Glycosylated animal protein expression in plant cells

Abstract

A method for animal protein production in a plant cell is disclosed. The method comprises designing a DNA vector for expression of an animal gene; inserting the DNA vector into the plant cell; grow the cells in defined media under defined conditions. In certain embodiments, the protein will remain in the Endoplasmic reticulum preventing downstream glycan modification. The addition of H / KDEL fused to the C-Terminal CDS of the protein will keep the protein from moving out of the endoplasmic reticulum. In some embodiments, the protein will pass from the endoplasmic reticulum to the Golgi apparatus and undergo additional modifications. In some embodiments, the addition of a vacuole targeting signal peptide fused to the C-terminal CDS of the protein directs the protein to a vacuole. In certain embodiments, the protein is passed along the endoplasmic reticulum, the Golgi apparatus, and undergo further modifications in the apoplast.

Description

Docket No. 10909-10334 PCT Glycosylated Animal Protein Expression in Plant Cells TECHNICAL FIELD

[0001] Protein production in cell cultures, and glycosylation of proteins. BACKGROUND

[0002] Proteins are large biomolecules that perform many different functions and reactions in all living organisms. These include DNA replication, response to environmental stimuli, transport of ions and other molecules, and catalyzing metabolic reactions. Proteins are composed of long amino acid chains. According to the central dogma in biology, different proteins are products of different genes and differ from each other in the number and sequence of amino acids. Each protein has a specific function, and specific targets it can interact with based on its amino acid sequence, which determines the protein structure.

[0003] Additional layer of protein diversity is derived from a variety of modifications that occur during / post protein synthesis. The most abundant type of modification in nature is protein glycosylation. Simply put, protein glycosylation is the covalent attachment of sugars (i.e., glycan) to a protein. Protein glycosylation is a complex, multistep process mediated by enzymes such as glycosyltransferase and glycosidases, that determine which proteins are to become glycoproteins, the positions of glycans attached to those proteins and the glycan structures assembled. In most cases, the glycosidases and glycosyltransferases involved in the N-glycan maturation are type II membrane proteins with a short N-terminal cytoplasmic tail, a single transmembrane domain, a stem region, and a large catalytic domain associated with the enzyme activity. SUMMARY

[0004] In a first aspect, the disclosure provides a method for animal protein production in a plant cell comprising: designing a DNA vector for expression of an animal gene; inserting the DNA vector into the plant cell; grow the cells in defined media under defined conditions.

[0005] Different conditions for growing cells lead to different results in the production and activity of those cells. Determining the optimal conditions for the cells utilized leads to better results for the cells and cellular products. In some embodiments, the definedDocket No. 10909-10334 PCT conditions comprise bioreactors and no photosynthesis, fertilizers, or soil. The media comprises: sucrose, salts, minerals, vitamins, and water. The cells are grown in a range of temperatures. In certain embodiments, the temperature is room temperature.

[0006] Glycosylation of proteins occurs in several cellular locations, and each different location produces a different glycosylation product. Such locations include the endoplasmic reticulum, Golgi apparatus, vacuoles, and cellular membranes. In some embodiments, the protein will remain in the Endoplasmic reticulum preventing downstream glycan modification. The addition of H / KDEL fused to the C-Terminal CDS of the protein will keep the protein from moving out of the endoplasmic reticulum. In some embodiments, the protein will pass from the endoplasmic reticulum to the Golgi apparatus and undergo additional modifications. In some embodiments, the addition of a vacuole targeting signal peptide fused to the C-terminal CDS of the protein directs the protein to a vacuole. In certain embodiments, the protein is passed along the endoplasmic reticulum, the Golgi apparatus, and undergo further modifications in the apoplast. In certain embodiments the vector includes a gene knockout of the first glycosyltransferase.

[0007] The vector includes sequences to enhance the expression of certain characteristics of the cells. One such sequence is a leader sequence. In some embodiments, the leader sequence is from Arabidopsis thaliana CHIB gene, Nicotiana tabacum acidic endochitinase P, Nicotiana tabacum Endochitinase A, and the ubiquitous H / KDEL signal peptide.

[0008] In certain embodiments, the cells are plant cells. Certain plant cells have proven more optimal for production of animal proteins. In these embodiments, the plant cells are one of Zephyranthes tubispatha, Muscari armeniacum, Euphorbia neococcinea, Tilia dasystyla, Rabiea albipuncta, Nicotiana tabacum, Nicotiana benthamiana, Bauhinia divaricate, Tragopogon porrifolius, Weberocereus imitans, Gasteria nitida, Pelargonium carnosum, Lamarckia aurea, Hakea suaveolens, Dracaena canaliculate, Dracaena canaliculate, Moraea aristate, Passiflora foetida, Orbea lutea, Malva sylvestris, Campanula fragilis, Amoreuxia palmatifida, Gomphrena globose, or Cleome gynandra.

[0009] Vectors include regions for integration into the DNA of the host cells and generally begin with a promoter and end with a terminator. In some embodiments, the vector further comprises a 35S mosaic cauliflower virus promoter. In other embodiments, the vector further comprises a nopaline synthase terminator.Docket No. 10909-10334 PCT

[0010] One of the areas for use of this method is in the production of food proteins. The vector inserts a specific animal protein into a plant cell and the plant cell reproduces and expresses the protein, giving an animal food protein.

[0011] In another aspect, a cell for producing a glycosylated animal protein is described comprising: a DNA vector inserted into the cell.

[0012] In some embodiments, the cell is a plant cell. In certain of these embodiments, the plant cell is one of Zephyranthes tubispatha, Muscari armeniacum, Euphorbia neococcinea, Tilia dasystyla, Rabiea albipuncta, Nicotiana tabacum, Nicotiana benthamiana, Bauhinia divaricate, Tragopogon porrifolius, Weberocereus imitans, Gasteria nitida, Pelargonium carnosum, Lamarckia aurea, Hakea suaveolens, Dracaena canaliculate, Dracaena canaliculate, Moraea aristate, Passiflora foetida, Orbea lutea, Malva sylvestris, Campanula fragilis, Amoreuxia palmatifida, Gomphrena globose, or Cleome gynandra.

[0013] In some embodiments, the cell is grown in a range of temperatures. In some of these embodiments, the temperature is room temperature.

[0014] The vector includes sections that code for proteins to direct where the protein is processed. In some embodiments, H / KDEL fused to the C-Terminal CDS of the protein retains the protein in the endoplasmic reticulum. In some embodiments, a vacuole targeting signal peptide fused to the C-terminal CDS of the protein directs the protein to a vacuole. In some embodiments, a gene knockout, introduced by the vector, of the first glycosyltransferase. The vector includes other functional sequences, such as a leader sequence. In some embodiments, the leader sequence is from Arabidopsis thaliana CHIB gene, Nicotiana tabacum acidic endochitinase P, Nicotiana tabacum Endochitinase A, and the ubiquitous H / KDEL signal peptide. In some embodiments, the vector further comprises a 35S mosaic cauliflower virus promoter. In certain embodiments, the vector further comprises a nopaline synthase terminator.

[0015] Further aspects and embodiments are provided in the foregoing drawings, detailed description and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The following drawings are provided to illustrate certain embodiments described herein. The drawings are merely illustrative and are not intended to limit the scope of claimed inventions and are not intended to show every potential feature or embodiment ofDocket No. 10909-10334 PCT the claimed inventions. The drawings are not necessarily drawn to scale; in some instances, certain elements of the drawing may be enlarged with respect to other elements of the drawing for purposes of illustration.

[0017] Figure 1 is a Western Blot analysis of CSN3 expression in plant cells.

[0018] Figure 2 is a Western Blot analysis of CSN3 expression in plant cells.

[0019] Figure 3 is a Western Blot analysis of CSN3 expression in the leaves of N. Benthamian.

[0020] Figure 4 is an Ion Exchange Chromatography analysis of CSN3 expression in plant cells.

[0021] Figure 5 is an ELISA analysis of CSN3 expression in plant cells.

[0022] Figure 6 is an ELISA analysis of Lactoferrin expression in plant cells.

[0023] Figure 7 is a Western Blot analysis of transient expression of recombinant Lactoferrin in N. Benthamian leaves. DETAILED DESCRIPTION

[0024] The following description recites various aspects and embodiments of the inventions disclosed herein. No particular embodiment is intended to define the scope of the invention. Rather, the embodiments provide non-limiting examples of various compositions, and methods that are included within the scope of the claimed inventions. The description is to be read from the perspective of one of ordinary skill in the art. Therefore, information that is well known to the ordinarily skilled artisan is not necessarily included. Definitions

[0025] The following terms and phrases have the meanings indicated below, unless otherwise provided herein. This disclosure may employ other terms and phrases not expressly defined herein. Such other terms and phrases shall have the meanings that they would possess within the context of this disclosure to those of ordinary skill in the art. In some instances, a term or phrase may be defined in the singular or plural. In such instances, it is understood that any term in the singular may include its plural counterpart and vice versa, unless expressly indicated to the contrary.Docket No. 10909-10334 PCT

[0026] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, reference to “a substituent” encompasses a single substituent as well as two or more substituents, and the like.

[0027] As used herein, “for example,” “for instance,” “such as,” or “including” are meant to introduce examples that further clarify more general subject matter. Unless otherwise expressly indicated, such examples are provided only as an aid for understanding embodiments illustrated in the present disclosure and are not meant to be limiting in any fashion. Nor do these phrases indicate any kind of preference for the disclosed embodiment.

[0028] The present invention is directed to methods and compositions by which plant cells are manipulated and genetically modified to produce glycosylated animal proteins (glycoproteins). The proteins show modified patterns of glycosylation that are very similar to their animal counterparts produced by animals or by animal cell cultures. The glycoproteins are intended to be used in the variety of applications where protein functionality is mediated by glycosylation across the food industry. In one embodiment, the animal protein is casein. In an embodiment the animal protein is kappa casein. In a particular embodiment the animal protein is a muscle protein. In further embodiments, the animal protein is a blood protein. In an embodiment, the animal protein is lactoferrin.

[0029] Other advantages of using plant cell cultures are that in contrast to the N- glycan profile of mammalian cell-derived recombinant proteins where a mixture of N-glycans is present, the plant produced counterparts exhibit generally a largely homogeneous glycosylation profile with a single dominant N-glycan species.

[0030] How the final glycosylation profile of a particular protein actually looks like is a priory not predictable. Two factors seem to influence the process: (i) the route along the secretory pathway and the final destination / accumulation of the heterologous proteins, and (ii) the intrinsic character of the (recombinant) protein itself.

[0031] Glycosylation plays a major role in amplifying protein diversity by generating proteins with identical amino acid sequence but with different glycosylation profiles, which gives each glycoform unique properties. Most glycans are found on the outermost surfaces of the cell or on secreted proteins and show remarkable diversity. Surface exposed glycans can form hydrogen bonds or other non-covalent interactions with other amino acids in the same protein, improving proper protein folding and conformational stability, prevent abnormal protein aggregation, decrease thermal denaturation and proteolytic inactivation. Furthermore,Docket No. 10909-10334 PCT glycans also directly participate in molecular interactions with other macromolecules such as proteins, altering the affinity, specificity, and biological activity of their protein conjugate.

[0032] There are 20 amino acids in nature, but only a few of them can undergo glycosylation. Glycosylation is classified according to the amino acid residue within the protein that is being glycosylated. To date, five distinct types of sugar-amino acid bonds have been identified:

[0033] • N-linked glycans – Carbohydrate attached to a nitrogen atom of asparagine or arginine amino acid.

[0034] • O-linked glycans - Carbohydrate attached to an oxygen atom of serine, threonine, tyrosine, hydroxylysine, or hydroxyproline amino acid.

[0035] • Phosphoglycans - linked through the phosphate of a phosphoserine;

[0036] • C-linked glycans - a rare form of glycosylation where a sugar is added to a carbon on a tryptophan side-chain

[0037] • Glypiation - the addition of a GPI anchor that links proteins to lipids through glycan linkages.

[0038] Protein glycosylation is a sequential process, and in each step, sugars are either added or trimmed from the glycan structure. The process begins in the endoplasmic reticulum (ER) and continues in the Golgi system of eukaryotic cells as the protein makes its way toward their final destinations, resulting in glycosylation of most (>85%) secreted proteins. Unlike proteins, glycans are not primary gene products and their synthesis occurs without a template.

[0039] Protein glycosylation is also very important in a variety of food products and applications. As a type of biomolecule, proteins play an important role in determining food texture, taste, flavor, color, and nutritional values. Protein glycosylation is directly affecting the protein hydration properties (solubility, viscosity, water holding capacity), ability to interact with other proteins and molecules (e.g., calcium), emulsion and foaming capacity, gelation, and sedimentation. For example, solubility, emulsibility, foamability, thermal stability, gel property of whey proteins, ovalbumin, bovine serum albumin, and peanut protein isolate, is significantly improved following protein glycosylation.

[0040] Glycoengineering is a method of improving the properties of proteins by changing their glycosylation profile. The process of genetic glycoengineering is tailored for a specific protein, as there is no currently available method to predict the glycosylation profileDocket No. 10909-10334 PCT of a recombinant protein expressed in a heterologous system in advance. Glycoengineering can be used to modify any glycosylation pathway including, but not limited to N-linked, O- linked, C-linked, phosphoglycans, and glypiation. 2.1 The glycosylation pathway overview and glycosylation engineering strategies:

[0041] The first step of N-glycosylation takes place in the ER, during protein synthesis. In brief, a glycan structure is first synthesized on the ER membrane, and then attached ‘en bloc’ to an Asparagine residue found within the following consensus sequence motif Asn-XXX-Ser / Thr / Cys, where XXX can be any amino acid except proline.

[0042] Next, the resultant glycoprotein is trimmed and transported from the ER to the Golgi, for further processing before reaching its destination. Further processing of the carbohydrate chain in the Golgi differs between yeasts, plants, and animal cells. In animal cells, the glycan structure is processed to complex-type glycan composed of galactose, fucose, sialic acid and N-acetylglucosamine, while in yeast cells there is there is only a step wise addition of mannose, which results in complicated hyper mannosylated glycoprotein. In plants, complex N-glycans share the core structure with mammalian, with the addition of unique plant glycans (β1,2-xylose and core α1,3-fucose residues), which leads to divergence in glycosylation profile of the expressed protein.

[0043] Using the common glycan core structures between plants and mammalians is the key to successful expression of animal glycoproteins in plants. Knocking-out the first enzyme in the pathway that triggers the divergence between plants and animals is a key strategy to successfully produce glycoengineered proteins in plants. In addition, knocking out the enzymes that add plant-specific glycan structures (i.e., β1,2-xylose and core α1,3-fucose residues) is additional method of modifying the glycan structure.

[0044] It is important to note that the final glycosylation profile of a specific protein is a priory not predictable. The final glycosylation profile is influenced by two factors: (a) the route along the secretory pathway and the final protein destination of the heterologous proteins, and (b) the intrinsic characteristic of the protein itself.

[0045] For this reason, a general methodology was devised which could be applied to any glycoprotein production in plant cell cultures. Specifically, our approach allows us to determine which cellular compartment is optimal for obtaining a functional glycoprotein and / or which cellular compartment is the optimal starting for the glycoengineering process. Each protein is expressed under the control of 3 DNA vectors, where different signal peptidesDocket No. 10909-10334 PCT targeting the protein to either be retained in the ER, or the plant vacuole or the apoplast. Following that, the protein glycoforms are analyzed using LC-MS / MS and compared to the WT protein. The optimal starting point for glycoengineering for each protein will be determined by comparing the glycoforms structures to the endogenous protein in a functional assay. For example – different protein variants will be subjected to enzymatic cleavage assay by the chymosin enzyme, which specifically cleaves the glycol-peptide fragment of kappa casein. In addition, the different variant’s ability to interact with the other 3 casein subunits to form a casein micelle structure with similar properties to WT casein micelle will be evaluated. Specifically, comparison of the micelle size, structure, and mineral composition will be compared. In addition, the ability to emulsify and coagulate will be evaluated and compared to the WT casein micelle proteins from bovine source. The variants performing the closest to the WT protein, will be subjected to the glycoengineering process.

[0046] First possibility would be to knock-out the first glycosyltransferase in the early Golgi apparatus and add a retention signal, targeting the protein to the ER, and preventing any further downstream glycan modification from occurring. This would result in a protein glycosylation profile carrying mainly oligo-mannosidic N-glycans (Man7, Man8, Man9), and are largely devoid of plant-specific glycans xylose and fucose. This is since plant specific β- 1,2-xylose and α-1,3-fucosylation are added in the medial and trans Golgi, respectively. To determine whether further glycan modifications are necessary (e.g., gene knock-in of bovine glycosyltransferase to perform), the protein functionally will be compared to the WT protein in a functionality assay. For example, Lactoferrin protein binding to iron, inhibition of pathogenic bacteria growth (used as antimicrobial agent in food). This approach is sometimes challenging to apply to pharmaceutical proteins, as these protein glycoforms have oligomannosidic structures atypical on mammalian proteins. As a result, the proteins are quickly eliminated from the bloodstream by immune cells. Since the protein passes through the body digestive track, this aspect is no longer a shortcoming, but a novel feature that could be used for providing enhanced protein performance in various food applications.

[0047] The second possibility would be to target the protein to secretion to the plant lytic vacuole. This means the protein will pass along the ER and the Golgi secretory pathway before reaching the plant lytic vacuole where it will undergo additional vacuole-specific glycosylation modifications. Unlike storage vacuoles that are present in storage tissues (e.g., seeds), lytic vacuoles are normally found in all tissue types and share some of their basic properties with the lysosomes of animal cells. One example is the glucocerebrosidaseDocket No. 10909-10334 PCT enzyme, which is made by targeting the protein to the plant lytic vacuole of carrot cells grown in suspension cultures. The enzyme was shown to be functional, and with improve performance compared to the counterpart made using animal cell cultures.

[0048] The third possibility would be to send the protein to the plant apoplast (i.e., extracellular matrix). In this scenario – the protein is passed along the ER, the Golgi, and final modifications occur in the plant apoplast by unique enzymes that are localized in the apoplast.

[0049] For each protein – all three possibilities will be evaluated by targeting the protein to these compartments, expressing, and isolating the protein, and comparing the different protein glycoforms performance by unique functional assays. The optimal subcellular location / s will be identified, and then start a process of “trial and error” to knock out / in specific glycosyltransferases genes and evaluate their influence on protein performance in the end product application.

[0050] Described herein is plant cell comprising a heterologous coding sequence operatively linked to sequence encoding a signal peptide, wherein the signal peptide is selected from the group consisting of an endoplasmic reticulum retention signal, a vacuole targeting signal peptide, and an apoplast targeting signal peptide.

[0051] In particular embodiments, the signal peptide may be, but is limited to, one of an Arabidopsis thaliana CHIB gene leader sequence, Nicotiana tabacum acidic endochitinase P leader sequence, Nicotiana tabacum Endochitinase A leader sequence, HDEL, and KDEL. In embodiments the heterologous coding sequence is a plant sequence. In certain embodiments the heterologous coding sequence is from one of the genera: okra, fir, maple, agrostis, allium, liuzhi, pineapples, andrographis, sidactylodes, andrographis, juniper, artemisia, arundo, atropa, berberis, (Beta), mangrove, brassica, calendula, camellia, camptotheca, cannabis, capsicum, safflower, catharanthus, cephalotaxus, chrysanthemums, cinchona, watermelons, coffee, colchicines, perilla (Coleus), cucumber, cucurbita, bermuda, manillea, dianthus, digitalis, dioscorea, elaeis, ephedra, saccharum, coca, festuca, strawberries, glycine, gossypium, helianthus, hevea, horea, hordeum, henbanum, scopolia, lettuce, salmonum, eclipta, calamus, lycopodium, and lycopodium, Mentha, Miscanthus, Musa, Nicotiana, Oryza, Panicum, Papaveris, Galium, Euphorbia, petunia, Phalaris (Phalaris), Gracilaria, Pinus, Populus, Rosa (Rosa), Saccharum, Salix, Rhizophora, Scopolia, Secale, Solanum, sorghum, Euphorbia, Ehrlichia, Taxus, Theobroma, triticale, Triticum, Helicosum, Veratrum, Catharanthus, Vitis, and Zea. In embodiments the heterologous codingDocket No. 10909-10334 PCT sequence is a fungal sequence. In embodiments the heterologous coding sequence is an animal sequence. In embodiments the heterologous coding sequence is a mammalian sequence. In particular embodiments, the heterologous coding sequences is from Meleagris Gallopavo, Bos indicus, Capra Hircus., Equus Caballus, Ovis Aries, Gallus Gallus Domesticus, Bos Tarus, and Sus Scrofa.

[0052] In embodiments the plant cell may lacks one or more of the enzymes required for β1,2-xylosylation and / or α1,3-fucosylation. In further embodiments, the plant cell comprises a knockout at least one glycosyltransferase and / or glycosidase

[0053] Embodiments include a plant cell plant cell lacking one or more of the enzymes required for β1,2-xylosylation and / or α1,3-fucosylation. In further embodiments, that plant cell further comprises a knockout at least one glycosyltransferase and / or glycosidase

[0054] Embodiments include set of nucleic acids, the set comprising at least two of: a coding sequence operatively linked to a heterologous endoplasmic reticulum retention signal, the coding sequence operatively linked to a heterologous vacuole targeting signal peptide, and the coding sequence operatively linked to a heterologous an apoplast targeting signal peptide. In particular embodiments, the set comprises the coding sequence linked, separately, to each of the three types of signal peptide.

[0055] Embodiments include methods of evaluating glycoforms of a protein, the method comprising: expressing in separate plant cells each of a heterologous coding sequence operatively linked to a endoplasmic reticulum retention signal, the coding heterologous sequence operatively linked to a vacuole targeting signal peptide, and the heterologous coding sequence operatively linked to a an apoplast targeting signal peptide so as to produce different glycoforms of the protein encoded by the coding sequence; purifying the different glycoforms; and evaluating the different glycoforms for one more physical properties in comparison to protein expressed by the coding sequence in its wild-type source organism.

[0056] In particular embodiments, the one or more physical properties are selected form the group consisting of enzymatic cleavage, complex formation, ligand binding, enzymatic activity, solubility, viscosity, water holding capacity, emulsion capacity, foaming capacity, gelation capacity, thermal stability, and sedimentation.

[0057] In particular embodiments, one or more of the signal peptides of the method may be, but is limited to, one of an Arabidopsis thaliana CHIB gene leader sequence,Docket No. 10909-10334 PCT Nicotiana tabacum acidic endochitinase P leader sequence, Nicotiana tabacum Endochitinase A leader sequence, HDEL, and KDEL. In embodiments the heterologous coding sequence is a plant sequence. In certain embodiments the heterologous coding sequence is from one of the genera: okra, fir, maple, agrostis, allium, liuzhi, pineapples, andrographis, sidactylodes, andrographis, juniper, artemisia, arundo, atropa, berberis, (Beta), mangrove, brassica, calendula, camellia, camptotheca, cannabis, capsicum, safflower, catharanthus, cephalotaxus, chrysanthemums, cinchona, watermelons, coffee, colchicines, perilla (Coleus), cucumber, cucurbita, bermuda, manillea, dianthus, digitalis, dioscorea, elaeis, ephedra, saccharum, coca, festuca, strawberries, glycine, gossypium, helianthus, hevea, horea, hordeum, henbanum, scopolia, lettuce, salmonum, eclipta, calamus, lycopodium, and lycopodium, Mentha, Miscanthus, Musa, Nicotiana, Oryza, Panicum, Papaveris, Galium, Euphorbia, petunia, Phalaris (Phalaris), Gracilaria, Pinus, Populus, Rosa (Rosa), Saccharum, Salix, Rhizophora, Scopolia, Secale, Solanum, sorghum, Euphorbia, Ehrlichia, Taxus, Theobroma, triticale, Triticum, Helicosum, Veratrum, Catharanthus, Vitis, and Zea. In embodiments the heterologous coding sequence is a fungal sequence. In embodiments the heterologous coding sequence is an animal sequence. In embodiments the heterologous coding sequence is a mammalian sequence. In particular embodiments, the heterologous coding sequences is from Meleagris Gallopavo, Bos indicus, Capra Hircus., Equus Caballus, Ovis Aries, Gallus Gallus Domesticus, Bos Tarus, and Sus Scrofa.

[0058] In embodiments the plant cell used in the method may lack one or more of the enzymes required for β1,2-xylosylation and / or α1,3-fucosylation. In further embodiments, the plant cell comprises a knockout at least one glycosyltransferase and / or glycosidase. Materials and Methods: Production of animal derived food proteins and glycoproteins in plant cell cultures for the food industry.

[0059] Traditional production of animal-derived food products requires growing feed crops in open fields (e.g., soy, corn, sorghum etc.), harvesting, transporting, and processing of the seeds to different locations where it will be used as feed for animals such as cows, chickens and pigs. This production chain is resource intensive, inefficient, and most importantly, is not able to support the fast-growing human population demand for food. The paradigm is that animals are grown for their ability to produce milk, eggs and meat, that is being collected by farmers, transported to designated food production facilities where it isDocket No. 10909-10334 PCT processed into different products or integrated as ingredients in many different food products. As 50% of the habitable land is already used for food production, and climate change has a dramatic and devastating influence on food production, humanity urgently needs to find an alternative that allows production of food all year round, in any geographical location and without fertilizers, pesticides or risk of pathogenic bacterial / viral / fungal contaminants.

[0060] These outdated and ancient methods of production are unsustainable and resource intensive (water, land, antibiotics, gas and energy) and also raise moral issues about the use of animals as food production “machines”. Furthermore, whether based on animal or crop agriculture, requires the harvesting and transportation of the goods from remote locations to designated facilities where the goods are processed and packed into food products. In light of the global energy crisis, and the need to produce food more efficiently and sustainably, we propose a new method of food production that takes place in a single geographical location, detached from land type, requires just a fraction of the water and electricity, and is not dependent on season of the year.

[0061] The approach described herein offers for the first time to harvest biotechnology tools that were previously applied in very limited capacity, and only in the pharmaceutical industry, to a novel application in the food production industry. Utilizing this approach, both production of food crops and animals could be replaced all together, while providing humanity with a resilient and sustainable food production system. By providing the cells with Sucrose, their metabolism can be altered in such a way that they do not require sunlight for growth. The plant cells can be grown in a range of temperatures (+ / - 5°C from room temp), with simple media composition (sucrose, salts, minerals, vitamins, and water), in simple and inexpensive containers (i.e., bioreactors), all year round (up to 26 cycles per year), without any risk of viral / bacterial / fungal contaminations. Since plants have cell walls - viruses that infect humans are not able to penetrate the cell wall, preventing potential outbreaks such as COVID-19 for example. Only salts, minerals, vitamins, sugar and small amounts of plant growth regulators are used – therefore none of the components are derived from an animal source, which significantly reduces the risk of human bacterial, fungal and viral pathogens. Finally - as the entire process takes place in sterile bioreactors using aseptic techniques - a safe production chain that is free of any contaminants is offered.

[0062] This invention details a new method of animal protein production that skips the traditional route of relying on agriculture of either animals or crops. Using genetic engineering and synthetic biology tools, a DNA vector is designed for the expression of anDocket No. 10909-10334 PCT animal gene of interest. The DNA vector is introduced into plant cells, which drives the expression of the recombinant protein. The cells are grown in defined media in bioreactors, without photosynthesis, fertilizers, pesticidies or dependency on soil type, whether conditions and geographical location. Moreover, the entire process takes place in. a controlled environment, allowing for safe and sustainable onshore food production without batch to batch inconsistencies. Finally, the resultant product will not be considered GMO since the protein is isolated from the plant cells, and there is no DNA left in the final product. Design of DNA vectors driving the expression of various proteins glycoforms

[0063] Coding sequence of animal proteins is taken from publicly available databases such as NCBI. The sequence is then cloned into 3 DNA vectors, under the control of 35S Mosaic cauliflower virus promoter and nopaline synthase (Tnos) terminator, with different signal peptides fused to the protein targeting the protein to different subcellular locations. All proteins are fused in their N-terminal to leader sequence directing the protein to the secretory pathway, either from Arabidopsis thaliana or Nicotiana tabacum. In one vector type, the addition of H / KDEL fused to the C-terminal CDS of the protein retains the protein in the ER. In a second vector, a vacuole targeting signal peptide fused to the C-terminal CDS targets the protein to the plant vacuole. In the third vector, the lack of additional signal peptides (i.e., HDEL or Vacuole SP) targets the protein for secretion to the apoplast. The combination of three DNA vectors is used to test the effect of different cellular pathways on protein modification and specifically protein glycosylation.

[0064] These signal peptides may include, but are not limited to, leader sequences from Arabidopsis thaliana CHIB gene, Nicotiana tabacum acidic endochitinase P, Nicotiana tabacum Endochitinase A, and the ubiquitous H / KDEL signal peptide.

[0065] The coding sequence is taken from the publicly available database such as NCBI and undergoes codon optimization for optimal expression in the new host organism. Following that, the entire coding sequence or CDS is subjected to codon optimization using computer aided algorithms, which include GeneArt, GenScript, ExpOptimzer, Codon harmonizer (Global, and amino acid versions), ATGme. The different coding sequences are compared to achieve the highest expression level for each recombinant protein.Docket No. 10909-10334 PCTDocket No. 10909-10334 PCT

[0066] Further disclosed herein are the following enumerated embodiments:

[0067] 1. A plant cell, the plant cell comprising: a heterologous coding sequence operatively linked to sequence encoding a signal peptide, wherein the signal peptide is selected from the group consisting of an endoplasmic reticulum retention signal, a vacuole targeting signal peptide, and an apoplast targeting signal peptide.

[0068] 2. The plant cell of embodiment 1, wherein the plant cell comprises different copies of the heterologous coding sequence linked to different selected signal peptides.

[0069] 3. The plant cell of embodiment 1, wherein the endoplasmic reticulum retention sequence is a HDEL or KDEL sequence.

[0070] 4. The plant cell of embodiment 1, wherein the vacuole targeting signal peptide targets to the lytic vacuole.

[0071] 5. The plant cell of embodiment 1, wherein the signal peptide is selected from at least one of an Arabidopsis thaliana CHIB gene leader sequence, Nicotiana tabacum acidic endochitinase P leader sequence, Nicotiana tabacum Endochitinase A leader sequence, HDEL, and KDEL.

[0072] 6. The plant cell of embodiment 1, wherein the heterologous coding sequence is an animal coding sequence.

[0073] 7. The plant cell of embodiment 1, wherein the heterologous coding sequence is a mammalian coding sequence.Docket No. 10909-10334 PCT

[0074] 8. The plant cell of embodiment 7, wherein the heterologous coding sequence encodes casein or lactoferrin.

[0075] 9. The plant cell of embodiment 1, wherein plant cell lacks one or more of the enzymes required for β1,2-xylosylation and / or α1,3-fucosylation.

[0076] 10. The plant of embodiment 9, wherein the plant cell further comprises a knockout at least one glycosyltransferase and / or glycosidase.

[0077] 11. A plant cell lacking one or more of the enzymes required for β1,2- xylosylation and / or α1,3-fucosylation.

[0078] 12, The plant of embodiment 11, further comprising a knockout at least one glycosyltransferase and / or glycosidase.

[0079] 13. A set of nucleic acids, the set comprising at least two of: a coding sequence operatively linked to a heterologous endoplasmic reticulum retention signal, the coding sequence operatively linked to a heterologous vacuole targeting signal peptide, and the coding sequence operatively linked to a heterologous an apoplast targeting signal peptide.

[0080] 14. The set of nucleic acids of embodiment 13, wherein the set comprises all three of the coding sequence operatively linked to a heterologous endoplasmic reticulum retention signal, the coding sequence operatively linked to a heterologous vacuole targeting signal peptide, and the coding sequence operatively linked to a heterologous an apoplast targeting signal peptide.

[0081] 15. The set of nucleic acids of embodiment 13, wherein the set of nucleic acids are comprised in a set of plant cells.

[0082] 16. The plant cell of embodiment 13, wherein the coding sequence is an animal coding sequence.Docket No. 10909-10334 PCT

[0083] 17. The plant cell of embodiment 13, wherein the coding sequence is a mammalian coding sequence.

[0084] 18. The plant cell of embodiment 13, wherein the coding sequence encodes casein or lactoferrin.

[0085] 19. A method of evaluating glycoforms of a protein, the method comprising: expressing in separate plant cells each of a heterologous coding sequence operatively linked to a endoplasmic reticulum retention signal, the coding heterologous sequence operatively linked to a vacuole targeting signal peptide, and the heterologous coding sequence operatively linked to a an apoplast targeting signal peptide so as to produce different glycoforms of the protein encoded by the coding sequence; purifying the different glycoforms; and evaluating the different glycoforms for one more physical properties in comparison to protein expressed by the coding sequence in its wild-type source organism.

[0086] 20. The method according to embodiment 19, wherein one or more physical properties are selected form the group consisting of enzymatic cleavage, complex formation, ligand binding, enzymatic activity, solubility, viscosity, water holding capacity, emulsion capacity, foaming capacity, gelation capacity, thermal stability, and sedimentation.

[0087] 21. The method according to embodiment 19, wherein the endoplasmic reticulum retention sequence is a HDEL or KDEL sequence.

[0088] 22. The method according to embodiment 19, wherein the vacuole targeting signal peptide targets to the lytic vacuole.

[0089] 23. The method according to embodiment 19, wherein the signal peptide is selected from at least one of an Arabidopsis thaliana CHIB gene leader sequence,Docket No. 10909-10334 PCT Nicotiana tabacum acidic endochitinase P leader sequence, Nicotiana tabacum Endochitinase A leader sequence, HDEL, and KDEL.

[0090] 24. The method according to embodiment 19, wherein the heterologous coding sequence is an animal coding sequence.

[0091] 25. The method according to embodiment 19, wherein the heterologous coding sequence is a mammalian coding sequence.

[0092] 26. The method according to embodiment 19, wherein plant cell lacks one or more of the enzymes required for β1,2-xylosylation and / or α1,3-fucosylation.

[0093] 27. The method according to embodiment 19, wherein the plant cell comprises a knockout at least one glycosyltransferase and / or glycosidase. Examples Example 1

[0094] BY2 Transformation

[0095] Plant Cell culture growth and maintenance:

[0096] Nicotiana tabacum cv. BY-2 (Nagata et al., 1992) cell suspensions were grown in dark conditions (no light source) at 25°C with 120 RPM agitation on a rotary shake (MaxQ 6000, Thermo Scientific), in liquid MS media [4.31 g / L Murashige and Skoog salts (Phytotech labs, Cat# B1468 ), supplemented with 30 g / L sucrose (Duchefa, S0809), 2.5 mg / L thiamine (Sigma, T1270), 50 mg / L myo-inositol (Sigma, I7508), and 0.2 mg / L of 2,4- Dichlorophenoxyacetic Acid (Phytotech labs, Cat# D299), pH 5.8 (adjusted with 1M KOH). Solid media was supplemented with 6g / L.

[0097] For solid cultures – Calli were transferred to fresh solid media every two weeks. Liquid cultures were grown in 50 mL of liquid media in a 250-mL sterile Erlenmeyer flask. 10% inoculum was transferred each week into 45mL of fresh medium to maintain a healthy suspension culture of cells. Plant transformationDocket No. 10909-10334 PCT

[0098] The AF#1-16 plasmids were mobilized into Agrobacterium tumefaciens strain EHA105, GV3101, or LBA 4404 by freeze thaw method (Jyothishwaran, 2007). In brief, 1- 5ug of purified plasmid were added to 50ul of competent Agrobacterium and incubated on ice for 20 minutes. The mixture was transferred into liquid nitrogen for 2 minutes, then the mixture was incubated at 37 C for 5 minutes. Following that, 1ml of sterile LB media (Formedium, Cat#LMM0102) was added to the mixture and the cells were incubated at 28°C for 2-4 hours. The cells were harvested by centrifugation at 13,000 RPM for 5 minutes, and cultured on LB agar (Formedium, Cat#LBX0202) plates supplemented with appropriate antibiotics. The cells were incubated at 28°C for 48 hours until individual colonies appeared on the agar plates.

[0099] Next, a single colony is picked and grown overnight at 28°C with 120 RPM agitation on a rotary shaker in liquid LB media supplemented with appropriate antibiotics. In the following morning, 5% of culture was transferred into fresh LB media, supplemented with appropriate antibiotics and 150mM Acetosyringone. The culture was grown at 28°C with 120 RPM agitation on a rotary shaker for 4-6 hours, until OD600 = 0.8. [000100] One mL of fresh Agrobacterium cells was harvested by centrifugation at 13,000 RPM for 5 minutes and supernatant was discarded. The cells were resuspended in 1ml of Paul media, harvested by centrifugation at 13,000 RPM for 5 minutes, supernatant was discarded, and the cells were resuspended in 30ul of Paul media. Preparation of BY-2 cells for transformation [000101] 50mL of 3 Day old BY2 suspension cultures were transferred into a 50mL sterile tube, and cells were left to sediment at 1xg for 20 minutes at room temperature. The supernatant was discarded, and the cells were resuspended in 40ml of fresh Paul media and cells left to sediment at 1xg for 20 minutes at room temperature. The supernatant was discarded, and the cells were resuspended in 10ml of Paul media. [000102] Finally, the BY2 cells were transferred into 2 ml microcentrifuge tubes and mixed with 30ul of agrobacterium. The mixture was incubated for 5 minutes at room temperature and then plated on solid Paul media plates supplemented with 150uM of Acetosyringone (Phytotech Labs, A104). The plates were left to dry without the lid in the biological hood for 20 minutes, then sealed with parafilm and incubated in dark at 25°C for 72-96 hours.Docket No. 10909-10334 PCT [000103] Next the cells were scraped from the plates using a sterile cell scraper (AlexRed, BX 70-1250) and resuspended in 40mL of sterile PBS solution (Sartorius, Cat # 02-023-1A) The cells were left to sediment at 1xg for 20 minutes at room temperature and the supernatant was discarded. Next, the cells were resuspended in 50mL of liquid MS media [4.31 g / L Murashige and Skoog salts (Phytotech labs, Cat# B1468 ), supplemented with 30 g / L sucrose (Duchefa, S0809), 2.5 mg / L thiamine (Sigma, T1270), 50 mg / L myo-inositol (Sigma, I7508), and 0.2 mg / L of 2,4-Dichlorophenoxyacetic Acid (Phytotech labs, Cat# D299), pH 5.8 adjusted with 1M KOH (Sigma, 911062), 400 mg / L Ticarcillin (Duchefa, T0190) and 500 mg / L carbenicillin (Formedium, CAS 4800-94-6). The cells were grown in the dark at 25°C for seven days. Next, the cells were left to sediment at 1xg for 20 minutes, and supernatant was discarded. The cells were resuspended in liquid MS media, supplemented with 400 mg / L Ticarcillin and 500 mg / L carbenicillin and 100 mg / L kanamycin. Kanamycin-resistant transformants were screened for GOI expression by ELISA and Western blot. Detection of recombinant protein expression in plant cell suspension culture [000104] Sample preparation - 10mL of 3 days old culture transformed cells were harvested by centrifugation at 600 xg for 10 minutes and the supernatant was discarded. The packed cells were then frozen in liquid nitrogen and crushed to fine powder using a mortar and pestle. Approximately 300-500mg of fine powder were transferred to a 1.7ml Eppendorf tube, and 500ul of PBS supplemented with Protease Inhibitor Cocktail (Sigma, cat# P9599) were added. [000105] A sterile 96 well ELISA plate was coated with 50μl of total protein or control antigen (50μg / ml) in PBS and incubated O.N at 4ºC or 1 for hour at R.T. The plate was blocked with 300μl / well of 3% [w / v] skim milk or 3% [v / v] in PBS for 2 hours at 37ºC, followed by 3 washes with PBS supplemented with 0.05% Twin (Sigma-Aldrich, T8787). Next, 75μl / well of primary antibody (table 1) antibody in blocking solution were applied to the first row in the plate, and serial dilution was carried out through the plate, followed by incubation 1 hour at R.T. Plate was washed 3 times with 300μl / well of PBST. Secondary antibody (table 2) anti H+L HRP conjugated was diluted 1 / 5000 in PBST and 50μl / well were applied to the plate for 1 hour incubation at R.T. The plate was washed 3 times with PBST. Finally, 50μl / well of TMB (Southern Biotech, 0410-01) were applied to the plate and incubated at R.T. Reaction was stopped by adding 50μl / well of 1M HSO. Plate absorbance at A was read using plate reader (Epoch, BioTek).Docket No. 10909-10334 PCT [000106] An alternative sample preparation is as follows: 100 mg fresh weight of cells was harvested and subsequently subjected to rapid freezing using liquid nitrogen. The frozen cells were ground into to fine powder using a pestle and mortar. Next, lysis buffer was added to the cells at a ratio of 1:5 [w / v] and incubated on ice for 40 minutes. Following this, the samples were centrifuged at 12,000 x g for 10 minutes at 4°C. The resultant supernatant, containing the cellular extract, was carefully transferred to a fresh tube. Subsequently,15ul of 4x sample buffer was mixed with 45ul of supernatant, and the samples were boiled at 95°C for a duration of 10 minutes. [000107] Western Blot [000108] Following SDS-PAGE run, proteins from gel were transferred onto a nitrocellulose membrane using iBlot® 2 Gel Transfer Device (IB21001, Thermo). Membranes were then blocked with 3% [w / v] skim milk or 3% [v / v] gelatin (Sigma, Cat#G7765) in TBST for 2 hours at R.T. Primary antibody (Table 1) was diluted in blocking solution and incubated O.N at 4°C. Membranes were then washed 3 times with TBST for 10 minutes at R.T. Blots were probed with HRP-conjugated secondary antibodies (Table 2) diluted in blocking solution and incubated for 1 hour at R.T, following 3 washes with TBS-T for 5 minutes at R.T. To detect protein bands, the membranes were developed using ECL super signal kit or ECL WESTAR SUPERNOVA for weak signals. Signal detection was performed using Amersham Imager 600 (Danyel Biotech). Protein bands intensities was quantified using densitometry analysis in ImageJ (Research Services Branch). Table 1. Western Blot and ELISA Primary Antibodies:Docket No. 10909-10334 PCTTable 2. Western Blot and ELISA Secondary Antibodies:[000110] An additional Western Blot analysis proceeds in the following manner: Following SDS-PAGE run, proteins from gel were transfer onto a PVDF membrane using iBlot® 2 Gel Transfer Device (IB21001, Thermo). Membranes were than blocked with 1% [w / v] bovine serum albumin in TBST for 2 hours at 37C. Primary antibody (Cloud clone corp PAJ3001, rabbit anti-casein), was diluted in blocking solution and incubated for 2 hours at 37C. Membranes were than washed 3 times with TBST for 5 minutes at R.T. Blots were probed with HRP-conjugated anti-species (Goat anti Rabbit, HRP conjugated, Jackson 111- 035-003) antibodies diluted in blocking solution and incubated for 1 hour at R.T, following 3 washes with TBS-T for 5 minutes at R.T. To detect protein bands, the membranes were developed using TMB Southern Biotech. Protein bands intensities was quantified using densitometry analysis in ImageJ (Research Services Branch). Example 2 [000111] Kappa casein expression [000112] Kappa casein was expressed in plant cells in a variety of locations within the plant cell. Various plasmids were constructed containing: a CSN3 gene; promoters from the group comprising promoter 1, promoter 2, promoter 3, and promoter 4; and terminators from the group comprising terminator 1, terminator 2, terminator 3, terminator 4, terminator 5, andDocket No. 10909-10334 PCT terminator 6. The resultant plasmids were introduced into plant cells. Following growth of the plant cells, protein expression levels were evaluated. [000113] Promoter 1, P2x35S [000114] GTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACA GTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGG AAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTG GAAAAGGAAGGTGGCT CCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTG CCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAA GAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATAACATGGTG GAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGA CCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCG GATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAG GTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGAT GCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGT GGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATA TCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTT CCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACGTCGAGAGTTCTCAACA CAACATATACAAAACAAACGAATCTCAAGCAATCAAGCATTCTACTTCTATTGC AGCAATTTAAATCATTTCTTTTAAAGCAAAAGCAATTTTCTGAAAATTTTCACCA TTTACGAACGATAG (SEQ ID NO:1) [000115] Promoter 2 P_Stubi [000116] GGAGGGAATCTAATACTTACCTCTTAGAAATAAGAAAAAGTGTTT CTAATAGACCCTCAATTTACATTAAATATTTTCAATCAAATTTAAATAACAAAT ATCAATATGAGGTCAATAACAATATCAAAATAATATGAAAAAAGAGCAATACA TAATATAAGAAAGAAGATTTAAGTGCGATTATCAAGGTAGTATTATATCCTAAT TTGCTAATATTTAAACTCTTATATTTAAGGTCATGTTCATGATAAACTTGAAATG CGCTATATTAGAGCATATATTAAAATAAAAAAATACCTAAAATAAAATTAAGTT ATTTTTAGTATATATTTTTTTACATGACCTACATTTTTCTGGGTTTTTCTAAAGGA GCGTGTAAGTGTCGACCTCATTCTCCTAATTTTCCCCACCACATAAAAATTAAA AAGGAAAGGTAGCTTTTGCGTGTTGTTTTGGTACACTACACCTCATTATTACAC GTGTCCTCATATAATTGGTTAACCCTATGAGGCGGTTTCGTCTAGAGTCGGCCADocket No. 10909-10334 PCT TGCCATCTATAAAATGAAGCTTTCTGCACCTCATTTTTTTCATCTTCTATCTGATT TCTATTATAATTTCTCTCAATTGCCTTCAAATTTCTCTTTAAGGTTAGAAATCTTC TCTATTTTTGGTTTTTGTCTGTTTAGATTCTCGAATTAGCTAATCAGGTGCTGTTA TAGCCCTTAATTTTGAGTTTTTTTTCGGTTGTTTTGATGGAAAAGGCCTAAAATT TGAGTTTTTTTACGTTGGTTTGATGGAAAAGGCCTACAATTGGAGTTTTCCCCGT TGTTTTGATGAAAAAGCCCCTAGTTTGAGATTTTTTTTCTGTCGATTCGATTCTA AAGGTTTAAAATTAGAGTTTTTACATTTGTTTGATGAAAAAGGCCTTAAATTTG AGTTTTTCCGGTTGATTTGATGAAAAAGCCCTAGAATTTGTGTTTTTTCGTCGGT TTGATTCTGAAGGCCTAAAATTTGAGTTTCTCCGGCTGTTTTGATGAAAAAGCC CTAAATTTGAGTTTCTCCGGCTGTTTTGATGAAAAAGCCCTAAATTTGAGTTTTT TCCCCGTGTTTTAGATTGTTTGGTTTTAATTCTCGAATCAGCTAATCAGGGAGTG TGAAAAGCCCTAAAATTTGAGTTTTTTTCGTTGTTCTGATTGTTGTTTTTATGAA TTTGCAG (SEQ ID NO:2) [000117] Promoter 3, P_Superpromoter [000118] ACGGTATCGATAAGCTCGCGGATCCCTGAAAGCGACGTTGGATGT TAACATCTACAAATTGCCTTTTCTTATCGACCATGTACGTAAGCGCTTACGTTTT TGGTGGACCCTTGAGGAAACTGGTAGCTGTTGTGGGCCTGTGGTCTCAAGATGG ATCATTAATTTCCACCTTCACCTACGATGGGGGGCATCGCACCGGTGAGTAATA TTGTACGGCTAAGAGCGAATTTGGCCTGTAGGATCCCTGAAAGCGACGTTGGAT GTTAACATCTACAAATTGCCTTTTCTTATCGACCATGTACGTAAGCGCTTACGTT TTTGGTGGACCCTTGAGGAAACTGGTAGCTGTTGTGGGCCTGTGGTCTCAAGAT GGATCATTAATTTCCACCTTCACCTACGATGGGGGGCATCGCACCGGTGAGTAA TATTGTACGGCTAAGAGCGAATTTGGCCTGTAGGATCCCTGAAAGCGACGTTGG ATGTTAACATCTACAAATTGCCTTTTCTTATCGACCATGTACGTAAGCGCTTACG TTTTTGGTGGACCCTTGAGGAAACTGGTAGCTGTTGTGGGCCTGTGGTCTCAAG ATGGATCATTAATTTCCACCTTCACCTACGATGGGGGGCATCGCACCGGTGAGT AATATTGTACGGCTAAGAGCGAATTTGGCCTGTAGGATCCGCGAGCTGGTCAAT CCCATTGCTTTTGAAGCAGCTCAACATTGATCTCTTTCTCGATCGAGGGAGATTT TTCAAATCAGTGCGCAAGACGTGACGTAAGTATCCGAGTCAGTTTTTATTTTTCT ACTAATTTGGTCGTTTATTTCGGCGTGTAGGACATGGCAACCGGGCCTGAATTT CGCGGGTATTCTGTTTCTATTCCAACTTTTTCTTGATCCGCAGCCATTAACGACT TTTGAATAGATACGCTGACACGCCAAGCCTCGCTAGTCAAAAGTGTACCAAACA ACGCTTTACAGCAAGAACGGAATGCGCGTGACGCTCGCGGTGACGCCATTTCGCDocket No. 10909-10334 PCT CTTTTCAGAAATGGATAAATAGCCTTGCTTCCTATTATATCTTCCCCCAAATTAC CAATACATTACACTAGCATCTGAATTTCATAACCAATCTCGATACACCAAATCG ACTCTAGG (SEQ ID NO:3) [000119] Promoter 4, P_AtHsp70 [000120] GAACTGCGAAAAAAGGGAGCAATAAAGTTCAGAAACAAGCCCTT GACTGTATGTTGAGAAGAAATAAACATTACCTGCCATGGTCTTTCCCAGTCAAG TGGCATAGGCCAAGCTCCAAACCATCCTCCAATAATTGCTCCATATGCTGGAAC TAAGAGCATATGTTCTATAATTCCGATTGGTCTAAAAGAAAAAAAAAAGATGG ATTAACAACAACATAAAGTGTGTGAATTATCATACTAGGTAGCATAAGTGACTT ACTTTAGTGAAGCAAAGATACGATGCCAATCTATCCATGATGCACCTAAAACTG CAGTTGCTGGTACAACCTATGAAAATCAAAATCATCAGACACCATCAAAAGGTT TGTTTCAAACTGCAGAAATACACATATGGCATGGTATTAACATCTTTTAAGTCA TGGACACTGCAGCTTACCGTGAAAACAGACATTAGAAAGGACCAGTGAATTGT TTTTGATAGAGATCTGCATAAGATGAGAAGGTAATACTCATGTCAGCTTTTGAA AATCACACAATCTCCATGCAGAAGTGAGACCACAACCAGCATTAAGGAGCCTC ATTTTTAATCTGGACAACTGAAAAGTCCAGATTTACAATCAACATTTCCACAAT TAGAAAGAAATAAAAAGATATAGAGAAAGAAGATCTTAGTGAAACATACTGCA TTCCAATAGGTGCACCCAAAGAAACAGCTCCCAAAGCATTTATAAGAGCACCT ATTAAACAAATCAAAACACAGGTATAGATATAGTAGACACAATCAAGGGATAC TGAATCAGCAAAAGCACAAGATGAAAGCATAAGAAGCTCAGACTCACTCACAT CTTCAGGTTTAGCTTAACATCTAGAATTTCCAGGTGAACTCATTGAGCAATCAA CTTCTTTGAAAAATTAGTGAGCTATAATAAGCTGAAAAACAGAAATACTAACCG GCAATTAGTCCGACTAAGCTTCGGCCAACAGCTCTAAAGTACTGGAAATCAATG AGAAAATCATGAATACAGAGTCAAAACACACAAGACCAAAATAATACTATATG AAAAGAAACGATTTTTTTGAGCATTAAGAGTGTAAAGTGAGGATACTAGCTTGT TTTGTCAATTTCATAAAAGGGAAATGAGACAAGCACAAAGCAATCGAGTTAAA ACGAGAAATTCAGTTTCTTTAATTCTCACAGAGAACCTCAGAGATGAACTATAC TCACCGAGCATTTCTCTGGGTTTCGTCGGAACAAGCTGTAGATGATTACCACGA TCGGGAACTCAATAATCTGAATATCAACATCAAAACAAAAAGGCTAAAATTAA CTGAAAAATATCCACTAGCAACCAGGTTATGAAAGAAAGTTTTAGTACCCATAG GAGACGCAGAGTGAGAGTTGGATCAGAAATGAGATCGACAGAGTATTTGTTAC GGACCACGTGAAATCCGAAGATCAGAAATAACCCAGTAATCACATAAACAGCA AAAGCCCCCCAAGTTGATATCGTGATACTAACGGAGATTTCTGGATTCTTCTTCTDocket No. 10909-10334 PCT CCTTCGCCTCTTTCATGGCTTTTCCTTTCTCGTCTTCGAAATCACAGAACAAGTG AAGAAAGAAGACGTAAACAAAATATTGAAAATCCTCCAGAACTTACACTGGGC CTTTTATTCTATATACGGGCCTACAAGTTTATACCATATGGGCTTTAATAGGCCC ATTTAATTATCAAGCGGTCGCCGGAGATAAAATATATCCCGGTCGGTGAATCCA GAACTCTCTTGTACGTTTGCGCGATTTCTCCACCTTTCCACAATCCCCTGGGTTG TGCCACGACCTTTTTTCTCGAAATGTCTCGTTCCTCTCGTCGGATTCGTATATAT AGCTTCTTCCATCGTTTCCGATTCTTCATCAAACAGATAAACAAACAAAAGAAA TCGAAAAACCTCACTTCCAATTTCATTCAATTACTGAAGCTTTTTTTTAGCA (SEQ ID NO:4) [000121] Terminator 1, T_3*utr-nos [000122] TTAACTCTGGTTTCATTAAATTTTCTTTAGTTTGAATTTACTGTTAT TCGGTGTGCATTTCTATGTTTGGTGAGCGGTTTTCTGTGCTCAGAGTGTGTTTAT TTTATGTAATTTAATTTCTTTGTGAGCTCCTGTTTAGCAGGTCGTCCCTTCAGCA AGGACACAAAAAGATTTTAATTTTATTAAAAAAAAAAAAAAAAAAAAGACCGG GAATTCGATATCAAGCTTATCGACCTGCAGATCGTTCAAACATTTGGCAATAAA GTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCT GTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTAT GAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGA AAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTA TGTTACTAGATCTCT (SEQ ID NO:5) [000123] Terminator 2, T_AtHsp18.2 [000124] ATATGAAGATGAAGATGAAATATTTGGTGTGTCAAATAAAAAGCT TGTGTGCTTAAGTTTGTGTTTTTTTCTTGGCTTGTTGTGTTATGAATTTGTGGCTT TTTCTAATATTAAATGAATGTAAGATCTCATTATAATGAATAAACAAATGTTTCT ATAATCCATTGTGAATGTTTTGTTGGATCTCTTCTGCAGCATATAACTACTGTAT GTGCTATGGTATGGACTATGGAA (SEQ ID NO:6) [000125] Terminator 3, Trbc [000126] TCATAAGCCCGATGGCTACTAAGTTTTACTATTTACCAAGACTTTT GAATATTAACCTTCTTGTAACGAGTCGGTTAAATTTGATTGTTTAGGGTTTTGTA TTATTTTTTTTTGGTCTTTTAATTCATCACTTTAATTCCCTAATTGTCTGTTCATTT CGTTGTTTGTTTCCGGATCGATAATGAAATGTAAGAGATATCATATATAAATAA TAAATTGTCGTTTCATATTTGCAATCTTTTTTTTACAAACCTTTAATCGTTGTATGDocket No. 10909-10334 PCT TATGACATTTTCTTCTTGTTATATTAGGGGGAAATAATGTTAAATAAAAGTACA AAATAAACTACAGTACATCGTACTGAATAAATTACCTAGCCAAAAAGTACACCT TTCCATATACTTCCTACATGAAGGCATTTTCAACATTTTCAAATAAGGAATGCTA CAACCGCATAATAACATCCACAAATTTTTTTATAAAATAACATGTCAGACAGTG ATTGAAAGATTTTATTATAGTTTCGTTATCTTCTTTTCTCATTAAGCGAATCACT ACCTAACACGTCATTTTGTGAAATATTTTTTGAATGTTTTTATATAGTTGTAGCA TTCCTCTTTTCAAATTAGGGTTTGTTTGAGATAGCATTTCAGCCGGTTCATACAA CTTAAAAGCATACTCTAATGCTGGAAAAAAGACTAAAAAATCTTGTAAGTTAGC GCAGAATATTGACCCAAATTATATACACACATGACCCCATATAGAGACTAATTA CACTTTTAACCACTAATAATTATTACTGTATTATAACATCTACTAATTAAACTTG TGAGTTTTTGCTAGAATTATTATCATATATACTAAAAGGCAGGAACGCAAACAT TGCCCCGGTACTGTAGCAACTACGGTAGACGCATTAATTGTCTATAGTGGA (SEQ ID NO:7) [000127] Terminator 4, T_35S [000128] GTCCGCAAAAATCACCAGTCTCTCTCTACAAATCTATCTCTCTCTA TTTTTCTCCAGAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTCTT ATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTAT TTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTG AC (SEQ ID NO:8) [000129] Terminator 5, T_nos [000130] CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTG CCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAAT AATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGT CCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACT AGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGG (SEQ ID NO:9) [000131] Terminator 6, T_AtAct2 [000132] GCTCTCAAGATCAAAGGCTTAAAAAGCTGGGGTTTTATGAATGGG ATCAAAGTTTCTTTTTTTCTTTTATATTTGCTTCTCCATTTGTTTGTTTCATTTCCC TTTTTGTTTTCGTTTCTATGATGCACTTGTGTGTGACAAACTCTCTGGGTTTTTAC TTACGTCTGCGTTTCAAAAAAAAAAACCGCTTTCGTTTTGCGTTTTAGTCCCATT GTTTTGTAGCTCTGAGTGATCGAATTGATGCCTCTTTATTCCTTTTGTTCCCTATA ATTTCTTTCAAAACTCAGAAGAAAAACCTTGAAACTCTTTGCAATGTTAATATADocket No. 10909-10334 PCT AGTATTGTATAAGATTTTTATTGATTTGGTTATTAGTCTTACTTTTGCTACCTCCA TCTTCACTTGGAACTGATATTCTGAATAGTTAAAGCGTTACATGTCTTCCATTCA CAAATGAACTTAAACTAGCACAAAGTCAGATATTTTAAGATCGCACCATTTTAT ATAACCCCAATCGTCAATTCTACTGTTTCAAGTTTTACACCAAAACAATTACGA GGTGTATCTATTCGTTACTCTTTTCGCTTATTAATCCTTTTACATGATGCAAAAT ATAACAAATTAATTTCAAATTGTCCTGCACATTTGGTTTATACATCTTGATTCCA AAAAGT (SEQ ID NO:10) [000133] In a first evaluation, recombinant CSN3 expressed in different sub-cellular locations in plant cell cultures, were analyzed via Western Blot. As seen in Figure 1, the CSN3 protein is expressed in the plant cells. Different cell lines were used to show the expression of the CSN3 protein in different locations within the cell. Lane 1- Mw marker, lane 2 positive control (Sigma C0406) , lane 3 – untransformed cells, lane 4-8 cell lines expressing CSN3 directed to the Endoplasmic Reticulum ~25kDa , lane 9-13 cell lines expressing CSN3 directed to the Apoplast ~25kDa, lane 14-15 cell lines expressing CSN3 directed to the vacuole ~27kda. [000134] Figure 2 depicts a western blot of the same cell lines where the cells were evaluated on a separate day. This this additional analysis further supports the ability of the plasmids to introduce the CSN3 gene into the plant cells. Recombinant CSN3 expressed in different sub-cellular locations in plant cell cultures. Lane 1- Mw marker, lane 2 positive control of untransformed cells spiked with commercial CSN3 (Sigma C0406), lane 3 – untransformed cells (wild type cells), lane 4 cell line expressing CSN3 directed to the apoplast (AF2 cell line), lane 5 cell line expressing CSN3 directed to the apoplast (AF3), lane 6 cell line expressing CSN3 directed to the vacuole (AF4) expression ~27kda, lane 7 cell line expressing CSN3 directed to the vacuole (AF5) expression ~27kda, lane 8 cell line expressing CSN3 directed to the vacuole (AF6) expression ~27kda, lane 9 cell line expressing CSN3 directed to the E.R (AF10) expression ~25kda, lane 10 Mw marker, lanes 11-13 commercial CSN3 (Sigma C0406). [000135] Growing plant cells in culture is one step in determining if an introduced protein is being expressed. Another determination is to grow the plant and test whether the protein is expressed in any or all parts of the plant and to determine if the protein is expressed consistently in all parts of the plant or if any part of the plant expresses the protein differently. Figure 3 is an analysis looking at the introduction of the CSN3 gene into a plant, as opposed to looking at the plant cells. The plasmid was introduced into N. Benthamian and the plantDocket No. 10909-10334 PCT grown. Following development of leaves, the leaves were analyzed for the presence of the CSN3 protein within the leaves. Lane 1- Mw marker, lane 2 – CSN3 directed to the ER, lane 3 CSN3 directed to the ER, lane 4 - CSN3 directed to the apoplast, lane 5 - CSN3 directed to the ER, lane 6 – empty vector control, lane 7 - CSN3 directed to the vacuole, lane 8 - CSN3 directed to the ER, lane 9 - CSN3 directed to the ER conjugated to Serine-proline x10 signal peptide, lane 10 CSN3 directed to the ER, lane 11 Mw Marker, lane 12 commercial CSN3. [000136] Analysis of subcellular structures was used to further verify the expression of the protein in plant calls. Figure 4 depicts BY-2 expressing rKappa casein in Vacuole growth in 5 shake flasks collected and dried with vacuum pump, fresh weight was subjected to freezing with liquid nitrogen and breaking with a pestle and mortar until fine powder was obtained. Powder incubated with lysis buffer (Tris 100mM pH 7.4, NaCl 250mM,2- Mercaptoethanol 10mM, Triton x-100 1%, ETDA 1mM, Glycerol 10%, protease inhibitor 1:100 sigma 539133) were added to the powder in a ratio of 1:10 in 4C for 40 minutes. Lysate centrifuged 18000g in 50ml tube 30min 4C. Lysate diluted in washing buffer (Tris 100mM pH 7.4,2-Mercaptoethanol 10mM, ETDA 1mM). Diluted lysate loaded on 16ml column of Q650M resin (Seplife), unbound fraction collected. Elution of from proteins were made with Elution buffer (Tris 100mM pH 7.4,2-Mercaptoethanol 10mM, ETDA 1mM, NaCl 1M) with step wise elution (2%,5%,10%,15%,20%,30%-70% gradient,100%). Fraction collected and loaded on SDS-page gel for transfer to membrane and reacted with antibodies (Goat anti Rabbit, HRP conjugated, Jackson 111-035-003) antibodies diluted in blocking solution and incubated for 1 hour at R.T, following 3 washes with TBS-T for 5 minutes at R.T. To detect protein bands, the membranes were developed using TMB Southern Biotech. Protein bands intensities was quantified using densitometry analysis in ImageJ (Research Services Branch). [000137] Verification of the protein expression through more than one method of analysis further enhances the validity of the invention. Turning to Figure 5 which depicts an ELISA analysis. Total protein fraction was extracted with a protein extraction buffer (TRIS- HCl buffer pH 7 0.1 M with 10 mM 2-mercaptoethanol, protease inhibitor cocktail 1:100 (P9599, Sigma-aldrich, USA). Samples were incubated on the ice for 15 minutes. centrifuged at 12000 rpm at 4℃ for 10 minutes and lysate transferred to the new tube. Protein concentration was measured with nanodrop (EZ drop 1000, Blue-ray biotech, Taiwan). Direct ELISA was performed with Bovine CSN3 (C0406, Sigma-Aldrich) as positive control and served for standard curve preparation. Primary antibody anti-bovine CN3 (ORB323029, Biorbyt) and secondary antibody donkey / or goat anti-rabbit HRP conjugated (711-035-152,Docket No. 10909-10334 PCT Jackson) were used in ELISA. Assay was developed with TMB (WZ06 Surmodics IVD, Inc, USA). Example 3 [000138] The expression of a second protein further validates the method of introducing a protein coding gene into a plant cell. In this second example, a lactoferrin coding gene was introduced to the plant cells and determined to be expressing lactoferrin in the plant cells. Figure 6 depicts an ELISA analysis showing the presence of the lactoferrin protein. [000139] Turning to Figure 7 which is a Western Blot analysis of lactoferrin expression in the leaves of N. Benthamian. Lactoferrin protein is shown to be present in different parts of the plant. Specifically, the recombinant Lactoferrin is present in the leaves. Recombinant Lactoferrin expressed in different sub-cellular locations in plant leaves. Lane 1- Mw, Lane 2 Lactoferrin directed for expression in the ER using pER LF (SEQ ID NO:11), Lane 3 Lactoferrin directed for expression Vacuole using pVac LF (FIG 8. and SEQ ID NO:12), Lane 4 +5 Lactoferrin directed for expression Apoplast using pApo LF (FIG. 9 and SEQ ID NO 13). Lane 6-7. Untransformed cells (wild type) control, lane 11-12, positive control native Lactoferrin, (Sigma, L9507). [000140] All patents and published patent applications referred to herein are incorporated herein by reference. The invention has been described with reference to various specific and preferred embodiments and techniques. Nevertheless, it is understood that many variations and modifications may be made while remaining within the spirit and scope of the invention.

Claims

Docket No. 10909-10334 PCT WHAT IS CLAIMED IS:

1. A plant cell, the plant cell comprising: a heterologous coding sequence operatively linked to sequence encoding a signal peptide, wherein the signal peptide is selected from the group consisting of an endoplasmic reticulum retention signal, a vacuole targeting signal peptide, and an apoplast targeting signal peptide.

2. The plant cell of claim 1, wherein the plant cell comprises different copies of the heterologous coding sequence linked to different selected signal peptides.

3. The plant cell of claim 1, wherein the endoplasmic reticulum retention sequence is a HDEL or KDEL sequence.

4. The plant cell of claim 1, wherein the vacuole targeting signal peptide targets to the lytic vacuole.

5. The plant cell of claim 1, wherein the signal peptide is selected from at least one of an Arabidopsis thaliana CHIB gene leader sequence, Nicotiana tabacum acidic endochitinase P leader sequence, Nicotiana tabacum Endochitinase A leader sequence, HDEL, and KDEL.

6. The plant cell of claim 1, wherein the heterologous coding sequence is an animal coding sequence.

7. The plant cell of claim 1, wherein the heterologous coding sequence is a mammalian coding sequence.

8. The plant cell of claim 7, wherein the heterologous coding sequence encodes casein or lactoferrin.Docket No. 10909-10334 PCT 9. The plant cell of claim 1, wherein plant cell lacks one or more of the enzymes required for β1,2-xylosylation and / or α1,3-fucosylation.

10. The plant of claim 9, wherein the plant cell further comprises a knockout at least one glycosyltransferase and / or glycosidase.

11. A plant cell lacking one or more of the enzymes required for β1,2-xylosylation and / or α1,3-fucosylation.

12. The plant of claim 11, further comprising a knockout at least one glycosyltransferase and / or glycosidase.

13. A set of nucleic acids, the set comprising at least two of: a coding sequence operatively linked to a heterologous endoplasmic reticulum retention signal, the coding sequence operatively linked to a heterologous vacuole targeting signal peptide, and the coding sequence operatively linked to a heterologous an apoplast targeting signal peptide.

14. The set of nucleic acids of claim 13, wherein the set comprises all three of the coding sequence operatively linked to a heterologous endoplasmic reticulum retention signal, the coding sequence operatively linked to a heterologous vacuole targeting signal peptide, and the coding sequence operatively linked to a heterologous an apoplast targeting signal peptide.

15. The set of nucleic acids of claim 13, wherein the set of nucleic acids are comprised in a set of plant cells.

16. The plant cell of claim 13, wherein the coding sequence is an animal coding sequence.

17. The plant cell of claim 13, wherein the coding sequence is a mammalian coding sequence.Docket No. 10909-10334 PCT 18. The plant cell of claim 13, wherein the coding sequence encodes casein or lactoferrin.

19. A method of evaluating glycoforms of a protein, the method comprising: expressing in separate plant cells each of a heterologous coding sequence operatively linked to a endoplasmic reticulum retention signal, the coding heterologous sequence operatively linked to a vacuole targeting signal peptide, and the heterologous coding sequence operatively linked to a an apoplast targeting signal peptide so as to produce different glycoforms of the protein encoded by the coding sequence; purifying the different glycoforms; and evaluating the different glycoforms for one more physical properties in comparison to protein expressed by the coding sequence in its wild-type source organism.

20. The method according to claim 19, wherein one or more physical properties are selected form the group consisting of enzymatic cleavage, complex formation, ligand binding, enzymatic activity, solubility, viscosity, water holding capacity, emulsion capacity, foaming capacity, gelation capacity, thermal stability, and sedimentation.

21. The method according to claim 19, wherein the endoplasmic reticulum retention sequence is a HDEL or KDEL sequence.

22. The method according to claim 19, wherein the vacuole targeting signal peptide targets to the lytic vacuole.

23. The method according to claim 19, wherein the signal peptide is selected from at least one of an Arabidopsis thaliana CHIB gene leader sequence, Nicotiana tabacum acidic endochitinase P leader sequence, Nicotiana tabacum Endochitinase A leader sequence, HDEL, and KDEL.

24. The method according to claim 19, wherein the heterologous coding sequence is an animal coding sequence.Docket No. 10909-10334 PCT 25. The method according to claim 19, wherein the heterologous coding sequence is a mammalian coding sequence.

26. The method according to claim 19, wherein plant cell lacks one or more of the enzymes required for β1,2-xylosylation and / or α1,3-fucosylation.

27. The method according to claim 19, wherein the plant cell comprises a knockout at least one glycosyltransferase and / or glycosidase.

Images