Composition, immune cells comprising same, and use of said immune cells

Abstract

The invention relates to a composition comprising: - a first single-stranded nucleic acid molecule comprising a region complementary to a target and sites for recognition of a transposase; - a second single-stranded nucleic acid molecule comprising a region complementary to a target and sites for recognition of a transposase; and - a third single-stranded molecule comprising a sequence encoding CD3ζ of TCR and sites for binding of a transposase.

Description

Composition, immune cells comprising it and use thereof

[0001] The invention relates to a composition as well as immune cells comprising said composition and the use of cells comprising said composition.

[0002] T lymphocytes are a class of white blood cells that participate in the body's immune defenses by destroying pathogens and tumor cells. However, in some cancers, these tumor cells have the ability to inactivate their host's immune defenses.

[0003] CAR-T or Chimeric Antigenic Receptor-T cells are a cellular immunotherapy approach aimed at fighting certain cancers, including B-cell leukemias and certain lymphomas, by strengthening the patient's immune system.

[0004] This innovative approach involves genetically modifying T lymphocytes from the patient or a compatible donor taken from a blood sample so that they can effectively recognize and eliminate cancer cells. This ex vivo modification (outside the patient's body) allows for better control of the genetic modification to be carried out, in this case the introduction of a gene enabling the production of surface receptors (CARs) that allow T cells to attack and destroy cancer cells. Once these cells have been produced in sufficient quantity to fight the disease, they are injected into the patient's bloodstream.

[0005] Several genome editing technologies have been adapted for the production of these CAR T cells, such as CRISPR / CAS9, Zinc-finger, and TALENs. However, these technologies suffer from relative efficiency in inserting the CAR gene into T cells.

[0006] Other systems are also used, such as viral vectors (AAV, Lentivirus) and transposon-sleeping beauty, but the pseudo-specific integration of the CAR gene with these approaches can lead to downstream consequences of their use (e.g. application WO2017180989A2).

[0007] Also, given the power of CAR technology, there remains a need for the production efficiency of modified CAR-T cells.

[0008] The present invention aims to overcome these drawbacks.

[0009] An aim of the invention is to provide a composition capable of enabling the simple and efficient production of modified CAR-T T cells.

[0010] Another aim of the invention is to provide a method or a medicament capable of treating pathologies by means of said modified CAR-T T cells.

[0011] The invention relates to a composition comprising

[0012] - a first single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence being linked in 5' to a first T-rich sequence 40 to 60 nucleotides long and in 3' to a second T-rich sequence 40 to 60 nucleotides long, said first and second T-rich sequences respectively comprising a first and a second domain of 6 to 12 nucleotides rich in G / C, the sequence of the first domain being complementary to the sequence of the second domain, said first and second domains being positioned 15 to 52 nucleotides from said sequence A,said first molecule comprising at its 5' end at least a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase,

[0013] - a second single-stranded nucleic acid molecule comprising or consisting essentially of a sequence B allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence B being linked in 5' to a third T-rich sequence 40 to 60 nucleotides long and in 3' to a fourth T-rich sequence 40 to 60 nucleotides long, said third and fourth T-rich sequences respectively comprising a third and fourth domain of 6 to 12 nucleotides rich in G / C, the sequence of the third domain being complementary to the sequence of the fourth domain, said third and fourth domains being positioned 15 to 52 nucleotides from said sequence B,said second molecule comprising at its 5' end at least the first 5'-3' oriented recognition sequence of said transposase and at its 3' end the second recognition sequence of said transposase,

[0014] said sequence B being a complementary sequence to said nucleic acid of interest, sequence A being positioned 5' of a region of interest of said nucleic acid of interest and sequence B positioned 3' of the region of interest of said nucleic acid of interest, and

[0015] - a third single-stranded molecule comprising

[0016] * in its 5' part, at least one sequence complementary to said second recognition sequence of said transposase of the first molecule,

[0017] * in its 3' part at least one sequence complementary to said first recognition sequence of said transposase of the second molecule, and

[0018] * an intermediate region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule and the complementary sequence of said first recognition sequence of said transposase of the second molecule, said intermediate region comprising a sequence coding for a fusion protein, said fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the activator domain of the T lymphocyte, i.e. the CD3ζ chain of the T cell receptor or TCR,

[0019] the first and third single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase and the second and third single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase.

[0020] The invention is based on the observation made by the inventors that the use of a molecule complex as described above, and involving a bacterial transposase, allows targeted and efficient replacement of a genomic target, and produced using a sequence of interest of the CART fusions, making it possible to custom produce T cells targeting specific tumor cells.

[0021] This means that the invention relates to a molecular complex comprising a first single-stranded nucleic acid molecule, a second single-stranded nucleic acid molecule and a third single-stranded nucleic acid molecule, said third single-stranded nucleic acid molecule comprising or consisting essentially at its 5' end of at least one sequence complementary to said first recognition sequence of said transposase, and said third single-stranded nucleic acid molecule comprising or consisting essentially at its 3' end of at least one sequence complementary to said second recognition sequence of said transposase,

[0022] said complex being such that the first, second and third single-stranded nucleic acid molecules are paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites for said transposase in the 5' end of the third molecule and two double-stranded binding sites for said transposase in the 3' end of the third molecule.

[0023] The invention is based on the unexpected observation made by the inventor that the use of specific single-stranded guides capable of targeting a region of a nucleic acid of interest makes it possible to mobilize transposases in a controlled and "site-specific" manner, and thus use the recombination properties of said transposases to carry out sequence replacement in molecules of interest.

[0024] The aforementioned molecular complex is in fact the basic unit of the technology defined in the invention. This basic unit serves to guide the recombinases to a specific site where recombination, and therefore sequence replacement, must take place. Unlike the CRISPR / Cas9 system, which requires the presence of PAM-like sequences (NGG), the molecular tool defined here can be used on any target sequence, regardless of its sequence.

[0025] The aforementioned molecular complex is therefore the basic unit which will have to be completed by:

[0026] - a region homology to a 5' region of the target sequence, said homology region being represented by the sequence A and

[0027] - a region homology to a 3' region of the target sequence, said homology region being represented by sequence B.

[0028] This is therefore an intermediate product of the tool as described below.

[0029] The molecular complex consists of three single-stranded nucleic acid molecules, which can be DNA molecules, RNA molecules, or mixed RNA and DNA molecules.

[0030] These three molecules are partially complementary to each other two by two, according to the complementarity of nucleic acid bases defined by Watson and Crick, that is to say that an Adenine pairs with a Thymidine or a Uracil, and a Cytosine pairs with a Guanine, and vice versa.

[0031] More particularly, the three molecules forming the aforementioned complex each comprise the sequence of one of the strands of a double-stranded molecule corresponding to the binding sequence of a transposase. Also, each single-stranded molecule therefore comprises a “half sequence” of transposase binding and therefore cannot allow interaction with said corresponding transposase. On the other hand, when the three molecules of the complex interact together, by base pairing as defined above, a double-stranded molecule is thus formed, reconstituting a double-stranded binding site of said transposase, the latter thus being able to interact with the molecule formed.

[0032] The complex

[0033] In addition to the detailed definition of each of the first, second and third molecules, each described below, the complex according to the invention is such that it comprises two pairs of binding sites for one or more transposases, a first pair of binding sites for a first transposase due to pairing according to the complementarity of the nucleic acid bases defined by Watson and Crick between the first single-stranded nucleic acid molecule and the third nucleic acid molecule, and a second pair of binding sites for a second transposase due to pairing according to the complementarity of the nucleic acid bases defined by Watson and Crick between the second single-stranded nucleic acid molecule and the third nucleic acid molecule.

[0034] the first and second transposase may be the same or different.

[0035] Each transposase binding site consists of two double-stranded motifs, a first double-stranded motif composed of a first half transposase binding site and a sequence complementary, according to the base complementarity defined by Watson and Crick, to said first half transposase binding site, and a second double-stranded motif composed of a second half transposase binding site and a sequence complementary, according to the base complementarity defined by Watson and Crick, to said second half transposase binding site.

[0036] In the invention, with regard to the complementary sequence of a half-site for binding to a transposase, we will speak of a half-site complementary to said site.

[0037] Therefore, a transposase binding site consists of four half-sites:

[0038] - a first half transposase binding site presenting a first sequence,

[0039] - a second half transposase binding site with a second sequence,

[0040] - a third half-site which presents a complementary sequence according to the complementarity of the bases defined by Watson and Crick, of the sequence of the first half-site and

[0041] - a fourth half-site which presents a complementary sequence according to the complementarity of the bases defined by Watson and Crick of the sequence of the second half-site.

[0042] Also, in the complex there will be 8 binding sites, four of them constituting the first pair of binding sites by pairing of the first and third nucleic acid molecules, and the other four constituting the second pair of binding sites by pairing of the second and third nucleic acid molecules.

[0043] Note that for the first pair of transposase binding sites, the four half-binding sites are such that the first half-site and the second half-site are contained in the first nucleic acid sequence, the complementary site of the second half-site is included in the third nucleic acid sequence,

[0044] their positions in the complex are therefore defined, and the complementary site of the first half-site is i) either included in the first nucleic acid molecule, ii) or included in the third nucleic acid molecule

[0045] it is therefore not necessary to define its position in one (first) or the other (third) nucleic acid molecule, the essential thing being that when the first and third nucleic acid molecules are paired according to the base complementarity defined by Watson and Crick, the two half-sites are reconstituted, that is to say that the first half-site is paired with the half-site complementary to the first half-site and that the second half-site is paired with the half-site complementary to the second half-site.

[0046] It will also be noted that for the second pair of transposase binding sites, the four half-binding sites are such that the first half-site and the second half-site are contained in the second nucleic acid sequence, the complementary site of the first half-site is included in the third nucleic acid sequence,

[0047] their positions in the complex are therefore defined, and the complementary site of the second half-site is i) either included in the second nucleic acid molecule, ii) or included in the third nucleic acid molecule

[0048] it is therefore not necessary to define its position in one (second) or the other (third) nucleic acid molecule, the essential thing being that when the second and third nucleic acid molecules are paired according to the base complementarity defined by Watson and Crick, the two half-sites are reconstituted, that is to say that the first half-site is paired with the half-site complementary to the first half-site and that the second half-site is paired with the half-site complementary to the second half-site.

[0049] The first molecule.

[0050] The first molecule of the complex is the molecule that will include, once modified, a nucleic acid sequence that will allow to specifically target a region of interest of a nucleic acid molecule of interest. This sequence of interest will be chosen by the user of the system according to the chosen target. This sequence of interest will be inserted into the first molecule of said complex at the level of region A. This region A corresponds at least to two nucleic acids between which will be inserted the sequence allowing to target the target molecule. In view of the oriented structure of nucleic acids (5'-3' direction), it is important that the sequence allowing to target the region of interest is positioned in the right direction, so that pairing is possible with the target sequence.

[0051] Also, advantageously, region A comprises one or more sites recognizing restriction enzymes in order to promote oriented insertion. One or more of the following sites may be present in region A:

[0052] AA / CGTTAclIA / AGCTTHindIIIAAT / ATTSspI / AATTMluCIA / CATGTPciIA / CCGGTAgeIACCTGC(4 / 8)BfuAI BspMIA / CCWGGTSexAIA / CGCGTMluIACGGC(12 / 14)BceAIA / CGTHpyCH4IVACN / GTHpyCH4IIISEQ ID NO :4(10 / 15)ACNNNNGTAYC(12 / 7)BaeISEQ ID NO :5(9 / 12)ACNNNNNCTCC(10 / 7)BsaXIA / CRYGTAflIIIA / CTAGTSpeIACTGG(1 / -1)BsrIACTGGG(5 / 4)BmrIA / GATCTBglIIAGC / GCTAfeIAG / CTAluIAGG / CCTStuIAGT / ACTScaI-AT / CGATClaI BspDISEQ ID NO :6ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15 / -19)PI-SceIATGCA / TNsiIAT / TAATAseIATTT / AAATSwaISEQ ID NO :7(11 / 13)CAANNNNNGTGG(12 / 10)CspCIC / AATTGMfeICACCTGC(4 / 8)PaqCICACGAGNb.BssSICACGAG(-5 / -1)BssSI-v2CACGTC(-3 / -3)BmgBICAC / GTGPmlICACNNN / GTGDraIIISEQ ID NO :8CACNN / NNGTGAleI-v2CAGCAG(25 / 27)EcoP15ICAG / CTGPvuIICAGNNN / CTGAlwNICAGTG(2 / 0)BtsIMutICA / TATGNdeICATG / NlaIII / CATGFatIC / ATGCviAIISEQ ID NO :9CAYNN / NNRTGMslICC(12 / 16)FspEISEQ ID NO :10CCANNNNN / NNNNTGGXcmISEQ ID NO :11CCANNNNN / NTGGBstXISEQ ID NO :12CCANNNN / NTGGPflMICCATC(4 / 5)BccIC / CATGGNcoICCCAGC(-5 / -1)BseYICCCGC(4 / 6)FauICCC / GGGSmaIC / CCGGG(0 / -1)CCDTspMI XmaI Nt.CviPIICCDG(10 / 14)LpnPICCGC(-3 / -1)AciICCGC / GGSacIICCGCTC(-3 / -3)BsrBIC / CGGMspI HpaIICC / NGGScrFI / CCNGGStyD4IC / CNNGGBsaJISEQ ID NO :13CCNNNN / NNGGBslIC / CRYGGBtgICC / SGGNciIC / CTAGGAvrIICCTC(7 / 6)MnlICCTCAGCNb.BbvCICCTCAGC(-5 / -7)Nt.BbvCICCTCAGC(-5 / -2)BbvCICCTGCA / GGSbfICCTNAGC(-5 / -2)Bpu10ICC / TNAGGBsu36ISEQ ID NO. :14CCTNN / NNNAGGEcoNICCTTC(6 / 5)HpyAV / CCWGGPspGICC / WGGBstNIC / CWWGGStyISEQ ID NO :15(10 / 12)CGANNNNNTGC(12 / 10)BcgICGAT / CGPvuICG / CGBstUIC / GGCCGEagICG / GWCCGRsrIICGRY / CGBsiEIC / GTACGBsiWI CGTCTCBsmBI-v2CGTCTC(1 / 5)Esp3ICGWCG / Hpy99ICMG / CKGMspA1ISEQ ID NO. :16CNNNNNNNNNNN / NNNNNNNNNGAbaSICNNR(9 / 13)MspJICR / CCGGYGSgrAIC / TAGBfaICTCAG(9 / 7)BspCNIC / TCGAGXhoI PaeR7ICTCTTC(1 / 4)EarICTGAAG(16 / 14)AcuICTGCA / GPstICTGGAG(16 / 14)BpmIC / TNAGDdeIC / TRYAGSfcIC / TTAAGAflIICTTGAG(16 / 14)BpuEIC / TYRAGSmlIC / YCGRGBsoBI AvaIGAAGA(8 / 7)MboIIGAAGAC(2 / 6)BbsI SEQ ID NO :17GAANN / NNTTCXmnIGAATGC(1 / -1)BsmIGAATGCNb.<h2 style=";text-align:left;direction:ltr">BsmIG / AATTCEcoRIGACGC(5 / 10)HgaIGACGT / CAatIIGAC / GTCZraIGACN / NNGTCPflFI Tth111ISEQ ID NO :18GACNN / NNGTCPshAISEQ ID NO :19GACNNN / NNGTCAhdISEQ ID NO :20GACNNNN / NNGTCDrdIGAG / CTCEco53kIGAGCT / CSacIGAGGAG(10 / 8)BseRIGAGTC(4 / -5)Nt.BstNBIGAGTC(4 / 5)PleIGAGTC(5 / 5)MlyIG / ANTCHinfIGAT / ATCEcoRVGA / TCDpnI / GATCSau3AI DpnII MboISEQ ID NO ID NO:21GATNN / NNATCBsaBIG / AWTCTfiIGCAATGNb.BsrDIGCAATG(2 / 0)BsrDIGCAGC(8 / 12)BbvIGCAGTG(2 / 0)BtsI-v2GCAGTGNb. :22GCANNNN / NTGCBstAPIGCATC(5 / 9)SfaNIGCATG / CSphIGCCC / GGGCSrfIGCCGAG(21 / 19)NmeAIIIG / CCGGCNgoMIVGCC / GGCNaeISEQ ID NO :23GCCNNNN / NGGCBglIGCGAT / CGCAsiSIGCGATG(10 / 14)BtgZIGCG / CHhaIG / CGCHinP1IG / CGCGCBssHIIGC / GGCCGCNotIGC / NGCFnu4HIGCN / NGCCac8ISEQ ID NO: :24GCNNNNN / NNGCMwoIG / CTAGCNheIGCTAG / CBmtIGCTCTTC(1 / -7)Nt.AlwIG / GATCCBamHI GGATG(9 / 13)FokIGGATG(2 / 0)BtsCIGG / CCHaeIIIGGCCGG / CCFseISEQ ID NO :25GGCCNNNN / NGGCCSfiIG / GCGCCKasIGG / CGCCNarIGGCGC / CPluTIGGC / GCCSfoIGG / CGCGCCAscIGGCGGA(11 / 9)EciIGGGA C(10 / 14)BsmFIGGGCC / CApaIG / GGCCCPspOMIG / GNCCSau96IGGN / NCCNlaIVG / GTACCAcc65IGGTAC / CKpnIGGTCTC(1 / 5)BsaI v2GGTGA(8 / 7)HphIG / GTNACCBstEII G / GWCCAvaIIG / GYRCCBanIGKGCM / CBaeGIGR / CGYCBsaHIGRGCY / CBanIIGT / ACRsaIG / TACCviQIGTATACBstZ17IGTATCC(6 / 5)BciVIG / TCGACSalIGTATC(1mBTC) BcoDIGTCTC(1 / -5)Nt.BsmAIG / TGCACApaLIGTGCAG(16 / 14)BsgIGT / MKACAccIGTN / NACHpy166II / GTSACTsp45IGTT / AACHpaIGTTT / AAACPmeIGTY / RACHincIIGWGCW / CBsiHKAINNCASTGNN / TspRIR / AATTYApo RCATG / YNspIR / CCGGYBsrFI-v2R / GATCYBstYIRGCGC / YHaeIIRG / CYCviKI-1RG / GNCCYEcoO109IRG / GWCCYPpuMISEQ ID NO :26TAACTATAACGGTCCTAAGGTAGCGAA(-9 / -13)GTABISEQ / GTABISE :27TAGGGATAACAGGGTAAT(-9 / -13)I-SceIT / CATGABspHIT / CCGGABspEITCCRAC(20 / 18)MmeIT / CGATaqI-v2TCG / CGANruITCN / GAHpy188ITC / NNGAHpy188IIIT / CTAGAXbalcITC / GATCABcITC TG / CAHpyCH4VTGC / GCAFspISEQ ID NO :28TGGCAAACAGCTATTATGGGTATTATGGGT(-13 / -17)PI-PspITGG / CCAMscIT / GTACABsrGI T / TAAMseITTAAT / TAAPacITTA / TAAPsiI-v2TT / CGAABstBITTT / AAADraIVC / TCGAGBPspXIW / CCGGWBsaWIYAC / GTRBsaAIY / GGCCREaeI.

[0053] Obviously, in the context of a chemical synthesis of the first molecule, it is not necessary to have cloning (or insertion) sites for the sequence allowing the target region to be targeted, but to take the precaution of providing a correctly oriented sequence. This is obviously possible, however.

[0054] The first molecule is furthermore made up on either side of the A region, of sequences rich in A / T, or if it is RNA in A / U, in order to allow a certain flexibility of the structure. By rich in A / T, or in A / U, is meant in the invention a sequence which comprises more than 50% of A or T, or U, preferably more than 50% of T or U, relative to the total number of nucleotides constituting the sequence. These sequences on either side of the A region have a size in nucleotides varying from 10 nucleotides to 60 nucleotides.

[0055] The flexibility of these flanking sequences of the A region, due to the presence of numerous A, T or U, can have the effect of allowing recombination via recombinases that are too poorly controlled, or even when the complex has not yet recognized the target molecule.

[0056] Also, in order to overcome this problem, G / C-rich sequences are introduced into each of the A / T-rich sequences, particularly those rich in T, or A / U, bordering the A region. These G / C-rich regions consist of 6 to 12 nucleotides, the quantity of C or G of which is greater than 50% of the nucleotides contained in the said G / C-rich sequence.

[0057] To stabilize the structure of the first molecule, and as described above to avoid untimely recombination, the G / C-rich regions are positioned 15 to 52 nucleotides from the end of the A region.

[0058] For clarity, if region A consists of 3 nucleotides, with the central nucleotide corresponding to position 0, the A / T or A / U rich region will start on the left at position -2, and on the right at position +2. Therefore, on the left side, the G / C rich region will be positioned from position -17 to position -54, and on the right side from position +17 to position +54.

[0059] Another important element is that the G / C-rich sequence to the right (or 5') of region A is necessarily complementary (according to the Watson and Crick pairing principle) to the G / C-rich region of the region to the right (or 3') of region A. Also, the first single-stranded molecule pairs with itself at the G / C-rich regions, which prevents any recombination by transposases, as long as there is no interaction with the complementary target sequence of the region that will be inserted into region A of the first molecule.

[0060] Finally, the first molecule comprises at its 5' end a sequence corresponding to a first binding site for a transposase, and at its 3' end a second binding site for said transposase.

[0061] The first binding site and the second binding site are advantageously the same, and above all both correspond to the same strand of the double-stranded binding site of said transposase. This means that the first transposase binding site present in the 5' region of the first molecule cannot pair completely, and therefore stably, with the transposase binding site present in the 3' region.

[0062] The first binding site and the second binding site are advantageously the same, but each correspond to a different strand of the double-stranded transposase binding site. Also, for example, if the first transposase binding site corresponds to the sense strand, the second transposase binding site corresponds to the sequence of the complementary strand. It is then possible to have two configurations: i) either the second binding site which corresponds to the complementary strand is oriented in the 3'-5' direction, in which case it will be able to pair with the first transposase binding site and form the double-stranded site, ii) or the second binding site which corresponds to the complementary strand is oriented in the 5'-3' direction, and in which case will not be able to pair with the first transposase binding sequence, the sequences, due to their orientation, not being complementary.In the above-mentioned case i), if the first single-stranded molecule self-pairs at the first and second binding sites, it will not be possible to form the above-mentioned complex, because there will no longer be a single-stranded complementary region available to pair with the second molecule so as to form two double-stranded transposase binding sites.

[0063] Also, the first molecule, when it lacks a sequence complementary to the target region in part A, or when it contains such a target sequence but the latter does not interact (does not pair) with said target sequence, forms a three-dimensional structure where the entire molecule is single-stranded except for the region corresponding to the G / C-rich regions which pair with each other.

[0064] A schematic representation of the paired form is shown in Figures 1A to 1E.

[0065] The second molecule.

[0066] The second molecule of the complex is structurally similar to the first molecule. The above explanations therefore apply mutatis mutandis. However, in the second molecule, the B region (or B sequence) and the transposase binding sites are organized differently.

[0067] First of all, region B is different from region A of the first molecule. Indeed, for the purpose of oriented recombination, there cannot be competition for the same target of interest between the first and second molecules.

[0068] Also, it is necessary that region B corresponds to a second sequence complementary to the target sequence, this second sequence complementary to the target sequence being positioned 3' relative to the first sequence recognized by the complementary sequence corresponding to sequence A of the first molecule.

[0069] Therefore, when the first molecule and the second molecule are paired with the target sequence, the target sequence will be flanked by these two molecules, the first molecule being located at the 5' end and the second molecule being positioned at the 3' end. The region of the target sequence located between the region of interaction with the first molecule and the region of interaction with the second molecule corresponds to the sequence that will be replaced by that of the third molecule.

[0070] The third molecule

[0071] The third molecule of the above-mentioned complex is simpler than the first two (the first and second molecules). The third molecule comprises, in its 5' portion, a transposase binding site which is complementary to the transposase binding site present in the 3' portion of the first molecule. Therefore, when the complex is formed, the ½ transposase binding site (single strand) located in the 3' portion of the first molecule could pair with the ½ transposase binding site (single strand) located in the 5' portion of the second molecule so as to form a double-stranded transposase binding site, a double-stranded site to which the transposase could attach.

[0072] In the 3' portion of the third molecule there is a transposase binding site which is complementary to the transposase binding site present in the 5' portion of the second molecule. Therefore, when the complex is formed, the ½ transposase binding site (single strand) located in the 3' portion of the third molecule could pair with the ½ transposase binding site (single strand) located in the 5' portion of the second molecule so as to form a double stranded transposase binding site, a double stranded site to which the transposase can attach.

[0073] Between the 5' portion which includes a ½ transposase binding site and the 3' portion which includes a ½ transposase binding site, the third molecule includes a replacement sequence, i.e. the sequence which will eventually replace the target sequence. This replacement sequence is bordered in 5' by at least one restriction site and in 3' by at least one restriction site; these two restriction sites being distinct. Also, the third molecule includes in the 5' to 3' direction: a ½ transposase binding site complementary to the transposase binding site of the first molecule, followed by at least one restriction site, followed by the replacement sequence, followed by at least one restriction site different from the restriction site upstream of the replacement sequence, followed finally by a ½ transposase binding site complementary to the transposase binding site of the second molecule.

[0074] The replacement sequence corresponds to the part of the coding sequence of the CD247 gene encoding at least the intracellular domain of the CD3 ζ protein (CD3 zeta).

[0075] The ζ chain (or CD3 ζ) is a transmembrane protein that is one of the components of the T cell receptor (TCR) complex and participates in signal transduction.

[0076] The ζ chain has a small extracellular N-terminal portion (9 amino acids) that interacts with the CD3α and CD3β chains, a single transmembrane domain, and a long cytoplasmic chain (120 amino acids). This long cytoplasmic chain contains three tyrosine-based immune receptor activation motifs (ITAMs), which participate in its interaction with the T cell cytoskeleton during T cell activation.

[0077] The composition according to the invention makes it possible to obtain the complex described above. It schematically illustrates the complex formed between the first, second and third molecules according to the invention.

[0078] The complex formed from the molecules of the composition of the invention, when the three molecules are correctly paired, comprises two pairs of double-stranded binding sites for recognition of a transposase:

[0079] - the first pair being obtained by the hybridization of the first molecule with the third molecule, and

[0080] - the second pair being obtained by the hybridization of the second molecule with the third molecule.

[0081] Sequence A in the first molecule is complementary to the same strand of nucleic acid that is complementary to sequence B in the second molecule. In other words, sequence A in the first molecule and sequence B in the second molecule are able to hybridize to the same nucleic acid simultaneously, because the two sequences A and B do not recognize the same sequence.

[0082] To further clarify the subject, the interest in the present invention is to provide a first molecule and a second molecule, both as defined above, the respective sequences A and B being such that they are capable of recognizing for one, a sequence located 5' of the target sequence of the nucleic acid of interest and for the other, a sequence located 3' of the same target sequence of the nucleic acid of interest. The sequences A and B are therefore complementary to regions bordering the sequence of interest, which it is desired to replace, of the nucleic acid molecule of interest.

[0083] The first and second molecules of interest are therefore essential to specifically target the molecule of interest, in order to frame the sequence to be replaced.

[0084] The third molecule in the set, for its part, is the one that provides the nucleic acid molecule that contains the replacement sequence, i.e. a sequence comprising the intracellular activation part of CD3 ζ.

[0085] From a mechanistic point of view, the complex according to the invention is such that it consists of its three molecules, the first and second molecules being structurally organized in space so that their G / C-rich regions are paired.

[0086] On either side of the third molecule, i.e. in 5' and 3', due to hybridization with the first and second molecules, two pairs of transposase binding sites allow, when present, transposase dimers to bind to the whole.

[0087] Note that the transposase binding sites of the first molecule may be the same as those of the second molecule, or they may be different. In the case where the binding sequences are the same, the transposase dimers at the 5' end of the third molecule (by hybridization of the 5' part of the third molecule with the first molecule), and at the 3' end of the third molecule (by hybridization of the 3' part of the third molecule with the second molecule) will be the same. Also, as an example, if the binding sites are all Tn5 transposase binding sites, the whole will be associated with 2 Tn5 transposase dimers.

[0088] It is also possible that the binding sites of the first molecule and the second molecule do not recognize the same transposase. In this case, and according to the definition given above, the 5' part of the third molecule will form, by hybridization with the first molecule, two double-stranded binding sites for a first transposase, and the 3' part of the third molecule will form, by hybridization with the second molecule, two double-stranded binding sites for a second transposase.

[0089] If now the above-mentioned complex, linked to two transposase dimers, is placed in the presence of a nucleic acid molecule of interest whose 5' part is complementary to the sequence A of the first molecule of the set and whose 3' part is complementary to the sequence B of the second molecule of the set, then there will be pairing between the nucleic acid molecule of interest and the set at the level of the regions A and B described above. This interaction will have the consequence of breaking the interaction of the two G / C-rich sequences of each of the first and second molecules of the set.From then on, the third molecule and the nucleic acid molecule of interest will be brought closer together spatially and the transposases will be able to carry out their tagmentation activity, the result of which will be the replacement of the sequence of the molecule of interest, bordered by the complementary sequences of sequences A and B, by the sequence of the third molecule of the set, which is located between the 5' and 3' transposase binding half-sites.

[0090] In the invention, the first molecules, second molecules and third molecules of the set are advantageously molecules consisting of deoxyribonucleotides, in order to form single-stranded DNA molecules.

[0091] Even more advantageously, the first molecules, second molecules and third molecules of the set are DNA / RNA hybrid molecules, where the "backbone" of the molecules is DNA, and the recognition sequences A and B of the nucleic acid molecule of interest, and the central region of the third molecule are RNA. This is particularly advantageous when the sequence replacement that the invention allows must be done directly on an RNA molecule.

[0092] La-A illustrates the interaction between the molecule of interest and the first / second / third molecule complex according to the invention.

[0093] Advantageously, the invention relates to the aforementioned complex, where said first molecule or said second molecule, or both is / are coupled to an enzyme, in particular by means of a modified nucleotide. This enzyme aims to promote the replacement of the molecule of interest. It may be

[0094] - a helicase, an enzyme capable of opening a double-stranded molecule which would be supercoiled or associated with proteins such as histones,

[0095] - a topoisomerase, an enzyme acting on the topological structure of DNA by generating transient cuts,

[0096] - a ligase which allows a phosphodiester bond to be formed between a 5' phosphate end of a nucleotide and the 3' OH end of another nucleotide,

[0097] - a polymerase, which will synthesize a nucleic acid molecule from an initiation site, free 3'OH, in the 5'-> 3' direction, in particular by copying an antiparallel complementary strand according to the Watson and Crick model.

[0098] It is also possible to combine two or more of said enzymes to provide all the enzymatic material necessary to enable the replacement of sequences provided for within the scope of the invention.

[0099] In a particular aspect of the invention, the first molecule of the set may contain in its 5' portion, more precisely between the first transposase binding site and region A, one or more modified nucleotides. In the same way, the third molecule of the set may contain in its 3' portion, more precisely between the first transposase binding site and region 3, one or more modified nucleotides.

[0100] This modified nucleotide is notably modified by grafting a carbon chain substituted with a protein label, or tag in English, or even a molecule allowing a specific interaction such as streptavidin or biotin.

[0101] Such modifications then make it possible to specifically bind, to the first molecule of the set, enzymes that can be used to promote tagmentation and sequence replacement. It will be particularly advantageous to have, for example, a streptavidin graft, which will allow the grafting of a biotinylated helicase (inversely helicase grafted with streptavidin and biotinylated nucleotide) used to open a double-stranded molecule. It is also possible to consider grafting with a biotinylated ligase (or coupled with streptavidin), in order to connect the recombinant strand on the 3' side.

[0102] It is also possible to associate with the first molecule or the second molecule of the set an oligonucleotide, so that said oligonucleotide will pair with a predetermined region of said first or second molecule. This oligonucleotide is then advantageously coupled to a grafting molecule as explained above.

[0103] Advantageously, the invention relates to the above-mentioned composition, wherein said fusion protein comprises the peptide capable of binding to a membrane protein of a cell, fused to a transmembrane portion of a membrane protein, the latter fused to the CD3ζ chain of the TCR.

[0104] In this advantageous embodiment, the third molecule comprises a sequence which codes for a fusion protein whose organization in the N-terminal to C-terminal direction is as follows: a peptide capable of binding to a membrane protein of a cell, generally a tumor cell as will be developed below, this peptide being followed by a transmembrane domain, itself followed by the intracellular part of the CD3ζ chain of the TCR.

[0105] It is particularly advantageous that the transmembrane part of the fusion protein in question is that of the CD3ζ chain of the TCR, but any other transmembrane domain can be used, provided that once synthesized in a cell the fusion protein is such that: the binding peptide is exposed outside the cell (extracellular), and the CD3ζ chain of the TCR is exposed inside the cell (intracellular) in order to allow the transduction of a signal.

[0106] If no other domain is present in the said fusion protein, it is called a chimeric receptor or first generation CAR.

[0107] Advantageously, the invention relates to the above-mentioned composition, wherein said fusion protein comprises the peptide capable of binding to a membrane protein of a cell, fused to a transmembrane portion of a membrane protein, the transmembrane domain of the membrane protein being fused to a coactivation domain, the latter being fused to the CD3ζ chain of the TCR.

[0108] Advantageously, the aforementioned fusion protein further comprises, between the transmembrane domain and the activation domain (i.e. the intracellular domain) of the CD3ζ chain of the TCR, a coactivation domain of a protein other than CD3ζ. This configuration is based on the normal activation mechanism of the TCR.

[0109] The dual intracellular signal is the typical feature of T cell activation. Three different types of receptors, including T cell antigen receptors, cytokine receptors, and costimulatory receptors, are included in this progression. The first signal is the specific signal that is triggered by the TCR when it recognizes the antigenic peptide-Major Histocompatibility Complex (MHC) complex on the surface of antigen-presenting cells. The second signal is the costimulatory signal, produced by a costimulatory molecule such as CD28 / B7, which promotes the synthesis of IL-2 to complete T cell activation and prevent apoptosis.

[0110] Naive T cells cannot perform their normal role if the costimulatory signal is absent, and the same is true if T cells are stimulated by antigen.

[0111] CARs that only include the CD3ζ sequence cannot activate cells without an endogenous co-stimulatory signal that must be recruited, which may delay the cellular response.

[0112] To avoid this drawback, it is preferable to group both the CD3ζ activation signal and the co-activation signal on the same fusion protein. Upon activation of the TCR after recognizing the antigen-presenting MHC, both signals will be activated simultaneously. Proliferation, cytotoxicity, and sustained response, as well as survival, of cells expressing this fusion protein will therefore be increased.

[0113] It is also possible to further include a third activation domain allowing the production of cytokines that stimulate IL-12 production. This third signal can be generated, for example, using the STAT3 factor-binding domain of the IL-2 receptor.

[0114] Other examples are conceivable, and those skilled in the art will be able to adapt the co-activation domains as they wish and according to the needs and developments of CAR cell technology.

[0115] Even more advantageously, the invention relates to the above-mentioned composition,

[0116] - where said sequence A comprises a sequence complementary to the sequence of a first region of the locus of the gene coding for the TRAC protein and

[0117] - where said sequence B comprises a sequence complementary to the sequence of a second region of the locus of the gene coding for the TRAC protein,

[0118] said sequence A and said sequence B being two different sequences, said first and second regions of the TRAC locus advantageously framing a 5' region of the locus of the gene coding for the TRAC protein.

[0119] As explained above, in order to carry out the replacement of the target gene by the third molecule, it is advantageous that the sequences of part A of the first molecule and part B of the second molecule are capable of:

[0120] - to recognize the same target molecule, and

[0121] - to frame the target region to be replaced, which means that the first molecule must, via its A region, recognize a sequence upstream of the sequence to be replaced of the target molecule and the second molecule must, via its B region, recognize a sequence downstream of the sequence to be replaced of the target molecule, or vice versa, i.e. the first molecule must, via its A region, recognize a sequence downstream of the sequence to be replaced of the target molecule and the second molecule must, via its B region, recognize a sequence upstream of the sequence to be replaced of the target molecule.

[0122] It is thus possible to replace any target sequence with any replacement sequence, as long as the sequences A and B respectively of the first and second molecules recognize the target region and frame it.

[0123] In the invention, it is particularly advantageous to insert the fusion encoded by the third molecule at a locus which allows its expression in a manner equivalent to the CD3ζ chain of the TCR, without replacing the CD3ζ chain of the endogenous TCR which is necessary for the activity of the T cells.

[0124] It is therefore possible to insert the fusion (i.e. the sequence of the third molecule coding for the fusion protein) anywhere in the target genome, as long as this insertion does not generate any mutation (interruption of a gene or a regulatory element). More particularly, it is interesting to propose an insertion of the fusion at the level of the TRAC gene locus, the gene which codes for the constant part of the α domain of the TCR. Even more particularly, it is advantageous to carry out an insertion at the level of the first exon of the TRAC locus, and even more advantageously, immediately 5' of the first exon.

[0125] Such insertion at the TRAC locus not only allows for basal expression similar to that of TCR chains, but also offers better antitumor efficacy.

[0126] In addition, such an insertion at the TRAC locus:

[0127] - reduces tonic activation signaling and the development of efficient internalization and balanced re-expression of CAR upon single or repeated antigen exposure.

[0128] - helps maintain a naive / central memory phenotype, delays differentiation and exhaustion of effector T cells, making them better effector cells.

[0129] - improves the safety profile. (Because the absence of TCR reduces the risk of TCR-induced alloeactivity and autoimmunity, and the precise insertion of the CAR coding sequence reduces the risk of insertional oncogenesis).

[0130] Advantageously, the invention relates to the above-mentioned composition where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second 5'-3' oriented sequence for recognition of said transposase and

[0131] where the second molecule comprises at its 5' end a first sequence complementary to said first recognition sequence of said transposase followed by a second sequence complementary to said second recognition sequence of said transposase.

[0132] More advantageously, the invention relates to the composition as defined above, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second 5'-3' oriented sequence for recognizing said transposase,

[0133] said second molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second 5'-3' oriented sequence for recognizing said transposase, and

[0134] where the third molecule comprises at its 5' end a first sequence complementary to said first recognition sequence of said transposase of the first molecule followed by a second sequence complementary to said second recognition sequence of said transposase of the first molecule and at its 3' end a first sequence complementary to said first recognition sequence of said transposase of the second molecule followed by a second sequence complementary to said second recognition sequence of said transposase of the second molecule.

[0135] Here a possible format of first and second molecules of the invention is defined. This configuration is shown schematically in. Obviously, in the context of this example of configuration of the first, second and third molecules, between the two half transposase sites of the 5' and 3' parts of the third molecule is the replacement sequence, here, the sequence coding the fusion protein containing the CD3ζ chain of the TCR.

[0136] Advantageously, the invention relates to the composition as defined above, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase, followed by a first sequence complementary to said first sequence for recognizing said transposase and

[0137] where the second molecule comprises at its 5' end a sequence complementary to said second recognition sequence of said transposase.

[0138] Even more advantageously, the invention relates to the above-mentioned composition, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase, followed by a first sequence complementary to said first sequence for recognizing said transposase of the first molecule,

[0139] the second molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase, said first sequence for recognizing said transposase of the 5' end being preceded by a second sequence complementary to said second sequence for recognizing said transposase of the first molecule,

[0140] And

[0141] where the third molecule comprises at its 5' end a sequence complementary to said second recognition sequence of said transposase of the first molecule and at its 3' end a sequence complementary to said first recognition sequence of said transposase of the second molecule.

[0142] Here another possibility of format of first and second molecules of the invention is defined. This configuration is schematized in and in. Obviously, within the framework of this example of configuration of the first, second and third molecules, between the two half transposase sites of the 5' and 3' parts of the third molecule is the replacement sequence, the sequence coding the fusion protein containing the CD3ζ chain of the TCR.

[0143] Advantageously, the invention relates to the above-mentioned composition, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a first sequence complementary to said first sequence for recognizing said transposase of the first molecule followed by a second sequence for recognizing said transposase, and

[0144] where the third molecule comprises at its 5' end a sequence complementary to said second recognition sequence of said transposase of the first molecule.

[0145] Even more advantageously, the invention relates to the above-mentioned composition, where said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a first sequence complementary to said first sequence for recognizing said transposase of the first molecule followed by a second sequence for recognizing said transposase,

[0146] the second molecule comprises at its 5' end a first 5'-3' oriented sequence for recognizing a transposase and at its 3' end a second sequence for recognizing said transposase of the first molecule, said first sequence being followed by a second sequence complementary to said second sequence for recognizing said transposase of the first molecule, and

[0147] where the third molecule comprises at its 5' end a sequence complementary to said second recognition sequence of said transposase of the first molecule and at its 3' end a sequence complementary to the first recognition sequence of the transposase of the second molecule.

[0148] This configuration is shown schematically in. Obviously, in this example of the configuration of the first, second and third molecules, between the two half transposase sites of the 5' and 3' parts of the third molecule is the replacement sequence, the sequence coding for the fusion protein containing the CD3ζ chain of the TCR.

[0149] Advantageously, the invention relates to the above-mentioned composition, where said transposase is a bacterial transposase, in particular a transposase chosen from Tn5, Tn9, Tn10 or Tc1 / mariner.

[0150] Advantageously, the aforementioned transposase is a bacterial type transposase selected from the transposon Tn5 transposase, the transposon Tn9 transposase, the transposon Tn10 transposase, Tn903, Tn602 or the transposon Tc1 transposase, or more generally from the mariner transposon superfamily.

[0151] Other examples of transposases that can be used in the context of the invention are: Vibrio harveyi transposase (transposase characterized by Agilent and used in the SureSelect QXT product), MuA transposase and a Mu transposase recognition site comprising the terminal sequences R1 and R2, Staphylococcus aureus transposon Tn552 transposase, Tn7 transposon transposase, Tn / O and IS10 transposase, Tn3 transposon transposase.

[0152] The Tn5 transposase is the best known. It is encoded by the Tnp gene of the Tn5 transposon. The transposase initiates transposition by forming a transposase dimer that binds to its target sequences. Within this complex, the transposase then catalyzes four phosphoryl transfer reactions (DNA cleavage, DNA hairpin formation, hairpin resolution, and strand transfer into the target DNA) resulting in the integration of the transposon into its new DNA site: this is tagmentation.

[0153] The invention is based on the principle of this tagmentation. By using the tagmentation properties of transposases, it is possible to insert one sequence into another in a targeted manner, thanks to the aforementioned complex.

[0154] Also within the scope of the invention, when reference is made to a transposase, reference is made to one of the aforementioned transposases, namely the transposases of the Tn5, Tn9, Tn10 or Tc1 / mariner transposons (or transposases mutated in order to increase their transposition or tagmentation activity).

[0155] In the invention, when several transposases are used simultaneously, one binding to the complex formed by the first molecule and the third molecule, and the other binding to the complex formed by the second molecule and the third molecule, preference will be given to pairs of transposases derived from transposons Tn5 and Tn10.

[0156] Advantageously, the first and second transposase recognition sequences are Tn5 transposase recognition sequences having one of the following sequences:

[0157] - CTGtCTCTTataCAcAtcT (SEQ ID NO: 29),

[0158] - CTGACTCTTataCACAagT (SEQ ID NO: 30), and

[0159] - CTGtCTCTTgatCAgATCT (SEQ ID NO: 31).

[0160] Consequently, the corresponding complementary sequences are as follows:

[0161] - AgaTgTGtatAAGAGaCAG (SEQ ID NO: 32), complementary to the sequence SEQ ID NO: 29,

[0162] - ActTGTGtatAAGAGTCAG (SEQ ID NO: 33), complementary to the sequence SEQ ID NO: 30, and

[0163] - AGATcTGatcAAGAGaCAG (SEQ ID NO: 34), complementary to the sequence SEQ ID NO: 31.

[0164] Other transposase recognition sequences include:

[0165] Tn5MErev,

[0166] 5′-[phos]CTGTCTCTTATACACATCT-3′ (SEQ ID NO: 35)

[0167] Tn5ME-A (Illumina FC-121-1030),

[0168] 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3′; (SEQ ID NO: 36)

[0169] and Tn5ME-B (Illumina FC-121-1031),

[0170] 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3′ (SEQ ID NO: 37)

[0171] Yet other transposase recognition sequences are as follows

[0172] - sense sequence SEQ ID NO: i

[0173] - antisense sequence SEQ ID NO: i+1,

[0174] where i varies from 38 to 192.

[0175] For example, the following pairs of sense and antisense sequences are considered: SEQ ID NO: 38 and SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41, SEQ ID NO: 42 and SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45, SEQ ID NO: 46 and SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 49, SEQ ID NO : 50 and SEQ ID NO: 51, SEQ ID NO : 52 and SEQ ID NO: 53, SEQ ID NO : 54 and SEQ ID NO: 55, SEQ ID NO : 56 and SEQ ID NO: 57, SEQ ID NO : 58 and SEQ ID NO: 59, SEQ ID NO : 60 and SEQ ID NO: 61, SEQ ID NO: 62 and SEQ ID NO: 63, SEQ ID NO : 64 and SEQ ID NO: 65, SEQ ID NO : 66 and SEQ ID NO: 67, SEQ ID NO : 68 and SEQ ID NO: 69, SEQ ID NO : 70 and SEQ ID NO: 71, SEQ ID NO : 72 and SEQ ID NO: 73, SEQ ID NO : 74 and SEQ ID NO: 75, SEQ ID NO : 76 and SEQ ID NO: 77, SEQ ID NO : 78 and SEQ ID NO: 79, SEQ ID NO : 80 and SEQ ID NO: 81, SEQ ID NO : 82 and SEQ ID NO: 83, SEQ ID NO : 84 and SEQ ID NO: 85, SEQ ID NO : 86 and SEQ ID NO: 87, SEQ ID NO : 88 and SEQ ID NO: 89, SEQ ID NO: 90 and SEQ ID NO: 91,SEQ ID NO : 92 et SEQ ID NO: 93, SEQ ID NO : 94 et SEQ ID NO: 95, SEQ ID NO : 96 et SEQ ID NO: 97, SEQ ID NO : 98 et SEQ ID NO: 99, SEQ ID NO : 100 et SEQ ID NO: 101, SEQ ID NO : 102 et SEQ ID NO: 103, SEQ ID NO : 104 et SEQ ID NO: 105, SEQ ID NO : 106 et SEQ ID NO: 107, SEQ ID NO : 108 et SEQ ID NO: 109, SEQ ID NO : 110 et SEQ ID NO: 111, SEQ ID NO : 112 et SEQ ID NO: 113, SEQ ID NO : 114 et SEQ ID NO: 115, SEQ ID NO : 116 et SEQ ID NO: 117, SEQ ID NO : 118 et SEQ ID NO: 119, SEQ ID NO : 120 et SEQ ID NO: 121, SEQ ID NO : 122 et SEQ ID NO: 123, SEQ ID NO : 124 et SEQ ID NO: 125, SEQ ID NO : 126 et SEQ ID NO: 127, SEQ ID NO : 128 et SEQ ID NO: 129, SEQ ID NO : 130 et SEQ ID NO: 131, SEQ ID NO : 132 et SEQ ID NO: 133, SEQ ID NO : 134 et SEQ ID NO: 135, SEQ ID NO : 136 et SEQ ID NO: 137, SEQ ID NO : 138 et SEQ ID NO: 139, SEQ ID NO : 140 et SEQ ID NO: 141, SEQ ID NO : 142 et SEQ ID NO: 143, SEQ ID NO : 144 et SEQ ID NO: 145, SEQ ID NO : 146 et SEQ ID NO: 147,SEQ ID NO : 148 et SEQ ID NO: 149, SEQ ID NO : 150 et SEQ ID NO: 151, SEQ ID NO : 152 et SEQ ID NO: 153, SEQ ID NO : 154 et SEQ ID NO: 155, SEQ ID NO : 156 et SEQ ID NO: 157, SEQ ID NO : 158 et SEQ ID NO: 159, SEQ ID NO : 160 et SEQ ID NO: 161, SEQ ID NO : 162 et SEQ ID NO: 163, SEQ ID NO : 164 et SEQ ID NO: 165, SEQ ID NO : 166 et SEQ ID NO: 167, SEQ ID NO : 168 et SEQ ID NO: 169, SEQ ID NO : 170 et SEQ ID NO: 171, SEQ ID NO : 172 et SEQ ID NO: 173, SEQ ID NO : 174 et SEQ ID NO: 175, SEQ ID NO : 176 et SEQ ID NO: 177, SEQ ID NO : 178 et SEQ ID NO: 179, SEQ ID NO : 180 et SEQ ID NO: 181, SEQ ID NO : 182 et SEQ ID NO: 183, SEQ ID NO : 184 et SEQ ID NO: 185, SEQ ID NO : 186 et SEQ ID NO: 187, SEQ ID NO : 188 et SEQ ID NO: 189, SEQ ID NO : 190 et SEQ ID NO: 191, et SEQ ID NO : 192 et SEQ ID NO: 193.,

[0176] Advantageously, the first G / C-rich domain of the first molecule (or the second molecule) corresponds to the following sequence GGCGATCGC (SEQ ID NO: 194) so ​​that the second G / C-rich domain will be the same. Indeed, due to the folding of the molecule on itself, the second G / C-rich domain will be in a complementary and antiparallel orientation with respect to the first G / C-rich domain, and the interaction will take place at the palindromic region (underlined in the sequence above).

[0177] The first and second G / C-rich domains may also be the following sequence GCGGCGATCGGGC (SEQ ID NO: 195). The above explanations apply mutatis mutandis.

[0178] Other sequences of the G / C-rich domains of the first molecule or the second molecule may be:

[0179] - first G / C-rich domain of sequence GGTCGC (SEQ ID NO: 196) and the second G / C-rich domain of sequence GCGACC (SEQ ID NO: 197).

[0180] These examples are given for illustrative purposes only and do not limit the scope of the invention.

[0181] In an advantageous embodiment, the A / T-rich sequences of the first molecule of said complex consist essentially of, or consist of, A or T.

[0182] Even more advantageously, the A / T-rich sequence of the first molecule of said complex consists of T.

[0183] Advantageously, the invention relates to the aforementioned composition, wherein the intermediate region of the third molecule comprises the sequence SEQ ID NO: 3 or the sequence SEQ ID NO: 1134.

[0184] As mentioned above, the third molecule comprises a sequence encoding the intracellular part of the CD3 ζ chain of the TCR. This sequence is preferentially oriented in the 5'-3' direction.

[0185] The complete sequence of the CD3 ζ TCR protein is represented by the sequence SEQ ID NO: 1, where

[0186] - the peptide part from 1 to 21 of said sequence SEQ ID NO: 1 corresponds to the propeptide, which is cleaved during the maturation of CD3 ζ,

[0187] - the peptide part from 22 to 30 of said sequence SEQ ID NO: 1 corresponds to the extracellular domain of CD3 ζ,

[0188] - the peptide part from 31 to 51 of said sequence SEQ ID NO: 1 corresponds to the transmembrane domain of CD3 ζ, and

[0189] - the peptide part from 52 to 164 of said sequence SEQ ID NO: 1 corresponds to the intracellular domain of CD3 ζ, i.e. the signal transducing domain.

[0190] The sequence SEQ ID NO: 3 corresponds to the DNA encoding the intracellular part of sequence SEQ ID NO: 2.

[0191] The sequence SEQ ID NO: 1134 corresponds to the DNA encoding the transmembrane domain and the intracellular part of CD3 ζ.

[0192] Advantageously, the invention relates to the above-mentioned composition, where the peptide capable of binding to a membrane protein is a single-chain variable fragment (scFv) recognizing a membrane protein, in particular the extracellular part of a membrane protein.

[0193] The scFv technology is particularly suitable for fusion as described in the invention, because it makes it possible to reproduce the variable part of the antibodies by fusing the variable part of the light chain to the variable part of the heavy chain, the two variable parts being linked together by a linker, the protein thus generated retains the specificity of the original immunoglobulin, despite the elimination of the constant regions and the introduction of the linker. It is then possible to create a nucleic acid molecule allowing the corresponding peptide to be synthesized and therefore to obtain a "short antibody" in a simplified manner. The linker is generally 10 to 25 amino acids in size (i.e. 30 to 75 nucleotides) and is generally rich in glycine for flexibility, as well as serine or threonine for solubility.The linker can connect the N-terminus of the variable part of the heavy chain (VH) to the C-terminus of the variable part of the light chain (VL), or vice versa.

[0194] The scFvs of interest in the context of the invention are in particular scFvs directed against membrane proteins widely expressed in tumors, such as CD19, BCma, CD123, CD20, CD22, CD38, LeY, ROR1, c-MET, CD133, CD171, CD70, CEA, EGFR-VIII, EpCAM, EphA2, FAP, c-KIT, Flt3, VEGFR2, PSMA, PSCA, MUC1, IL13Ra2, HER2, FAP, GD2, GPC3, Mesothelin, EIIIB, gp100 / HLA-A2, HLA-A2-WT1Db126, HA-1 H / HLA-A2, HLA-A*02:01, PD-1, PD-L1, CTLA-4 and TGFβ. This list is obviously not limiting.

[0195] Advantageously, the invention relates to the above-mentioned composition, where the peptide capable of binding to a membrane protein is a peptide fused to streptavidin. In this way, when the fusion peptide (extracellular streptavidin peptide and intracellular activation part comprising the CD3ζ chain of the TCR), it is possible to couple specific antibodies whose heavy chain is associated with biotin. The streptavidin and biotin will then interact specifically, which will reproduce a hybrid chimera making it possible to recognize the cellular target via the antibody and to activate the desired signal via the CD3ζ chain of the TCR.

[0196] The peptide capable of binding to a membrane protein can also be the ligand of a membrane receptor found on the target cell. It can be, for example, a cytokine, such as IL-13 which will recognize the IL13ra receptor, but also the ligand of the receptors Flt3, c-Kit, c-Met, VEGFR2, PD1, HER2, EGFR, TNFRs, NKG2, CD116 (GM-CSF receptor)... here again this list is not exhaustive.

[0197] Advantageously, the invention relates to a composition as defined above, where the coactivation domain corresponds to the coactivation domain of a protein chosen from CD28, 4-1BB, OX40 or ICOS.

[0198] As used herein, the term "coactivation domain" or "costimulatory signaling region" refers to the portion of the chimeric T cell receptor comprising the intracellular domain of a costimulatory molecule. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for an effective lymphocyte response to the antigen. Examples of such molecules include CD28, 4-1BB, DAP-10, and ICOS. For example, chimeric TCRs containing the intracellular domain of

[0199] - CD28 (SEQ ID NO: 1135),

[0200] - 4-1BB (complete sequence given in Seq ID No: 1136),

[0201] - ICOS (complete sequence given in Seq ID No: 1137) and

[0202] - DAP-10 (Seq ID No: 1138) are suitably employed in the context of the present invention.

[0203] Even more advantageously, the invention relates to the composition as defined above, where the first, second and third molecules are chosen from the triplets as defined in Table 2 below.

[0204] Advantageously, the invention relates to a composition comprising one of the triplets of first, second and third molecules described in the following table 2:

[0205]

[0206] Also, advantageously the invention relates to the above-mentioned composition, said composition comprising a triplet chosen from the above-mentioned triplets #1 to #312.

[0207] Advantageously, the invention relates to the composition as described above, further comprising

[0208] ** a fourth single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A' allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence being linked in 5' to a fifth T-rich sequence 40 to 60 nucleotides long and in 3' to a sixth T-rich sequence 40 to 60 nucleotides long, said fifth and sixth T-rich sequences respectively comprising a fifth and a sixth domain of 6 to 12 nucleotides rich in G / C, the sequence of the fifth domain being complementary to the sequence of the sixth domain, said fifth and sixth domain being positioned 15 to 52 nucleotides from said sequence A',said fourth molecule comprising at its 5' end at least a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second sequence for recognition of said transposase,

[0209] ** a fifth single-stranded nucleic acid molecule comprising or consisting essentially of a sequence B' allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence B' being linked in 5' to a seventh T-rich sequence 40 to 60 nucleotides long and in 3' to an eighth T-rich sequence 40 to 60 nucleotides long, said seventh and eighth T-rich sequences respectively comprising a seventh and eighth domain of 6 to 12 nucleotides rich in GC, the sequence of the seventh domain being complementary to the sequence of the eighth domain, said seventh and eighth domains being positioned 15 to 52 nucleotides from said sequence B',said fifth molecule comprising at its 5' end at least the first 5'-3' oriented recognition sequence of said transposase and at its 3' end the second recognition sequence of said transposase,

[0210] said sequence B' being a complementary sequence to said nucleic acid of interest, sequence A' being positioned 5' of a region of interest to said nucleic acid of interest and sequence B' positioned 3' of the region of interest to said nucleic acid of interest, and

[0211] ** a sixth single-stranded molecule comprising

[0212] * in its 5' part, at least one sequence complementary to said fifth recognition sequence of said transposase of the first molecule,

[0213] * in its 3' part at least one sequence complementary to said fourth recognition sequence of said transposase of the second molecule, and

[0214] * an intermediate region located between the complementary sequence of said fourth recognition sequence of said transposase of the first molecule and the complementary sequence of said fifth recognition sequence of said transposase of the second molecule, a complementary sequence of said sequence coding said fusion protein contained in the third molecule, i.e. a complementary sequence of the sequence coding the CD3ζ chain of the TCR,

[0215] the fourth and sixth single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase and the fifth and sixth single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase.

[0216] Advantageously, the composition according to the invention comprises 6 molecules, i.e. two triplets which allow a double-strand replacement of a target molecule. This replacement can only be done if the regions A, B and A' and B' are correctly chosen so that the region of interest to be replaced is correctly framed.

[0217] Obviously, all the definitions given for the composition comprising 3 molecules apply mutatis mutandis to a composition comprising 6 molecules.

[0218] Advantageously, the invention relates to the above-mentioned composition, wherein

[0219] - said sequence A comprises a sequence complementary to the sequence of a first region of the locus of the gene coding for the TRAC protein,

[0220] - said sequence B comprises a sequence complementary to the sequence of a second region of the locus of the gene coding for the TRAC protein,

[0221] said sequence A and said sequence B being two different sequences, said first and second regions advantageously framing a 5' region of the locus of the gene coding for the TRAC protein,

[0222] and where

[0223] - said sequence A' comprises a sequence complementary to the sequence of a third region of the locus of the gene coding for the TRAC protein,

[0224] - said sequence B' comprises a sequence complementary to the sequence of a fourth region of the locus of the gene coding for the TRAC protein,

[0225] said sequence A' and said sequence B' being two different sequences, said third and fourth regions of the locus of the gene coding the TRAC protein, advantageously framing a sequence complementary to said 5' region of the locus of the gene coding the TRAC protein,

[0226] and where

[0227] sequence A and sequence A' are at most partly complementary,

[0228] sequence A and sequence B' are at most partly complementary,

[0229] sequence B and sequence A' are at most partly complementary, and

[0230] sequence B and sequence B' are at most partly complementary.

[0231] By "at most partly complementary" is meant in the invention that the sequences have sequences which are capable of pairing according to the complementarity of the bases defined by Watson and Crick, but not on all of the sequences. In other words, only a part of the sequences is complementary. Advantageously, the sequences A, A', B and B' are partly complementary on less than 50% of the sequences, in particular less than 30% of the sequences, in particular less than 10% of the sequences, in particular are not at all complementary to each other.

[0232] In this way it is possible to frame the 5' part of the TRAC locus (just upstream of the first exon) in a specific and oriented manner, for both strands, in order to avoid disordered or incoherent recombinations (i.e. tagmentations) so that the result would not be the expected one.

[0233] It is also conceivable to create a molecule comprising the fusion sequence and exon 1 of the TRAC gene, so that insertion is achieved by replacing exon 1 with a sequence containing the coding sequence of the fusion containing the CD3ζ of the TCR, followed by a transcription termination sequence, itself followed by the sequence of exon 1 of TRAC. An example of recombination at the TRAC locus is shown schematically in.

[0234] Even more advantageously, the aforementioned composition comprises at least one of the sextuplets mentioned in the following Table 3:

[0235]

[0236] The composition according to the invention thus advantageously provides 156 sextuplets of molecules allowing the insertion at the TRAC gene locus of a hybrid sequence coding for a fusion protein comprising the CD3ζ chain of the TCR, and comprising in its N-terminal part a protein sequence recognizing a peptide expressed on the surface of a target cell.

[0237] This therefore allows, depending on the target cell, to restore a function lost by the mutation, and to achieve functional complementation.

[0238] In another aspect, the invention relates to an immune cell, in particular a T lymphocyte, comprising a composition as defined above. The aforementioned immune cell is isolated and purified, outside its natural context.

[0239] The immune cell in question is in a state where recombination, that is, insertion, has not yet taken place. The cell contains in its cytoplasm or nucleus, or both, the molecular complex as formed by the triplets of first, second, and third molecules, and possibly the sextuplets further comprising the aforementioned fourth, fifth, and sixth molecules.

[0240] The immune cell is even more advantageously a tumor-infiltrating immune cell, especially an infiltrating T cell.

[0241] If it is intended to make a single-stranded insertion, for example to make an insertion so that the resulting cell will have two different alleles: one allele having an insertion, and one allele not having the insertion, it will be advantageous to use the composition comprising the first, second and third molecules. The same will be true if a replacement is made on an RNA, and in particular a messenger RNA.

[0242] On the other hand, if a double-stranded insertion is desired, it will be advantageous to use the first, second, third, fourth, fifth and sixth molecules.

[0243] The composition according to the invention is introduced into the immune cell using transfection techniques well known to those skilled in the art, and in particular electroporation or calcium phosphate precipitation. Those skilled in the art will be able to choose the best technique depending on the nature of the targeted immune cell.

[0244] It is also advantageous for the cell to comprise a composition comprising any one of the triplets in Table 2, or any one of the sextuplets in Table 3.

[0245] In another aspect, the invention relates to a pharmaceutical composition comprising the above-described composition, or an immune cell described above, in association with a pharmaceutically acceptable carrier.

[0246] The above-mentioned composition, in association with a pharmaceutically acceptable vehicle, can be used in the treatment of pathologies. The vehicle is a commonly accepted vehicle known to those skilled in the art, for example distilled water, or a physiological buffer. This vehicle must allow the formation of a complex as mentioned above, but also be acceptable to a cell or a living being.

[0247] The same applies to the cell. It is placed in contact with a pharmaceutically acceptable vehicle which has the property of keeping it alive (not affecting the membrane, and not inducing cell death phenomena) and being compatible with a living organism.

[0248] In another aspect, the invention relates to the aforementioned composition, or the aforementioned immune cell, as a medicament.

[0249] It is further advantageous that the composition comprising any one of the triplets of Table 2, or any one of the sextuplets of Table 3 is used as a medicament.

[0250] In yet another aspect, the invention relates to the aforementioned composition, or the aforementioned immune cell, for use in the treatment of cancer.

[0251] Since the above-mentioned composition is intended to provide CAR cells, it is particularly relevant to use this composition to treat cancer.

[0252] The composition will be tailored to the target cancer cell, choosing the extracellular part of the fusion protein so as to target a specific tumor cell.

[0253] Expression by lymphocytes modified by the composition according to the invention thus ensures specificity with respect to the tumor antigen. It is then sufficient to inject the patient with a few tens or hundreds of millions of lymphocytes expressing the CAR. Finally, as they proliferate in vivo, the modified lymphocytes persist for weeks, even months, and thus participate in the reduction or even destruction of the tumor by killing the cancer cells.

[0254] Advantageously, the invention relates to a method of treating cancer in a patient in need, the method comprising administering an effective dose of composition as described above. In particular, the aforementioned method comprises administering an effective amount of immune cells comprising said composition as described above.

[0255] Advantageously, cancer can be of any type and involve solid tumors and hematopoietic tumors of any type. Cancer can therefore be, in particular,

[0256] - hematopoietic type: acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), mantle cell lymphoma (MCL), multiple myeloma (MM), non-Hodgkin's lymphoma (NHL), acute multiple leukemia (AML), CD19-positive cancers, chronic myeloid leukemia (CML), acute myeloid leukemia (AML), small lymphocytic leukemia (SLL), and CD20-positive malignancies, or

[0257] solid type: neuroblastoma (NB), glioma, mesothelioma, lung cancer, ovarian cancer (OC), breast cancer (BC), sarcoma, osteosarcoma (OS), hepatocellular carcinoma (HCC), HER2-positive cancer, EGFRvIII-positive cancer, glioblastoma (GBM), pancreatic cancer (PC), MUC1-positive cancer, prostate cancer (PCa), colorectal adenocarcinoma (COADREAD), colorectal cancer (CRC), melanoma (MEL), meduloblastoma (MB), gastric cancer (GC), liver cancer, neck cancer, head cancer, skin cancer, bone cancer, brain cancer, colorectal cancer, stomach cancer, associated bladder tumor, testicular cancer, thyroid cancer, endometrium, cervical and endocervical cancer.

[0258] In another aspect, the invention relates to the use of an above-mentioned composition, for inserting, into a T lymphocyte cell, a sequence encoding a fusion protein comprising, in the amino-terminal part a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part the CD3ζ chain of the TCR, provided that the use does not comprise a method for modifying the germline genetic identity of human beings and that said use is not a method for treating the human or animal body by surgery or therapy.

[0259] This insertion is preferentially located at the TRAC locus as described above.

[0260] As explained above, the composition allows to specifically target a target region and replace it with a sequence of interest, using the tagmentation properties of transposases.

[0261] The composition according to the invention is particularly advantageous for CAR cells in vitro, i.e. modified T cells expressing, in addition to the T receptor (TCR), a chimeric T receptor which allows specific cellular targeting of tumors.

[0262] The invention further relates to a method for inserting, in particular in vitro, a sequence coding for a fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the CD3ζ chain of the TCR, said method comprising:

[0263] - bringing into contact, in order to obtain a replacement complex, a composition as defined above, with a target nucleic acid comprising at least one 5' region of the locus of the gene coding for the TRAC protein,

[0264] said composition being such that

[0265] the sequence A of said first molecule comprises a sequence complementary to a first region of the locus of the gene coding for the TRAC protein,

[0266] the sequence B of said second molecule comprises a sequence complementary to a second region of the locus of the gene coding for the TRAC protein, and

[0267] the third molecule comprises the sequence of a fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the CD3ζ chain of the TCR located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule,

[0268] - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said composition, to obtain a recombination complex, and

[0269] - recombination of the combination complex to obtain the sequence coding for the fusion protein inserted into the target nucleic acid between the first and second regions of the locus of the gene coding for the TRAC protein.

[0270] Advantageously, the invention relates to a method for in vitro insertion of a sequence coding for a fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the CD3ζ chain of the TCR, said method comprising:

[0271] - bringing into contact, in order to obtain a replacement complex, a composition with a target nucleic acid comprising at least one 5' region of the locus of the gene coding for the TRAC protein, said composition comprising a triplet as defined in Table 2 or a sextuplet as defined in Table 3

[0272] - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said composition, to obtain a recombination complex, and

[0273] - recombination of the combination complex to obtain the sequence coding for the fusion protein inserted into the target nucleic acid between the first and second regions of the locus of the gene coding for the TRAC protein.

[0274] In another aspect, the invention relates to a method for producing chimeric antigen receptor T cells or CAR T cells comprising the sequence of a fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the CD3ζ chain of the TCR, said method comprising:

[0275] - bringing a composition as defined above into contact with a purified T cell, the genomic DNA of said purified T cell comprising the locus of the gene coding for the TRAC protein,

[0276] said composition or said assembly being such that

[0277] the sequence A of said first molecule comprises a sequence complementary to a first region of the locus of the gene coding for the TRAC protein,

[0278] the sequence B of said second molecule comprises a sequence complementary to a second region of the locus of the gene coding for the TRAC protein, and

[0279] the third molecule comprises the sequence of a fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the CD3ζ chain of the TCR located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule, in order to obtain a replacement complex,

[0280] - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said assembly, to obtain a recombination complex,

[0281] - recombination of the combination complex to obtain a CART cell, the genomic DNA of said CART cell comprising the sequence coding for said fusion protein at the locus of the gene coding for the TRAC protein, and

[0282] - purification of the CAR T cell.

[0283] Advantageously, the invention relates to a method for producing chimeric antigen receptor T cells or CAR T cells comprising the sequence of a fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the CD3ζ chain of the TCR, said method comprising:

[0284] - bringing a composition into contact with a purified T cell, the genomic DNA of said purified T cell comprising the locus of the gene coding for the TRAC protein, in order to obtain a replacement complex,

[0285] - bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said assembly, to obtain a recombination complex,

[0286] - recombination of the combination complex to obtain a CART cell, the genomic DNA of said CART cell comprising the sequence coding for said fusion protein at the locus of the gene coding for the TRAC protein, and

[0287] - purification of the CAR T cell.

[0288] The invention also relates to a modified T lymphoid cell obtainable by the aforementioned method, said modified T lymphoid cell comprising in its genome an insertion of a sequence coding for a fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the CD3ζ chain of the TCR, said insertion being located at the locus of the gene coding for the TRAC protein.

[0289] Due to the recombination by "tagmentation" carried out by transposases, and the molecular signature that such recombination generates, that is to say a gene modification at the level of the zones of cleavage of the DNA by the transposases, these lymphocyte cells can only be defined more precisely by their method of obtaining. These cells are recognizable by the recognition zones of the regions A, B, and possibly A' and B', which will differ from the original sequences.

[0290] These cells are new, and differ from those that could be obtained, for example, with modern genome editing technologies, such as CRISPR / Cas9. Brief description of the figures

[0291] The invention will be better understood by reading the examples below and the following figures:

[0292] is a first schematic representation of a first form of pairing of the first, second and third molecules of the composition according to the invention.

[0293] is a second schematic representation of a first form of pairing of the first, second and third molecules of the composition according to the invention.

[0294] is a third schematic representation of a first form of pairing of the first, second and third molecules of the composition according to the invention.

[0295] is a fourth schematic representation of a first form of pairing of the first, second and third molecules of the composition according to the invention.

[0296] is a fifth schematic representation of a first form of pairing of the first, second and third molecules of the composition according to the invention.

[0297] is a diagram showing the principle and steps of single-strand replacement using the first, second and third molecules of the composition according to the invention.

[0298] is a diagram showing the principle and steps of double-strand replacement using the first, second, third, fourth, fifth and sixth molecules of the composition according to the invention.

[0299] is a diagram showing the association of the molecules contained in tube 1 of example 1. The black ball represents biotin.

[0300] is a diagram showing the association of the molecules contained in tube 2 of example 1. The black ball represents biotin.

[0301] is a diagram showing the insertion of a scFV-coactivator domain-CD3ζ fusion. A. illustrates the TRAC locus near the TRAV and TRAJ loci, and the recognition zone around exon 1 of the complex formed by the first, third molecules (which contain the fusion sequence and exon 1 of TRAC), and second molecules. B. represents the tagmentation in the presence of transposases. C. represents the result of insertion of the fusion sequence at the TRAC locus. D. schematically represents the protein encoded by the fusion sequence inserted at the TRAC locus. * represents the scFv exposed to the outside of the T cell, ** represents the coactivator domain (e.g., CD28), and *** represents the intracellular activator domain of CD3ζ. Examples

[0302] Example 1 - Obtaining B cells expressing a CAR fusion

[0303] In order to treat patients with cancer expressing the CD19 marker, it may be advantageous to propose a cell therapy aimed at grafting into patients CAR T CD19 scFv- CD3ζ + cells having been modified using a composition according to the invention, in particular to insert the sequence coding the fusion protein at the TRAC locus, into T lymphocytes of the patient (in order to limit rejections). A- Isolation of T cells from blood

[0304] Blood samples from healthy donors are collected, fresh or frozen.

[0305] Samples are centrifuged at 1000g for 8min without brake on sterile density gradient centrifugation medium (e.g. Ficoll in the presence of EDTA) to isolate peripheral blood mononuclear cells (PBMCs);

[0306] The white blood cell rings are collected and washed with phosphate buffered saline (PBS) -

[0307] White blood cells are cultured for 12 hours at 37°C and 5% CO2 in a medium specifically dedicated to the culture of hematopoietic cells supplemented with IL-2 (20ng / mL) and 5% human serum.

[0308] T lymphocytes are then isolated in the cell sorter by positive selection using anti-CD3 antibody labeling or by negative selection using a cocktail of anti-CD2, anti-CD34, anti-CD14, anti-CD16, anti-CD19, anti-CD24, anti-CD56n, anti-CD66b and anti-CD61 antibodies;

[0309] The purified T cells are then cultured at 37°C and 5% CO2 for 72 hours under a CD3 / 28 and IL-2 activation cocktail (40ng / mL).

[0310] The cells are thus ready to be transfected with the composition according to the invention.

[0311] B- Preparation of the molecules of the composition according to the invention

[0312] In order to target the TRAC gene, and verify the insertion at the TRAC locus Chr14: 22,547,500- 22,552,358 HG38GR, a construct comprising GFP was prepared.

[0313] Two tubes were prepared as follows:

[0314] ** Tube 1 (10µL):

[0315] - oligo Great X1 (10µM) corresponding to molecule 1 of sequence SEQ ID: 198 following

[0316] 5'-AgaTgTGtatAAGAGaCAGGTAGTGTATTTTTTTTTTTTTTTTATCATCCTGtCTCTTataCAcAtcTTTTTTTTTTTTTTTTTTTTTTTGGCGATCGCTTTTTTTT TTTTTTTTGCAGACATCCAGCTGGATCCAAAACCAAATTTTTTTTTTTTTTTTGCGATCGCCTTTTTTTTTTTGATACATTTAgaTgTGtatAAGAGaCAGGATGAT-3'

[0317] - oligo Great X3 (10µM) corresponding to molecule 4, of sequence SEQ ID: 201 following

[0318] 5'-CACGTGCTGtCTCTTataCAcAtcTTTTCTCGATCATTATTATTTTTTGGCGATCGCTTTTTTTTTTTTTTTTCATTGCCGAGGCCACCAGGGCTGGCTCAGCTTTTTT TTTTTTTTTGCGATCGCCTTTTTTTTTTTTTTTTTTTTAgaTgTGtatAAGAGaCAGCACGTGTTTTTTTTTTTTTTTTTTTTCAGCTATACTGtCTCTTataCAcAtcT-3'

[0319] - the reverse oligo GREAT X1 Rev (10µM) corresponding to the 5' part of molecule 3 of sequence SEQ ID NO: 1139 following

[0320] 5'-TACACTACCTGtCTCTTataCAcAtcTTTTTTTTTTTTTTTTTTTTTTggttacGCGGCCGCCGTACA-3'

[0321] - the reverse oligo GREAT X3 Rev (10µM) corresponding to the 3' part of molecule 6 of sequence SEQ ID NO: 1140 following

[0322] 5'-TGTACGGCGGCCGCgtaaccTTTTTTTTTTTTTTTTTTTTTTAgaTgTGtatAAGAGaCAGTATAGCTG-3'

[0323] - the Reverse Helix Rev oligo corresponding to an additional strand allowing a helicase to be bound by the biotinylated 3' end, the oligo having the following sequence SEQ ID NO: 1141

[0324] 5’-ATAATAATGATCGAGAACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT[Biot]-3’

[0325] ** Tube 2 (10µL) :

[0326] - l’oligo Great X2 (10µM) correspondant à la molécule 2, de séquence SEQ ID NO : 199 suivante

[0327] 5'-CACGTGCTGtCTCTTataCAcAtcTTTTCTCGATCATTATTATTTTTTGGCGATCGCTTTTTTTTTTTTTT

[0328] TTGTTGGAGCCACTGACCCTGCCAGAATATGGTTTTTTTTTTTTTTTTGCGATCGCCTTTTTTTTTTTTTTTTTTTTTAgaTgTGtatAAGAGaCAGCACGTGTTTTTTTTTTTTTTTTTTTTGACGAATACTGtCTCTTataCAcAtcT-3'

[0329] - l’oligo Great X4 (10µM) correspondant à la molécule 5, de séquence SEQ ID NO : 202 suivante :

[0330] 5’- AgaTgTGtatAAGAGaCAGAGTATGAATTTTTTTTTTTTTTTTTATCATCCTGtCTCTTataCAcAtcTTTTTTTTTTTTTTTTTTTTTTTGGCGATCGCTTTTTTTTTTTTTTTTCTGCATGACTCACTAGCACTCTATCACGGCTTTTTTTTTTTTTTTTGCGATCGCCTTTTTTTTTTTTTGATACATTTAgaTgTGtatAAGAGaCAGGATGAT-3’

[0331] - the reverse oligo GREAT X2 Rev (10µM) corresponding to the 3' part of molecule 3 of sequence SEQ ID NO: 1142 following

[0332] 5'-CGATACGGTACCatgttcTTTTTTTTTTTTTTTTTTTTTTTAgaTgTGtatAAGAGaCAGTATTCGTC-3'

[0333] - the reverse oligo GREAT X4 Rev (10µM) corresponding to the 5' part of the following molecule 6 SEQ ID NO: 1143

[0334] 5'-TTCATACTCTGtCTCTTataCAcAtcTTTTTTTTTTTTTTTTTTTTTTgaacatGGTACCGTATCG-3'

[0335] - the Reverse Helix Rev oligo corresponding to an additional strand allowing a helicase to be bound via the biotinylated 3' end, the oligo having the sequence SEQ ID NO: 1142.

[0336] The two tubes are then heated to 95°C for 5 min then left for 1 hour at room temperature then each tube is digested with the corresponding restriction enzymes: Tube 1: NotI and Tube 2: KpnI then purified by PCR purification kit (elution 20µL).

[0337] Figures 4 and 5 schematically represent the contents of tubes 1 and 2 respectively before enzymatic digestion.

[0338] In parallel, the anti-CD19-CD3ζ-P2A-GFP sequence was obtained via direct amplification by DH5α bacteria of the plasmid pSLCAR-CD19-CD3 ζ. This sequence is amplified (oligos with NotI and KpnI restriction site architecture digested after PCR) then digested with the corresponding restriction enzymes and purified by PCR purification kit eluted at a volume of 20µL. The GFP-CD19-CD3ζ fusion is then with flanking ends (i.e. free NotI and KpnI half-site) in tube 3.

[0339] The contents of the 3 tubes (tube 1, tube 2 and tube 3) are then mixed and T4 phage ligase is added to the mixture (4µL, 100 U) in the presence of appropriate buffer (T4 buffer; 5µL 10X) and 11µL of distilled water. The mixture is left for 1 hour at room temperature. Then the mixture is gel purified (30µL elution) in order to isolate the largest fragment GFP-CD19-CD3ζ, greater than 1Kb, and comprising the four sarcophages X1, X2, X3 and X4 at its 5' and 3' ends. The purified fragment is ready for use and comprises the first, second, fourth and fifth molecules at the ends, the third and sixth molecules corresponding to the GFP-CD19-CD3ζ fusion (tube 4).

[0340] The replacement GFP-CD19-CD3ζ fragment with its four sarcophages positioned at the 5' and 3' ends is then ready to receive the transposase dimers.

[0341] At this stage, the modified single-stranded oligonucleotide complementary to a part of the first and fourth molecules, the 3' part of the complementary modified single-stranded oligonucleotide being coupled to biotin (biotinylated oligo), was added. This biotinylated molecule is not mandatory.

[0342] C- Transfection of T lymphocytes with the composition according to the invention.

[0343] The contents of tube 4, containing the biotinylated oligo or not, are then used to transfect the isolated lymphocyte cells by electroporation.

[0344] Cells are centrifuged at 300g for 5min and washed with PBS before being suspended in electrolytic buffer at a cell density of 75,000 to 100,000 cells per electroporation chamber. The contents of tube 4, as well as a plasmid encoding the Tn5 protein, and optionally a plasmid encoding a helicase-streptavidin fusion (UVRD-mSA) are added to the electroporation chamber according to the “Episomal iPSC Reprogramming Vectors” protocol of the Neon® Transfert System transfection system proposed by Thermofisher.

[0345] The mixture is electroporated at 1650V by three 10 ms sequences.

[0346] The cells are then immediately centrifuged at 300g for 5min and suspended in supplemented hematopoietic cell culture medium for 48 to 96h at 37°C and 5% CO2.

[0347] Tagmentation (i.e. gene replacement) is then possible. The cells are maintained in an appropriate culture medium. D- Verification of transfection

[0348] Transfected cells having inserted the molecule of interest at the locus are selected by means of selection with an antibiotic whose resistance gene is contained in the replacement sequence (for example neomycin, bleomycin, blasticidin S etc.).

[0349] A simple PCR using a sense oligonucleotide 5' of the insertion and an antisense oligonucleotide 3' of the insertion is performed (Single-Tail Adapter / Tag (STAT)-PCR based method). The PCR product is then sequenced using conventional techniques, in order to detect in the region of interest at least the presence of GFP, a sign of the fusion insertion.

[0350] Transfected cells can also be detected by cytometry to detect GFP expression.

[0351] Reverse transcription can also be performed on isolated cells to obtain a cDNA library. Amplification of the fusion sequence is then performed by PCR Oligos for PCR and sequencing antiCD19: AGGAGTCCCATCAAGGTTCAGT (SEQ ID NO: 1144) and GFP Rev: CACGAACTCCAGCAGGACCATG (SEQ ID NO: 1145) and the amplified fragment is sequenced by Sanger sequencing but also migrated on agarose gel. As expected, after analysis (NCBI blast), we find a very close similarity with the theoretical GFP-CD19-CD3ζ fragment at the TRAC locus.

[0352] E- Functional analysis of T cells modified by the composition according to the invention

[0353] In order to verify that the cells have been effectively transfected and that the insertion is functional, several tests are carried out: CAR T cell proliferation test

[0354] The produced T cells are cultured in 24-well plates in medium not supplemented with IL-2 and in the presence of irradiated Raji cells (ratio 1:1) at 37°C and 5% CO2;

[0355] A fraction of the T cells is harvested after 4, 7 and 10 days in order to count them by flow cytometry.CAR T cell cytotoxicity test

[0356] The produced T cells are cultured in 12-well plates in medium not supplemented with IL-2 and in the presence of Raji cells expressing a fluorochrome (ratio 3:1) at 37°C and 5% CO2;

[0357] After 24 hours of incubation, a fraction of the cells is harvested to quantify the presence of the fluorochrome by flow cytometry and the rest of the cells are re-cultured with an additional ratio of Raji cells;

[0358] This step is reproduced at 36h and 48h of incubation.

[0359] Example 2 – Alternate CD3ζ fusion format.

[0360] It is also possible to perform another fusion by following the protocol described above in Example 1.

[0361] Tube 1 is prepared as described in the example suf for the following sequences

[0362] - the reverse oligo GREAT X1 Rev (10µM) corresponding to the 5' part of molecule 3 of sequence SEQ ID NO: 1146 following

[0363] 5'-TACACTACCTGtCTCTTataCAcAtcTTTTTTTTTTTTTTTTTTTTTTggttacACCGGTCGTACA-3'

[0364] - the reverse oligo GREAT X3 Rev (10µM) corresponding to the 3' part of molecule 6 of sequence SEQ ID NO: 1147 following

[0365] 5'-TGTACGACCGGTgtaaccTTTTTTTTTTTTTTTTTTTTTTAgaTgTGtatAAGAGaCAGTATAGCTG-3'

[0366] Tube 2 is prepared as follows

[0367] - the reverse oligo GREAT X2 Rev (10µM) corresponding to the 3' part of molecule 3 of sequence SEQ ID NO: 1148 following

[0368] 5'-CGATACCCGCGGatgttcTTTTTTTTTTTTTTTTTTTTTTAgaTgTGtatAAGAGaCAGTATTCGTC-3'

[0369] - the reverse oligo GREAT X4 Rev (10µM) corresponding to the 5' part of the following molecule 6 SEQ ID NO: 1149

[0370] 5'-TTCATACTCTGtCTCTTataCAcAtcTTTTTTTTTTTTTTTTTTTTTTgaacatCCGCGGGTATCG-3'

[0371] - the Reverse Helix Rev oligo corresponding to an additional strand allowing a helicase to be bound via the biotinylated 3' end, the oligo having the sequence SEQ ID NO: 1142.

[0372] The two tubes are then heated to 95°C for 5 min then left for 1 hour at room temperature then each tube is digested with the corresponding restriction enzymes: Tube 1: AgeI and Tube 2: SacII then purified by PCR purification kit (elution 20µL).

[0373] In parallel, the anti-CD19-CD3ζ-P2A-GFP sequence was obtained via direct amplification by DH5α bacteria of the plasmid pSLCAR-CD19-CD3 ζ. This plasmid is then digested via the AgeI and SacII restriction sites and the CD19-CD3ζ-P2A-GFP sequence is then purified by gel purification kit to a volume of 20µL. The CD19-CD3ζ-P2A-GFP fusion is then with flanking ends (i.e. free AgeI and SacII half-site) in tube 3.

[0374] The contents of the 3 tubes (tube 1, tube 2 and tube 3) are then mixed and T4 phage ligase is added to the mixture (4µL, 100 U) in the presence of appropriate buffer (T4 buffer; 5µL 10X) and 11µL of distilled water. The mixture is left for 1 hour at room temperature. Then the mixture is gel purified (30µL elution) in order to isolate the largest CD19-CD3ζ-P2A-GFP fragment, greater than 1Kb, and comprising the four sarcophages X1, X2, X3 and X4 at its 5' and 3' ends. The purified fragment is ready for use and comprises the first, second, fourth and fifth molecules at the ends, the third and sixth molecules corresponding to the CD19-CD3ζ-P2A-GFP fusion (tube 4).

[0375] The replacement CD19-CD3ζ-P2A-GFP fragment with its four sarcophages positioned at the 5' and 3' ends is then ready to receive the transposase dimers.

[0376] At this stage, the modified single-stranded oligonucleotide complementary to a part of the first and fourth molecules, the 3' part of the complementary modified single-stranded oligonucleotide being coupled to biotin (biotinylated oligo), was added. This biotinylated molecule is not mandatory.

[0377] Transfection is performed as described in Example 1.

[0378] Transfection verification is performed as described in Example 1, except for reverse transcriptase detection. Amplification of the fusion sequence is then performed by PCR Oligos for PCR and sequencing antiCD19: AGGAGTCCCATCAAGGTTCAGT (SEQ ID NO: 1144) and GFP Rev: CACGAACTCCAGCAGGACCATG (SEQ ID NO: 1145) and the amplified fragment is sequenced by Sanger sequencing but also migrated on agarose gel. As expected, after analysis (NCBI blast), we find a very close similarity with the theoretical CD19-CD3ζ-P2A-GFP fragment at the TRAC locus.

[0379] Example 3 – Obtaining T cells expressing the CD3ζ-containing fusion from pluripotent stem cells.

[0380] Since it can be difficult to obtain T cells from the patient, it is possible to use induced pluripotent stem cell (iPSC) technology.

[0381] iPSc cells can be obtained from cell banks, whose immunological profile is compatible with patients.

[0382] It is also possible to take differentiated cells from the patient (for example fibroblasts or epithelial cells), and to force dedifferentiation by the expression of the Oct4 and Socs2 genes, as well as other genes such as Klf4, Dub3, c-Myc, Nanog. Such techniques are now well known to those skilled in the art, and they will be able to adapt the protocols described in the prior art according to the cell type they wish to engage in a dedifferentiation model.

[0383] At this stage it is possible to transfect the iPSc cells with Lipofectamine in the presence of tube 4 as described in Example 1 or Example 2.

[0384] Transfected cells are selected by use of the appropriate antibiotic, and insertion is verified as described in Example 1.

[0385] iPSc cells are cultured on cell matrix gel-coated plates, cocultured with inactivated murine embryonic fibroblasts for 24 hours, in complete stem cell culture medium supplemented with bFGF and ROCK inhibitor.

[0386] The iPSc cells are then cultured for 7 days in 24-hour culture media containing distinct differentiation cocktails each day:

[0387] o D0-1: medium supplemented with hBMP-4, hVEGF, hWnt3a and KOSR;

[0388] o D2: medium supplemented with hBMP-4, hVEGF and KOSR;

[0389] o D3: medium supplemented with hBMP-4, hVEGF and bFGF;

[0390] o D4-5: medium supplemented with hVEGF and bFGF;

[0391] o D6: IMDM medium supplemented with F12, B27, N2, BSA, hVEGF, bFGF, human stem cell factor and hFlt3 ligand;

[0392] o D7: IMDM medium supplemented with F12, B27, N2, BSA, hVEGF, bFGF, human stem cell factor, hFlt3 ligand, TPO, IL-6, hEPOgen, and FICZ (6-formylindolo [3,2-b]carbazole)

[0393] After 7 days, the cells are then kept in culture for an additional 3 to 7 days before continuing the experiments on the harvested non-adherent cells. These cells are tested to verify that they express the CD34+ marker, by flow cytometry using an anti-CD34 antibody.

[0394] If the cells were not transfected at the iPSc stage, they can then be transfected at the CD34+ stage as described in Example 1.

[0395] Their differentiation into T cells is then induced as follows:

[0396] - Differentiation into progenitor cells of the lymphoid lineage:

[0397] The resulting CD34+ cells are cultured on plates coated with cell matrix gel specifically designed for the culture of lymphoid progenitors without feeder cells, in a culture medium for hematopoietic cells supplemented with recombinant human cytokines to specifically promote differentiation into CD7+CD5+ T progenitor cells (pro-T cells).

[0398] The cells are maintained in culture at 37°C 5% CO2 for 14 days, refreshing half of the medium every 3-4 days.

[0399] - Maturation of progenitor cells into CD4+CD8+ T cells:

[0400] At D14, pro-T cells are collected, transferred to new cell matrix gel-coated plates, and cultured in a new hematopoietic cell culture medium supplemented with recombinant human cytokines to specifically promote the maturation of pro-T cells into mature T cells.

[0401] The cells are maintained in culture at 37°C 5% CO2 for 14 days, refreshing half of the medium every 3-4 days.

[0402] Maturation of T cells into CD8+:

[0403] The cells obtained in the previous step are collected, transferred into new plates coated with cell matrix gel and cultured in the same culture medium as previously supplemented in particular with recombinant human IL-15 and CD3 / 28 activation cocktail.

[0404] The cells are maintained in culture at 37°C 5% CO2 for 7 days, refreshing half of the medium on days 3-4.

Claims

Composition comprising- a first single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence being linked in 5' to a first T-rich sequence 40 to 60 nucleotides long and in 3' to a second T-rich sequence 40 to 60 nucleotides long, said first and second T-rich sequences respectively comprising a first and a second domain of 6 to 12 nucleotides rich in G / C, the sequence of the first domain being complementary to the sequence of the second domain, said first and second domains being positioned 15 to 52 nucleotides from said sequence A,said first molecule comprising at its 5' end at least a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second sequence for recognition of said transposase,- a second single-stranded nucleic acid molecule comprising or consisting essentially of a B sequence allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary B sequence being linked at 5' to a third T-rich sequence 40 to 60 nucleotides long and at 3' to a fourth T-rich sequence 40 to 60 nucleotides long, said third and fourth T-rich sequences respectively comprising a third and a fourth domain of 6 to 12 nucleotides rich in G / C, the sequence of the third domain being complementary to the sequence of the fourth domain,said third and fourth domains being positioned from 15 to 52 nucleotides of said sequence B, said second molecule comprising at its 5' end at least the first 5'-3' oriented recognition sequence of said transposase and at its 3' end the second recognition sequence of said transposase, said sequence B being a sequence complementary to said nucleic acid of interest, sequence A being positioned 5' of a region of interest of said nucleic acid of interest and sequence B positioned 3' of the region of interest of said nucleic acid of interest, and- a third single-stranded molecule comprising* in its 5' part, at least one sequence complementary to said second recognition sequence of said transposase of the first molecule,* in its 3' part at least one sequence complementary to said first recognition sequence of said transposase of the second molecule,and* an intermediate region located between the complementary sequence of said second recognition sequence of said transposase of the first molecule and the complementary sequence of said first recognition sequence of said transposase of the second molecule, said intermediate region comprising a sequence coding for a fusion protein, said fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the activator domain of the T lymphocyte, i.e. the CD3ζ chain of the T cell receptor or TCR,the first and third single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase and the second and third single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase., The composition of claim 1, wherein said fusion protein comprises the peptide capable of binding to a membrane protein of a cell, fused to a transmembrane portion of a membrane protein, the latter fused to the CD3ζ chain of the TCR. The composition of claim 1, wherein said fusion protein comprises the peptide capable of binding to a membrane protein of a cell, fused to a transmembrane portion of a membrane protein, the transmembrane domain of the membrane protein being fused to a coactivation domain, the latter being fused to the CD3ζ chain of the TCR. Composition according to any one of claims 1 to 3,- wherein said sequence A comprises a sequence complementary to the sequence of a first region of the locus of the gene coding for the TRAC protein and- wherein said sequence B comprises a sequence complementary to the sequence of a second region of the locus of the gene coding for the TRAC protein, said sequence A and said sequence B being two different sequences, said first and second regions of the TRAC locus advantageously flanking a 5' region of the locus of the gene coding for the TRAC protein. Composition according to any one of claims 1 to 4, wherein said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second 5'-3' oriented sequence for recognition of said transposase andwhere the second molecule comprises at its 5' end a first sequence complementary to said first sequence for recognition of said transposase followed by a second sequence complementary to said second sequence for recognition of said transposase. Composition according to any one of claims 1 to 5, wherein said first molecule comprises at its 5' end a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second sequence for recognition of said transposase, followed by a first sequence complementary to said first sequence for recognition of said transposase andwhere the second molecule comprises at its 5' end a sequence complementary to said second sequence for recognition of said transposase. Composition according to any one of claims 1 to 6, wherein said transposase is a bacterial transposase, in particular a transposase chosen from Tn5, Tn9, Tn10 or Tc1 / mariner. A composition according to any one of claims 1 to 7, wherein the intermediate region of the third molecule comprises the sequence SEQ ID NO: 3 or the sequence SEQ ID NO: 1134. Composition according to any one of claims 1 to 8, wherein the first, second and third molecules are chosen from the triplets as defined in Table 2. A composition according to any one of claims 1 to 9 further comprising,** a fourth single-stranded nucleic acid molecule comprising or consisting essentially of a sequence A' allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary sequence being linked in 5' to a fifth T-rich sequence 40 to 60 nucleotides long and in 3' to a sixth T-rich sequence 40 to 60 nucleotides long, said fifth and sixth T-rich sequences respectively comprising a fifth and sixth domain of 6 to 12 nucleotides rich in G / C, the sequence of the fifth domain being complementary to the sequence of the sixth domain, said fifth and sixth domain being positioned 15 to 52 nucleotides from said sequence A',said fourth molecule comprising at its 5' end at least a first 5'-3' oriented sequence for recognition of a transposase and at its 3' end a second sequence for recognition of said transposase,** a fifth single-stranded nucleic acid molecule comprising or consisting essentially of a B' sequence allowing the insertion of a sequence complementary to a nucleic acid of interest, or comprising a sequence complementary to a nucleic acid of interest, said complementary B' sequence being linked at 5' to a seventh T-rich sequence 40 to 60 nucleotides long and at 3' to an eighth T-rich sequence 40 to 60 nucleotides long, said seventh and eighth T-rich sequences respectively comprising a seventh and eighth domain of 6 to 12 nucleotides rich in GC, the sequence of the seventh domain being complementary to the sequence of the eighth domain,said seventh and eighth domains being positioned from 15 to 52 nucleotides of said sequence B', said fifth molecule comprising at its 5' end at least the first 5'-3' oriented recognition sequence of said transposase and at its 3' end the second recognition sequence of said transposase, said sequence B' being a sequence complementary to said nucleic acid of interest, sequence A' being positioned 5' of a region of interest of said nucleic acid of interest and sequence B' positioned 3' of the region of interest of said nucleic acid of interest, and** a sixth single-stranded molecule comprising* in its 5' part, at least one sequence complementary to said fifth recognition sequence of said transposase of the first molecule,* in its 3' part at least one sequence complementary to said fourth recognition sequence of said transposase of the second molecule,and* an intermediate region located between the complementary sequence of said fourth recognition sequence of said transposase of the first molecule and the complementary sequence of said fifth recognition sequence of said transposase of the second molecule, a complementary sequence of said sequence coding for said fusion protein contained in the third molecule, the fourth and sixth single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase and the fifth and sixth single-stranded nucleic acid molecules being paired according to the base complementarity defined by Watson and Crick so as to define two double-stranded binding sites of said transposase., Composition according to claim 10, wherein- said sequence A comprises a sequence complementary to the sequence of a first region of the locus of the gene coding for the TRAC protein,- said sequence B comprises a sequence complementary to the sequence of a second region of the locus of the gene coding for the TRAC protein, said sequence A and said sequence B being two different sequences, said first and second regions advantageously flanking a 5' region of the locus of the gene coding for the TRAC protein, and wherein- said sequence A' comprises a sequence complementary to the sequence of a third region of the locus of the gene coding for the TRAC protein,- said sequence B' comprises a sequence complementary to the sequence of a fourth region of the locus of the gene coding for the TRAC protein, said sequence A' and said sequence B' being two different sequences, said third and fourth regions of the locus of the gene coding for the TRAC protein,advantageously framing a sequence complementary to said 5' region of the locus of the gene coding for the TRAC protein, and where sequence A and sequence A' are at most partly complementary, sequence A and sequence B' are at most partly complementary, sequence B and sequence A' are at most partly complementary, and sequence B and sequence B' are at most partly complementary., An isolated and purified immune cell, in particular a T lymphocyte cell, comprising a composition according to any one of claims 1 to 11. Pharmaceutical composition comprising:- a composition according to any one of claims 1 to 11, or- an immune cell according to claim 12, in association with a pharmaceutically acceptable vehicle. Composition according to any one of claims 1 to 11, for use as a medicament. Composition according to any one of claims 1 to 11, for its use in the treatment of cancer. Use of a composition according to any one of claims 1 to 11, for inserting, into a T lymphocyte cell, a sequence coding for a fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the CD3ζ chain of the TCR, provided that the use does not comprise a method for modifying the germline genetic identity of human beings and that said use is not a method for treating the human or animal body by surgery or therapy. A method for in vitro insertion of a sequence encoding a fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the CD3ζ chain of the TCR, said method comprising:- contacting, in order to obtain a replacement complex, a composition as defined in any one of claims 1 to 11, with a target nucleic acid comprising at least one 5' region of the locus of the gene encoding the TRAC protein, said composition being such that the sequence A of said first molecule comprises a sequence complementary to a first region of the locus of the gene encoding the TRAC protein, the sequence B of said second molecule comprises a sequence complementary to a second region of the locus of the gene encoding the TRAC protein, and the third molecule comprises the sequence of a fusion protein comprising,in the amino-terminal part a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part the CD3ζ chain of the TCR located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule,- bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said composition, to obtain a recombination complex, and- recombination of the combination complex to obtain the sequence coding for the fusion protein inserted into the target nucleic acid between the first and second regions of the locus of the gene coding for the TRAC protein., A method for producing chimeric antigen receptor T cells or CAR T cells comprising the sequence of a fusion protein comprising, in the amino-terminal portion, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal portion, the CD3ζ chain of the TCR, said method comprising:- contacting a composition as defined in any one of claims 1 to 11, with a purified T cell, the genomic DNA of said purified T cell comprising the locus of the gene encoding the TRAC protein, said composition or said assembly being such that the sequence A of said first molecule comprises a sequence complementary to a first region of the locus of the gene encoding the TRAC protein, the sequence B of said second molecule comprises a sequence complementary to a second region of the locus of the gene encoding the TRAC protein, and the third molecule comprises the sequence of a fusion protein comprising,in the amino-terminal part a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part the CD3ζ chain of the TCR located between a sequence complementary to said second recognition sequence of said transposase of the first molecule and the sequence complementary to said first recognition sequence of said transposase of the second molecule, in order to obtain a replacement complex,- bringing the replacement complex into contact with a transposase recognizing the double-stranded binding sites of said transposase contained in said assembly, to obtain a recombination complex,- recombination of the combination complex to obtain a CART cell, the genomic DNA of said CART cell comprising the sequence coding for said fusion protein at the locus of the gene coding for the TRAC protein, and- purification of the CAR T cell., Modified T lymphoid cell obtainable by the method according to claim 19, said modified T lymphoid cell comprising in its genome an insertion of a sequence coding for a fusion protein comprising, in the amino-terminal part, a peptide capable of binding to a membrane protein of a cell and in the carboxy-terminal part, the CD3ζ chain of the TCR, said insertion being located at the locus of the gene coding for the TRAC protein.

Images