC-treated OVCA cells by PRAME TCR-T cells. Recognition and killing of DAC-treated target cells by the HSS3PRAME / SLL / A2TCR-T cells, shown for four different donors. (A) IFN-y production (ng / mL) of the PRAME TCR-T cells cocultured overnight with 7 days 1 pM DAC or DMSO treated fibroblasts and tumor cell cells (E:T = 1 :6). Bars represent mean and symbols depict averaged duplicate values from four different donors in two independent experiments. (B) Percentage killed cells (E:T = 10:1 and 1 :1) measured in a 6-hour51Cr-release assay. Allo HLA-A*02:01 reactive T cells are shown as well. Mean and SD depict technical triplicates from four different donors in two independent experiments, at E:T ratio 10:1. (A-B) Recognition and killing of DMSO and DAC treated cells, or Raji cells loaded with and without peptide, are compared using a paired t-test (two-sided), (ns: not significant, DAC: 5-aza-2'-deoxycytidine, E:T: effectortarget ratio).

[0076] Figure 16 NSG mice engrafted with 2*106 U266 MM cells transduced with Luc2 luciferase.

[0077] Mice were i.v. treated with 5*106 PRAME or CMV TCR-T cells 14 days after tumor infusion. A) DSK3 PRAME / QLL / A2 TCR-T cells were infused into U266 engrafted mice. B) 16.3C1 PRAME / LYV / A24 TCR-T cells were infused into U266 + A24 engrafted mice. C) 8.10C4 PRAME / SPS / B7 TCR-T cells were infused into U266 engrafted mice. D) HSS3 PRAME / SLL / A2 TCR-T cells were infused into U266 engrafted mice. Mean and SD of tumor outgrowth (average radiance measured by bioluminescence imaging) over time on the ventral side are depicted. N=6 for PRAME TCR-T cells and n=4 for CMV TCR-T cells. Tumor outgrowth in mice treated with PRAME or CMV-TCR T cells was compared for each time point using two-way ANOVA on log- transformed data, followed by Bonferroni post-hoc analysis. Only significant results are depicted. (ANOVA= analysis of variance) The patent, scientific and technical literature referred to herein establish knowledge that was available to those skilled in the art at the time of filing. The entire disclosures of the issued patents, published and pending patent applications, and other publications that are cited herein are hereby incorporated by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference. In the case of any inconsistencies, the present disclosure will prevail.

[0078] Various aspects of the invention are described in further detail below.

[0079] Detailed Description

[0080] Nucleic acid compositions that encode binding protein components

[0081] An isolated nucleic acid composition that encodes a cancer-associated antigen-specific binding protein having a TCR a chain variable (Va) domain and a TCR p chain variable (VP) domain is provided herein, the composition comprising:

[0082] (a) a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence; and

[0083] (b) a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence, wherein the CDR3 sequences together specifically bind to a cancer-associated antigen (e.g. PRAME or CTCFL).

[0084] As would be clear to a person of skill in the art, the CDR3 amino acid sequences described herein specifically bind to their target (in this case a cancer associated peptide, for example a PRAME peptide or a CTCFL peptide), when the target (i.e. the appropriate cancer associated peptide) is presented in the context of HLA. The binding proteins (and CDR3 sequences specifically described herein) are therefore capable of specifically binding to an appropriate cancer- associated peptide:HLA complex. These complexes are described in more detail elsewhere herein.

[0085] The invention provides an isolated nucleic acid composition that encodes a binding protein comprising T cell receptor (TCR) components that specifically bind a cancer-associated antigen (e.g. to a PRAME, or a CTCFL antigen). The encoded binding protein is therefore capable of specifically binding to a peptide containing a cancer-associated antigen (e.g. a PRAME antigen comprising an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 and SEQ ID NO: 44, or a CTCFL antigen comprising the amino acid sequence of: SEQ ID NO: 45) and does not bind to a peptide that does not contain a cancer associated-antigen (e.g. it does not bind to a peptide that does not contain a cancer-associated antigen comprising an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 45).

[0086] The nucleic acid composition comprises (a) a nucleic acid sequence that encodes a TOR Va domain with the specified features described herein and (b) a nucleic acid sequence that encodes a TOR Vp domain with the specified features described herein. The encoded TOR components form a cancer-associated antigen-specific binding protein.

[0087] The nucleic acid sequences of (a) and (b) above may be distinct nucleic acid sequences within the nucleic acid composition. The TOR components of the binding protein may therefore be encoded by two (or more) nucleic acid sequences (with distinct nucleotide sequences) which, together, encode all of the TCR components of the binding protein. In other words, some of the TCR components may be encoded by one nucleic acid sequence in the nucleic acid composition, and others may be encoded by another (distinct) nucleic acid sequence within the nucleic acid composition.

[0088] Alternatively, the nucleic acid sequences of (a) and (b) may be part of a single nucleic acid sequence. The TCR components of the binding protein may therefore all be encoded by a single nucleic acid sequence (for example with a single open reading frame, or with multiple (e.g. 2 or more, three or more etc.) open reading frames).

[0089] Nucleic acid sequences described herein may form part of a larger nucleic acid sequence that encodes a larger component part of a functioning binding protein. For example, a nucleic acid sequence that encodes a TCR Va domain with the specified features described herein may be part of a larger nucleic acid sequence that encodes a functional TCR a chain (including the constant domain). As another example, a nucleic acid sequence that encodes a TCR Vp domain with the specified features described herein may be part of a larger nucleic acid sequence that encodes a functional TCR chain (including the constant domain). As a further example, both nucleic acid sequences (a) and (b) above may be part of a larger nucleic acid sequence that encodes a combination of a functional TCR a chain (including the constant domain) and a functional TCR p chain (including the constant domain), optionally wherein the sequence encoding the functional TCR a chain is separated from the sequence encoding the functional TCR P chain by a linker sequence that enables coordinate expression of two proteins or polypeptides in the same nucleic acid sequence. More details on this are provided below.

[0090] The nucleic acid sequences described herein may alternatively encode a small component of a T cell receptor e.g. a TCR Va domain, or a TCR Vp domain, only. The nucleic acid sequences may be considered as “building blocks” that provide essential components for peptide binding specificity. The nucleic acid sequences described herein may be incorporated into a distinct nucleic acid sequence (e.g. a vector) that encodes the other elements of a functional binding protein such as a TCR, such that when the nucleic acid sequence described herein is incorporated, a new nucleic acid sequence is generated that encodes e.g. a TCR a chain and / or a TCR p chain that specifically binds to a cancer-associated antigen (e.g. wherein the cancer- associated antigen comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 45). The nucleic acid sequences described herein therefore have utility as essential components that confer binding specificity for a cancer-associated antigen, and thus can be used to generate a larger nucleic acid sequence encoding a binding protein with the required antigen binding activity and specificity.

[0091] The nucleic acid sequences described herein may be codon optimised for expression in a host cell, for example they may be codon optimised for expression in a human cell, such as a cell of the immune system, a inducible pluripotent stem cell (iPSC), a hematopoietic stem cell, a T cell, a primary T cell, a T cell line, a NK cell, or a natural killer T cell (Scholten et al, Clin. Immunol. 119: 135, 2006). The T cell can be a CD4+ or a CD8+ T cell. Codon optimisation is a well-known method in the art for maximizing expression of a nucleic acid sequence in a particular host cell. For instance, one or more cysteine residues may also be introduced into the encoded TCR alpha and beta chain components (e.g. to reduce the risk of mispairing with endogenous TCR chains).

[0092] In one example, the nucleic acid sequences described herein are codon optimised for expression in a suitable host cell, and / or are modified to introduce codons encoding one or more cysteine amino acids (e.g. into the constant domain of the encoded TCR alpha chain and / or the encoded TCR beta chain) to reduce the risk of mispairing with endogenous TCR chains. In one example, the nucleic acid sequences described herein are codon optimised for expression in a suitable host cell, optionally wherein the host cell is a human cell.

[0093] In certain examples, a TCR constant domain is modified to enhance pairing of desired TCR chains. For example, enhanced pairing between a heterologous TCR a chain and a heterologous TCR p chain due to a modification may result in the preferential assembly of a TCR comprising two heterologous chains over an undesired mispairing of a heterologous TCR chain with an endogenous TCR chain (see, e.g., Covers et al, Trends Mol. Med. 16(2):11 (2010)). Exemplary modifications to enhance pairing of heterologous TCR chains include the introduction of complementary cysteine residues in each of the heterologous TCR a chain and chain. A binding protein that is encoded by the nucleic acid compositions described herein is specific for a cancer-associated antigen (e.g. PRAME or CTCFL) and comprises cancer-associated antigen specific-TCR components. However, the encoded binding protein is not limited to being a TCR. Other appropriate binding proteins that comprise the specified cancer-associated antigen (e.g. PRAME or CTCFL) specific -TCR components are also encompassed. For example, the encoded binding protein may comprise a TCR, an antigen binding fragment of a TCR, a chimeric antigen receptor (CAR), a T-engager or an immTAC. TCRs, antigen binding fragments thereof, CARs, T- engagers and ImmTACs are well defined in the art.

[0094] A person of skill in the art would understand that in the context of the invention, the antigen binding fragment of a TCR may be coupled to additional amino acids sequences. For example, the antigen binding fragment of a TCR may be coupled to parts of an antibody or nanobody or other protein or DNA structure (DNA origami).

[0095] A non-limiting example of an antigen binding fragment of a TCR is a single chain TCR (scTCR) or a chimeric dimer composed of the antigen binding fragments of the TCR a and TCR p chain linked to transmembrane and intracellular domains of a dimeric complex so that the complex is a chimeric dimer TCR (cdTCR). A T-engager and an ImmTAC comprise a TCR connected to an anti-CD3 antibody. T-engagers and ImmTACs are therefore bispecific, combining cancer- associated antigen-recognizing TCR components with immune activating complexes.

[0096] In certain examples, an antigen-binding fragment of a TCR comprises a single chain TCR (scTCR), which comprises both the TCR Va and TCR Vp domains, but only a single TCR constant domain. In other examples, an antigen-binding fragment of a TCR comprises a chimeric TCR dimer in which the antigen binding fragment of the TCR is linked to an alternative transmembrane and intracellular signalling domain (where the alternative transmembrane and intracellular signalling domain are not naturally found in TCRs). In further examples, an antigen-binding fragment of a TCR or a chimeric antigen receptor is chimeric (e.g., comprises amino acid residues or motifs from more than one donor or species), humanized (e.g., comprises residues from a nonhuman organism that are altered or substituted so as to reduce the risk of immunogenicity in a human), or human.

[0097] "Chimeric antigen receptor" (CAR) refers to a fusion protein that is engineered to contain two or more naturally-occurring amino acid sequences linked together in a way that does not occur naturally or does not occur naturally in a host cell, which fusion protein can function as a receptor when present on a surface of a cell. CARs described herein include an extracellular portion comprising an antigen binding domain (i.e., obtained or derived from an immunoglobulin or immunoglobulin-like molecule, such as an scFv derived from an antibody or TCR specific for an antigen (e.g. a cancer antigen etc), or an antigen binding domain derived or obtained from a killer immunoreceptor from an NK cell) linked to a transmembrane domain and one or more intracellular signalling domains (optionally containing co-stimulatory domain(s)) (see, e.g., Sadelain et al, Cancer Discov., 3(4):388 (2013); see also Harris and Kranz, Trends Pharmacol. Sci., 37(3):220 (2016), and Stone et al, Cancer Immunol. Immunother., 63(11): 1163 (2014)).

[0098] Methods for producing engineered TCRs are described in, for example, Bowerman et al, Mol. Immunol, 5(15):3000 (2009). Methods for making CARs are well known in the art and are described, for example, in U.S. Patent No. 6,410,319; U.S. Patent No. 7,446,191 ; U.S. Patent Publication No. 2010 / 065818; U.S. Patent No. 8,822,647; PCT Publication No. WO 2014 / 031687; U.S. Patent No. 7,514,537; and Brentjens et al, 2007, Clin. Cancer Res. 73:5426.

[0099] The binding proteins described herein may also be expressed as part of a transgene construct that encodes additional accessory proteins, such as a safety switch protein, a tag, a selection marker, a CD8 co-receptor p-chain, a-chain or both, or any combination thereof.

[0100] A T cell receptor (TCR) is a molecule found on the surface of T cells (T lymphocytes) that is responsible for recognising a peptide that is bound to (presented by) a major histocompatibility complex (MHC) molecule on a target cell. The invention is directed to nucleic acid compositions that encode binding proteins comprising TCR components that interact with a particular peptide in the context of the appropriate serotype of MHC, i.e. a cancer-associated antigen (e.g. PRAME or CTCFL) in the context of HLA-A*24:02, HLA-B*07:02 or HLA-A*02:01 (in other words, the encoded binding protein is capable of specifically binding to a cancer-associated antigen (e.g. PRAME or CTCFL): specific HLA complex). In an example, the invention is directed to nucleic acid compositions that encode binding proteins comprising TCR components that interact with a particular peptide in the context of the appropriate serotype of MHC, i.e. LYVDSLFFL (SEQ ID NO: 43) in the context of HLA-A*24:02; SPSVSQLSVL (SEQ ID NO: 44) in the context of HLA- B*07:02; or KLHGILVEA (SEQ ID NO: 45) in the context of HLA-A*02:01.

[0101] HLA-A*02:01 is a globally common human leukocyte antigen serotype within the HLA-A serotype group. Peptides that are presented by HLA-A*02:01 to TCRs are described as being “HLA- A*02:01 restricted”.

[0102] HLA-A*24:02, and HLA-B*07:02 are also common human leukocyte antigen serotypes within the HLA-A and HLA-B serotype groups. Peptides that are presented by HLA-A*24:02 to TCRs are described as being “HLA-A*24:02 restricted”. Similarly, peptides that are presented by HLA- B*07:02 to TCRs are described as being “HLA-B*07:02 restricted”.

[0103] HLA-A*02:01 is referred to herein as HLA-A2; HLA-B*07:02 is also referred to herein as HLA-B7; and HI_A-A*24:02 is also referred to herein as HLA-A24.

[0104] As described herein, the inventors have identified several cancer-associated antigen (e.g. PRAME and CTCFL) derived peptides presented on malignant cells in HLA-A*24:02, HLA- B*07:02 or HI_A-A*02:01. Specifically, the inventors identified the PRAME derived peptides SEQ ID NO: 43 to 44, and the CTCFL derived peptide SEQ ID NO: 45.

[0105] Accordingly, the cancer-associated antigen specifically bound by a binding protein described herein may comprise an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 45. The antigen may be an antigenic fragment (i.e. a portion) of an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 35, it may consist of an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 45, or it may comprise (i.e. include within a longer sequence) an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 45.

[0106] The inventors identified that the PRAME derived peptide LYVDSLFFL (SEQ ID NO: 43) is capable of being presented by HLA-A*24:02; that the PRAME derived peptide SPSVSQLSVL (SEQ ID NO: 44) is capable of being presented by HLA-B*07:02; and that the CTCFL derived peptide KLHGILVEA (SEQ ID NO: 45) is capable of being presented by HLA-A*02:01.

[0107] Accordingly, in one example, the encoded binding protein is capable of specifically binding to a peptide:HLA complex selected from the group consisting of: a LYVDSLFFL:HLA-A*24:02 complex, a SPSVSQLSVL:HLA-B*07:02 complex, and a KLHGILVEA:HLA-A*02:01 complex.

[0108] In one example, the cancer derived peptide (e.g. the PRAME derived peptide or the CTCFL derived peptide) of the peptide:HLA complex comprises an antigenic fragment of an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 45. In a further example, the cancer derived peptide (e.g. the PRAME derived peptide or the CTCFL derived peptide) of the peptide:HLA complex comprises or consists of an amino acid sequence selected from the group consisting of: SEQ ID NO:43 to 45.

[0109] The TCR is composed of two different polypeptide chains. In humans, 95% of TCRs consist of an alpha (a) chain and a beta (P) chain (encoded by TRA and TRB respectively). When the TCR engages with a peptide in the context of HLA (e.g. in the context of HLA-A*24:02, HLA-B*07:02 or HLA-A*02:01 , as appropriate), the T cell is activated through signal transduction.

[0110] The alpha and beta chains of the TCR are highly variable in sequence. Each chain is composed of two extracellular domains, a variable domain (V) and a constant domain (C). The constant domain is proximal to the T cell membrane followed by a transmembrane region and a short cytoplasmic tail while the variable domain binds to the peptide / HLA complex.

[0111] An isolated nucleic acid composition that encodes a cancer-associated antigen-specific binding protein is provided herein having a TCR a chain variable (Va) domain and a TCR p chain variable (VP) domain. In one example the nucleic acid composition described herein may comprise a TCR a chain constant domain and / or a TCR p chain constant domain.

[0112] The variable domain of each chain has three hypervariable regions (also called complementarity determining regions (CDRs)). Accordingly, the TCR alpha variable domain (referred to herein as a TCR Va domain, TCR V alpha domain, Va domain or V alpha domain, alpha variable domain etc) comprises a CDR1 , a CDR2 and CDR3 region. Similarly, the TCR beta variable domain (referred to herein as a TCR Vp domain, TCR V beta domain, Vp domain or V beta domain, beta variable domain etc) also comprises a (different) CDR1 , CDR2, and CDR3 region. In each of the alpha and beta variable domains it is CDR3 that is mainly responsible for recognizing the peptide being presented by the HLA molecules.

[0113] As will be clear to a person of skill in the art, the phrase “TCR a chain variable domain” refers to the variable (V) domain (extracellular domain) of a TCR alpha chain, and thus includes three hypervariable regions (CDR1 , CDR2 and the specified CDR3), as well as the intervening sequences, but does not include the constant (C) domain of the alpha chain, which does not form part of the variable domain.

[0114] As will be clear to a person of skill in the art, the phrase “TCR p chain variable domain” refers to the variable (V) domain (extracellular domain) of a TCR beta chain, and thus includes three hypervariable regions (CDR1 , CDR2 and the specified CDR3), as well as the intervening sequences, but does not include the constant (C) domain of the beta chain, which does not form part of the variable domain.

[0115] TCR Components

[0116] The isolated nucleic acid composition described herein encodes a cancer-associated antigenspecific binding protein (e.g. a PRAME antigen-specific binding protein or a CTCFL antigen- specific binding protein). As discussed herein, the inventors have identified several TCRs that specifically bind to a cancer-associated antigen selected from LYVDSLFFL (SEQ ID NO: 43), SPSVSQLSVL (SEQ ID NO: 44) and KLHGILVEA (SEQ ID NO: 45).

[0117] (i) TCR components that interact with LYVDSLFFL (SEQ ID NO: 43) from PRAME

[0118] As provided elsewhere herein, the inventors identified TCR clone 16.3C1 (PRAME p365 A24 TCR) which interacts with LYVDSLFFL (SEQ ID NO: 43) in the context of HLA-A*24:02. The sequences provided herein that correspond to TCR clone 16.3C1 are SEQ ID NO:s 1 to 14.

[0119] In one embodiment, an isolated nucleic acid composition that encodes a cancer-associated antigen-specific binding protein (i.e. a PRAME antigen specific binding protein) having a TCR a chain variable (Va) domain and a TCR p chain variable (VP) domain is provided, the composition comprising: a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:3, or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ I D NO:6, or a functional fragment thereof, wherein the CDR3 sequences together specifically bind to PRAME.

[0120] An example of an appropriate TCR Va domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular to a PRAME antigen (e.g. to LYVDSLFFL (SEQ ID NO: 43)), is shown in SEQ ID NO:3. As would be clear to a person of skill in the art, variants of the amino acid sequence shown in SEQ ID NO:3 may also be functional (i.e. retain their ability to confer specific binding to a PRAME antigen (e.g. to the peptide LYVDSLFFL (SEQ ID NO: 43) when the CDR3 is part of TCR Va domain). Such functional variants are therefore encompassed herein.

[0121] For example, appropriate (functional) Va domain CDR3 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 3, i.e. they may have at least 80%, at least 83%, at least 91 %, or 100% sequence identity to SEQ ID NO: 3. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO:3). In other words, appropriate (functional) Va domain CDR3 amino acid sequences may vary from the sequence shown in SEQ ID NO:3 by one or several (e.g. two etc) amino acids.

[0122] As stated above, functional variants of SEQ ID NO:3 retain their ability to confer specific binding to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:43) when the CDR3 is part of TCR Va domain. Functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO:3. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one, two or more amino acids of SEQ ID NO:3, or substitution, deletion or insertion of non-critical amino acids in non- critical regions of the CDR3.

[0123] Non-functional variants are amino acid sequence variants of SEQ ID NO: 3 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:43). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO:3 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0124] In one example, the CDR3 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO: 3. In examples where the TCR Va domain CDR3 has the amino acid sequence of SEQ ID NO:3, the CDR3 may be encoded by any appropriate nucleic acid sequence.

[0125] The encoded TCR Va domain may comprise, in addition to the specified CDR3, a CDR1 comprising an amino acid sequence of SEQ ID NO: 1 , or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to the PRAME antigen (e.g. the peptide shown in SEQ ID NO:43)). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO:1. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO:1 , or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0126] Non-functional variants are amino acid sequence variants of SEQ ID NO: 1 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:43). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ I D NO: 1 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0127] For example, appropriate functional Va domain CDR1 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 1 , i.e. it may have at least 80%, or 100% sequence identity to SEQ ID NO: 1. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO:1). In other words, appropriate functional Va domain CDR1 amino acid sequences may vary from the sequence shown in SEQ ID NO: 1 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO:1. As stated above, functional variants of SEQ ID NO: 1 retain the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:43) when the CDR1 is part of TCR Va domain).

[0128] In one example, the CDR1 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO:1. In examples where the TCR Va domain CDR1 has the amino acid sequence of SEQ ID NO:1 , the CDR1 may be encoded by any appropriate nucleic acid sequence.

[0129] The encoded TCR Va domain may also comprise, in addition to the specified CDR3 (and optionally the specified CDR1 above), a CDR2 comprising an amino acid sequence of SEQ ID NO:2, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to HLA-A*24:02). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO:2. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO:2, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0130] Non-functional variants are amino acid sequence variants of SEQ ID NO: 2 that do not specifically bind to HI_A-A*24:02. Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 2 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0131] For example, appropriate functional Va domain CDR2 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 2, i.e. it may have at least 80%, or 100% sequence identity to SEQ ID NO: 2. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO:2). In other words, appropriate (functional) Va domain CDR2 amino acid sequences may vary from the sequence shown in SEQ ID NO:2 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO:2. As stated above, a functional variant of SEQ ID NO: 2 retains the ability to specifically bind to HLA-A*24:02. In one example, the CDR2 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO: 2. In examples where the TOR Va domain CDR2 has the amino acid sequence of SEQ ID NO:2, the CDR2 may be encoded by any appropriate nucleic acid sequence.

[0132] The encoded TOR Va domain may therefore comprise the CDRs mentioned in detail above (by SEQ ID specifically i.e. SEQ ID NO:3, SEQ ID NO: 1 and SEQ ID NO: 2, or functional variants thereof), with appropriate intervening sequences between the CDRs.

[0133] The encoded TCR Va domain may comprise an amino acid sequence of SEQ ID NO:7, or a functional variant thereof (i.e. wherein the variant TCR Va domain retains the ability to specifically bind to a PRAM E antigen (e.g. the peptide shown in SEQ ID NO:43) when part of a binding protein described herein). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO:7. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO:7, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0134] Non-functional variants are amino acid sequence variants of SEQ ID NO: 7 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:43). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO:7 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0135] In one example, the encoded TCR Va domain may have an amino acid sequence having at least 75%, at least 80%, at least 85% or at least 90% (or at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 7, whilst retaining the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:43). In other words, a functional TCR Va domain with one or several amino acid substitutions compared to the sequence of SEQ ID NO:7 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO:7 may all be in regions of the TCR Va domain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 3, SEQ ID NO: 1 and / or SEQ ID NO: 2, and still have 25% (or less) sequence variability compared to SEQ ID NO:7). In other words, the sequence of the CDRs of SEQ ID NO: 7 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 7).

[0136] As an example, the encoded TOR Va domain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 7, wherein the TOR Va domain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 3. In this example, the TCR Va domain CDR1 may have an amino acid sequence of SEQ ID NO: 1 and the TCR Va domain CDR2 may have an amino acid sequence of SEQ ID NO: 2.

[0137] As another example, the encoded TCR Va domain may comprise an amino acid sequence having the amino acid sequence of SEQ ID NO: 7, with 0 to 10 (or 0 to 5) amino acid substitutions, insertions or deletions), wherein the TCR Va domain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 3. In this example, the TCR Va domain CDR1 may have an amino acid sequence of SEQ ID NO: 1 and the TCR Va domain CDR2 may have an amino acid sequence of SEQ ID NO: 2.

[0138] In examples where the TCR Va domain has the amino acid sequence of SEQ ID NO:7, the TCR Va domain may be encoded by the nucleic acid sequence of SEQ ID NO:8, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).

[0139] The phrase “genetically degenerate sequence thereof” is used interchangeably with “derivative thereof” herein.

[0140] For the avoidance of doubt, the nucleic acid sequence encoding the TCR Va domain may also encode a TCR a chain constant domain. An example of a suitable constant domain (for either a TCR a chain or a TCR chain) is encoded in the MP71-TCR-flex retroviral vector. However, the invention is not limited to this specific constant domain, and encompasses any appropriate TCR a chain constant domain. The constant domain may be murine derived, human derived or humanised. Methods for identifying or generating appropriate constant domains are well known to a person of skill in the art and are well within their routine capabilities.

[0141] By way of example only, the constant domain may be encoded by or derived from a vector, such as a lentiviral, retroviral or plasmid vector but also adenovirus, adeno-associated virus, vaccinia virus, canary poxvirus or herpes virus vectors in which murine or human constant domains are pre-cloned. Recently, minicircles have also been described for TCR gene transfer (non-viral 1

[0142] Sleeping Beauty transposition from minicircle vectors as published by R Monjezi, et al., 2017). Moreover, naked (synthetic) DNA / RNA can also be used to introduce the TCR. As an example, a pMSGV retroviral vector with pre-cloned TCR-Ca and Cb genes as described in LV Coren et al., BioTechniques 2015 may be used to provide an appropriate constant domain. Alternatively, single stranded or double stranded DNA or RNA can be inserted by homologous directed repair into the TCR locus (see Roth et al 2018 Nature vol 559; page 405). As a further option, non - homologous end joining is possible.

[0143] An example of a specific TCR a chain amino acid sequence that includes a TCR Va domain described herein with an appropriate constant domain is shown in SEQ ID NO: 11. Appropriate functional variants of SEQ ID NO:11 are also encompassed (e.g. variants having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 11 , wherein the variant TCR a chain amino acid sequence retains its ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:43) when part of a binding protein described herein). In other words, a functional TCR a chain with one or several amino acid substitutions compared to the sequence of SEQ I D NO: 11 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO: 11 may all be in regions of the TCR a chain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 3, SEQ ID NO: 1 and / or SEQ ID NO: 2, and still have 25% (or less) sequence variability compared to SEQ ID NO:11). In other words, the sequence of the CDRs of SEQ ID NO: 11 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 11).

[0144] As an example, the encoded TCR a chain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 11 , wherein the TCR a chain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 3. In this example, the TCR a chain CDR1 may have an amino acid sequence of SEQ ID NO:1 and the TCR a chain CDR2 may have an amino acid sequence of SEQ ID NO: 2.

[0145] In examples where the TCR a chain has the amino acid sequence of SEQ ID NO:11 , the TCR a chain may be encoded by the nucleic acid sequence of SEQ ID NO: 12, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code). It is noted that SEQ ID NO: 12 is the nucleic acid sequence for TCR a chain of clone 16.3C1 (PRAME p365 A24 TCR). In one example, the nucleic acid composition provided herein comprises a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:3, or a functional fragment thereof.

[0146] In another example, the CDR3 of the Va domain of a nucleic acid composition provided herein comprises or consists of the amino acid sequence of SEQ ID NO: 3.

[0147] In another example, the Va domain of a nucleic acid composition provided herein comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 7.

[0148] As provided above, the inventors identified TCR clone 16.3C1 (PRAME p365 A24 TCR) which interacts with LYVDSLFFL (SEQ ID NO: 43) in the context of HI_A-A*24:02. The sequences provided herein that correspond to TCR clone 16.3C1 are SEQ ID NO:s 1 to 14.

[0149] Accordingly, an example of an appropriate TCR Vp domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular to a PRAME antigen (e.g. to LYVDSLFFL (SEQ ID NO: 43)), is shown in SEQ ID NO:6. As would be clear to a person of skill in the art, variants of the amino acid sequence shown in SEQ ID NO:6 may also be functional (i.e. retain their ability to confer specific binding to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:43) when the CDR3 is part of TCR Vp domain). Such functional variants are therefore encompassed herein.

[0150] For example, appropriate (functional) Vp domain CDR3 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 6, i.e. they may have at least 80%, at least 84%, at least 92%, or 100% sequence identity to SEQ ID NO: 6. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 6). In other words, appropriate (functional) Vp domain CDR3 amino acid sequences may vary from the sequence shown in SEQ ID NO: 6 by one or several (e.g. two) amino acids. As stated above, functional variants of SEQ ID NO: 6 retain their ability to confer specific binding to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 43) when the CDR3 is part of TCR Vp domain.

[0151] Functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 6. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 6, or substitution, deletion or insertion of non-critical amino acids in non- critical regions of the CDR3. Non-functional variants are amino acid sequence variants of SEQ ID NO: 6 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 43). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 6 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0152] In one example, the CDR3 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO: 6. In examples where the TCR Vp domain CDR3 has the amino acid sequence of SEQ ID NO:6, the CDR3 may be encoded by any appropriate nucleic acid sequence.

[0153] The encoded TCR Vp domain may comprise, in addition to the specified CDR3, a CDR1 comprising an amino acid sequence of SEQ ID NO: 4, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 43)). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 4. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 4, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0154] Non-functional variants are amino acid sequence variants of SEQ ID NO: 4 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 43). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 4 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0155] For example, appropriate functional Vp domain CDR1 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 4, i.e. it may have at least 80%, or 100% sequence identity to SEQ ID NO: 4. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 4). In other words, appropriate (functional) Vp domain CDR1 amino acid sequences may vary from the sequence shown in SEQ ID NO:4 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO:4. As stated above, functional variants of SEQ ID NO: 4 retain the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 43) when the CDR1 is part of TCR Vp domain. In one example, the CDR1 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO: 4. In examples where the TOR Va domain CDR1 has the amino acid sequence of SEQ ID NO:4, the CDR1 may be encoded by any appropriate nucleic acid sequence.

[0156] The encoded TOR Vp domain may also comprise, in addition to the specified CDR3 (and optionally the specified CDR1 above), a CDR2 having an amino acid sequence of SEQ ID NO: 5, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to HLA-A*24:02). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 5. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 5, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0157] Non-functional variants are amino acid sequence variants of SEQ ID NO: 5 that do not specifically bind to HI_A-A*24:02. Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 5 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0158] For example, appropriate functional Vp domain CDR2 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 5, i.e. it may have at least 80%, at least 83%, or 100% sequence identity to SEQ ID NO: 5. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 5). In other words, appropriate (functional) Vp domain CDR2 amino acid sequences may vary from the sequence shown in SEQ ID NO: 5 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO: 5. As stated above, a functional variant of SEQ ID NO: 5 retains the ability to specifically bind to HI_A-A*24:02.

[0159] In one example, the CDR2 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO: 5. In examples where the TCR Vp domain CDR2 has the amino acid sequence of SEQ ID NO:5, the CDR2 may be encoded by any appropriate nucleic acid sequence.

[0160] The encoded TCR Vp domain may therefore comprise the CDRs mentioned in detail above (by SEQ ID specifically i.e. SEQ ID NO:6, SEQ ID NO: 4 and SEQ ID NO: 5, or functional variants thereof), with appropriate intervening sequences between the CDRs. The encoded TCR Vp domain may have an amino acid sequence of SEQ ID NO: 9, or a functional variant thereof (i.e. wherein the variant TCR Vp domain retains the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 43) when part of a binding protein described herein). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 9. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 9, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0161] Non-functional variants are amino acid sequence variants of SEQ ID NO: 9 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 43). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO:9 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0162] In one example, the encoded TCR Vp domain may have an amino acid sequence having at least 75%, at least 80%, at least 85% or at least 90% (or at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 9, whilst retaining the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 43). In other words, a functional TCR Vp domain with one or several amino acid substitutions compared to the sequence of SEQ ID NO: 9 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO:9 may all be in regions of the TCR Vp domain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 6, SEQ ID NO: 4 and / or SEQ ID NO: 5, and still have 25% (or less) sequence variability compared to SEQ ID NO: 9). In other words, the sequence of the CDRs of SEQ ID NO: 9 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 9).

[0163] As an example, the encoded TCR Vp domain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 9, wherein the TCR Vp domain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 6. In this example, the TCR Vp domain CDR1 may have an amino acid sequence of SEQ ID NO:4 and the TCR Vp domain CDR2 may have an amino acid sequence of SEQ ID NO: 5. In examples where the TCR Vp domain has the amino acid sequence of SEQ ID NO:9, the TCR VP domain may be encoded by the nucleic acid sequence of SEQ ID NO: 10, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).

[0164] For the avoidance of doubt, the nucleic acid sequence encoding the TCR Vp domain may also encode a TCR p chain constant domain. Examples of suitable constant domains are generally discussed above.

[0165] An example of a specific TCR p chain amino acid sequence that includes a TCR Vp domain described herein and an appropriate constant domain is shown in SEQ ID NO: 13. Appropriate functional variants of SEQ ID NO: 13 are also encompassed (e.g. variants having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 13, wherein the variant TCR p chain amino acid sequence retains its ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 43) when part of a binding protein described herein). In other words, a functional TCR p chain with one or several amino acid substitutions compared to the sequence of SEQ ID NO: 13 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO: 13 may all be in regions of the TCR p chain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 6, SEQ ID NO: 4 and / or SEQ ID NO: 5, and still have 25% (or less) sequence variability compared to SEQ ID NO:13). In other words, the sequence of the CDRs of SEQ ID NO: 13 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 13).

[0166] As an example, the encoded TCR p chain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 13, wherein the TCR p chain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 6. In this example, the TCR p chain CDR1 may have an amino acid sequence of SEQ ID NO: 4 and the TCR p chain CDR2 may have an amino acid sequence of SEQ ID NO: 5.

[0167] In examples where the TCR p chain has the amino acid sequence of SEQ ID NO: 13, the TCR p chain may be encoded by the nucleic acid sequence of SEQ ID NO: 14, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code). It is noted that SEQ ID NO: 14 is the nucleic acid sequence for TOR p chain of clone 16.3C1 (PRAME p365 A24 TOR).

[0168] In an example, the nucleic acid composition provided herein comprises a nucleic acid sequence that encodes a TOR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:6, or a functional fragment thereof.

[0169] In another example, the CDR3 of the Vp domain of a nucleic acid composition provided herein comprises or consists of the amino acid sequence of SEQ ID NO:6.

[0170] In a further example, the Vp domain of a nucleic acid composition provided herein comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 9.

[0171] The TCR Vp domain sequences derived from TCR clone 16.3C1 discussed above are particularly compatible with the TCR Va domain sequences derived from TCR clone 16.3C1 discussed elsewhere herein.

[0172] Accordingly, in one example, a nucleic acid composition described herein encodes a PRAME antigen-specific binding protein having TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:3, or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR p domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:6, or a functional fragment thereof.

[0173] In a particular example, a nucleic acid composition described herein encodes a PRAME antigenspecific binding protein having a TCR Va domain with a CDR3 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 3; and a TCR Vp domain with a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO:6. In addition, the PRAME antigen may comprise or consist of the sequence shown in SEQ ID NO: 43. Furthermore, the TCR Va domain may be part of a TCR a chain having a constant domain and the TCR Vp domain may be part of a TCR p chain having a constant domain.

[0174] In this particular example, the Va domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 7; and the Vp domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 9. In one example, the Va domain comprises the amino acid sequence of SEQ ID NO: 7 and the Vp domain comprises the amino acid sequence of SEQ ID NO: 9. In such cases, the Va domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 8; and the Vp domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 10.

[0175] In this particular example, the TOR Va domain may include a CDR1 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO:1 and a CDR2 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO:2. Furthermore, the TCR p domain may include a CDR1 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO:4 and a CDR2 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 5.

[0176] For the avoidance of doubt, this particular example encompasses components of TCR clone 16.3C1 exemplified herein. The different components of TCR clone 16.3C1 and their respective SEQ ID Nos are summarised in Table 4 below.

[0177] As stated in more detail elsewhere herein, the nucleic acid composition described herein encodes both a TCR Va domain and a TCR Vp domain, which form the binding protein that is capable of specifically binding to a cancer-associated antigen. In examples where the TCR Va domain and the TCR Vp domain are encoded by the same nucleic acid sequence, the TCR Va domain and TCR Vp domain may be joined together via a linker, e.g. a linker that enables expression of two proteins or polypeptides from the same vector. By way of example, a linker comprising a porcine teschovirus-1 2A (P2A) sequence may be used, such as 2A sequences from foot-and-mouth disease virus (F2A), equine rhinitis A virus (E2A) or Thosea asigna virus (T2A) as published by A.L. Szymczak et al., Nature Biotechnology 22, 589 - 594 (2004) or 2A-like sequences. 2A and 2A-like sequences are linkers that are cleavable once the nucleic acid molecule has been transcribed and translated. Another example of a linker is an internal ribosomal entry sites (IRES) which enables translation of two proteins or polypeptides from the same transcript. Any other appropriate linker may also be used. As a further example, the nucleic acid sequence encoding the TCR Va domain and nucleic acid sequence encoding the TCR Vp domain may be cloned into a vector with dual internal promoters (see e.g. S Jones et al., Human Gene Ther 2009). The identification of appropriate linkers and vectors that enable expression of both the TCR Va domain and the TCR Vp domain is well within the routine capabilities of a person of skill in the art.

[0178] Additional appropriate polypeptide domains may also be encoded by the nucleic acid sequences that encode the TCR Va domain and / or the TCR Vp domain. By way of example only, the nucleic acid sequence may comprise a membrane targeting sequence that provides for transport of the encoded polypeptide to the cell surface membrane of the modified cell. Other appropriate additional domains are well known and are described, for example, in WQ2016 / 071758. In one example, the nucleic acid composition described herein may encode a soluble TCR. For example, the nucleic acid composition may encode the variable domain of the TCR alpha and beta chains respectively together with an immune-modulator molecule such as a CD3 agonist (e.g. an anti-CD3 scFv). The CD3 antigen is present on mature human T cells, thymocytes and a subset of natural killer cells. It is associated with the TCR and is involved in signal transduction of the TCR. Antibodies specific for the human CD3 antigen are well known. One such antibody is the murine monoclonal antibody OKT3, which is the first monoclonal antibody approved by the FDA. Other antibodies specific for CD3 have also been reported (see e.g. W02004 / 106380; U.S. Patent Application Publication No. 2004 / 0202657; U.S. Pat. No. 6,750,325). Immune mobilising mTCR Against Cancer (ImmTAC; Immunocore Limited, Milton Partk, Abington, Oxon, United Kingdom) are bifunctional proteins that combine affinity monoclonal T cell receptor (mTCR) targeting with a therapeutic mechanism of action (i.e. , an anti-CD3 scFv). In another example, a soluble TCR of the invention may be combined with a radioisotope or a toxic drug. Appropriate radioisotopes and / or toxic drugs are well known in the art and are readily identifiable by a person of ordinary skill in the art.

[0179] In one example, the nucleic acid composition may encode a chimeric single chain TCR wherein the TCR alpha chain variable domain is linked to the TCR beta chain variable domain and a constant domain which is e.g. fused to the CD3 zeta signalling domain. In this example, the linker is non-cleavable. In an alternative embodiment, the nucleic acid composition may encode a chimeric two chain TCR in which the TCR alpha chain variable domain and the TCR beta chain variable domain are each linked to a CD3 zeta signalling domain or other transmembrane and intracellular domains. Methods for preparing such single chain TCRs and two chain TCRs are well known in the art; see for example RA Willemsen et al, Gene Therapy 2000.

[0180] (ii) TCR components that interact with SPSVSQLSVL (SEQ ID NO: 44) from PRAME

[0181] As provided elsewhere herein, the inventors have also identified TCR clone 8.10C4 (PRAME p359 B7 TCR) which interacts with SPSVSQLSVL (SEQ ID NO: 44) in the context of HLA- B*07:02. The sequences provided herein that correspond to TCR clone 8.10C4 are SEQ ID NO:s 15 to 28.

[0182] In one embodiment, an isolated nucleic acid composition that encodes a cancer-associated antigen-specific binding protein (i.e. a PRAME antigen specific binding protein) having a TCR a chain variable (Va) domain and a TCR p chain variable (VP) domain is provided, the composition comprising: a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 17, or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 20, or a functional fragment thereof, wherein the CDR3 sequences together specifically bind to PRAME.

[0183] Accordingly, another example of an appropriate TCR Va domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular a PRAME antigen (e.g. to SPSVSQLSVL (SEQ ID NO: 44)), is shown in SEQ ID NO: 17. As would be clear to a person of skill in the art, variants of the amino acid sequence shown in SEQ I D NO: 17 may also be functional (i.e. retain their ability to confer specific binding to a PRAME antigen (e.g. to the peptide SPSVSQLSVL (SEQ ID NO: 44)) when the CDR3 is part of TCR Va domain). Such functional variants are therefore encompassed herein.

[0184] For example, appropriate (functional) Va domain CDR3 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 17, i.e. they may have at least 80%, at least 81%, at least 90%, or 100% sequence identity to SEQ ID NO: 17. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 17). In other words, appropriate (functional) Va domain CDR3 amino acid sequences may vary from the sequence shown in SEQ ID NO: 17 by one or several (e.g. two etc) amino acids.

[0185] As stated above, functional variants of SEQ ID NO: 17 retain their ability to confer specific binding to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:44) when the CDR3 is part of TCR Va domain.

[0186] Functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 17. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one, two or more amino acids of SEQ ID NO: 17, or substitution, deletion or insertion of non-critical amino acids in non- critical regions of the CDR3.

[0187] Non-functional variants are amino acid sequence variants of SEQ ID NO: 17 that do not specifically bind to a PRAME antigen (e.g. to the peptide shown in SEQ ID NO: 44). Nonfunctional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 17 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and nonfunctional variants are well known to a person of ordinary skill in the art. In one example, the CDR3 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO: 17. In examples where the TOR Va domain CDR3 has the amino acid sequence of SEQ ID NO: 17, the CDR3 may be encoded by any appropriate nucleic acid sequence.

[0188] The encoded TOR Va domain may comprise, in addition to the specified CDR3, a CDR1 comprising an amino acid sequence of SEQ ID NO: 15, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:44)). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 15. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 15, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0189] Non-functional variants are amino acid sequence variants of SEQ ID NO: 15 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:44). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 15 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0190] For example, appropriate functional Va domain CDR1 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 15, i.e. it may have at least 80%, or 100% sequence identity to SEQ ID NO: 15. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO:15). In other words, appropriate functional Va domain CDR1 amino acid sequences may vary from the sequence shown in SEQ ID NO: 15 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO: 15. As stated above, functional variants of SEQ ID NO: 15 retain the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:44) when the CDR1 is part of TCR Va domain.

[0191] In one example, the CDR1 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO:15. In examples where the TCR Va domain CDR1 has the amino acid sequence of SEQ ID NO: 15, the CDR1 may be encoded by any appropriate nucleic acid sequence.

[0192] The encoded TCR Va domain may also comprise, in addition to the specified CDR3 (and optionally the specified CDR1 above), a CDR2 comprising an amino acid sequence of SEQ ID NO: 16, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to HLA-B*07:02). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 16. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 16, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0193] Non-functional variants are amino acid sequence variants of SEQ ID NO: 16 that do not specifically bind to HLA-B*07:02. Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 16 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0194] For example, appropriate functional Va domain CDR2 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 16, i.e. it may have at least 80%, at least 85%, or 100% sequence identity to SEQ ID NO: 16. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 16). In other words, appropriate (functional) Va domain CDR2 amino acid sequences may vary from the sequence shown in SEQ ID NO: 16 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO: 16. As stated above, a functional variant of SEQ ID NO:16 retains the ability to specifically bind to HLA-B*07:02.

[0195] In one example, the CDR2 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO: 16. In examples where the TOR Va domain CDR2 has the amino acid sequence of SEQ ID NO: 16, the CDR2 may be encoded by any appropriate nucleic acid sequence.

[0196] The encoded TOR Va domain may therefore comprise the CDRs mentioned in detail above (by SEQ ID specifically i.e. SEQ ID NO: 17, SEQ ID NO: 15 and SEQ ID NO: 16, or functional variants thereof), with appropriate intervening sequences between the CDRs.

[0197] The encoded TOR Va domain may comprise an amino acid sequence of SEQ ID NO:21 , or a functional variant thereof (i.e. wherein the variant TOR Va domain retains the ability to specifically bind to a PRAM E antigen (e.g. the peptide shown in SEQ ID NO:44) when part of a binding protein described herein). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO:21. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO:21 , or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0198] Non-functional variants are amino acid sequence variants of SEQ ID NO:21 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:44). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO:21 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0199] In one example, the encoded TCR Va domain may have an amino acid sequence having at least 75%, at least 80%, at least 85% or at least 90% (or at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO:21 , whilst retaining the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:44). In other words, a functional TCR Va domain with one or several amino acid substitutions compared to the sequence of SEQ ID NO:21 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO:21 may all be in regions of the TCR Va domain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 17, SEQ ID NO:15 and / or SEQ ID NO:16, and still have 25% (or less) sequence variability compared to SEQ ID NO:21). In other words, the sequence of the CDRs of SEQ ID NO: 21 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 21).

[0200] As an example, the encoded TCR Va domain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 21 , wherein the TCR Va domain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 17. In this example, the TCR Va domain CDR1 may have an amino acid sequence of SEQ ID NO: 15 and the TCR Va domain CDR2 may have an amino acid sequence of SEQ ID NO: 16.

[0201] As another example, the encoded TCR Va domain may comprise an amino acid sequence having the amino acid sequence of SEQ ID NO: 21 , with 0 to 10 (or 0 to 5) amino acid substitutions, insertions or deletions, wherein the TCR Va domain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 17. In this example, the TCR Va domain CDR1 may have an amino acid sequence of SEQ ID NO: 15 and the TOR Va domain CDR2 may have an amino acid sequence of SEQ ID NO: 16.

[0202] In examples where the TOR Va domain has the amino acid sequence of SEQ ID NO:21 , the TOR Va domain may be encoded by the nucleic acid sequence of SEQ ID NO: 22, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).

[0203] For the avoidance of doubt, the nucleic acid sequence encoding the TOR Va domain may also encode a TOR a chain constant domain. Examples of suitable constant domains are generally discussed above.

[0204] An example of a specific TOR a chain amino acid sequence that includes a TOR Va domain described herein with an appropriate constant domain is shown in SEQ ID NO: 25. Appropriate functional variants of SEQ ID NO: 25 are also encompassed (e.g. variants having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 25, wherein the variant TCR a chain amino acid sequence retains its ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO:44) when part of a binding protein described herein). In other words, a functional TCR a chain with one or several amino acid substitutions compared to the sequence of SEQ ID NO:25 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO:25 may all be in regions of the TCR a chain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 17, SEQ ID NO: 15 and / or SEQ ID NO: 16, and still have 25% (or less) sequence variability compared to SEQ ID NO:25). In other words, the sequence of the CDRs of SEQ ID NO: 25 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 25).

[0205] As an example, the encoded TCR a chain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 25, wherein the TCR a chain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 17. In this example, the TCR a chain CDR1 may have an amino acid sequence of SEQ ID NO: 15 and the TCR a chain CDR2 may have an amino acid sequence of SEQ ID NO: 16. In examples where the TCR a chain has the amino acid sequence of SEQ ID NO:25, the TCR a chain may be encoded by the nucleic acid sequence of SEQ ID NO:26, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code). It is noted that SEQ ID NO:26 is the nucleic acid sequence for TCR a chain of clone 8.10C4.

[0206] In one example, the nucleic acid composition provided herein comprises a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 17, or a functional fragment thereof.

[0207] In another example, the CDR3 of the Va domain of a nucleic acid composition provided herein comprises or consists of the amino acid sequence of SEQ ID NO: 17.

[0208] In another example, the Va domain of a nucleic acid composition provided herein comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 21.

[0209] As provided elsewhere herein, the inventors have identified TCR clone 8.10C4 which interacts with SPSVSQLSVL (SEQ ID NO: 44) in the context of HLA-B*07:02. The sequences provided herein that correspond to TCR clone 8.10C4 are SEQ ID NO:s 15 to 28.

[0210] An example of an appropriate TCR Vp domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular a PRAME antigen (e.g. to SPSVSQLSVL (SEQ ID NO: 44)), is shown in SEQ ID NQ:20. As would be clear to a person of skill in the art, variants of the amino acid sequence shown in SEQ ID NQ:20 may also be functional (i.e. retain their ability to confer specific binding to a PRAME antigen (i.e. the peptide shown in SEQ ID NO: 44) when the CDR3 is part of TCR Vp domain). Such functional variants are therefore encompassed herein.

[0211] For example, appropriate (functional) Vp domain CDR3 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 20, i.e. they may have at least 80%, at least 85%, at least 92%, or 100% sequence identity to SEQ ID NO: 20. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 20). In other words, appropriate (functional) Vp domain CDR3 amino acid sequences may vary from the sequence shown in SEQ ID NO: 20 by one or several (e.g. two) amino acids. As stated above, functional variants of SEQ ID NO: 20 retain their ability to confer specific binding to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 44) when the CDR3 is part of TCR Vp domain. Functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 20. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 20, or substitution, deletion or insertion of non-critical amino acids in non- critical regions of the CDR3.

[0212] Non-functional variants are amino acid sequence variants of SEQ ID NO: 20 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 44). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 20 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0213] In one example, the CDR3 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO: 20. In examples where the TCR Vp domain CDR3 has the amino acid sequence of SEQ ID NQ:20, the CDR3 may be encoded by any appropriate nucleic acid sequence.

[0214] The encoded TCR Vp domain may comprise, in addition to the specified CDR3, a CDR1 comprising an amino acid sequence of SEQ ID NO: 18, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 44)). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 18. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 18, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0215] Non-functional variants are amino acid sequence variants of SEQ ID NO: 18 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 44). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 18 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0216] For example, appropriate functional Vp domain CDR1 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 18, i.e. it may have at least 80%, or 100% sequence identity to SEQ ID NO: 18. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 18). In other words, appropriate (functional) Vp domain CDR1 amino acid sequences may vary from the sequence shown in SEQ ID NO: 18 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO: 18. As stated above, functional variants of SEQ ID NO: 18 retain the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 44) when the CDR1 is part of TCR Vp domain.

[0217] In one example, the CDR1 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO: 18. In examples where the TCR Va domain CDR1 has the amino acid sequence of SEQ ID NO: 18, the CDR1 may be encoded by any appropriate nucleic acid sequence.

[0218] The encoded TCR Vp domain may also comprise, in addition to the specified CDR3 (and optionally the specified CDR1 above), a CDR2 having an amino acid sequence of SEQ ID NO: 19, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to HLA-B*07:02). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 19. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 19, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0219] Non-functional variants are amino acid sequence variants of SEQ ID NO: 19 that do not specifically bind to HLA-B*07:02. Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 19 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0220] For example, appropriate functional Vp domain CDR2 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 19, i.e. it may have at least 80%, at least 83%, or 100% sequence identity to SEQ ID NO: 19. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 19). In other words, appropriate (functional) Vp domain CDR2 amino acid sequences may vary from the sequence shown in SEQ ID NO: 19 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO: 19. As stated above, a functional variant of SEQ ID NO: 19 retains the ability to specifically bind to HLA-B*07:02. In one example, the CDR2 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO: 19. In examples where the TOR Vp domain CDR2 has the amino acid sequence of SEQ ID NO: 19, the CDR2 may be encoded by any appropriate nucleic acid sequence.

[0221] The encoded TOR Vp domain may therefore comprise the CDRs mentioned in detail above (by SEQ ID specifically i.e. SEQ ID NQ:20, SEQ ID NO: 18 and SEQ ID NO: 19, or functional variants thereof), with appropriate intervening sequences between the CDRs.

[0222] The encoded TCR Vp domain may have an amino acid sequence of SEQ ID NO: 23, or a functional variant thereof (i.e. wherein the variant TCR Vp domain retains the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 44) when part of a binding protein described herein). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 23. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 23, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0223] Non-functional variants are amino acid sequence variants of SEQ ID NO: 23 that do not specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 44). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO:23 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0224] In one example, the encoded TCR Vp domain may have an amino acid sequence having at least 75%, at least 80%, at least 85% or at least 90% (or at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 23, whilst retaining the ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 44). In other words, a functional TCR Vp domain with one or several amino acid substitutions compared to the sequence of SEQ ID NO: 23 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO:23 may all be in regions of the TCR Vp domain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 20, SEQ ID NO: 18 and / or SEQ ID NO: 19, and still have 25% (or less) sequence variability compared to SEQ ID NO: 23). In other words, the sequence of the CDRs of SEQ ID NO: 23 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 23).

[0225] As an example, the encoded TOR p domain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 23, wherein the TOR Vp domain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 20. In this example, the TCR Vp domain CDR1 may have an amino acid sequence of SEQ ID NO:18 and the TCR Vp domain CDR2 may have an amino acid sequence of SEQ ID NO: 19.

[0226] In examples where the TCR Vp domain has the amino acid sequence of SEQ ID NO:23, the TCR VP domain may be encoded by the nucleic acid sequence of SEQ ID NO:24, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).

[0227] For the avoidance of doubt, the nucleic acid sequence encoding the TCR p domain may also encode a TCR p chain constant domain. Examples of suitable constant domains are generally discussed above.

[0228] An example of a specific TCR p chain amino acid sequence that includes a TCR p domain described herein and an appropriate constant domain is shown in SEQ ID NO: 27. Appropriate functional variants of SEQ ID NO: 27 are also encompassed (e.g. variants having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 27, wherein the variant TCR p chain amino acid sequence retains its ability to specifically bind to a PRAME antigen (e.g. the peptide shown in SEQ ID NO: 44) when part of a binding protein described herein). In other words, a functional TCR p chain with one or several amino acid substitutions compared to the sequence of SEQ ID NO: 27 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO:27 may all be in regions of the TCR p chain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 20, SEQ ID NO: 18 and / or SEQ ID NO: 19, and still have 25% (or less) sequence variability compared to SEQ ID NO:27). In other words, the sequence of the CDRs of SEQ ID NO: 27 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 27). As an example, the encoded TCR p chain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 27, wherein the TCR chain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 20. In this example, the TCR p chain CDR1 may have an amino acid sequence of SEQ ID NO: 18 and the TCR p chain CDR2 may have an amino acid sequence of SEQ ID NO: 19.

[0229] In examples where the TCR p chain has the amino acid sequence of SEQ ID NO:27, the TCR p chain may be encoded by the nucleic acid sequence of SEQ ID NO:28, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code). It is noted that SEQ ID NO:28 is the nucleic acid sequence for TCR p chain of clone 8.10C4.

[0230] In an example, the nucleic acid composition provided herein comprises a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NQ:20, or a functional fragment thereof.

[0231] In another example, the CDR3 of the Vp domain of a nucleic acid composition provided herein comprises or consists of the amino acid sequence of SEQ ID NQ:20.

[0232] In a further example, the Vp domain of a nucleic acid composition provided herein comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 23.

[0233] The TCR Vp domain sequences derived from TCR clone 8.10C4 discussed above are particularly compatible with the TCR Va domain sequences derived from TCR clone 8.10C4 discussed elsewhere herein.

[0234] Accordingly, in one example, a nucleic acid composition described herein encodes a PRAME antigen-specific binding protein having TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 17, or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR p domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NQ:20, or a functional fragment thereof.

[0235] In a particular example, a nucleic acid composition described herein encodes a PRAME antigenspecific binding protein having a TCR Va domain with a CDR3 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 17; and a TCR Vp domain with a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO:20. In addition, the PRAME antigen may comprise or consist of the sequence shown in SEQ ID NO: 44. Furthermore, the TCR Va domain may be part of a TCR a chain having a constant domain and the TCR Vp domain may be part of a TCR chain having a constant domain.

[0236] In this particular example, the Va domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 21 ; and the p domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 23. In one example, the Va domain comprises the amino acid sequence of SEQ ID NO: 21 and the Vp domain comprises the amino acid sequence of SEQ ID NO: 23. In such cases, the Va domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 22; and the Vp domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 24.

[0237] In this particular example, the TCR Va domain may include a CDR1 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 15 and a CDR2 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO:16. Furthermore, the TCR Vp domain may include a CDR1 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 18 and a CDR2 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 19.

[0238] For the avoidance of doubt, this particular example encompasses components of TCR clone 8.10C4 exemplified herein. The different components of TCR clone 8.10C4 and their respective SEQ ID Nos are summarised in Table 5 below.

[0239] As stated in more detail elsewhere herein, the nucleic acid composition described herein encodes both a TCR Va domain and a TCR Vp domain, which form the binding protein that is capable of specifically binding to a cancer-associated antigen. In examples where the TCR Va domain and the TCR Vp domain are encoded by the same nucleic acid sequence, the TCR Va domain and TCR Vp domain may be joined together via a linker. Suitable linkers are discussed generally elsewhere herein. Additional appropriate polypeptide domains that may also be encoded by the nucleic acid sequences that encode the TCR Va domain and / or the TCR Vp domain are also discussed generally elsewhere herein.

[0240] In one example, the nucleic acid composition described herein may encode a soluble TCR or a chimeric single chain TCR wherein the TCR alpha chain variable domain is linked to the TCR beta chain variable domain and a constant domain which is e.g. fused to the CD3 zeta signalling domain. These are discussed generally in more detail elsewhere herein.

[0241] (iii) TCR components that interact with KLHGILVEA (SEQ ID NO: 45) from CTCFL

[0242] As provided elsewhere herein, the inventors have also identified TCR clone 39.2E12 (CTCFL p 752 A2 TCR) which interacts with KLHGILVEA (SEQ ID NO: 45) in the context of HLA-A*02:01. The sequences provided herein that correspond to TCR clone 39.2E12 are SEQ ID NO:s 29 to 42.

[0243] In one embodiment, an isolated nucleic acid composition that encodes a cancer-associated antigen-specific binding protein (i.e. a CTCFL antigen specific binding protein) having a TCR a chain variable (Va) domain and a TCR p chain variable (VP) domain is provided, the composition comprising: a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:31 , or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:34, or a functional fragment thereof, wherein the CDR3 sequences together specifically bind to CTCFL.

[0244] An example of an appropriate TCR Va domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, particularly a CTCFL antigen (e.g. to KLHGILVEA (SEQ ID NO: 45), is shown in SEQ ID NO:31. As would be clear to a person of skill in the art, variants of the amino acid sequence shown in SEQ ID NO:31 may also be functional (i.e. retain their ability to confer specific binding to a CTCFL antigen (e.g. to the peptide KLHGILVEA (SEQ ID NO: 45) when the CDR3 is part of TCR Va domain). Such functional variants are therefore encompassed herein.

[0245] For example, appropriate (functional) Va domain CDR3 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 31 , i.e. they may have at least 80%, at least 85%, at least 92%, or 100% sequence identity to SEQ ID NO: 31. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO:31). In other words, appropriate (functional) Va domain CDR3 amino acid sequences may vary from the sequence shown in SEQ ID NO:31 by one or several (e.g. two etc) amino acids.

[0246] As stated above, functional variants of SEQ ID NO: 31 retain their ability to confer specific binding to a CTCFL antigen (i.e. the peptide shown in SEQ ID NO: 45) when the CDR3 is part of TCR Va domain. Functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 31. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one, two or more amino acids of SEQ ID NO: 31 , or substitution, deletion or insertion of non-critical amino acids in non- critical regions of the CDR3.

[0247] Non-functional variants are amino acid sequence variants of SEQ ID NO: 31 that do not specifically bind to a CTCFL antigen (i.e. the peptide shown in SEQ ID NO: 45). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 31 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0248] In one example, the CDR3 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO: 31. In examples where the TCR Va domain CDR3 has the amino acid sequence of SEQ ID NO: 31 , the CDR3 may be encoded by any appropriate nucleic acid sequence.

[0249] The encoded TCR Va domain may comprise, in addition to the specified CDR3, a CDR1 comprising an amino acid sequence of SEQ ID NO: 29, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45)). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 29. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 29, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0250] Non-functional variants are amino acid sequence variants of SEQ ID NO: 29 that do not specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 29 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0251] For example, appropriate functional Va domain CDR1 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 29, i.e. it may have at least 80%, at least 85%, or 100% sequence identity to SEQ ID NO: 29. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 29). In other words, appropriate functional Va domain CDR1 amino acid sequences may vary from the sequence shown in SEQ ID NO: 29 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO: 29. As stated above, functional variants of SEQ ID NO: 29 retain the ability to specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45) when the CDR1 is part of TCR Va domain.

[0252] In one example, the CDR1 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO: 29. In examples where the TCR Va domain CDR1 has the amino acid sequence of SEQ ID NO: 29, the CDR1 may be encoded by any appropriate nucleic acid sequence.

[0253] The encoded TCR Va domain may also comprise, in addition to the specified CDR3 (and optionally the specified CDR1 above), a CDR2 comprising an amino acid sequence of SEQ ID NO: 30, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to HI_A-A*02:01). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 30. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 30, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0254] Non-functional variants are amino acid sequence variants of SEQ ID NO: 30 that do not specifically bind to HLA-A*02:01. Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 30 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0255] For example, appropriate functional Va domain CDR2 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 30, i.e. it may have at least 80%, or 100% sequence identity to SEQ ID NO: 30. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NQ:30). In other words, appropriate (functional) Va domain CDR2 amino acid sequences may vary from the sequence shown in SEQ ID NQ:30 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO: 30. As stated above, a functional variant of SEQ ID NO: 30 retains the ability to specifically bind to HLA-A*02:01. In one example, the CDR2 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO: 30. In examples where the TOR Va domain CDR2 has the amino acid sequence of SEQ ID NO:30, the CDR2 may be encoded by any appropriate nucleic acid sequence.

[0256] The encoded TOR Va domain may therefore comprise the CDRs mentioned in detail above (by SEQ ID specifically i.e. SEQ ID NO: 31 , SEQ ID NO: 29 and SEQ ID NO: 30, or functional variants thereof), with appropriate intervening sequences between the CDRs.

[0257] The encoded TCR Va domain may comprise an amino acid sequence of SEQ ID NO: 35, or a functional variant thereof (i.e. wherein the variant TCR Va domain retains the ability to specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45) when part of a binding protein described herein). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 35. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 35, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0258] Non-functional variants are amino acid sequence variants of SEQ ID NO: 35 that do not specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 35 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0259] In one example, the encoded TCR Va domain may have an amino acid sequence having at least 75%, at least 80%, at least 85% or at least 90% (or at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 35, whilst retaining the ability to specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45). In other words, a functional TCR Va domain with one or several amino acid substitutions compared to the sequence of SEQ ID NO: 35 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO: 35 may all be in regions of the TCR Va domain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 31 , SEQ ID NO: 29 and / or SEQ ID NO: 30, and still have 25% (or less) sequence variability compared to SEQ ID NO: 35). In other words, the sequence of the CDRs of SEQ ID NO: 35 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 35).

[0260] As an example, the encoded TOR Va domain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 35, wherein the TOR Va domain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 31. In this example, the TCR Va domain CDR1 may have an amino acid sequence of SEQ ID NO: 29 and the TCR Va domain CDR2 may have an amino acid sequence of SEQ ID NO: 30.

[0261] As another example, the encoded TCR Va domain may comprise an amino acid sequence having the amino acid sequence of SEQ ID NO: 35, with 0 to 10 (or 0 to 5) amino acid substitutions, insertions or deletions, wherein the TCR Va domain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 31. In this example, the TCR Va domain CDR1 may have an amino acid sequence of SEQ ID NO: 29 and the TCR Va domain CDR2 may have an amino acid sequence of SEQ ID NO: 30.

[0262] In examples where the TCR Va domain has the amino acid sequence of SEQ ID NO: 35, the TCR Va domain may be encoded by the nucleic acid sequence of SEQ ID NO: 36, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).

[0263] For the avoidance of doubt, the nucleic acid sequence encoding the TCR Va domain may also encode a TCR a chain constant domain. Examples of suitable constant domains are generally discussed above.

[0264] An example of a specific TCR a chain amino acid sequence that includes a TCR Va domain described herein with an appropriate constant domain is shown in SEQ ID NO: 39. Appropriate functional variants of SEQ ID NO: 39 are also encompassed (e.g. variants having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 39, wherein the variant TCR a chain amino acid sequence retains its ability to specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45) when part of a binding protein described herein). In other words, a functional TCR a chain with one or several amino acid substitutions compared to the sequence of SEQ ID NO: 39 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO: 39 may all be in regions of the TCR a chain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 31 , SEQ ID NO: 29 and / or SEQ ID NO: 30, and still have 25% (or less) sequence variability compared to SEQ ID NO: 39). In other words, the sequence of the CDRs of SEQ ID NO: 39 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 39).

[0265] As an example, the encoded TOR a chain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 39, wherein the TOR a chain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 31 . In this example, the TOR a chain CDR1 may have an amino acid sequence of SEQ ID NO: 29 and the TOR a chain CDR2 may have an amino acid sequence of SEQ ID NO: 30.

[0266] In examples where the TOR a chain has the amino acid sequence of SEQ ID NO: 39, the TOR a chain may be encoded by the nucleic acid sequence of SEQ ID NO: 40, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code). It is noted that SEQ ID NQ:40 is the nucleic acid sequence for TOR a chain of clone 39.2E12.

[0267] In one example, the nucleic acid composition provided herein comprises a nucleic acid sequence that encodes a TOR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:31 , or a functional fragment thereof.

[0268] In another example, the CDR3 of the Va domain of a nucleic acid composition provided herein comprises or consists of the amino acid sequence of SEQ ID NO: 31.

[0269] In another example, the Va domain of a nucleic acid composition provided herein comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 35.

[0270] As provided above, the inventors identified TCR clone 39.2E12 which interacts with KLHGILVEA (SEQ ID NO: 45) in the context of HI_A-A*02:01. The sequences provided herein that correspond to TCR clone 39.2E12 are SEQ ID NO:s 29 to 42.

[0271] An example of an appropriate TCR Vp domain CDR3 amino acid sequence that confers specific binding to a cancer-associated antigen, in particular a CTCFL antigen (e.g. to KLHGILVEA (SEQ ID NO: 45), is shown in SEQ ID NO:34. As would be clear to a person of skill in the art, variants of the amino acid sequence shown in SEQ ID NO:34 may also be functional (i.e. retain their ability to confer specific binding to a CTCFL antigen (i.e. the peptide shown in SEQ ID NO: 45) when the CDR3 is part of TCR Vp domain). Such functional variants are therefore encompassed herein.

[0272] For example, appropriate (functional) Vp domain CDR3 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 34, i.e. they may have at least 80%, at least 86%, at least 93%, or 100% sequence identity to SEQ ID NO: 34. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 34). In other words, appropriate (functional) Vp domain CDR3 amino acid sequences may vary from the sequence shown in SEQ ID NO: 34 by one or several (e.g. two) amino acids. As stated above, functional variants of SEQ ID NO: 34 retain their ability to confer specific binding to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45) when the CDR3 is part of TCR Vp domain.

[0273] Functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 34. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 34, or substitution, deletion or insertion of non-critical amino acids in non- critical regions of the CDR3.

[0274] Non-functional variants are amino acid sequence variants of SEQ ID NO: 34 that do not specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 34 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0275] In one example, the CDR3 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO: 34. In examples where the TCR Vp domain CDR3 has the amino acid sequence of SEQ ID NO:34, the CDR3 may be encoded by any appropriate nucleic acid sequence.

[0276] The encoded TCR Vp domain may comprise, in addition to the specified CDR3, a CDR1 comprising an amino acid sequence of SEQ ID NO: 32, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45)). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 32. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 32, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0277] Non-functional variants are amino acid sequence variants of SEQ ID NO: 32 that do not specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 32 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0278] For example, appropriate functional Vp domain CDR1 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 32, i.e. it may have at least 80%, or 100% sequence identity to SEQ ID NO: 32. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 32). In other words, appropriate (functional) Vp domain CDR1 amino acid sequences may vary from the sequence shown in SEQ ID NO:32 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO:32. As stated above, functional variants of SEQ ID NO: 32 retain the ability to specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45) when the CDR1 is part of TCR Vp domain.

[0279] In one example, the CDR1 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO: 32. In examples where the TCR Vp domain CDR1 has the amino acid sequence of SEQ ID NO:32, the CDR1 may be encoded by any appropriate nucleic acid sequence.

[0280] The encoded TCR Vp domain may also comprise, in addition to the specified CDR3 (and optionally the specified CDR1 above), a CDR2 having an amino acid sequence of SEQ ID NO: 33, or a functional variant thereof (i.e. wherein the variant retains the ability to specifically bind to HLA-A*02:01). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 33. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 33, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0281] Non-functional variants are amino acid sequence variants of SEQ ID NO: 33 that do not specifically bind to HLA-A*02:01. Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO: 33 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art.

[0282] For example, appropriate functional Vp domain CDR2 amino acid sequences may have at least 80% sequence identity to SEQ ID NO: 33, i.e. it may have at least 80%, at least 83%, or 100% sequence identity to SEQ ID NO: 33. Suitably, percent identity is calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 33). In other words, appropriate (functional) Vp domain CDR2 amino acid sequences may vary from the sequence shown in SEQ ID NO: 33 by one or several amino acids. As stated previously, the variant may comprise an amino acid substitution such as a conservative amino acid substitution compared to the sequence shown in SEQ ID NO: 33. As stated above, a functional variant of SEQ ID NO: 33 retains the ability to specifically bind to HLA-A*02:01.

[0283] In one example, the CDR2 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO: 33. In examples where the TOR Vp domain CDR2 has the amino acid sequence of SEQ ID NO:33, the CDR2 may be encoded by any appropriate nucleic acid sequence.

[0284] The encoded TOR Vp domain may therefore comprise the CDRs mentioned in detail above (by SEQ ID specifically i.e. SEQ ID NO:34, SEQ ID NO: 32 and SEQ ID NO: 33, or functional variants thereof), with appropriate intervening sequences between the CDRs.

[0285] The encoded TOR Vp domain may have an amino acid sequence of SEQ ID NO: 37, or a functional variant thereof (i.e. wherein the variant TOR Vp domain retains the ability to specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45) when part of a binding protein described herein). Such functional variants may be naturally occurring, synthetic, or synthetically improved functional variants of SEQ ID NO: 37. The term “variant” also encompasses homologues and fragments. Functional variants will typically contain only conservative substitutions of one or more amino acids of SEQ ID NO: 37, or substitution, deletion or insertion of non-critical amino acids in non-critical regions of the protein.

[0286] Non-functional variants are amino acid sequence variants of SEQ ID NO: 37 that do not specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45). Non-functional variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO:37 or a substitution, insertion or deletion in critical amino acids or critical regions. Methods for identifying functional and non-functional variants are well known to a person of ordinary skill in the art. In one example, the encoded TCR p domain may have an amino acid sequence having at least 75%, at least 80%, at least 85% or at least 90% (or at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the amino acid sequence of SEQ ID NO: 37, whilst retaining the ability to specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45). In other words, a functional TCR Vp domain with one or several amino acid substitutions compared to the sequence of SEQ ID NO: 37 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO:37 may all be in regions of the TCR Vp domain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 34, SEQ ID NO: 32 and / or SEQ ID NO: 33, and still have 25% (or less) sequence variability compared to SEQ ID NO: 37). In other words, the sequence of the CDRs of SEQ ID NO: 37 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 37).

[0287] As an example, the encoded TCR Vp domain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 37, wherein the TCR Vp domain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 34. In this example, the TCR Vp domain CDR1 may have an amino acid sequence of SEQ ID NO:32 and the TCR Vp domain CDR2 may have an amino acid sequence of SEQ ID NO: 33.

[0288] In examples where the TCR Vp domain has the amino acid sequence of SEQ ID NO:37, the TCR VP domain may be encoded by the nucleic acid sequence of SEQ ID NO:38, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code).

[0289] For the avoidance of doubt, the nucleic acid sequence encoding the TCR p domain may also encode a TCR p chain constant domain. Examples of suitable constant domains are generally discussed above.

[0290] An example of a specific TCR p chain amino acid sequence that includes a TCR p domain described herein and an appropriate constant domain is shown in SEQ ID NO: 41. Appropriate functional variants of SEQ ID NO: 41 are also encompassed (e.g. variants having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 41 , wherein the variant TCR p chain amino acid sequence retains its ability to specifically bind to a CTCFL antigen (e.g. the peptide shown in SEQ ID NO: 45) when part of a binding protein described herein). In other words, a functional TOR p chain with one or several amino acid substitutions compared to the sequence of SEQ ID NO: 41 is also encompassed. As stated previously, the amino acid substitution may be a conservative amino acid substitution. The variability in sequence compared to SEQ ID NO:41 may all be in regions of the TCR chain that do not form CDRs (i.e. the variant may have the CDRs of SEQ ID NO: 34, SEQ ID NO: 32 and / or SEQ ID NO: 33, and still have 25% (or less) sequence variability compared to SEQ ID NO:41). In other words, the sequence of the CDRs of SEQ ID NO: 41 may be retained whilst the rest of the sequence is varied, as appropriate within the “at least 75% identity” parameters specified above. Suitably, percent identity can be calculated as the percentage of identity to the entire length of the reference sequence (e.g. SEQ ID NO: 41).

[0291] As an example, the encoded TCR p chain may comprise an amino acid sequence having at least 75% (e.g. at least 75%, at least 80%, at least 85%, at least 90%, at least 95% etc) sequence identity to the amino acid sequence of SEQ ID NO: 41 , wherein the TCR p chain comprises a CDR3 having an amino acid sequence of SEQ ID NO: 34. In this example, the TCR p chain CDR1 may have an amino acid sequence of SEQ ID NO: 32 and the TCR p chain CDR2 may have an amino acid sequence of SEQ ID NO: 33.

[0292] In examples where the TCR p chain has the amino acid sequence of SEQ ID NO:41 , the TCR p chain may be encoded by the nucleic acid sequence of SEQ ID NO: 42, or a genetically degenerate sequence thereof (i.e. other nucleic acid sequences that encode the same protein as a result of the degeneracy of the genetic code). It is noted that SEQ ID NO:42 is the nucleic acid sequence for TCR p chain of clone 39.2E12.

[0293] In an example, the nucleic acid composition provided herein comprises a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:34, or a functional fragment thereof.

[0294] In another example, the CDR3 of the Vp domain of a nucleic acid composition provided herein comprises or consists of the amino acid sequence of SEQ ID NO:34.

[0295] In a further example, the Vp domain of a nucleic acid composition provided herein comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 37. The TCR Vp domain sequences derived from TCR clone 39.2E12 discussed above are particularly compatible with the TCR Va domain sequences derived from TCR clone 39.2E12 discussed elsewhere herein.

[0296] Accordingly, in one example, a nucleic acid composition described herein encodes a CTCFL antigen-specific binding protein having TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:31 , or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR p domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:34, or a functional fragment thereof.

[0297] In a particular example, a nucleic acid composition described herein encodes a CTCFL antigenspecific binding protein having a TCR Va domain with a CDR3 amino acid sequence comprising or consisting of the amino acid sequence of SEQ I D NO: 31 ; and a TCR Vp domain with a CDR3 comprising or consisting of the amino acid sequence of SEQ ID NO:34. In addition, the CTCFL antigen may comprise or consist of the sequence shown in SEQ ID NO: 45. Furthermore, the TCR Va domain may be part of a TCR a chain having a constant domain and the TCR Vp domain may be part of a TCR p chain having a constant domain.

[0298] In this particular example, the Va domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 35; and the Vp domain may comprise an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 37. In one example, the Va domain comprises the amino acid sequence of SEQ ID NO: 35 and the Vp domain comprises the amino acid sequence of SEQ ID NO: 37. In such cases, the Va domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 36; and the Vp domain may be encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 38.

[0299] In this particular example, the TCR Va domain may include a CDR1 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 29 and a CDR2 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NQ:30. Furthermore, the TCR Vp domain may include a CDR1 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO:32 and a CDR2 amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 33.

[0300] For the avoidance of doubt, this particular example encompasses components of TCR clone 39.2E12 exemplified herein. The different components of TCR clone 39.2E12 and their respective SEQ ID Nos are summarised in Table 6 below. As stated in more detail elsewhere herein, the nucleic acid composition described herein encodes both a TCR Va domain and a TCR Vp domain, which form the binding protein that is capable of specifically binding to a cancer-associated antigen. In examples where the TCR Va domain and the TCR p domain are encoded by the same nucleic acid sequence, the TCR Va domain and TCR Vp domain may be joined together via a linker. Suitable linkers are discussed generally elsewhere herein. Additional appropriate polypeptide domains that may also be encoded by the nucleic acid sequences that encode the TCR Va domain and / or the TCR Vp domain are also discussed generally elsewhere herein.

[0301] In one example, the nucleic acid composition described herein may encode a soluble TCR or a chimeric single chain TCR wherein the TCR alpha chain variable domain is linked to the TCR beta chain variable domain and a constant domain which is e.g. fused to the CD3 zeta signalling domain. These are discussed generally in more detail elsewhere herein.

[0302] Vector systems

[0303] A vector system is also provided which includes a nucleic acid composition described herein. The vector system may have one or more vectors. As discussed previously, the binding protein components that are encoded by the nucleic acid composition may be encoded by one or more nucleic acid sequences in the nucleic acid composition. In examples where all of the binding protein components are encoded by a single nucleic acid sequence, the nucleic acid sequence may be present within a single vector (and thus the vector system described herein may comprise of one vector only). In examples where the binding protein components are encoded by two or more nucleic acid sequences (wherein the plurality of nucleic acid sequences, together, encode all of the components of the binding protein) these two or more nucleic acid sequences may be present within one vector (e.g. in different open reading frames of the vector), or may be distributed over two or more vectors. In this example, the vector system will comprise a plurality of distinct vectors (i.e. vectors with different nucleotide sequences).

[0304] Accordingly, in one example, a vector system is provided, comprising a nucleic acid composition described herein.

[0305] Any appropriate vector can be used. By way of example only, the vector may be a plasmid, a cosmid, or a viral vector, such as a retroviral vector or a lentiviral vector. Adenovirus, adeno- associated virus, vaccinia virus, canary poxvirus, herpes virus, minicircle vectors and naked (synthetic) DNA / RNA may also be used (for details on minicircle vectors, see for example non- viral Sleeping Beauty transposition from minicircle vectors as published by R Monjezi et al., Leukemia 2017). Alternatively, single stranded or double stranded DNA or RNA can be used to transfect lymphocytes with a TCR of interest (see Roth et al 2018 Nature vol 559; page 405).

[0306] In one example, the vector is a plasmid, a viral vector, or a cosmid, optionally wherein the vector is selected from the group consisting of a retrovirus, lentivirus, adeno-associated virus, adenovirus, vaccinia virus, canary poxvirus, herpes virus, minicircle vector and synthetic DNA or RNA.

[0307] As used herein, the term “vector” refers to a nucleic acid sequence capable of transporting another nucleic acid sequence to which it has been operably linked. The vector can be capable of autonomous replication or it can integrate into a host DNA. The vector may include restriction enzyme sites for insertion of recombinant DNA and may include one or more selectable markers or suicide genes. The vector can be a nucleic acid sequence in the form of a plasmid, a bacteriophage or a cosmid. Preferably the vector is suitable for expression in a cell (i.e. the vector is an “expression vector”). Preferably, the vector is suitable for expression in a human T cell such as a CD8+T cell or CD4+T cell, or stem cell, iPS cell, or NK cell. In certain aspects, the vector is a viral vector, such as a retroviral vector, a lentiviral vector or an adeno-associated vector. Optionally, the vector is selected from the group consisting of an adenovirus, vaccinia virus, canary poxvirus, herpes virus, minicircle vector and synthetic DNA or synthetic RNA.

[0308] Preferably the (expression) vector is capable of propagation in a host cell and is stably transmitted to future generations.

[0309] The vector may comprise regulatory sequences. "Regulatory sequences" as used herein, refers to, DNA or RNA elements that are capable of controlling gene expression. Examples of expression control sequences include promoters, enhancers, silencers, TATA- boxes, internal ribosomal entry sites (IRES), attachment sites for transcription factors, transcriptional terminators, polyadenylation sites etc. Optionally, the vector includes one or more regulatory sequences operatively linked to the nucleic acid sequence to be expressed. Regulatory sequences include those which direct constitutive expression, as well as tissue-specific regulatory and / or inducible sequences.

[0310] Optionally, the vector comprises the nucleic acid sequence of interest operably linked to a promoter. "Promoter", as used herein, refers to the nucleotide sequences in DNA to which RNA polymerase binds to start transcription. The promoter may be inducible or constitutively expressed. Alternatively, the promoter is under the control of a repressor or stimulatory protein. The promoter may be one that is not naturally found in the host cell (e.g. it may be an exogenous promoter). The skilled person in the art is well aware of appropriate promoters for use in the expression of target proteins, wherein the selected promoter will depend on the host cell.

[0311] "Operably linked" refers to a single or a combination of the below-described control elements together with a coding sequence in a functional relationship with one another, for example, in a linked relationship so as to direct expression of the coding sequence.

[0312] The vector may comprise a transcriptional terminator. “T ranscriptional terminator” as used herein, refers to a DNA element, which terminates the function of RNA polymerases responsible for transcribing DNA into RNA. Preferred transcriptional terminators are characterized by a run of T residues preceded by a GC rich dyad symmetrical region.

[0313] The vector may comprise a translational control element. “Translational control element”, as used herein, refers to DNA or RNA elements that control the translation of mRNA. Preferred translational control elements are ribosome binding sites. Preferably, the translational control element is from the same (homologous) system as the promoter, for example a promoter and its associated ribozyme binding site. Preferred ribosome binding sites are known, and will depend on the chosen host cell.

[0314] The vector may comprise restriction enzyme recognition sites. "Restriction enzyme recognition site" as used herein, refers to a motif on the DNA recognized by a restriction enzyme.

[0315] The vector may comprise a selectable marker. "Selectable marker" as used herein, refers to proteins that, when expressed in a host cell, confer a phenotype onto the cell which allows selection of the cell expressing said selectable marker gene. Generally this may be a protein that confers a new beneficial property onto the host cell (e.g. antibiotic resistance) or a protein that is expressed on the cell surface and thus accessible for antibody binding. Appropriate selectable markers are well known in the art.

[0316] Optionally, the vector may also comprise a suicide gene. A “suicide gene” as used herein, encodes a protein that induces death of a modified cell upon treatment with specific drugs. By way of example, suicide can be induced in cells modified by the herpes simplex virus thymidine kinase gene upon treatment with specific nucleoside analogs including ganciclovir, cells modified by human CD20 upon treatment with anti-CD20 monoclonal antibody and cells modified with inducible Caspase9 (iCasp9) upon treatment with AP1903 (reviewed by BS Jones, LS Lamb, F Goldman, A Di Stasi; Improving the safety of cell therapy products by suicide gene transfer. Front Pharmacol. (2014) 5:254). Appropriate suicide genes are well known in the art. Preferably the vector comprises those genetic elements which are necessary for expression of the binding proteins described herein by a host cell. The elements required for transcription and translation in the host cell include a promoter, a coding region for the protein(s) of interest, and a transcriptional terminator.

[0317] A person of skill in the art will be well aware of the molecular techniques available for the preparation of (expression) vectors and how the (expression) vectors may be transduced or transfected into an appropriate host cell (thereby generating a modified cell described further below). The (expression) vector system described herein can be introduced into cells by conventional techniques such as transformation, transfection or transduction. “Transformation”, “transfection” and “transduction” refer generally to techniques for introducing foreign (exogenous) nucleic acid sequences into a host cell, and therefore encompass methods such as electroporation, microinjection, gene gun delivery, transduction with retroviral, lentiviral or adeno- associated vectors, lipofection, superfection etc. The specific method used typically depends on both the type of vector and the cell. Appropriate methods for introducing nucleic acid sequences and vectors into host cells such as human cells are well known in the art; see for example Sambrook et al (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y; Ausubel et al (1987) Current Protocols in Molecular Biology, John Wiley and Sons, Inc., NY; Cohen et al (1972) Proc. Natl. Acad. Sci. USA 69, 2110; Luchansky et al (1988) Mol. Microbiol. 2, 637-646. Further conventional methods that are suitable for preparing expression vectors and introducing them into appropriate host cells are described in detail in WO2016 / 071758 for example.

[0318] It is understood that it some examples, the host cell is contacted with the vector system (e.g. viral vector) in vitro, ex vivo, and in some examples, the host cell is contacted with the vector system (e.g. viral vector) in vivo.

[0319] The term "host cell" includes any cell into which the nucleic acid composition or vector system described herein may be introduced. Once a nucleic acid molecule or vector system has been introduced into the cell, it may be referred to as a “modified cell” herein. Once the nucleic acid molecule or vector is introduced into the host cell, the resultant modified cell should be capable of expressing the encoded binding protein (and e.g. correctly localising the encoded binding protein for its intended function e.g. transporting the encoded binding protein to the cell surface).

[0320] The nucleic acid composition or vector system may be introduced into the cell using any conventional method known in the art. For example, the nucleic acid composition or vector system may be introduced using CRISPR technology. Insertion of the nucleic acid sequences at the endogenous TCR locus by engineering with CRISPR / Cas9 and homologous directed repair (HDR) or non-homologous end joining (NHEJ) is therefore encompassed. Other conventional methods such as transfection, transduction or transformation of the cell may also be used.

[0321] The term “modified cell” refers to a genetically altered (e.g. recombinant) cell. The modified cell includes at least one exogenous nucleic acid sequence (i.e. a nucleic acid sequence that is not naturally found in the host cell). In the context of the invention, the exogenous sequence may comprise at least one of the T cell receptor component parts described herein for any of clones 16.3C1 , 8.10C4 or 39.2E12 (e.g. the sequences etc that encode the CDR3 sequences that are specific for a cancer-associated antigen (e.g. PRAME or CTCFL, e.g. the peptide of SEQ ID NO: 43 to 45)). The term “modified cell” refers to the particular subject cell and also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

[0322] In one example, a modified cell comprises a nucleic acid composition or a vector system provided herein.

[0323] The host cell (and thus the modified cell) is typically a eukaryotic cell, and particularly a human cell (e.g. a T cell such as a CD8+T cell or a CD4+T cell, or a mixture thereof, or a hematopoietic stem cell, an iPSC, or gamma-delta T cell, or a pluripotent stem cell, or a NK-T cell or NK cell). The host cell (and thus the modified cell) may be an autologous or allogeneic cell (e.g. such as a CD8+T cell or a CD4+T cell, or a mixture thereof, or a hematopoietic stem cell, an iPSC, or gamma-delta T cell, or a pluripotent stem cell, or a NK-T cell or NK cell). “Allogeneic cell” refers to a cell derived from a different individual to the individual to which it is later administered. In other words, the host cell (and thus the modified cell) may be an isolated cell from a distinct individual compared to the subject to be treated. “Autologous cell” refers to a cell derived from the individual to which it is also later administered. In other words, the host cell (and thus the modified cell) may be an isolated cell from the subject that is to be treated.

[0324] Accordingly, in an example, the modified cell is a human cell.

[0325] The host cell (and thus the modified cell) may be any cell that is able to confer anti-tumour immunity after TCR gene transfer. Non limiting examples of appropriate cells include autologous or allogeneic CD8 T cells, CD4 T cells, Natural Killer (NK) cells, NKT cells, gamma-delta T cells, inducible pluripotent stem cells (iPSCs), hematopoietic stem cells or other progenitor cells and any other autologous or allogeneic cell or cell line (NK-92 for example or T cell lines) that is able to confer anti-tumor immunity after TCR gene transfer.

[0326] Accordingly, in one example the modified cell is selected from the group consisting of a CD8 T cell, a CD4 T cell, an NK cell, an NK-T cell, a gamma-delta T cell, a hematopoietic stem cell, an inducible pluripotent stem cell, a progenitor cell, a T cell line and a NK-92 cell line.

[0327] In the context of the methods of treatment described herein, the host cell (and thus the modified cell) is typically for administration to a HLA-A*24:02, HI_A-B*07:02 or HLA-A*02:01 positive human subject, however other suitable subjects are described elsewhere herein. In view of this, the host cell (and thus the modified cell) is typically HI_A-A*24:02, HLA-B*07:02 or HLA- A*02:01 positive but needs to be cancer-associated antigen (e.g. PRAME or CTCFL) negative (i.e. modified cells can either be HI_A-A*24:02, HLA-B*07:02 or HI_A-A*02:01 positive or negative).

[0328] In the context of the methods of treatment described herein, the host cell (and thus the modified cell) that is to be administered to the subject can either be autologous or allogeneic.

[0329] Advantageously, the modified cell is capable of expressing the binding protein encoded by the nucleic acid composition or vector system described herein (i.e. the TCR component parts) such that the modified cell provides an immunotherapy that specifically targets cells that express a cancer-associated antigen (e.g. PRAME or CTCFL), and thus can be used to treat or prevent PRAME or CTCFL associated diseases or conditions in a corresponding HLA-A*24:02, HLA- B*07:02 or HLA-A*02:01 positive human subject. More details on this use are given below.

[0330] Pharmaceutical compositions

[0331] A nucleic acid composition, vector system, modified cell, or isolated nucleic acid sequence described herein may be provided as part of a pharmaceutical composition. Advantageously, such compositions may be administered to a human subject in need thereof (as described elsewhere herein). A particularly suitable composition may be selected based on the HLA serotype of the human subject, as described in detail elsewhere herein.

[0332] A pharmaceutical composition may comprise a nucleic acid composition, vector system, modified cell, or isolated nucleic acid sequence described herein along with a pharmaceutically acceptable excipient, adjuvant, diluent and / or carrier. Compositions may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines and optionally other therapeutic agents or compounds.

[0333] As used herein, "pharmaceutically acceptable" refers to a material that is not biologically or otherwise undesirable, i.e., the material may be administered to an individual along with the selected nucleic acid composition, vector system, modified cell, or isolated nucleic acid sequence without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.

[0334] Excipients are natural or synthetic substances formulated alongside an active ingredient (e.g. a nucleic acid sequence, a nucleic acid composition, vector or vector system, modified cell, or isolated nucleic acid as provided herein), included for the purpose of bulking-up the formulation or to confer a therapeutic enhancement on the active ingredient in the final dosage form, such as facilitating drug absorption or solubility. Excipients can also be useful in the manufacturing process, to aid in the handling of the active substance concerned such as by facilitating powder flowability or non-stick properties, in addition to aiding in vitro stability such as prevention of denaturation over the expected shelf life. Pharmaceutically acceptable excipients are well known in the art. A suitable excipient is therefore easily identifiable by one of ordinary skill in the art. By way of example, suitable pharmaceutically acceptable excipients include water, saline, aqueous dextrose, glycerol, ethanol, and the like.

[0335] Adjuvants are pharmacological and / or immunological agents that modify the effect of other agents in a formulation. Pharmaceutically acceptable adjuvants are well known in the art. A suitable adjuvant is therefore easily identifiable by one of ordinary skill in the art.

[0336] Diluents are diluting agents. Pharmaceutically acceptable diluents are well known in the art. A suitable diluent is therefore easily identifiable by one of ordinary skill in the art.

[0337] Carriers are non-toxic to recipients at the dosages and concentrations employed and are compatible with other ingredients of the formulation. The term “carrier” denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. Pharmaceutically acceptable carriers are well known in the art. A suitable carrier is therefore easily identifiable by one of ordinary skill in the art.

[0338] Treatment of a subject Pharmaceutical compositions described herein may advantageously be administered to a HLA- A*24:02, HI_A-B*07:02 or HLA-A*02:01 positive human subject in need thereof (where certain compositions are more suitable for certain human subjects, based on their HLA status, as described in more detail elsewhere herein).

[0339] Typically, the subject in need of treatment has a disease or condition that is associated with an elevated level of HI_A-restricted cancer associated- antigens (i.e. cancer-associated antigens that are presented at the cell surface in the context of an H LA). For example, PRAME and / or CTCFL antigens that are presented at the cell surface in the context of an HLA. Accordingly, in some examples, the subject in need of treatment has a disease or condition that is associated with an elevated level of HLA- restricted PRAME antigen or an elevated level of H LA-restricted CTCFL antigen. Accordingly, in some examples, the subject in need of treatment has a disease or condition that is associated with an elevated level of H LA-restricted PRAME antigen. Accordingly, in some examples, the subject in need of treatment has a disease or condition that is associated with an elevated level of H LA-restricted CTCFL antigen.

[0340] The disease or condition is typically a PRAME associated disease or condition or a CTCFL associated disease or condition, however other examples of diseases or conditions are described elsewhere herein. In a particular example, the disease or condition is a PRAME associated disease or condition. In another example, the disease or condition is a CTCFL associated disease or condition. In one example, the PRAME associated disease or condition or the CTCFL associated disease or condition may be a hyperproliferative disease or condition. The PRAME associated disease or condition or the CTCFL associated disease or condition (e.g. the hyperproliferative disease or condition) is typically one in which a H LA-restricted cancer- associated antigen described herein is presented at the cell surface in the context of a HLA, e.g. a PRAME or a CTCFL antigen presented at the cell surface in the context of an HLA.

[0341] In one example, the PRAME associated disease or condition or the CTCFL associated disease or condition may be a hematological malignancy. In other words, it may be a hematological malignancy with an elevated level of H LA-restricted cancer-associated antigens (i.e. cancer- associated antigens that are presented at the cell surface in the context of a HLA, e.g. PRAME and / or CTCFL antigens that are presented at the cell surface in the context of an HLA). For example, it may be a hematological malignancy with an elevated level of H LA-restricted PRAME antigens or it may be a hematological malignancy with an elevated level of H LA-restricted CTCFL antigens. Examples of appropriate hematological malignancies are well known in the art, and include, for example Multiple myeloma, plasma cell leukemia, Acute lymphoblastoid leukemia (ALL), Acute myeloid leukemia (AML), and B cell lymphoma. Examples of B cell lymphomas include Diffuse large B cell lymphoma (DLBCL), High grade B cell lymphoma, Mantel cell lymphoma (MCL), Follicular lymphoma (FL) and Burkitt Lymphoma.

[0342] In an alternative example, the PRAME associated disease or condition or the CTCFL associated disease or condition may be a solid tumor. In other words, it may be a solid tumor with an elevated level of H LA-restricted cancer-associated antigens (i.e. cancer-associated antigens that are presented at the cell surface in the context of an HLA, e.g. PRAME and / or CTCFL antigens that are presented at the cell surface in the context of an HLA). For example, it may be a solid tumor with an elevated level of HLA- restricted PRAME antigens or it may be a solid tumor with an elevated level of HLA- restricted CTCFL antigens. Examples of appropriate solid tumours are well known in the art, and include, for example Melanoma, Uveal melanoma, Ovarian Carcinoma, Uterine carcinoma, Testicular tumors, Lung carcinoma, Lung squamous cell carcinoma, Thymoma , Synovial sarcoma, Kidney carcinoma, Breast carcinoma, Sarcoma, Bladder carcinoma, Mesothelioma, Pancreatic carcinoma, Prostate carcinoma, Colorectal carcinoma, Cervical carcinoma and Stomach carcinoma.

[0343] The PRAME associated disease or condition or the CTCFL associated disease or condition may be a hyperproliferative disease or condition. For example, the PRAME associated disease or condition or the CTCFL associated disease or condition may be a HLA- restricted PRAME or H LA- restricted CTCFL antigen expressing tumor or cancer. For example, the PRAME associated disease or condition may be a H LA-restricted PRAME antigen expressing tumor or cancer. For example, the CTCFL associated disease or condition may be a H LA-restricted CTCFL antigen expressing tumor or cancer. In other words, the PRAME associated disease or condition may be a PRAME positive tumor or cancer. In other words, the CTCFL associated disease or condition may be a CTCFL positive tumor or cancer.

[0344] In an example, the pharmaceutical composition provided herein is for use in inducing or enhancing an immune response in human subject diagnosed with a PRAME associated disease or condition or a CTCFL associated disease or condition.

[0345] As would be clear to a person skilled in the art, an appropriate therapy for subject in need thereof (e.g. an appropriate pharmaceutical composition described herein) may be selected based on the HLA serotype of the subject.

[0346] In one example, if the subject in need thereof is HLA-A*24:02 positive, an appropriate therapy (e.g. an appropriate pharmaceutical composition described herein) may comprise components of TCR clone 16.3C1 exemplified herein. Accordingly, TCRs comprising components of TCR clone 16.3C1 exemplified herein are particularly suitable for administration, or treating, stimulating, providing appropriate immunity (e.g. anti-tumor immunity etc) in HLA-A*24:02 positive human subjects.

[0347] In one example, if the subject in need thereof is HLA-B*07:02 positive, an appropriate therapy (e.g. an appropriate pharmaceutical composition described herein) may comprise components of TCR clone 8.10C4 exemplified herein. Accordingly, TCRs comprising components of TCR clone 8.10C4 exemplified herein are particularly suitable for administration, or treating, stimulating, providing appropriate immunity (e.g. anti-tumor immunity etc) in HLA-B*07:02 positive human subjects.

[0348] In one example, if the subject in need thereof is HI_A-A*02:01 positive, an appropriate therapy (e.g. an appropriate pharmaceutical composition described herein) may comprise components of TCR clone 39.2E12 exemplified herein. Accordingly, TCRs comprising components of TCR clone 39.2E12 exemplified herein are particularly suitable for administration, or treating, stimulating, providing appropriate immunity (e.g. anti-tumor immunity etc) in HLA-A*02:01 positive human subjects.

[0349] The phrase “induced or enhanced immune response” refers to an increase in the immune response (e.g. a cell mediated immune response such as a T cell mediated immune response) of the subject during or after treatment compared to their immune response prior to treatment. An “induced or enhanced” immune response therefore encompasses any measurable increase in the immune response that is directly or indirectly targeted to the disease or condition being treated (or prevented).

[0350] In another example, the pharmaceutical composition may be for use in stimulating a cell mediated immune response to a target cell population or tissue in a human subject.

[0351] In another example, the pharmaceutical composition may be for use in stimulating a cell mediated immune response to a target cell population or tissue in a human subject. In such an example, the target cell population or tissue may be a HI_A-restricted cancer -associated antigen expressing target cell population or tissue (e.g. a PRAME and / or a CTCFL antigen expressing target cell population or tissue). Typically, it is a H LA- restricted cancer-associated antigen expressing target cell population or tissue (e.g. a H LA-restricted PRAME, and / or a H LA- restricted CTCFL antigen expressing target cell population or tissue). For example, it may be a target cell population or tissue comprising a H LA-restricted cancer-associated antigen expressing tumor or cancer. For example, it may be a target cell population or tissue comprising a H LA-restricted PRAME antigen and / or H LA-restricted CTCFL antigen expressing tumor or cancer.

[0352] The pharmaceutical composition may also be for use in providing anti-tumor immunity to a human subject. The pharmaceutical composition is typically for use in providing anti-tumor immunity against a tumor in which a H LA-restricted cancer-associated antigen described herein is presented at the cell surface in the context of a HLA, e.g. a PRAME and / or CTCFL antigen presented at the cell surface in the context of an HLA. For example, the pharmaceutical composition may be for use in providing anti-tumor immunity against a tumor in which a HLA- restricted PRAME antigen or CTCFL antigen described herein is presented at the cell surface in the context of a HLA.

[0353] In another example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with an elevated level of HLA-restricted cancer- associated antigen. For example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with an elevated level of HLA-restricted PRAME antigen or an elevated level of HLA-restricted CTCFL antigen. For example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with an elevated level of HLA-restricted PRAME and / or CTCFL.

[0354] A person of skill in the art will be fully aware of PRAME associated diseases or conditions and CTCFL associated diseases or conditions that may be treated in accordance with the invention. Appropriate examples of such diseases or conditions are discussed elsewhere herein.

[0355] As would be clear to a person skilled in the art, the PRAME associated diseases or conditions and / or the CTCFL associated diseases or conditions may comprise at least one tumor (particularly, at least one HLA-restricted PRAME antigen expressing tumor or at least one HLA- restricted CTCL antigen expressing tumor). For example, a HLA-restricted PRAME antigen and / or a HLA-restricted CTCFL antigen expressing tumor.

[0356] It would also be clear to a person skilled in the art that certain compositions are more suitable for treating certain diseases or conditions. For example, compositions comprising PRAME binding proteins, or nucleic acid components encoding the same, are particularly suitable for treating PRAME associated diseases or conditions. Similarly, compositions comprising CTCFL binding proteins, or nucleic acid components encoding the same, are particularly suitable for treating CTCFL associated diseases or conditions. Specific examples of PRAME binding proteins and CTCFL binding proteins are provided herein. As used herein, the terms “treat”, “treating” and "treatment" are taken to include an intervention performed with the intention of preventing the development or altering the pathology of a condition, disorder or symptom (e.g. a PRAME associated disease or condition and / or a CTCFL associated disease or condition). Accordingly, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted condition, disorder or symptom. “Treatment” therefore encompasses a reduction, slowing or inhibition of the amount or concentration of target cells, for example as measured in a sample obtained from the subject, of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% when compared to the amount or concentration of target cells before treatment. Methods of measuring the amount or concentration of target cells include, for example, qRT-PCR, and quantification of disease specific biomarkers in a sample obtained from the subject.

[0357] As used herein the term “subject” refers to an individual, e.g., a human, having or at risk of having a specified condition, disorder or symptom. The subject may be a patient i.e. a subject in need of treatment in accordance with the invention. The subject may have received treatment for the condition, disorder or symptom. Alternatively, the subject has not been treated prior to treatment in accordance with the present invention.

[0358] The compositions described herein can be administered to the subject by any conventional route, including injection or by gradual infusion over time. The administration may, for example, be by infusion or by intramuscular, intravascular, intracavity, intracerebral, intralesional, rectal, subcutaneous, intradermal, epidural, intrathecal, percutaneous administration.

[0359] The compositions described herein may be in any form suitable for the above modes of administration. For example, compositions comprising modified cells may in any form suitable for infusion. As further examples, suitable forms for parenteral injection (including, subcutaneous, intramuscular, intravascular or infusion) include a sterile solution, suspension or emulsion. Alternatively, the route of administration may be by direct injection into the target area, or by regional delivery or by local delivery. The identification of suitable dosages of the compositions of the invention is well within the routine capabilities of a person of skill in the art.

[0360] Advantageously, the compositions described herein may be formulated for use in T cell receptor (TCR) gene transfer, an approach that is rapid, reliable and capable of generating large quantities of T cells with specificity for cancer-associated antigenic peptides (e.g. the peptides shown in any one of SEQ ID NOs:43 to 45), regardless of the patient’s pre-existing immune repertoire. Using TCR gene transfer, modified cells suitable for infusion may be generated within a few days. The compositions described herein are for administration in an effective amount. An “effective amount” is an amount that alone, or together with further doses, produces the desired (therapeutic or non-therapeutic) response. The effective amount to be used will depend, for example, upon the therapeutic (or non-therapeutic) objectives, the route of administration, and the condition of the patient / subject. For example, the suitable dosage of the composition of the invention for a given patient / subject will be determined by the attending physician (or person administering the composition), taking into consideration various factors known to modify the action of the composition of the invention for example severity and type of haematological malignancy, body weight, sex, diet, time and route of administration, other medications and other relevant clinical factors. The dosages and schedules may be varied according to the particular condition, disorder or symptom the overall condition of the patient / subject. Effective dosages may be determined by either in vitro or in vivo methods.

[0361] The pharmaceutical compositions described herein are advantageously presented in unit dosage form.

[0362] Methods of generating binding proteins (e.g. TCRs)

[0363] A method of generating a binding protein that is capable of specifically binding to a peptide containing a cancer-associated antigen and does not bind to a peptide that does not contain the cancer-associated antigen is also provided, comprising contacting a nucleic acid composition (or vector system) described herein with a cell under conditions in which the nucleic acid composition is incorporated and expressed by the cell, wherein the cancer-associated antigen is a PRAME antigen or a CTCFL antigen.

[0364] In the context of the binding proteins described herein, the cancer-associated antigen may comprise or consist of a sequence comprising an amino acid sequence selected from the group consisting of: SEQ ID NO:43 to 45, or a functional fragment or variant thereof.

[0365] The method may be carried out on the (host) cell ex vivo or in vitro. Alternatively, the method may be performed in vivo, wherein the nucleic acid composition (or vector system) is administered to the subject and is contacted with the cell in vivo, under conditions in which the nucleic acid sequence is incorporated and expressed by the cell to generate the binding protein. In one example, the method is not a method of treatment of the human or animal body.

[0366] Appropriate in vivo, in vitro and ex vivo methods for contacting a nucleic acid sequence (or vector systems) with a cell under conditions in which the nucleic acid sequence (or vector) is incorporated and expressed by the cell are well known, as described elsewhere herein. As stated elsewhere herein, the binding protein comprise a TCR, an antigen binding fragment of a TCR, a T-engager, a ImmTAC or a chimeric antigen receptor (CAR). Further details are provided elsewhere herein.

[0367] The binding proteins described herein may be used therapeutically, as described elsewhere herein. Furthermore, the binding proteins may be used in a diagnostic setting, e.g. to detect the presence of a cancer-associated antigen (e.g. PRAME and / or CTCFL) presented in the context of an appropriate HLA at the cell surface of diseased / malignant tissues.

[0368] General definitions

[0369] As used herein “nucleic acid sequence”, “polynucleotide”, “nucleic acid” and “nucleic acid molecule” are used interchangeably to refer to an oligonucleotide sequence or polynucleotide sequence. The term nucleotide sequence may be replaced with nucleic acid molecule herein. The nucleotide sequence may be of genomic, synthetic or recombinant origin, and may be doublestranded or single-stranded (representing the sense or antisense strand). The term "nucleotide sequence" includes genomic DNA, cDNA, synthetic DNA, and RNA (e.g. mRNA) and analogs of the DNA or RNA generated, e.g., by the use of nucleotide analogs. In one example, the nucleotide sequence lacks introns. In other words, it is an intronless nucleic acid sequence. For example, the nucleotide sequence may be a DNA sequence that does not comprise intron sequences.

[0370] As used herein, “isolated nucleic acid sequence” or “isolated nucleic acid composition” refers to a nucleic acid sequence that is not in its natural environment when it is linked to its naturally associated sequence(s) that is / are also in its / their natural environment. In other words, an isolated nucleic acid sequence / composition is not a native nucleotide sequence / composition, wherein "native nucleotide sequence / composition" means an entire nucleotide sequence that is in its native environment and when operatively linked to an entire promoter with which it is naturally associated, which promoter is also in its native environment. Such a nucleic acid could be part of a vector and / or such nucleic acid or polypeptide could be part of a composition (e.g., a cell lysate), and still be isolated in that such vector or composition is not part of the natural environment for the nucleic acid or polypeptide. The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region ("leader and trailer") as well as intervening sequences (introns) between individual coding segments (exons).

[0371] The nucleic acid sequences of the invention may be a non-naturally occurring nucleic acid sequence (e.g. it may be that the entire sequence does not occur in its entirety in nature). For example, the nucleic acid sequence of the invention may be operably linked to a promoter, wherein the promoter is not naturally associated with equivalent human nucleic acid sequences in nature (e.g. human TCR sequences or fragments thereof); i.e. it is not the entire promoter that is naturally associated with the nucleic acid in its natural environment. In this context, such promoters may be considered exogenous promoters. Examples of appropriate promoters are described elsewhere.

[0372] As used herein "specifically binds" or "specific for" refers to an association or union of a binding protein (e.g., TCR receptor) or a binding domain (or fusion protein thereof) to a target molecule with an affinity or Ka(i.e., an equilibrium association constant of a particular binding interaction with units of 1 / M) equal to or greater than 105M-1(which equals the ratio of the on-rate [kon] to the off-rate [kOff] for this association reaction), while not significantly associating or uniting with any other molecules or components in a sample. Binding proteins or binding domains (or fusion proteins thereof) may be classified as "high affinity" binding proteins or binding domains (or fusion proteins thereof) or as "low affinity" binding proteins or binding domains (or fusion proteins thereof). "High affinity" binding proteins or binding domains refer to those binding proteins or binding domains having a Kaof at least 107M-1, at least 108M-1, at least 109M-1, at least 101° M-1, at least 1011M’1, at least 1012M-1, or at least 1013M-1. Low affinity" binding proteins or binding domains refer to those binding proteins or binding domains having a Kaof up to 107M'1up to 106M’1, up to 105M-1. Alternatively, affinity can be defined as an equilibrium dissociation constant (Kd) of a particular binding interaction with units of M (e.g., 10'5M to 10'13M).

[0373] In certain embodiments, a receptor or binding domain may have "enhanced affinity," which refers to selected or engineered receptors or binding domains with stronger binding to a target antigen than a wild type (or parent) binding domain. For example, enhanced affinity may be due to a Ka(equilibrium association constant) for the target antigen that is higher than the wild type binding domain, due to a Kd (dissociation constant) for the target antigen that is less than that of the wild type binding domain, due to an off-rate (kOff) for the target antigen that is less than that of the wild type binding domain, or a combination thereof. In certain embodiments, enhanced affinity TCRs can be codon optimized to enhance expression in a particular host cell, such as a cell of the immune system, a inducible pluripotent stem cell (iPSC), a hematopoietic stem cell, a T cell, a primary T cell, a T cell line, a NK cell, or a natural killer T cell (Scholten et al, Clin. Immunol. 119: 135, 2006). The T cell can be a CD4+ or a CD8+ T cell, or gamma-delta T cell.

[0374] The PRAME gene (ENSG00000185686; Uniprot: P78395) is localized on the reverse strand of chromosome 22, is approximately 12 kilobases long and contains leucine-rich repeat domains. Overexpression of PRAME (also called MAPE, OIP4, CT130, OIP-4) blocks retinoic acid (RA)- mediated cell differentiation, cell growth arrest and apoptotic death, suggesting that PRAME appears to serve as an inhibitor of retinoic acid receptor (RAR) signalling. Upregulation of PRAME contributes to tumorigenesis via inhibiting the RA / RAR signalling pathway. In line with this, high expression of PRAME is observed in 88% of primary tissues and 95% of metastatic tissues in melanomas. In addition to melanoma, PRAME is frequently expressed in numerous solid cancers, such as head and neck cancer, breast cancer, renal cell carcinoma and non-small-cell lung cancer (NSCLC).

[0375] CTCFL (ENSG00000124092; Uniprot: Q8N151), also named brother of the regulator of imprinted sites (BORIS) or CT27, CTCF-T, HMGB1 L1 , dJ579F20.2, is a DNA binding protein and plays a central role in gene regulation by acting as a transcription factor of testis-specific genes, including CTAs. By interfering in cellular processes, CTCFL exhibits several oncogenic properties, including apoptosis, proliferation and immortalization. In ovarian cancer CTCFL expression indeed showed correlation with increased stage and decreased survival. Also in other tumor types CTCFL expression has been detected, although data have been contradictory. According to the TCGA data, CTCFL is mainly expressed in ovarian cancer. Since CTCFL expression is epigenetically regulated, treatment with demethylating agent DAC has shown upregulation of CTCFL in OVCA cell lines.

[0376] CLDN6 (ENSG00000184697; Uniprot: P56747) is one of 27 members of the CLDN family. CLDN6 (Claudin 6) can bind with signal proteins and cytoskeletal proteins, and participate in the cellular response to external and intracellular signal transmission. CLDN6 is expressed in a variety of embryonic epithelia, induces epithelial cell junction formation and polarity, and participates in the differentiation of stem cells into epithelial cells. CLDN6 is an important component of the CLDN family and serves a substantial role in maintaining the function of tight junctions. In certain tumours, such as liver, ovarian, endometrial and oesophageal cancer, and atypical teratoid / rhabdoid tumours, research consistently shows that CLDN6 is expressed in tumour tissues but is not expressed or is expressed at low levels in surrounding tissues. In these tumours, CLDN6 has potential as a carcinoembryonic antigen and a therapeutic target.

[0377] In some examples, a protein and a gene encoding said protein may be referred to using the same term. In examples where a protein and a gene encoding said protein are referred to using the same term, a person of skill in the art would readily be able to determine whether the protein or the gene was being referred to depending on the context in which the term was mentioned. Typically, gene names are written in italics.

[0378] As discussed elsewhere herein, the cancer-associated antigen may be a PRAME antigen or a CTCFL antigen. In other words, the (cancer-associated) antigen may be derived from PRAME and / or CTCFL. As used herein, the term "cancer-associated antigen" or "cancer-associated peptide antigen" refers to a naturally or synthetically produced peptide portion of a cancer-associated protein (e.g. antigen) ranging in length from about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, up to about 20 amino acids, which can form a complex with a MHC (e.g., HLA) molecule, and a binding protein of this disclosure specific for a cancer-associated peptide: MHC (e.g., HI_A) complex can specifically bind to such as complex. In other words, the cancer-associated antigen may be derived from a cancer-associated protein (e.g. antigen). The cancer-associated peptide antigen may be a PRAME or CTCFL peptide antigen. In other words, the cancer-associated antigen may be derived from a PRAME protein or a CTCFL protein (see for example, SEQ ID NO: 43 to 45). Typically, for the purposes of this disclosure, the cancer- associated peptide antigen comprises or consists of an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 45, however other cancer-associated peptide antigens are described elsewhere herein. Additionally, for the purposes of this disclosure, the cancer- associated peptide antigen:HLA complex typically comprises a peptide:HLA complex selected from the group consisting of: a LYVDSLFFL:HLA-A*24:02 complex, a SPSVSQLSVLHLA- B*07:02 complex, and a KLHGILVEA:HLA-A*02:01 complex, however other cancer-associated peptide antigen:HLA complexes are described elsewhere herein.

[0379] The term "cancer-associated antigen-specific binding protein," as used herein, refers to a protein or polypeptide, such as a TCR or CAR, that specifically binds to a cancer-associated peptide antigen (e.g. a PRAME and / or a CTCFL peptide antigen) (or to a cancer-associated peptide antigen:HLA complex, e.g., on a cell surface, e.g. a PRAME:HLA-A*24:02 complex, a PRAME:HLA-B*07:02 complex, and / or a CTCFL:HLA-A*02:01 complex), and does not bind a peptide sequence that does not include the cancer-associated peptide antigen (e.g. PRAME or CTCFL). Typically, for the purposes of this disclosure, the cancer-associated peptide antigen comprises or consists of an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 45, and the cancer-associated peptide antigen:HLA complex comprises a peptide:HLA complex selected from the group consisting of: a LYVDSLFFL:HLA-A*24:02 complex, a SPSVSQLSVL:HLA-B*07:02 complex, and a KLHGILVEA:HLA-A*02:01 complex, as appropriate, however other cancer-associated peptide antigens and cancer-associated peptide antigen: HLA complexes are described elsewhere herein.

[0380] In certain embodiments, a cancer-associated antigen-specific binding protein specifically binds to a cancer-associated peptide antigen (e.g. a PRAME and / or a CTCFL peptide antigen) (or a cancer-associated peptide antigen:HLA complex e.g. a PRAME:HLA complex and / or a CTCFL: HLA complex) with a Kd of less than about 10-8M, less than about 10-9M, less than about 10'10M, less than about 10-11M, less than about 10-12M, or less than about 10-13M, or with an affinity that is about the same as, at least about the same as, or is greater than at or about the affinity exhibited by an exemplary cancer-associated antigen-specific binding protein provided herein, such as any of the cancer-associated antigen-specific TCRs provided herein, for example, as measured by the same assay. In certain embodiments, a cancer-associated antigen-specific binding protein comprises a cancer-associated antigen-specific immunoglobulin superfamily binding protein or binding portion thereof. Typically, for the purposes of this disclosure, the cancer-associated peptide antigen comprises or consists of an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 45, and the cancer-associated peptide antigen:HLA complex comprises a peptide:HLA complex selected from the group consisting of: a LYVDSLFFL:HLA-A*24:02 complex, a SPSVSQLSVL:HLA-B*07:02 complex, and a KLHGILVEA:HLA-A*02:01 complex, as appropriate, however other cancer-associated peptide antigen and cancer-associated peptide antigen:HI_A complexes are described elsewhere herein.

[0381] The selective binding may be in the context of cancer-associated antigen presentation by HLA- A*24:02, HI_A-B*07:02 or HI_A-A*02:01. In other words, in certain embodiments, a binding protein that “specifically binds to a cancer-associated antigen” may only do so when it is being presented (i.e. it is bound by) by a specific HI_A or is in an equivalent structural formation as when it is being presented by the specific HLA. As discussed elsewhere herein, the inventors identified that the PRAME derived peptide LYVDSLFFL (SEQ ID NO: 43) is capable of being presented by HLA- A*24:02; that the PRAME derived peptide SPSVSQLSVL (SEQ ID NO: 44) is capable of being presented by HLA-B*07:02; and that the CTCFL derived peptide KLHGILVEA (SEQ ID NO: 45) is capable of being presented by HLA-A*02:01.

[0382] Accordingly, in certain examples, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:43, may only do so when it is being presented (i.e. it is bound by) HLA-A*24:02 or is in an equivalent structural formation as when it is being presented by HLA-A*24:02. In another example, a binding protein that “specifically binds to a cancer-associated antigen”, in particular the peptide of SEQ ID NO: 44 may only do so when it is being presented (i.e. it is bound by) HLA-B*07:02, or is in an equivalent structural formation as when it is being presented by HLA-B*07:02. In another example, a binding protein that “specifically binds to a cancer-associated antigen”, in particular a peptide of SEQ ID NO:45 may only do so when it is being presented (i.e. it is bound by) HI_A-A*02:01 or is in an equivalent structural formation as when it is being presented by HI_A-A*02:01.

[0383] By “specifically bind(s) to” as it relates to a T cell receptor, or as it refers to a recombinant T cell receptor, nucleic acid fragment, variant, or analog, or a modified cell, such as, for example, the PRAME or CTCFL T cell receptors, and PRAME- or CTCFL-expressing modified cells herein, is meant that the T cell receptor, or fragment thereof, recognizes, or binds selectively to the particular antigen, such as the PRAME antigen or CTCFL antigen as appropriate (e.g. wherein the PRAME antigen comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 44, and the CTCFL antigen comprises an amino acid sequence of SEQ D NO: 45). Further appropriate antigens are described elsewhere herein. Under certain conditions, for example, in an immunoassay, for example an immunoassay discussed herein, the T cell receptor binds to a PRAME antigen or a CTCFL antigen (e.g. wherein the PRAME antigen comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 44, and the CTCFL antigen comprises an amino acid sequence of SEQ D NO: 45) and does not bind in a significant amount to other polypeptides. Thus the T cell receptor may bind to a PRAME antigen or a CTCFL antigen (e.g. wherein the PRAME antigen comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 43 to 44 and the CTCFL antigen comprises an amino acid sequence of SEQ D NO: 45) with at least 10, 100, or 1000, fold more affinity than to a control antigenic polypeptide. This binding may also be determined indirectly in the context of a modified T cell that expresses a PRAME or a CTCFL TCR. In assays such as, for example, an assay discussed herein, the modified T cell is specifically reactive against a PRAME or CTCFL expressing melanoma cell line as appropriate (e.g. a SK2.3 cell line) or a PRAME or CTCFL expressing multiple myeloma cell line, as appropriate (e.g. a U266 cell line). Thus, the modified PRAME-TCR or CTCFL-TCR expressing T cell may bind to a PRAME- or CTCFL- expressing melanoma or a PAME- or CTCFL- expressing multiple myeloma cell line (e.g. a SK2.3 cell line or a U266 cell line, respectively) with at least 10, 100, or 1000, fold more reactivity when compared to its reactivity against a control cell line that is not a PRAME- or CTCFL- expressing melanoma or a PAME- or CTCFL- expressing multiple myeloma cell line (e.g. a SK2.3 cell line or U266 cell line, respectively), as appropriate.

[0384] A “non-essential” (or “non-critical”) amino acid residue is a residue that can be altered from the wild-type sequence of (e.g., the sequence identified by SEQ ID NO herein) without abolishing or, more preferably, without substantially altering a biological activity, whereas an “essential” (or “critical”) amino acid residue results in such a change. For example, amino acid residues that are conserved are predicted to be particularly non-amenable to alteration, except that amino acid residues within the hydrophobic core of domains can generally be replaced by other residues having approximately equivalent hydrophobicity without significantly altering activity.

[0385] A “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a nonessential (or non-critical) amino acid residue in a protein is preferably replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly, and the resultant mutants can be screened for activity to identify mutants that retain activity.

[0386] Calculations of sequence homology or identity (the terms are used interchangeably herein) between sequences are performed as follows.

[0387] To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 75%, 80%, 82%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

[0388] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman et al. (1970) J. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available at http: / / www.gcg.com), using either a BLOSLIM 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at http: / / www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the one that should be used if the practitioner is uncertain about what parameters should be applied to determine if a molecule is within a sequence identity or homology limitation of the invention) are a BLOSLIM 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

[0389] Alternatively, the percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of Meyers et al. (1989) CABIOS 4:11-17) which has been incorporated into the ALIGN program (version 2.0), using a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.

[0390] The nucleic acid and protein sequences described herein can be used as a “query sequence” to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using the N BLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-410). BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, gapped BLAST can be utilized as described in Altschul et al. (1997, Nucl. Acids Res. 25:3389-3402). When using BLAST and gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See <http: / / www.ncbi.nlm.nih.gov>.

[0391] The polypeptides and nucleic acid molecules described herein can have amino acid sequences or nucleic acid sequences sufficiently or substantially identical to the sequences identified by SEQ ID NO. The terms “sufficiently identical” or “substantially identical” are used herein to refer to a first amino acid or nucleotide sequence that contains a sufficient or minimum number of identical or equivalent (e.g. with a similar side chain) amino acid residues or nucleotides to a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences have a common structural domain or common functional activity. In other words, amino acid sequences or nucleic acid sequences having one or several (e.g. two, three, four etc) amino acid or nucleic acid substitutions compared to the corresponding sequences identified by SEQ ID NO may be sufficiently or substantially identical to the sequences identified by SEQ ID NO (provided that they retain the requisite functionality). In such examples, the one or several (e.g. two, three, four etc) amino acid or nucleic acid substitutions may be conservative substitutions. For example, amino acid or nucleotide sequences that contain a common structural domain having at least about 60%, or 65% identity, likely 75% identity, more likely 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity are defined herein as sufficiently or substantially identical.

[0392] TCR sequences are defined according to IMGT. See the LeFranc references herein for further details i.e. [1] Lefranc M.-P. "Unique database numbering system for immunogenetic analysis" Immunology Today, 18: 509 (1997). [2] Lefranc M.-P. "The IMGT unique numbering for immunoglobulins, T cell Receptors and Ig-like domains" The immunologist, 7,132-136 (1999).

[0393] [3] Lefranc M.-P. et al. "IMGT unique numbering for immunoglobulin and Tcell receptor variable domains and Ig superfamily V-like domains" Dev. Comp. Immunol., 27, 55-77 (2003).

[0394] [4] Lefranc M.-P. et al. "IMGT unique numbering for immunoglobulin and T cell receptor constant domains and Ig superfamily C-like domains" Dev. Comp. Immunol., 2005, 29, 185-203 PMID: 15572068.

[0395] As used herein, the term “ex vivo” refers to “outside” the body. The term “in vitro” can be used to encompass “ex vivo” components, compositions and methods.

[0396] Additional binding proteins, vector systems, modified cells, isolated peptides and uses thereof As described elsewhere herein, the inventors have identified several novel peptides encoded by OVCA-associated genes (e.g. that are presented by HLA class I molecules). The peptides SPSVSQLSVL (SEQ ID NO: 44) and KLHGILVEA (SEQ ID NO: 45) are discussed in detail above however, these peptides are also discussed here in the context of additional binding proteins, vector systems, modified cells, isolated peptides and uses thereof.

[0397] The inventors have identified the following novel peptides encoded by OVCA-associated genes that are presented by HLA class I: SPSVSQLSVL (SEQ ID NO: 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74). These peptides are derived from either of PRAME, CTCFL or CLDN6 which the inventors identified as ovarian-cancer associated antigens.

[0398] Advantageously, the peptides derived from the cancer-associated antigens PRAME, CTCFL and CLDN6 can be used as therapeutic agents (e.g. vaccines) to treat or prevent a PRAME associated disease or condition, a CTCFL associated disease or condition, or a CLDN6 associated disease or condition (e.g. to induce or enhance an immune response in human subject diagnosed with a PRAME associated disease or condition, a CTCFL associated disease or condition, or a CLDN6 associated disease or condition as appropriate). The peptides themselves therefore have utility e.g. in isolated form or when formulated as a pharmaceutical composition. Alternatively, they can be used as a target antigen for treatment of such patients with modified cells described herein (e.g. peripheral blood lymphocytes or tumour-infiltrating lymphocytes (TILs)) having T cell receptors that specifically recognize one of the specified peptides).

[0399] Accordingly, an isolated nucleic acid composition that encodes a cancer-associated antigenspecific binding protein having a TCR a chain variable (Va) domain and a TCR p chain variable (VP) domain is also provided, the composition comprising: a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence, wherein the CDR3 sequences together specifically bind to a peptide selected from the group consisting of: SPSVSQLSVL (SEQ ID NO: 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74).

[0400] An isolated nucleic acid composition that encodes a cancer-associated antigen-specific binding protein (i.e. a PRAME antigen-specific binding protein) having a TCR a chain variable (Va) domain and a TCR p chain variable (VP) domain is also provided, the composition comprising: a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence, wherein the CDR3 sequences together specifically bind to SPSVSQLSVL (SEQ ID NO: 44).

[0401] An isolated nucleic acid composition that encodes a cancer-associated antigen-specific binding (i.e. a CTCFL antigen-specific binding protein) protein having a TCR a chain variable (Va) domain and a TCR p chain variable (Vp) domain is also provided, the composition comprising: a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence, wherein the CDR3 sequences together specifically bind to a peptide selected from the group consisting of: CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70) and AETTGLIKL (SEQ ID NO: 71). An isolated nucleic acid composition that encodes a cancer-associated antigen-specific binding protein (i.e. a CLDN6 antigen-specific binding protein) having a TCR a chain variable (Va) domain and a TCR p chain variable (VP) domain is also provided, the composition comprising: a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence, wherein the CDR3 sequences together specifically bind to a peptide selected from the group consisting of: GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74).

[0402] Nucleic acid compositions that encode binding protein components (e.g. nucleic acid compositions that encode a cancer-associated antigen-specific binding proteins) are described elsewhere herein. The information, definitions, and examples provided elsewhere herein regarding nucleic acid compositions that encode binding protein components (e.g. nucleic acid compositions that encode a cancer-associated antigen-specific binding proteins) apply equally here. i.e. wherein the cancer-associated antigen comprises PRAME, CTCFL or CLDN6, or an antigen or peptide thereof, (e.g. wherein the cancer-associated antigen comprises a peptide selected from the group consisting of: SPSVSQLSVL (SEQ ID NO: 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74)).

[0403] The inventors have identified that the peptide SPSVSQLSVL (SEQ ID NO: 44) is presented by HLA-B*07:02, that CSAVFHERY (SEQ ID NO: 68) is presented by HLA-A*01:01, that RSDEIVLTV (SEQ ID NO: 69) is presented by HLA-A*01 :01, a KLHGILVEA (SEQ ID NO: 45) is presented by HLA-A*02:01 , that HAYSAAELK (SEQ ID NO: 75) is presented by HLA-A*03:01, that SVLSEQFTK (SEQ ID NO: 76) is presented by HLA-A*03:01 , that KYASVEASKL (SEQ ID NO: 77) is presented by HLA-A*24:02, that DSKLAVSL (SEQ ID NO: 70) is presented by HLA- B*08:01 , that AETTGLIKL (SEQ ID NO: 71) is presented by HLA-B*40:01, that GPSEYPTKNYV (SEQ ID NO: 72) is presented by HLA-A*01:01 and that DSKARLVL (SEQ ID NO: 74) is presented by HLA-B*08:01. Therefore, specific binding to any one of these peptides may occur in the context of the appropriate HLA (i.e. specific binding to the peptide may occur only when it is presented by the appropriate HLA).

[0404] As described elsewhere herein, the invention is directed to nucleic acid compositions that encode binding proteins comprising TCR components that interact with a particular peptide in the context of the appropriate serotype of MHC, i.e. a cancer-associated antigen (e.g. PRAME, CTCFL or CLDN6) in the context of HLA-B*07:02, HLA-A*01:01, HLA-A*02:01, HLA-A*03:01 , HLA-A*24:02, HLA-B*08:01 or HLA-B*40:01 (in other words, the encoded binding protein is capable of specifically binding to a cancer-associated antigen (e.g. PRAME, CTCFL or CLDN6): specific HI_A complex). In an example, the invention is directed to nucleic acid compositions that encode binding proteins comprising TCR components that interact with a particular peptide in the context of the appropriate serotype of MHC, i.e. SPSVSQLSVL (SEQ ID NO: 44) in the context of HLA- B*07:02, CSAVFHERY (SEQ ID NO: 68) in the context of HLA-A*01:01, RSDEIVLTV (SEQ ID NO: 69) in the context of HLA-A*01:01, KLHGILVEA (SEQ ID NO: 45) in the context of HLA- A*02:01 , HAYSAAELK (SEQ ID NO: 75) in the context of HLA-A*03:01, SVLSEQFTK (SEQ ID NO: 76) in the context of HLA-A*03:01, KYASVEASKL (SEQ ID NO: 77) in the context of HLA- A*24:02, DSKLAVSL (SEQ ID NO: 70) in the context of HLA-B*08:01, AETTGLIKL (SEQ ID NO: 71) in the context of HLA-B*40:01, GPSEYPTKNYV (SEQ ID NO: 72) in the context of HLA- A*01:01 or DSKARLVL (SEQ ID NO: 74) in the context of HLA-B*08:01.

[0405] HI_A-A*02:01 , HI_A-A*24:02, and HI_A-B*07:02 are described elsewhere herein.

[0406] HLA-A*01 :01 , HLA-A*03:01 , HLA-B*08:01 and HLA-B*40:01 are also common human leukocyte antigen serotypes within the HI_A-A and HI_A-B serotype groups.

[0407] Peptides that are presented by HLA-A*01:01, HLA-A*03:01, HLA-B*08:01 or HLA-B*40:01 to TCRs are described as being “HI_A-A*01 :01 restricted”, “HLA-A*03:01 restricted”, “HLA- B*08:01 restricted” or “HLA-B*40:01 restricted” respectively.

[0408] HI_A-A*01 :01 is also referred to herein as HLA-A1 ; HI_A-A*03:01 is also referred to herein as HLA- A3; HLA-B*08:01 is also referred to herein as HI_A-B8; HI_A-B*40:01 is also referred to herein as HLA-B40.

[0409] As described herein, the inventors have identified several cancer-associated antigen (e.g. PRAME, CTCFL and CLDN6) derived peptides presented on malignant cells in HLA-B*07:02, HLA-A*01:01, HLA-A*02:01, HLA-A*03:01, HLA-A*24:02, HLA-B*08:01 or HLA-B*40:01. The inventors identified the PRAME derived peptide of SEQ ID NO: 44, the CTCFL derived peptides of SEQ ID NOs: 68-71 , 45 and 75-77, and the CLDN6 derived peptides of SEQ ID NO: 72 and 74.

[0410] Accordingly, the cancer-associated antigen specifically bound by a binding protein described herein may comprise an amino acid sequence selected from the group consisting of: SEQ ID NO: 44, 68 -71 , 45, 75- 77, 72 and 74. The antigen may be an antigenic fragment (i.e. a portion) of an amino acid sequence selected from the group consisting of: SEQ ID NO: 44, 68 -71 , 45, 75- 77, 72, 74, it may consist of an amino acid sequence selected from the group consisting of: SEQ ID NO: 44, 68 -71 , 45, 75- 77, 72 and 74 or it may comprise (i.e. include within a longer sequence) an amino acid sequence selected from the group consisting of: SEQ ID NO: 44, 68 -71 , 45, 75- 77, 72 and 74.

[0411] The inventors identified that the PRAME derived peptide SPSVSQLSVL (SEQ ID NO: 44) is capable of being presented by HLA-B*07:02; that the CTCFL derived peptide

[0412] CSAVFHERY (SEQ ID NO: 68) is capable of being presented by HLA-A*01 :01 ; that the CTCFL derived peptide RSDEIVLTV (SEQ ID NO: 69) is capable of being presented by HLA-A*01:01 ; that the CTCFL derived peptide KLHGILVEA (SEQ ID NO: 45) is capable of being presented by HLA-A*02:01; that the CTCFL derived peptide HAYSAAELK (SEQ ID NO: 75) is capable of being presented by HLA-A*03:01 ; that the CTCFL derived peptide SVLSEQFTK (SEQ ID NO: 76) is capable of being presented by HLA-A*03:01 ; that the CTCFL derived peptide KYASVEASKL (SEQ ID NO: 77) is capable of being presented by HLA-A*24:02; that the CTCFL derived peptide DSKLAVSL (SEQ ID NO: 70) is capable of being presented by HLA-B*08:01 ; that the CTCFL derived peptide AETTGLIKL (SEQ ID NO: 71) is capable of being presented by HLA-B*40:01; that the CLDN6 derived peptide GPSEYPTKNYV (SEQ ID NO: 72) is capable of being presented by HLA-A*01:01; and that the CDLN6 derived peptide DSKARLVL (SEQ ID NO: 74) is capable of being presented by HLA-B*08:01.

[0413] Accordingly, in one example, the encoded binding protein is capable of specifically binding to a peptide:HLA complex selected from the group consisting of: a SPSVSQLSVL:HLA-B*07:02 complex, a CSAVFHERY:HLA-A*01 :01 complex, a RSDEIVLTV:HLA-A*01 :01 complex, a KLHGILVEA:HLA-A*02:01 complex, a HAYSAAELK:HLA-A*03:01 complex, a SVLSEQFTK: HLA-A*03:01 complex, a KYASVEASKL:HLA-A*24:02 complex, a DSKLAVSL:HLA-B*08:01 complex, a AETTGLIKL:HLA-B*40:01 complex, a GPSEYPTKNYV: H LA- A*01:01 complex and a DSKARLVL:HLA-B*08:01 complex.

[0414] In one example, the cancer derived peptide (e.g. the PRAME derived peptide, the CTCFL derived peptide or the CLDN6 derived peptide) of the peptide:HLA complex comprises an antigenic fragment of an amino acid sequence selected from the group consisting of: SEQ ID NO: 44, 68 - 71 , 45, 75- 77, 72 and 74. In a further example, the cancer derived peptide (e.g. the PRAME derived peptide, the CTCFL derived peptide or the CLDN6 peptide) of the peptide:HLA complex comprises or consists of an amino acid sequence selected from the group consisting of: SEQ ID NO: 44, 68 -71 , 45, 75- 77, 72 and 74.

[0415] As described elsewhere herein, the nucleic acid composition may further comprise a TCR a chain constant domain and / or a TCR chain constant domain. Examples of appropriate constant domains are described elsewhere herein and as would be clear to the skilled person, may be used in the context of a nucleic acid composition specifically binding to a cancer-associated antigen comprising a peptide selected from the group consisting of: SPSVSQLSVL (SEQ ID NO:

[0416] 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO:

[0417] 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74).

[0418] As stated in more detail elsewhere herein, the nucleic acid composition described herein encodes both a TCR Va domain and a TCR Vp domain, which form the binding protein that is capable of specifically binding to a cancer-associated antigen. In examples where the TCR Va domain and the TCR p domain are encoded by the same nucleic acid sequence, the TCR Va domain and TCR Vp domain may be joined together via a linker. Suitable linkers are discussed generally elsewhere herein. Additional appropriate polypeptide domains that may also be encoded by the nucleic acid sequences that encode the TCR Va domain and / or the TCR Vp domain are also discussed generally elsewhere herein.

[0419] In one example, the nucleic acid composition described herein may encode a soluble TCR or a chimeric single chain TCR wherein the TCR alpha chain variable domain is linked to the TCR beta chain variable domain and a constant domain which is e.g. fused to the CD3 zeta signalling domain. These are discussed generally in more detail elsewhere herein.

[0420] A vector system comprising a nucleic acid composition described herein is also provided.

[0421] A modified cell comprising a nucleic acid composition described herein or a vector system described herein is also provided.

[0422] Vector systems and modified cells are described elsewhere herein and the information, definitions, and examples provided elsewhere herein regarding vector systems and modified cells apply equally here (e.g. wherein the cancer-associated antigen comprises PRAME, CTCFL or CLDN6, or an antigen or peptide thereof, e.g. in the context of ovarian-cancer associated antigenspecific binding proteins that specifically bind to a peptide selected from the group consisting of: SPSVSQLSVL (SEQ ID NO: 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74)). In some examples, the at least one exogenous nucleic acid sequence included in the modified cell may be at least one of component part of a ovarian-cancer associated-antigen specific binding protein (e.g. the sequences etc that encode the CDR3 sequences that are specific for a cancer- associated antigen (e.g. PRAME, CTCFL or CLDN6, e.g. the peptide of SEQ ID NO: 44, 68 -71, 45, 75- 77, 72 or 74)).

[0423] In the context of the methods of treatment described herein, the host cell (and thus the modified cell) may be for administration to a HLA-B*07:02, HLA-A*01:01, HLA-A*02:01 , HLA-A*03:01, HLA-A*24:02, HI_A-B*08:01 or HLA-B*40:01 positive human subject. In view of this, the host cell (and thus the modified cell) may be HLA-B*07:02, HLA-A*01:01, HLA-A*02:01, HLA-A*03:01, HI_A-A*24:02, HI_A-B*08:01 or HLA-B*40:01 positive but needs to be cancer-associated antigen (e.g. PRAME, CTCFL or CLDN6) negative (i.e. modified cells can either be HLA-B*07:02, HLA- A*01 :01 , HLA-A*02:01, HLA-A*03:01, HLA-A*24:02, HLA-B*08:01 or HLA-B*40:01 positive or negative).

[0424] Advantageously, the modified cell is capable of expressing the binding protein encoded by the nucleic acid composition or vector system described herein (i.e. the TCR component parts) such that the modified cell provides an immunotherapy that specifically targets cells that express a cancer-associated antigen (e.g. PRAME, CTCFL or CLDN6), and thus can be used to treat or prevent PRAME-, CTCFL-, or CLDN6 associated diseases or conditions in a corresponding HLA- B*07:02, HLA-A*01:01, HLA-A*02:01, HLA-A*03:01 , HLA-A*24:02, HLA-B*08:01 or HLA-B*40:01 positive human subject. More details on this use are given below.

[0425] As discussed elsewhere herein, the inventors have identified the following peptides encoded by OVCA-associated genes that are presented by HLA class I, namely: SPSVSQLSVL (SEQ ID NO:

[0426] 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO:

[0427] 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74).

[0428] Accordingly, the invention also provides an isolated peptide comprising an amino acid sequence selected from the group consisting of: (i) SPSVSQLSVL (SEQ ID NO: 44); (ii) CSAVFHERY (SEQ ID NO: 68); (iii) RSDEIVLTV (SEQ ID NO: 69); (iv) KLHGILVEA (SEQ ID NO: 45); (v) HAYSAAELK (SEQ ID NO: 75); (vi) SVLSEQFTK (SEQ ID NO: 76); (vii) KYASVEASKL (SEQ ID NO: 77); (viii) DSKLAVSL (SEQ ID NO: 70); (ix) AETTGLIKL (SEQ ID NO: 71); (x) GPSEYPTKNYV (SEQ ID NO: 72); and (xi) DSKARLVL (SEQ ID NO: 74). An isolated (PRAME derived) peptide comprising an amino acid sequence of SPSVSQLSVL (SEQ ID NO: 44) is also provided.

[0429] An isolated (CTCFL derived) peptide comprising an amino acid sequence selected from the group consisting of: CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70) and AETTGLIKL (SEQ ID NO: 71) is also provided.

[0430] An isolated (CLDN6 derived) peptide comprising an amino acid sequence selected from the group consisting of: GPSEYPTKNYV (SEQ ID NO: 72), and DSKARLVL (SEQ ID NO: 74) is also provided.

[0431] As used herein, an “isolated peptide” refers to a peptide that is not in its natural environment. The peptide may therefore be of synthetic origin (or alternatively, of natural original, but isolated from its natural environment).

[0432] The isolated peptide may be relatively short (i.e. no more than 20 amino acids; e.g. no more than 19, 18, 17, 16, 15, 14, 13, 12, 11 , or 10 amino acids). The peptide may consist of the amino acid sequence of: (i) SPSVSQLSVL (SEQ ID NO: 44); (ii) CSAVFHERY (SEQ ID NO: 68);(iii) RSDEIVLTV (SEQ ID NO: 69);(iv) KLHGILVEA (SEQ ID NO: 45);(v) HAYSAAELK (SEQ ID NO: 75);(vi) SVLSEQFTK (SEQ ID NO: 76);(vii) KYASVEASKL (SEQ ID NO: 77);(viii) DSKLAVSL (SEQ ID NO: 70);(ix) AETTGLIKL (SEQ ID NO: 71);(x) GPSEYPTKNYV (SEQ ID NO: 72); or (xi) DSKARLVL (SEQ ID NO: 74) only.

[0433] The isolated peptide may be administered to a human subject in order to treat or prevent a PRAME associated disease or condition, a CTCFL associated disease or condition, or a CLDN6 associated disease or condition. For example, the isolated peptide may be administered to the subject in order to induce or enhance their immune response. The peptide may therefore be administered to the subject to induce T cell activation (e.g. in vivo T cell activation) in the subject, wherein the activated T cells are specific for the peptide (and thus will specifically target the cancer-associated antigen).

[0434] The isolated peptide may be administered as a peptide vaccine for treating or preventing a PRAME associated disease or condition, a CTCFL associated disease or condition, or a CLDN6 associated disease or condition. The isolated peptide may be administered to induce or enhance activation of T cells specific for PRAME, CTCFL, or CLDN6 positive malignant cells.

[0435] The inventors have shown that the peptides described herein are ovarian-cancer associated peptides (e.g. peptides derived from PRAME, peptides derived from CTCFL or peptides derived from CLDN6 that bind to T cells). In some examples, these peptides are presented to the T cell repertoire of a PRAME, CTCFL or CLDN6 positive subject in vivo. Binding of several of these peptides to T cells has been demonstrated herein. These peptides therefore represent bonafide immunogenic OVCA-specific antigens that may be further exploited in the development of personalized vaccines, which may be particularly useful as an adjunct to other therapies (e.g. ACT as described herein). These immunogenic peptides can therefore be used as an immunotherapy in the form of peptide, RNA, DNA, dendritic cell based therapies, and adoptive TCR transgenic T cell-based therapies (for a suitable review, see ref 23).

[0436] An isolated peptide comprising an amino acid sequence selected from the group consisting of: (i) SPSVSQLSVL (SEQ ID NO: 44); (ii) CSAVFHERY (SEQ ID NO: 68);(iii) RSDEIVLTV (SEQ ID NO: 69);(iv) KLHGILVEA (SEQ ID NO: 45);(v) HAYSAAELK (SEQ ID NO: 75);(vi) SVLSEQFTK (SEQ ID NO: 76);(vii) KYASVEASKL (SEQ ID NO: 77);(viii) DSKLAVSL (SEQ ID NO: 70);(ix) AETTGLIKL (SEQ ID NO: 71);(x) GPSEYPTKNYV (SEQ ID NO: 72); and (xi) DSKARLVL (SEQ ID NO: 74) may therefore be useful as an immunotherapy. For example, such isolated peptides may be used as an immunotherapy for subjects with, at risk of developing, or suspected of having a PRAM E associated disease or condition, a CTCFL associated disease or condition, or a CLDN6 associated disease or condition. Nucleic acid sequences and vectors encoding these peptides may also be useful for this purpose.

[0437] The particular peptide for administration may be chosen based on the HLA-A status of the subject. As explained elsewhere herein, a peptide comprising the sequence of SPSVSQLSVL (SEQ ID NO: 44) may be particularly suitable for administration to a subject that is HLA-B*07:02 positive; a peptide comprising the sequence of CSAVFHERY (SEQ ID NO: 68) may be particularly suitable for administration to a subject that is HLA-A*01 :01 positive; a peptide comprising the sequence of RSDEIVLTV (SEQ ID NO: 69) may be particularly suitable for administration to a subject that is HLA-A*01 :01 positive; a peptide comprising the sequence of KLHGILVEA (SEQ ID NO: 45) may be particularly suitable for administration to a subject that is HLA-A*02:01 positive; a peptide comprising the sequence HAYSAAELK (SEQ ID NO: 75) may be particularly suitable for administration to a subject that is HLA-A*03:01 positive; a peptide comprising the sequence SVLSEQFTK (SEQ ID NO: 76) may be particularly suitable for administration to a subject that is HLA-A*03:01 positive; a peptide comprising the sequence KYASVEASKL (SEQ ID NO: 77) may be particularly suitable for administration to a subject that is HLA-A*24:02 positive; a peptide comprising the sequence DSKLAVSL (SEQ ID NO: 70) may be particularly suitable for administration to a subject that is HLA-B*08:01 positive; a peptide comprising the sequence AETTGLIKL (SEQ ID NO: 71) may be particularly suitable for administration to a subject that is HLA-B*40:01 positive; a peptide comprising the sequence GPSEYPTKNYV (SEQ ID NO: 72) may be particularly suitable for administration to a subject that is HLA-A*01 :01 positive; and a peptide comprising the sequence DSKARLVL (SEQ ID NO: 74) may be particularly suitable for administration to a subject that is HLA-B*08:01 positive.

[0438] Isolated peptides of the invention may also be provided in compositions that comprise more than one of the peptides discussed above. Any combination of one or more peptides selected from (i) to (xi) may therefore be provided in a composition.

[0439] An isolated nucleic acid sequence encoding the peptide described herein is provided.

[0440] A vector system comprising a nucleic acid sequence described herein (e.g. an isolated nucleic acid sequence encoding the peptide described herein) is also provided. Vector systems are described elsewhere herein and the information, definitions, and examples provided elsewhere herein regarding vector systems apply equally here (e.g. wherein the cancer-associated antigen comprises PRAME, CTCFL or CLDN6, or an antigen or peptide thereof, e.g. in the context of a vector system comprising an isolated nucleic acid sequence encoding the peptide described herein).

[0441] A nucleic acid composition, vector system, modified cell, isolated peptide or isolated nucleic acid sequence described herein may be provided as part of a pharmaceutical composition. Advantageously, such compositions may be administered to a human subject in need thereof (as described elsewhere herein). A particularly suitable composition may be selected based on the HI_A serotype of the human subject, as described in detail elsewhere herein.

[0442] Accordingly, a pharmaceutical composition may comprise a nucleic acid composition, vector system, modified cell, isolated peptide or isolated nucleic acid sequence described herein along with a pharmaceutically acceptable excipient, adjuvant, diluent and / or carrier.

[0443] Pharmaceutical compositions are described elsewhere herein and the information, definitions, and examples provided elsewhere herein regarding pharmaceutical compositions apply equally here (e.g. wherein the cancer-associated antigen comprises PRAME, CTCFL or CLDN6, or an antigen or peptide thereof, e.g. in the context of a pharmaceutical composition comprising a nucleic acid composition, vector system, modified cell, isolated peptide or isolated nucleic acid sequence described herein along with a pharmaceutically acceptable excipient, adjuvant, diluent and / or carrier). In some examples, the pharmaceutical composition is formulated as a vaccine (e.g. where the pharmaceutical composition comprises an isolated peptide described herein, a nucleic acid sequence encoding an isolated peptide described herein, or a vector system comprising said isolated nucleic acid sequence).

[0444] Pharmaceutical compositions described herein may advantageously be administered to a HLA- B*07:02, HLA-A*01:01, HLA-A*02:01, HLA-A*03:01 , HLA-A*24:02, HLA-B*08:01 or HLA-B*40:01 positive human subject in need thereof (where certain compositions are more suitable for certain human subjects, based on their HLA status, as described in more detail elsewhere herein).

[0445] The treatment of a subject is described elsewhere herein and the information, definitions, and examples provided elsewhere herein regarding the treatment of a subject apply equally here (e.g. wherein the cancer-associated antigen comprises PRAME, CTCFL or CLDN6, or an antigen or peptide thereof, e.g. in the context of a pharmaceutical composition comprising a nucleic acid composition, vector system, modified cell, isolated peptide or isolated nucleic acid sequence described herein along with a pharmaceutically acceptable excipient, adjuvant, diluent and / or carrier).

[0446] Accordingly, as described elsewhere herein, typically, the subject in need of treatment has a disease or condition that is associated with an elevated level of HLA- restricted cancer associated- antigens (i.e. cancer-associated antigens that are presented at the cell surface in the context of an HLA). For example, PRAME, CTCFL and / or CLDN6 antigens that are presented at the cell surface in the context of an HLA. Accordingly, in some examples, the subject in need of treatment has a disease or condition that is associated with an elevated level of H LA-restricted PRAME antigen, an elevated level of H LA-restricted CTCFL antigen or an elevated level of H LA-restricted CLDN6 antigen.

[0447] The disease or condition is typically a PRAME associated disease or condition, a CTCFL associated disease or condition and / or a CLDN6 associated disease or condition. In one example, the disease or condition is a CLDN6 associated disease or condition.

[0448] Accordingly, in one example, the pharmaceutical composition described herein is for use in treating or preventing a PRAME associated disease or condition, a CTCFL associated disease or condition, or a CLDN6 associated disease or condition in a subject.

[0449] A method of treating or preventing a PRAME associated disease or condition, a CTCFL associated disease or condition, or CLDN6 associated disease or condition in a subject is also provided, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.

[0450] Suitably, the method may induce or enhance a cell mediated immune response in the subject.

[0451] A method of inducing or enhancing an immune response in human subject diagnosed with a PRAME associated disease or condition, a CTCFL associated disease or condition, or a CLDN6 associated disease or condition is also provided, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.

[0452] A method of stimulating a cell mediated immune response to a target cell population or tissue in a human subject is also provided, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.

[0453] A method of providing anti-tumor immunity to a human subject is also provided, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.

[0454] A method of treating a human subject having a disease or condition associated with an elevated level of HI_A-restricted PRAME antigen, an elevated level of HI_A-restricted CTCFL antigen, or an elevated level of H LA-restricted CLDN6 antigen is also provided, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition provided herein.

[0455] Use of a pharmaceutical composition described herein in the manufacture of a medicament for treating or preventing a PRAME associated disease or condition or, a CTCFL associated disease or condition, or CLDN6 associated disease or condition in a subject is also provided.

[0456] Use of a pharmaceutical composition described herein in the manufacture of a medicament for use in inducing or enhancing an immune response in human subject diagnosed with a PRAME associated disease or condition, a CTCFL associated disease or condition, or a CLDN6 associated disease or condition is also provided.

[0457] Use of a pharmaceutical composition described herein in the manufacture of a medicament for use in in stimulating a cell mediated immune response to a target cell population or tissue in a human subject is also provided. Use of a pharmaceutical composition described herein in the manufacture of a medicament for use in providing anti-tumor immunity to a human subject is also provided.

[0458] Use of a pharmaceutical composition described herein in the manufacture of a medicament for use in treating an human subject having a disease or condition associated with an elevated level of H LA- restricted PRAME antigen, an elevated level of H LA-restricted CTCFL antigen or an elevated level of H LA-restricted CLDN6 antigen is also provided.

[0459] In one example, the PRAME associated disease or condition, the CTCFL associated disease or condition, or the CLDN6 associated disease or condition may be a hyperproliferative disease or condition. The PRAME associated disease or condition, the CTCFL associated disease or condition, or the CLDN6 associated disease or condition (e.g. the hyperproliferative disease or condition) is typically one in which a H LA- restricted cancer-associated antigen described herein is presented at the cell surface in the context of a HLA, e.g. a PRAME, a CTCFL or a CLDN6 antigen presented at the cell surface in the context of an HLA.

[0460] Suitable examples of appropriate PRAME associated diseases or conditions or CTCFL associated diseases or conditions are described elsewhere herein and apply equally here.

[0461] In one example, the PRAME associated disease or condition, the CTCFL associated disease or condition, and / or the CLDN6 associated disease or condition may be a hematological malignancy. For example, it may be a hematological malignancy with an elevated level of HLA- restricted CLDN6 antigens.

[0462] In an alternative example, the PRAME associated disease or condition, the CTCFL associated disease or condition, and / or the CLDN6 associated disease or condition may be a solid tumor. For example, it may be a solid tumor with an elevated level of H LA-restricted CLDN6 antigens.

[0463] The PRAME associated disease or condition, the CTCFL associated disease or condition or the CLDN6 associated disease or condition may be a hyperproliferative disease or condition. For example, the CLDN6 associated disease or condition may be a H LA-restricted CLDN6 antigen expressing tumor or cancer. In other words, the CLDN6 associated disease or condition may be a CLDN6 positive tumor or cancer.

[0464] In an example, the pharmaceutical composition provided herein is for use in inducing or enhancing an immune response in human subject diagnosed with a PRAME associated disease or condition, a CTCFL associated disease or condition or a CLDN6 associated disease or condition.

[0465] As would be clear to a person skilled in the art, an appropriate therapy for subject in need thereof (e.g. an appropriate pharmaceutical composition described herein) may be selected based on the HLA serotype of the subject.

[0466] In one example, if the subject in need thereof is HI_A-B*07:02 positive, an appropriate therapy (e.g. an appropriate pharmaceutical composition described herein) may comprise components of TCR clone 8.10C4 exemplified herein. Accordingly, TCRs comprising components of TCR clone 8.10C4 exemplified herein are particularly suitable for administration, or treating, stimulating, providing appropriate immunity (e.g. anti-tumor immunity etc) in HLA-B*07:02 positive human subjects.

[0467] In one example, if the subject in need thereof is HI_A-A*02:01 positive, an appropriate therapy (e.g. an appropriate pharmaceutical composition described herein) may comprise components of TCR clone 39.2E12 exemplified herein. Accordingly, TCRs comprising components of TCR clone 39.2E12 exemplified herein are particularly suitable for administration, or treating, stimulating, providing appropriate immunity (e.g. anti-tumor immunity etc) in HLA-A*02:01 positive human subjects.

[0468] It would be clear to a person skilled in the art that certain compositions are more suitable for treating certain diseases or conditions. For example, compositions comprising PRAME binding proteins or nucleic acid components encoding the same or PRAME derived peptides, are particularly suitable for treating PRAME associated diseases or conditions. Similarly, compositions comprising CTCFL binding proteins, or nucleic acid components encoding the same or CTCFL derived peptides, are particularly suitable for treating CTCFL associated diseases or conditions. Similarly, compositions comprising CLDN6 binding proteins, or nucleic acid components encoding the same or CLDN6 derived peptides, are particularly suitable for treating CLDN6 associated diseases or conditions. Specific examples of PRAME binding proteins, CTCFL binding proteins, and CLDN6 binding proteins, PRAME peptides, CTCFL peptides and CLDN6 peptides are provided herein.

[0469] In another example, the pharmaceutical composition may be for use in stimulating a cell mediated immune response to a target cell population or tissue in a human subject. In one example, it may be a target cell population or tissue comprising a H LA-restricted PRAME antigen, H LA- restricted CTCFL antigen or a H LA-restricted CLDN6 antigen expressing tumor or cancer.

[0470] The pharmaceutical composition may also be for use in providing anti-tumor immunity to a human subject. For example, the pharmaceutical composition may be for use in providing anti-tumor immunity against a tumor in which a H LA- restricted PRAME antigen, H LA-restricted CTCFL antigen or a H LA- restricted CLDN6 antigen described herein is presented at the cell surface in the context of a H LA.

[0471] In another example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with an elevated level of HLA-restricted cancer- associated antigen. For example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with an elevated level of HLA-restricted PRAME antigen, an elevated level of HLA-restricted CTCFL antigen or an elevated level of HLA- restricted CLDN6 antigen. For example, the pharmaceutical composition may be for use in treating a human subject having a disease or condition associated with an elevated level of HLA- restricted PRAME, CTCFL and / or CLDN6 (e.g. of HLA-restricted PRAME antigen, HLA-restricted CTCFL antigen or HLA-restricted CLDN6 antigen).

[0472] A person of skill in the art will be fully aware of PRAM E associated diseases or conditions, CTCFL associated diseases or conditions and CLDN6 associated diseases or conditions that may be treated in accordance with the invention. Appropriate examples of such diseases or conditions are discussed elsewhere herein.

[0473] As would be clear to a person skilled in the art, the PRAME associated diseases or conditions, the CTCFL associated diseases or conditions, the CLDN6 associated diseases or conditions may comprise at least one tumor (particularly, at least one HLA-restricted PRAME antigen expressing tumor, at least one HLA-restricted CTCL antigen expressing tumor or at least one CLDN6 antigen expressing tumour). For example, a HLA-restricted PRAME antigen, a HLA-restricted CTCFL antigen expressing tumor and / or a HLA-restricted CTCFL antigen.

[0474] Advantageously, the compositions described herein may be formulated for use in T cell receptor (TCR) gene transfer, an approach that is rapid, reliable and capable of generating large quantities of T cells with specificity for cancer-associated antigenic peptides (e.g. the peptides shown in any one of SEQ ID NOs: 44, 68 -71 , 45, 75- 77, 72 and 74), regardless of the patient’s pre-existing immune repertoire. Using TCR gene transfer, modified cells suitable for infusion may be generated within a few days.

[0475] Advantageously, the compositions of the invention may be formulated for use as a vaccine (e.g. a composition comprising one or more peptides selected from the group consisting of:(i) SPSVSQLSVL (SEQ ID NO: 44); (ii) CSAVFHERY (SEQ ID NO: 68);(iii) RSDEIVLTV (SEQ ID NO: 69);(iv) KLHGILVEA (SEQ ID NO: 45);(v) HAYSAAELK (SEQ ID NO: 75);(vi) SVLSEQFTK (SEQ ID NO: 76);(vii) KYASVEASKL (SEQ ID NO: 77);(viii) DSKLAVSL (SEQ ID NO: 70);(ix) AETTGLIKL (SEQ ID NO: 71);(x) GPSEYPTKNYV (SEQ ID NO: 72); and (xi) DSKARLVL (SEQ ID NO: 74) may be formulated as a pharmaceutical composition that is suitable for use as a peptide vaccine. Suitable peptide vaccine formulations are well known in the art.

[0476] A method of generating a binding protein that is capable of specifically binding to a peptide containing a cancer-associated antigen and does not bind to a peptide that does not contain the cancer-associated antigen is also provided, comprising contacting a nucleic acid composition (or vector system) described herein with a cell under conditions in which the nucleic acid composition is incorporated and expressed by the cell, wherein the cancer-associated antigen is a peptide selected from the group consisting of: SPSVSQLSVL (SEQ ID NO: 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74).

[0477] Methods of generating binding proteins are described elsewhere herein and the information, definitions, and examples provided elsewhere herein regarding methods of generating binding proteins apply equally here (e.g. wherein the cancer-associated antigen comprises PRAME, CTCFL or CLDN6, or an antigen or peptide thereof, e.g. in the context of a method of generating a binding protein that is capable of specifically binding to a peptide containing an cancer- associated antigen and does not bind to a peptide that does not contain the cancer-associated antigen, comprising contacting a nucleic acid composition (or vector system) described herein with a cell under conditions in which the nucleic acid composition is incorporated and expressed by the cell, wherein the cancer-associated antigen is a peptide selected from the group consisting of: SPSVSQLSVL (SEQ ID NO: 44), CSAVFHERY (SEQ ID NO: 68), RSDEIVLTV (SEQ ID NO: 69), KLHGILVEA (SEQ ID NO: 45), HAYSAAELK (SEQ ID NO: 75), SVLSEQFTK (SEQ ID NO: 76), KYASVEASKL (SEQ ID NO: 77), DSKLAVSL (SEQ ID NO: 70), AETTGLIKL (SEQ ID NO: 71), GPSEYPTKNYV (SEQ ID NO: 72) and DSKARLVL (SEQ ID NO: 74)). In the context of the binding proteins described herein, the cancer-associated antigen may comprise or consist of a sequence comprising an amino acid sequence selected from the group consisting of: SEQ ID NOs: 44, 68 -71 , 45, 75- 77, 72 and 74, or a functional fragment or variant thereof.

[0478] General definitions are provided elsewhere herein. The information, definitions, and examples provided in the general definitions section above apply equally here (e.g. wherein the cancer- associated antigen comprises PRAME, CTCFL or CLDN6, or an antigen or peptide thereof).

[0479] Accordingly, the cancer-associated antigen may be a PRAME antigen, a CTCFL antigen or a CLDN6 antigen. In other words, the (cancer-associated) antigen may be derived from PRAME, CTCFL and / or CLDN6.

[0480] The cancer-associated peptide antigen may be a PRAME, CTCFL or CLDN6 peptide antigen. In other words, the cancer-associated antigen may be derived from a PRAME protein, a CTCFL protein and / or a CLDN6 protein (see for example, SEQ ID NO: 44, 68 -71 , 45, 75- 77, 72 and 74). The cancer-associated peptide antigen may comprise or consist of an amino acid sequence selected from the group consisting of: SEQ ID NO: 44, 68 -71 , 45, 75- 77, 72 and 74. Additionally, for the purposes of this disclosure, the cancer-associated peptide antigen: H LA complex may comprise a peptide: H LA complex selected from the group consisting of: a SPSVSQLSVLHLA- B*07:02 complex, a CSAVFHERY:HLA-A*01:01 complex, a RSDEIVLTV:HLA-A*01 :01 complex, a KLHGILVEA:HLA-A*02:01 complex, a HAYSAAELK:HLA-A*03:01 complex, a SVLSEQFTK: HLA-A*03:01 complex, a KYASVEASKL:HLA-A*24:02 complex, a DSKLAVSL:HLA-B*08:01 complex, a AETTGLIKL:HLA-B*40:01 complex, a GPSEYPTKNYV:HLA-A*01:01 complex and a DSKARLVL:HLA-B*08:01 complex.

[0481] The term "cancer-associated-specific binding protein," is defined elsewhere herein and encompasses a protein or polypeptide, such as a TCR or CAR, that specifically binds to a CLDN6 antigen (or a CLDN6:HLA-A*01 :01 complex or a CLDN6:HLA-B*08:01 complex) and does not bind a peptide sequence that does not include the CLDN6 antigen. The cancer-associated peptide antigen may comprise or consist of an amino acid sequence selected from the group consisting of: SEQ ID NO: 44, 68 -71 , 45, 75- 77, 72 and 74, and the cancer-associated peptide antigen: H LA complex may comprise a peptide:HLA complex selected from the group consisting of: a SPSVSQLSVL:HLA-B*07:02 complex, a CSAVFHERY:HLA-A*01:01 complex, a RSDEIVLTV:HLA-A*01 :01 complex, a KLHGILVEA:HLA-A*02:01 complex, a HAYSAAELK:HLA- A*03:01 complex, a SVLSEQFTK: HLA-A*03:01 complex, a KYASVEASKL:HLA-A*24:02 complex, a DSKLAVSL:HLA-B*08:01 complex, a AETTGLIKL:HLA-B*40:01 complex, a GPSEYPTKNYV:HLA-A*01:01 complex and a DSKARLVL:HLA-B*08:01 complex.

[0482] The selective binding may be in the context of cancer-associated antigen presentation by HI_A- B*07:02, HLA-A*01:01, HLA-A*02:01 , HLA-A*03:01, HLA-A*24:02, HLA-B*08:01 or HLA- B*40:01. The peptides capable of being presented by particular HI_As are described elsewhere herein.

[0483] Accordingly, in certain examples a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:44, may only do so when it is being presented (i.e. it is bound by) HLA-B*07:02 or is in an equivalent structural formation as when it is being presented by HLA-B*07:02. In another example, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:68, may only do so when it is being presented (i.e. it is bound by) HLA-A*01 :01 or is in an equivalent structural formation as when it is being presented by HLA-A*01 :01. In another example, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:69, may only do so when it is being presented (i.e. it is bound by) HLA-A*01 :01 or is in an equivalent structural formation as when it is being presented by HLA-A*01 :01 . In another example, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:45, may only do so when it is being presented (i.e. it is bound by) HLA-A*02:01 or is in an equivalent structural formation as when it is being presented by HI_A-A*02:01. In another example, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:75, may only do so when it is being presented (i.e. it is bound by) HLA- A*03:01 or is in an equivalent structural formation as when it is being presented by HLA- A*03:01.ln another example, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:76, may only do so when it is being presented (i.e. it is bound by) HLA-A*03:01 or is in an equivalent structural formation as when it is being presented by HLA-A*03:01. In another example, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:77, may only do so when it is being presented (i.e. it is bound by) HLA-A*24:02 or is in an equivalent structural formation as when it is being presented by HLA-A*24:02. In another example, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NQ:70, may only do so when it is being presented (i.e. it is bound by) HLA-B*08:01 or is in an equivalent structural formation as when it is being presented by HLA-B*08:01 . In another example, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:71 may only do so when it is being presented (i.e. it is bound by) HLA-B*40:01 or is in an equivalent structural formation as when it is being presented by HI_A-B*40:01. In another example, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:72 may only do so when it is being presented (i.e. it is bound by) HLA- A*01 :01 or is in an equivalent structural formation as when it is being presented by HLA- A*01 :01.ln another example, a binding protein that “specifically binds to a cancer associated antigen”, in particular the peptide of SEQ ID NO:74 may only do so when it is being presented (i.e. it is bound by) HLA-B*08:01 or is in an equivalent structural formation as when it is being presented by HI_A-B*08:01. Therefore, specific binding to any one of these peptides may occur in the context of the appropriate HLA (i.e. specific binding to the peptide may occur only when it is presented by the appropriate HI_A).

[0484] By “specifically bind(s) to” as it relates to a T cell receptor, or as it refers to a recombinant T cell receptor, nucleic acid fragment, variant, or analog, or a modified cell, such as, for example, the PRAME, CTCFL and CLDN6 T cell receptors, and PRAME- ,CTCFL- or CLDN6-expressing modified cells herein, is meant that the T cell receptor, or fragment thereof, recognizes, or binds selectively to the particular antigen (e.g. a PRAME antigen, a CTCFL antigen or a CLDN6 antigen,) as appropriate (e.g. wherein the PRAME antigen comprises SEQ ID NO: 44, wherein the CTCFL antigen comprises a sequences selected from the group consisting of: SEQ ID NOs: 68-71 , 45 and 75-77, or wherein the CLDN6 antigen comprises the sequence of SEQ ID NO: 72 or 74).

[0485] Under certain conditions, for example, in an immunoassay, for example an immunoassay discussed herein, the T cell receptor binds to a PRAME antigen, a CTCFL antigen or a CLDN6 antigen (e.g. wherein the PRAME antigen comprises SEQ ID NO: 44, wherein the CTCFL antigen comprises a sequences selected from the group consisting of: SEQ ID NOs: 68-71 , 45 and 75- 77, or wherein the CLDN6 antigen comprises the sequence of SEQ ID NO: 72 or 74, as appropriate) and does not bind in a significant amount to other polypeptides. Thus the T cell receptor may bind to a PRAME antigen, a CTCFL antigen or a CLDN6 antigen (e.g. wherein the PRAME antigen comprises SEQ ID NO: 44, wherein the CTCFL antigen comprises a sequences selected from the group consisting of: SEQ ID NOs: 68-71 , 45 and 75-77, or wherein the CLDN6 antigen comprises the sequence of SEQ ID NO: 72 or 74, as appropriate) with at least 10, 100, or 1000, fold more affinity than to a control antigenic polypeptide. This binding may also be determined indirectly in the context of a modified T cell that expresses a PRAME, a CTCFL or a CLN6 TCR. In assays such as, for example, an assay discussed herein, the modified T cell is specifically reactive against a PRAME, CTCFL or CLDN6 expressing melanoma cell line as appropriate (e.g. a SK2.3 cell line) or a PRAME, CTCFL or CLDN6 expressing multiple myeloma cell line, as appropriate (e.g. a U266 cell line). Thus, the modified PRAME-TCR, CTCFL-TCR or CLDN6-TCR expressing T cell may bind to a PRAME-, CTCFL- or CLDN6 - expressing melanoma or a PRAME-, CTCFL- or CLDN6- expressing multiple myeloma cell line (e.g. a SK2.3 cell line or a U266 cell line, respectively) with at least 10, 100, or 1000, fold more reactivity when compared to its reactivity against a control cell line that is not a PRAME-, CTCFL- or CLDN6- expressing melanoma or a PRAME-, CTCFL- or CLDN6- expressing multiple myeloma cell line (e.g. a SK2.3 cell line or U266 cell line, respectively), as appropriate.

[0486] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. For example, Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d Ed., John Wiley and Sons, NY (1994); and Hale and Marham, The Harper Collins Dictionary of Biology, Harper Perennial, NY (1991) provide those of skill in the art with a general dictionary of many of the terms used in the invention. Although any methods and materials similar or equivalent to those described herein find use in the practice of the present invention, the preferred methods and materials are described herein. Accordingly, the terms defined immediately below are more fully described by reference to the Specification as a whole. Also, as used herein, the singular terms "a", "an," and "the" include the plural reference unless the context clearly indicates otherwise. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary, depending upon the context they are used by those of skill in the art.

[0487] Aspects of the invention are demonstrated by the following non-limiting examples.

[0488] EXAMPLE 1- PRAME and CTCFL-reactive TCRs for the treatment of ovarian cancer patients

[0489] As discussed elsewhere herein, ovarian cancer (OVCA) is the fifth most lethal cancer type among women. Recurrent disease and treatment resistance emerges in the majority of patients with ovarian cancer (OVCA). Immunotherapies are explored and adoptive T-cell based therapies with T-cell receptors (TCRs) targeting tumor-associated antigens (TAAs) are considered promising solutions for non-immunogenic tumors. However, in order to treat a broader patient population, more TCRs specific for additional peptides derived from different TAAs binding in various HLA class I molecules are essential.

[0490] As described herein, the inventors sought to find stringent tumor-specific TAAs in ovarian cancer and high-affinity TCRs targeting these targets. By performing a differential expression analysis using mRNA-seq datasets, the inventors identified PRAME, CTCFL and CLDN6 as stringent tumor-specific TAAs, with high expression in OVCA and at least 20 fold lower expression in all healthy tissues of risk. In OVCA patient samples as well as cell lines, the inventors confirmed expression by RT-qPCR and identified naturally expressed peptides in the HLA class I ligandome. Subsequently, the inventors surprisingly isolated high-avidity T-cell clones recognizing these peptides from the allo-HI_A T-cell repertoire of 25 healthy individuals. Using large panels of OVCA patient samples, OVCA cell lines and healthy cell subsets, the inventors advantageously identified two novel PRAME TCRs and one novel CTCFL TCR with potent and specific anti-tumor reactivity in recognition and killing assays.

[0491] In CTCFL negative tumor cells the inventors demonstrated that demethylating agent DAC can induce CTCFL expression, resulting in reactivity by the CTCFL TCR-T cells.

[0492] Advantageously, as described herein, the inventors show that the TCRs identified are promising candidates for the treatment of patients with OVCA and are an essential expansion to the currently used HLA-A*02:01 restricted PRAME TCRs. The inventors expect the differentially expressed genes, naturally expressed peptides and TCRs identified herein to improve the use of T-cell based therapies in patients with OVCA.

[0493] Materials and Methods

[0494] Differential gene expression analysis

[0495] Publicly available datasets (TCGA (https: / / www.cancer.gov / tcga); GTEx

[0047] ; HPA

[0048] ) were accessed through the online resource Recount2

[0496] (https: / / jhubiostatistics. shinyapps. io / recount / )

[0049] . Read alignment against the hg38 reference genome and mRNA quantification were part of the Recount2 pre-processing pipeline, raw count tables were obtained and combined into one comprehensive dataset. For each distinct primary cancer tissue from the TCGA 30 samples were randomly chosen. Random sampling was also applied for the GTEx dataset, with maximum number of 20 samples, if available. Regarding the HPA dataset, all samples were included (3-5 samples per tissue). The compiled dataset consisted of a total of 2202 samples and was normalized utilizing the EdgeR package and its Relative Log Expression (RLE) method[50, 51] in R (v3.4.3). Finally, the dataset was filtered to retain only those genes showing evidence of expression in ovarian cancer, as defined by a minimum mean of 100 read counts (16855 genes in total). Differential gene expression analysis was performed using the EdgeR package after fitting a quasi-likelihood negative binomial generalized log-linear model to the count data. Genes were defined to be DE in ovarian cancer when they exhibited an absolute minimum fold change (FC) of > 20 and FDR adjusted p-value of < 0.05. Mean expression in ovarian cancer was compared against most of the healthy tissues present in the dataset, only tissues from reproductive organs and tumors were excluded. elution

[0497] 7 solid OVCA patient samples (2 - 20 gram) were collected and dissociated using the gentleMACS (Miltenyi Biotec) procedure (see Supplemental Methods below). Also 1 ascites OVCA patient sample (6*109cells) and 3 primary AML samples (65 - 500*109cells) were collected. Furthermore, various cell lines were expanded up to at least 2*109cells. Cell lines transduced with HLA alleles, CLDN6 and / or CTCFL were first enriched for marker gene expression via magnetic-activated cell sorting (MACS) or fluorescence-activated cell sorting (FACS). HLA typing of all samples / cell lines was performed and gene expression was quantified by Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) (see Supplemental Methods below).

[0498] HLA class l-peptide elution procedure, fractionation and mass spectrometry

[0499] Cell pellets were lysed and subjected to an immunoaffinity column to collect bound peptide-HLA complexes, peptides were subsequently separated, fractionated and analyzed by data-dependent MS / MS (see Supplemental Methods below). Proteome Discoverer V.2.1 (Thermo Fisher Scientific) was used for peptide and protein identification, using the mascot search node for identification (mascot V.2.2.04) and the UniProt Homo Sapiens database (UP000005640; Jan 2015; 67,911 entries). Peptides were in-house synthesized using standard Fmoc chemistry and PE-conjugated pMHC-multimers were generated with minor modifications (see Supplemental Methods below).

[0500] Cell culture

[0501] T cells were cultured in T-cell medium (TCM) and (re)stimulated every 10-14 days with autologous feeders (see Supplemental Methods below). OVCA cell lines COV-318 / -362.4 / -413b / -434 / -504 / - 641 were established at the department of Medical Oncology (LUMC, NL).

[0052] OVCA cell lines OVCAR-3 and SK-OV-3 were obtained from the ATCC and A2780 from the ECACC. Primary OVCA-L11 cells (isolated from bulk tumor tissue using the gentleMACS) and OVCA-L23 cells (malignant cells present in ascites) were thawed three days before being used as target cells in screening experiments. OVCA cell lines, other tumor cell lines and primary OVCA cells were cultured in various media (see Supplemental Methods below). CD14-derived mDCs and imDCs, and activated CD19 cells were isolated from PBMCs of different healthy donors and generated as previously described.

[0023] Purity of the generated cells was assessed using flow cytometry (see Supplemental Methods below). Fibroblasts and keratinocytes, both cultured from skin biopsies, were cultured as previously described.

[0023] PTECs derived from kidney tubules were isolated and cultured as previously described.

[0053]

[0502] DAC treatment DAC (5-aza-2'-deoxycytidine) (A3656, Sigma-Aldrich) was dissolved in Dimethyl sulfoxide (DMSO). Target cells were at 50% confluency at start of treatment and were treated with 1 pM DAC on day 1 and 4. DMSO treated cells served as negative control. On day 7, cells were harvested for T-cell reactivity assays and RNA isolation to determine gene expression by RT- qPCR.

[0503] Isolation of OVCA-specific T cells by pMHC-multimer enrichment

[0504] Buffy coats of healthy donors were collected after informed consent (Sanquin). PBMCs were isolated using Ficoll gradient separation and incubated with the selection of pMHC-multimers for 1 hour at 4°C or 15 minutes at 37°C. pMHC-multimers were only included if the healthy donor was negative for the restricted HI_A allele. pMHC-multimer bound cells were MACS enriched using anti-PE MicroBeads (Miltenyi Biotec / 130-048-801). The positive fraction was stained with CD8 (AF700) and CD4, CD14 and CD19 (FITC). pMHC-multimer and CD8 positive cells were single-cell sorted using an Aria III cell sorter (BD Biosciences) in a 96 well round bottom plate containing 5x104irradiated PBMCs (35Gy) and 5x103EBV-JY cells (55Gy) in 100 pL TCM with 0.8 pg / mL PHA. T-cell recognition was assessed 10 - 14 days after stimulation, followed by restimulation or storage of the selected T-cell clones.

[0505] T-cell reactivity assays

[0506] T-cell recognition was measured by an IFN-y ELISA (Sanquin or Diaclone). 5,000 T cells were cocultured overnight with target cells in various effector-to-target (E:T) ratios in 60 pL TCM in 384- well flat-bottom plates (Greiner Bio-One). To upregulate HLA expression, all adherent target cells were treated for 48 hours with 100 lll / mL IFN-y (Boehringer Ingelheim) before coculture. All T cells and target cells were washed thoroughly before coculture to remove expansion-related cytokines. Supernatants were transferred during the ELISA procedure using the Hamilton Microlab STAR Liquid Handling System (Hamilton company) and diluted 1 :5, 1 :25 and / or 1 :125 to quantify IFN-y production levels within the area of the standard curve. T-cell mediated cytotoxicity was measured in a 6-hour51chromium release assay (see Supplemental methods below).

[0507] TCR identification and TCR gene transfer to CD8+ T cells

[0508] TCR a and chains of the selected T-cell clones were identified by sequencing with minor modifications (see Supplemental Methods below). The TCR chains were codon optimized, synthesized and cloned in MP71-TCR-flex retroviral vectors by Baseclear. The MP71-TCR-flex vector contains codon-optimized and cysteine-modified murine TCRa constant domains and P2A sequence to link TCR chains, resulting in optimized TCR expression and increased preferential pairing.

[0054] Apart from the OVCA-specific TCRs, a murinized CMV-specific TCR (NLVPMVATV (SEQ ID NO: 46) peptide presented in HLA-A*02:01) was included as a negative control. CD8+ T cells were isolated from PBMCs of different donors by MACS and TCRs were introduced via retroviral transduction two days after stimulation with autologous feeders. Seven days after stimulation, CD8+ T cells were MACS enriched for the murine TCR. Ten days after stimulation, CD8+ T cells were functionally tested and purity was checked by flow cytometry (more details in Supplemental Methods below).

[0509] Statistical analysis

[0510] Statistical analysis was performed using GraphPad Prism software (Version 9.0.1 .). The statistical test used is indicated in the figure legend, P < 0.05 was considered significant. Significance levels are indicated as p < .05 *, p < .01 **, p < .001 ***, and p < .0001 ****.

[0511] Study approval

[0512] AML patient samples were used from the Leiden University Medical Center Biobank for Hematological Diseases. This study was approved by the Institutional Review Board of the Leiden University Medical Center (approval number 3.4205 / 010 / FB / jr) and the METC-LDD (approval number HEM 008 / SH / sh). Materials from patients and healthy individuals were collected after written informed consent according to the Declaration of Helsinki. The OVCA samples were residual material and collected anonymously.

[0513] Supplemental Material and Methods

[0514] Dissociation OVCA patient samples

[0515] Solid OVCA tumors were sliced into small pieces and dead, clotted or non-tumor material was removed. The small tumor-pieces were added to a C-tube (Miltenyi Biotec) with ice cold buffer without detergent and complete Protease Inhibitor (Sigma-Aldrich), to prevent protein degradation. Using a gentleMACS (Miltenyi Biotec) procedure small tumor-pieces were dissociated until an almost homogenous cell solution. Benzonase (Merck) was added in a concentration of 125 lU / mL to remove DNA / RNA complexes during lysis.

[0516] Gene expression by Real-Time Quantitative Polymerase Chain Reaction

[0517] Gene expression was quantified by Real-Time Quantitative Polymerase Chain Reaction (RT- qPCR), see Supplemental Methods below. Total RNA was isolated using the RNAqueous-Micro Kit (Ambion) or ReliaPrep RNA Cell Miniprep System (Promega). First strand cDNA synthesis was performed with Moloney murine leukemia virus reverse transcriptase and Oligo (dT) primers (Invitrogen by Thermo Fisher Scientific). RT-qPCR was performed using Fast Start TaqDNA Polymerase (Roche) and EvaGreen (Biotium), and gene expression was measured on the Lightcycler 480 (Roche). All samples and genes were run in triplicate with 10 ng cDNA per reaction. Expression was calculated as percentage relative to the average of housekeeping genes GUSB, VPS29 and PSMB4, which was set at 100%. The following primers were used: PRAME (forward: GTTGCTCAGGCACGTGAT (SEQ ID NO: 47), reverse:

[0518] CCCACTTAGACTCAGGACACTTA (SEQ ID NO: 48)), CTCFL (TvX) (forward: GTCCGACACAGGCGCTATAA (SEQ ID NO: 49), reverse: CCACACTGGCATACTTGCAC (SEQ ID NO: 50)), CTCFL variant 13 (Tv13) (forward: AAAGCCATTCTTGGACTTGAAGC (SEQ ID NO: 51), reverse: TACACTTGGAGTAACTTGTACAGCA (SEQ ID NO: 52)), CLDN6 (forward: CAGGGGTCCTGACGCTAATC (SEQ ID NO: 53), reverse: AGCCACCAGGGGGTTATAGA (SEQ ID NO: 54)), GUSB (forward: ACTGAACAGTCACCGACGAG (SEQ ID NO: 55), reverse: GGAACGCTGCACTTTTTGGT (SEQ ID NO: 56)), PSMB4 (forward: GTTTCCGCAACATCTCTCGC (SEQ ID NO: 57), reverse: CATCAATCACCATCTGGCCG (SEQ ID NO: 58)), VPS29 (forward: TGAGAGGAGACTTCGATGAGAATC (SEQ ID NO: 59), reverse: TCTGCAACAGGGCTAAGCTG (SEQ ID NO: 60)).

[0519] HLA class l-peptide elution procedure, fractionation and mass spectrometry

[0520] Peptide elution was performed as outlined previously. [23, 55] In short, the cell pellets were lysed and subjected to an immunoaffinity column to collect bound peptide-HLA complexes, with either an HLA class-l antibody (W6 / 32, ATCC) or an HLA-A*02:01 antibody (BB7.2, ATCC). To separate the peptides, bound peptide-HLA complexes were dissociated with 10% acetic acid and filtrated using a 10 kDa membrane. Eluted peptide pools were either fractionated by strong cation exchange chromatography (SCX)

[0055] or by high pH reversed phase fractionation (High pH- RP)

[0056] , SCX and high pH-RP peptide fractions were lyophilized, dissolved in 95 / 3 / 0.1 water / acetonitrile / formic acid v / v / v and subsequently analysed by data-dependent MS / MS on either an LTQ FT Ultra equipped with a nanoflow liquid chromatography 1100 HPLC system (Agilent Technologies) or a Q Exactive mass spectrometer equipped with an easy-nLC 1000 (Thermo Fisher Scientific). Proteome Discoverer version 2.1 (Thermo Fisher Scientific) was used for peptide and protein identification, using the mascot search node for identification (mascot version 2.2.04) and the UniProt Homo Sapiens database (UP000005640; Jan 2015; 67,911 entries). All unique PRAME, CTCFL and CLDN6-derived peptides with a length between 8 and 14 amino acids, a minimal Best Mascot Ion (BMI) score of 20, a mass accuracy of 10 ppm and predicted to bind to a common HLA molecule according to the netMHC peptide binding algorithm were selected as candidate for peptide synthesis and validation.

[0057]

[0521] In total 34 synthetic peptides were in-house synthesized using standard Fmoc chemistry. By mass spectrometry the tandem mass spectra of the eluted peptides were validated with synthetic peptides. In total 17 pMHC-multimer complexes were generated with minor modifications.

[0058] In short, monomers consisting of the selected HLA allele heavy chain, human beta-2 microglobulin (B2M) light chain and selected peptide were purified by gel-filtration high-performance liquid chromatography and biotinylated. Subsequently, pMHC-multimers were generated by adding PE- conjugated streptavidin (Invitrogen, Thermo Fisher Scientific).

[0522] Cell culture

[0523] T cells were cultured in T-cell medium (TCM) composed of Iscove’s Modified Dulbecco’s Medium (IM DM) (Lonza), 5% heat- inactivated Fetal Bovine Serum (FBS) (Gibco, Thermo Fisher Scientific), 5% human serum (Sanquin Reagents), 1.5% 200 mM L-glutamine (Lonza), 1% 10,000 U / mL penicillin / streptomycin (Pen / Strep; Lonza) and 100 IIJ / mL IL-2 (Novartis Pharma). Every 10-14 days, 0.2*106T cells were (re)stimulated with 1*106irradiated (35 Gy) PBMCs, 0.1*106irradiated (55 Gy) EBV-LCLs and 0.8 pg / mL phytohemagglutinin (PHA) (Oxoid Microbiology Products, Thermo Fisher Scientific). OVCA cell lines were cultured in Dulbecco’s Modified Eagle Medium (DMEM, high glucose 4.5 g / L, NEAA) (Gibco), 8% FBS, 2% 200 mM L-glutamine and 1% 10,000 U / mL Pen / Strep. Other tumor cell lines were cultured in IMDM, 10% FBS, 1.5% L- glutamine and 1% Pen / Strep. Using the PlasmoTest Mycoplasma Detection Kit (InvivoGen), all cell lines were found to be mycoplasma negative. HLA typing was performed and if needed, a single HLA allele was introduced by retroviral transduction. These genes were expressed in MP71 retroviral backbone vectors with marker genes nerve growth factor receptor (NGF-R), green fluorescent protein (GFP), CD34 or mouse CD19 (mCD19). Target cells were enriched for marker gene expression via MACS or FACS and purity was confirmed by flow cytometry. Primary OVCA cells were cultured in IMDM, 10% FBS, 1.5% L-glutamine and 1 % Pen / Strep, on FBS pre-coated plates.

[0524] Antibodies and Flow cytometry

[0525] FACS was performed on an LSR II flow cytometer (BD Biosciences) and data was analysed using FlowJo software (TreeStar). T cells were stained with the following conjugated antibodies: CD4 FITC (BD / 555346), CD14 FITC (BD / 555397), CD19 FITC (BD / 555412), CD8 AF700 (lnvitrogen / MHCD0829), murine TCR-P (mTCR-P) APC (BD / 553174) and pMHC-multimers PE. Target cells transduced with PRAME, CTCFL, CLDN6 or HLA alleles were stained with: NGFR / CD271 APC (Sanbio / CL10013APC), CD34 APC (BD / 555824), murine CD19 PE (BD / 557399), HLA-A2 PE (BD / 558570). Non-malignant hematopoietic subsets with: CD14 FITC (BD / 555397), CD19 FITC (BD / 555412), CD80 PE (BD / 557227) and CD86 PE (BD / 555658).

[0526] TCR identification and production of retroviral supernatants

[0527] TCR a and p chains of the selected T-cell clones were identified by sequencing with minor modifications, as previously described.

[0059] mRNA was isolated by the Dynabeads mRNA DIRECT Kit (Invitrogen) or total RNA was isolated by the ReliaPrep RNA cell Miniprep System (Promega). TCR cDNA was generated using TCR constant a and p primers, a SA.rt anchor template-switching oligonucleotide (TSO), and SMARTScribe Reverse Transcriptase (Takara, Clontech).

[0060] The TOR a and p products were generated in a first PCR using Phusion Flash (Thermo Fisher Scientific), followed by a second PCR that was used to include 2-sided barcode sequences for the different T-cell clones. Barcoded TCR PCR products were pooled and TCR sequences were identified by HiSeq or NovaSeq (GenomeScan). The Va and Vp families were determined of the NGS data using the MiXCR software and ImMunoGeneTics (IMGT) database.

[0061] The TCR chains were codon optimized, synthesized and cloned in MP71-TCR-flex retroviral vectors by Baseclear. The MP71-TCR-flex vector contains codon-optimized and cysteine-modified murine TCRap constant domains and P2A sequence to link TCR chains, resulting in optimized TCR expression and increased preferential pairing.

[0054] Phoenix-AMPHO (ATCC) cells were transiently transfected with the created constructs and after 48 hours retroviral supernatants were harvested and stored at -80°C.

[0528] TCR gene transfer to CD8+ T cells

[0529] CD8+ T cells were isolated from PBMCs of different donors by MACS using anti-CD8 MicroBeads (Miltenyi Biotech / 130-045-201). CD8+ T cells were stimulated with irradiated autologous feeders (40 Gy) and 0.8 pg / mL PHA in 24-well flat-bottom culture plates (Costar). Two days after stimulation, CD8+ T cells were transferred to 24-well flat-bottom suspension culture plates (Greiner Bio-One) for retroviral transduction. These plates were first coated with 30 pg / mL retronectin (Takara, Clontech) and blocked with 2% human serum albumin. Retroviral supernatants were added, and plates were centrifuged at 3000 g for 20 minutes at 4°C. After removal of the retroviral supernatant, 0.3*106CD8+ T cells were transferred per well. After O / N incubation, CD8+ T cells were transferred to 24-well flat-bottom culture plates (Costar). Seven days after stimulation, CD8+ T cells were MACS enriched for the murine TCR, using mTCR-p APC antibody (BD / 553174) and anti-APC MicroBeads (Miltenyi Biotec / 130-090-855). Ten days after stimulation, CD8+ T cells were functionally tested and purity was checked by flow cytometry.

[0530] 51chromium release assay

[0531] T-cell mediated cytotoxicity was measured in a 6-hour51chromium release assay. Target cells were labelled with 100 pCi51chromium (PerkinElmer) for 1 hour at 37°C, washed, and cocultured with T cells at various E:T ratios in 100 pL TCM per well in 96-well Il-bottom culture plates (Costar). Spontaneous and maximum51Cr release for all targets were measured in separate plates with per well 100 pL TCM or 100 pL TCM with 1 % Triton-X 100 (Sigma-Aldrich), respectively. After 6 hours of coculture, 25 pL supernatant was harvested, transferred to 96-well LumaPlates (PerkinElmer) and51chromium release was measured in counts per minute on a 2450 Microbeta2plate counter (PerkinElmer). The percentage of killed target cells was calculated with the following formula = ((experimental release - spontaneous release) / (maximum release - spontaneous release)) *100.

[0532] Results

[0533] Interrogation of mRNA-seq data reveals differentially expressed genes in ovarian cancer

[0534] To identify genes that might have immuno-therapeutic potential in ovarian cancer, the inventors obtained mRNA-seq data of 2202 samples from three independent sources (TCGA, GTEx, and HPA) representing 120 healthy or tumor tissues. The inventors combined these tissues into one comprehensive dataset to perform an elaborate differential gene expression analysis (Figure 1A). Genes were defined to be differentially expressed (DE) in ovarian cancer when they exhibited an absolute fold change (FC) of > 20 compared to the different healthy tissues present in the dataset. Tissues from reproductive organs were excluded from this comparison, as expression in the reproductive compartment does not form a lethal toxicity risk for ovarian cancer patients. Nine genes were identified to be DE with a FC > 20 in ovarian cancer, the inventors plotted the minimum FC against the adjusted p-value to visualize the minimal extent of differential expression (Figure 1 B).

[0535] Six of the nine DE genes were not considered target candidates for T-cell therapy, based on lack of consistent protein expression. SLC25A3P1 , small nuclear RNU1-27P and small nuclear RNU1- 28P are pseudogenes which are assumed not to be translated.

[0024] Also microRNA MIR3687-1 , antisense RNA ELFN1-AS1 and an uncharacterized long non-coding RNA gene are classified as non-protein coding RNAs, although they do exhibit several gene regulating functions of other genes.

[0025] The final three genes: preferentially expressed antigen of melanoma (PRAME), CCCTC-binding factor (CTCFL), and Claudin-6 (CLDN6) were considered interesting target candidates. These genes were at least 20 times higher expressed in ovarian cancer compared with all healthy tissues, except for some reproductive organs (Figure 7, summarized in Figure 1C). PRAME and CTCFL were highly expressed in testis, in line with their classification as CTA.

[0026] PRAME was also found to be expressed in healthy endometrium and ovary, and CLDN6 in placenta.

[0536] To confirm expression of the three selected genes in OVCA, the inventors quantified gene expression by RT-qPCR in OVCA patient-derived solid tumor tissues and malignant ascites samples, and in OVCA cell lines (Figure 2A). PRAME and CLDN6 expression was demonstrated in most primary patient samples and OVCA cell lines. Expression of CTCFL was high in 10 / 12 tumor samples, but limited expression was observed in ascites samples and cell lines.

[0537] PRAME, CTCFL and CLDN6-derived peptides identified in the HLA class I associated ligandome The number of peptides derived from PRAME, CTCFL and CLDN6 binding in different common HLA class I molecules is currently limited, as is solid evidence of processing and presentation in the context of HI_A class I on ovarian tumors. The PRAME TCRs currently investigated in clinical trials all target the SLLQHLIGL (SEQ ID NO: 61) or VLDGLDVLL (SEQ ID NO: 62) peptide presented in HLA-A*02:01. To establish a dataset of peptides that can be targeted by TCRs, the HI_A class I associated ligandome was determined of eight OVCA patient samples and two OVCA cell lines (Table 1A-B). In order to expand the dataset, various tumor cell lines and acute myeloid leukemia (AML) patient samples expressing the selected genes were also included (Table 1C), some of these cell lines were transduced with CTCFL, CLDN6 and / or HLA class I molecules (Table 1 D). All peptides with a minimal Best Mascot Ion (BMI) score of 20 and a mass accuracy of 10 ppm were selected. CLDN6 and CTCFL share homology with ubiquitously expressed family members. Only those peptides were selected that were unique for the target genes and did not demonstrate major sequence overlap with Claudin-family members (n=47) or paralog CTCF (n=6). In addition, the inventors only continued with peptides binding to common HLA molecules according to netMHC peptide binding algorithm, that matched with t...

Claims

Claims1. An isolated nucleic acid composition that encodes a cancer-associated antigen-specific binding protein having a TCR a chain variable (Va) domain and a TCR p chain variable (VP) domain, the composition comprising:(i) a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:3, or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ I D NO:6, or a functional fragment thereof, wherein the CDR3 sequences together specifically bind to PRAME; or(ii) a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 17, or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 20, or a functional fragment thereof, wherein the CDR3 sequences together specifically bind to PRAME; or(iii) a nucleic acid sequence that encodes a TCR Va domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:31 , or a functional fragment thereof; and a nucleic acid sequence that encodes a TCR Vp domain comprising a CDR3 amino acid sequence having at least 80% sequence identity to SEQ ID NO:34, or a functional fragment thereof, wherein the CDR3 sequences together specifically bind to CTCFL.

2. The nucleic acid composition of any preceding claim, wherein:(i) the CDR3 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO:

3. and the CDR3 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO:6; or(ii) the CDR3 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO: 17, and the CDR3 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NQ:20; or(iii) the CDR3 of the Va domain comprises or consists of the amino acid sequence of SEQ ID NO: 31 , and the CDR3 of the Vp domain comprises or consists of the amino acid sequence of SEQ ID NO:34.

3. The nucleic acid composition of any preceding claim, wherein:(i) the Va domain comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 7; and the Vp domain comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 9; or(ii) the Va domain comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 21 ; and the Vp domain comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 23; or(iii) the Va domain comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 35; and the p domain comprises an amino acid sequence having at least 80% sequence identity to, comprising, or consisting of, SEQ ID NO: 37.

4. The nucleic acid composition of any preceding claim, wherein the cancer-associated antigen comprises an amino acid sequence selected from the group consisting of: LYVDSLFFL (SEQ ID NO: 43), SPSVSQLSVL (SEQ ID NO: 44) and KLHGILVEA (SEQ ID NO: 45).

5. The nucleic acid composition of claim 4, wherein the encoded binding protein is capable of specifically binding to a peptide:HLA complex selected from the group consisting of: a LYVDSLFFL:HLA-A*24:02 complex, a SPSVSQLSVL:HLA-B*07:02 complex, and a KLHGILVEA:HLA-A*02:01 complex.

6. The nucleic acid composition of any preceding claim, wherein the nucleic acid sequence is codon optimised for expression in a host cell, optionally wherein the host cell is a human cell.

7. The nucleic acid composition of any preceding claim, further comprising a TCR a chain constant domain and / or a TCR p chain constant domain.

8. The nucleic acid composition of any preceding claim, wherein the encoded binding protein comprises a TCR, an antigen binding fragment of a TCR, a chimeric antigen receptor (CAR), a T-engager or an ImmTAC.

9. The nucleic acid composition of claim 8, wherein the antigen binding fragment of a TCR is a single chain TCR (scTCR) or a chimeric TCR dimer in which the antigen binding fragment of the TCR is linked to an alternative transmembrane and intracellular signalling domain.

10. A vector system comprising a nucleic acid composition according to any one of claims 1 to 9.

11. The vector system of claim 10, wherein the vector is a plasmid, a viral vector, or a cosmid, optionally wherein the vector is selected from the group consisting of a retrovirus, lentivirus,adeno-associated virus, adenovirus, vaccinia virus, canary poxvirus, herpes virus, minicircle vector and synthetic DNA or RNA.

12. A modified cell comprising a nucleic acid composition according to any of claims 1 to 9, or a vector system according to claim 10 or 11 .

13. The modified cell of claim 12, wherein the modified cell is selected from the group consisting of a CD8 T cell, a CD4 T cell, an NK cell, an NK-T cell, a gamma-delta T cell, a hematopoietic stem cell, an inducible pluripotent stem cell, a progenitor cell, a T cell line and NK- 92 cell line.

14. The modified cell of claim 12 or 13, wherein the modified cell is a human cell.

15. A pharmaceutical composition comprising a nucleic acid composition according to any of claims 1 to 9, a vector system according to claim 10 or 11 , or a modified cell according to any of claims 12 to 14, and a pharmaceutically acceptable excipient, adjuvant, diluent and / or carrier.

16. A pharmaceutical composition according to claim 15 for use in inducing or enhancing an immune response in human subject diagnosed with a PRAME associated disease or condition or a CTCFL associated disease or condition.

17. A pharmaceutical composition according to claim 15 for use in stimulating a cell mediated immune response to a target cell population or tissue in a human subject.

18. A pharmaceutical composition according to claim 15 for use in providing anti-tumor immunity to a human subject.

19. A pharmaceutical composition according to claim 15 for use in treating an human subject having a disease or condition associated with an elevated level of H LA-restricted PRAME antigen or an elevated level of H LA-restricted CTCFL antigen.

20. The pharmaceutical composition for use according to any of claims 16 to 19 wherein the human subject has at least one tumor.

21. The pharmaceutical composition for use according to any of claims 17 to 20, wherein the subject has been diagnosed with a PRAME associated disease or condition or a CTCFL associated disease or condition.

22. The pharmaceutical composition for use according to claim 16 or 21 , wherein the PRAME associated disease or condition or the CTCFL associated disease or condition is a hematological malignancy or a solid tumor.

23. The pharmaceutical composition for use according to claim 22, wherein the hematological malignancy is selected from the group consisting of: Multiple myeloma, plasma cell leukemia, Acute lymphoblastoid leukemia (ALL), Acute myeloid leukemia (AML), and B cell lymphoma, optionally wherein the B cell lymphoma is selected from the group consisting of: Diffuse large B cell lymphoma (DLBCL), High grade B cell lymphoma, Mantel cell lymphoma (MCL), Follicular lymphoma (FL) and Burkitt Lymphoma.

24. The pharmaceutical composition for use according to claim 22, wherein the solid tumor is selected from the group consisting of: Melanoma, Uveal melanoma, Ovarian Carcinoma, Uterine carcinoma, Testicular tumors, Lung carcinoma, Lung squamous cell carcinoma, Thymoma , Synovial sarcoma, Kidney carcinoma, Breast carcinoma, Sarcoma, Bladder carcinoma, Mesothelioma, Pancreatic carcinoma, Prostate carcinoma, Colorectal carcinoma, Cervical carcinoma and Stomach carcinoma.

25. The pharmaceutical composition for use according to claim 22, where the solid tumour is selected from the group consisting of: ovarian carcinoma, synovial sarcoma, uterine carcinoma, lung carcinoma, melanoma and uveal melanoma, optionally wherein the solid tumour is ovarian carcinoma.

26. A method of generating a binding protein that is capable of specifically binding to a peptide containing a cancer-associated antigen and does not bind to a peptide that does not contain the cancer-associated antigen, comprising contacting a nucleic acid composition according to any of claims 1 to 9 with a cell under conditions in which the nucleic acid composition is incorporated and expressed by the cell, wherein the cancer-associated antigen is a PRAME antigen or a CTCFL antigen.

27. The method of claim 26, wherein the method is ex vivo.

28. An isolated nucleic acid sequence comprising or consisting of the nucleotide sequence of any one of SEQ ID NOs: 8, 10, 12, 14, 22, 24, 26, 28, 36, 38, 40 or 42.

29. An isolated nucleic acid sequence comprising or consisting of the nucleotide sequence of any one of SEQ ID NOs: 8, 10, 12, 14, 22, 24, 26, 28, 36, 38, 40 or 42 for use in therapy.

Images