Engineering natural killer cells to overcome xenobiotic and hypoxic environments

Abstract

The present disclosure relates ARNTKO natural killer cells and methods of use thereof.

Description

[0001] ENGINEERING NATURAL KILLER CELLS TO OVERCOME XENOBIOTIC AND HYPOXIC ENVIRONMENTS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This PCT application claims priority to, and the benefit of, U.S. Provisional Patent Application No. 63 / 446,939, filed February 20, 2023, entitled “ENGINEERING NATURAL KILLER CELLS TO OVERCOME XENOBIOTIC AND HYPOXIC ENVIRONMENTS,”, and U.S. Provisional Patent Application No. 63 / 447,102, filed February 21, 2023, entitled “ENGINEERING NATURAL KILLER CELLS TO OVERCOME XENOBIOTIC AND HYPOXIC ENVIRONMENTS,” which is incorporated by reference herein in its entirety.

[0004] REFERENCE TO SEQUENCE LISTING

[0005] The sequence listing submitted on February 20, 2024, as an .XML file entitled “10935- 028WOl_SEQ” created on February 20, 2024, and having a file size of 4,096 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).

[0006] FIELD

[0007] The present disclosure relates ARNTKO natural killer cells and methods of use thereof.

[0008] BACKGROUND

[0009] Generating genetically modified natural killer (NK) cells with enhanced ability to target cancers and overcome the highly immune-suppressive tumor microenvironment can improve the clinical outcomes of cancer immunotherapy. There are many genes within NK cells to be considered as effective targets. The aryl hydrocarbon receptor nuclear translocator (ARNT) protein binds to ligand-bound aryl hydrocarbon receptor (AHR). ARNT is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1 alpha (HIFla). Both the AHR and HIFla proteins are important sensors related to immune suppression in the tumor environment. Currently, there are limited cancer immunotherapies that can overcome the harsh tumor microenvironment. Thus, there is a need to identify and generation cancer therapeutics that are not effected by xenobiotic and / or hypoxic tumor microenvironments, and maintains the ability to target cancers.

[0010] SUMMARY The present disclosure provides methods of treating, preventing, reducing, decreasing, and / or ameliorating a cancer, including but not limited to solid tumor growth, using an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell. The present disclosure also provides an immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell.

[0011] In one aspect, disclosed herein is a method of treating, preventing, reducing, decreasing, and / or ameliorating a cancer, including but not limited to solid tumor growth, in a subject in need thereof, the method comprising administering to the subject an immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell, wherein the ARNTKO NK cell is resistant to a xenobiotic and hypoxic microenvironment within the cancer.

[0012] In some embodiments, the method of treating, preventing, reducing, decreasing, and / or ameliorating a cancer comprises an ARNTKO NK cell generated using a CRISPR / Cas9 gene editing system, including but not limited to a Cas9 / ribonucleoprotein (RNP) complex. In some embodiments, the method of treating, preventing, reducing, decreasing, and / or ameliorating a cancer comprises a guide RNA (gRNA) targeting an ARNT gene in the NK cell. In some embodiments, the method of treating, preventing, reducing, decreasing, and / or ameliorating a cancer comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the method of treating, preventing, reducing, decreasing, and / or ameliorating a cancer increases ARNTKO NK cytotoxicity against the cancer relative to a control NK cell.

[0013] In one aspect, disclosed herein is a method of preventing, reducing, decreasing, and / or ameliorating a solid tumor growth, the method comprising administering to a subject comprising a solid tumor an immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell, wherein the ARNTKO NK cell is resistant to a xenobiotic and hypoxic microenvironment of the solid tumor, and wherein the ARNTKO NK cell targets the solid tumor.

[0014] In some embodiments, the method of preventing, reducing, decreasing, and / or ameliorating a solid tumor growth comprises an ARNTKO NK cell is generated using a CRISPR / Cas9 gene editing system, including but not limited to a Cas9 / ribonucleoprotein (RNP) complex. In some embodiments, the method of preventing, reducing, decreasing, and / or ameliorating a solid tumor growth comprises a guide RNA (gRNA) targeting an ARNT gene in the NK cell. In some embodiments, the method of preventing, reducing, decreasing, and / or ameliorating a solid tumor growth comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the method of preventing, reducing, decreasing, and / or ameliorating a solid tumor growth increases ARNTKO NK cytotoxicity against the solid tumor relative to a control NK cell.

[0015] In one aspect, disclosed herein is an immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell and a pharmaceutically acceptable carrier, including but not limited to an excipient, diluent, salt, buffer, stabilizer, solubilizer, lipid, nanoparticle, or combinations thereof.

[0016] In some embodiments, the immunotherapeutic composition comprises an ARNTKO NK cell generated using a CRISPR / Cas9 gene editing system, including but not limited to a Cas9 / ribonucleoprotein (RNP) complex. In some embodiments, the immunotherapeutic composition comprises an ARNTKO NK cell generated by targeting an ARNT gene in the NK cell. In some embodiments, the immunotherapeutic composition comprises an ARNTKO NK cell generated using SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0017] In some embodiments, the immunotherapeutic composition comprises an ARNTKO NK cell, wherein an ARNT gene, or a fragment thereof, is deleted from the ARNTKO NK cell. In some embodiments, the ARNTKO NK cell is xenobiotic resistant. In some embodiments, the ARNTKO NK cell is hypoxia resistant. In some embodiments, the ARNTKO NK cell is xenobiotic resistant and hypoxia resistant.

[0018] BRIEF DESCRIPTION OF FIGURES

[0019] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below.

[0020] Figure 1 shows the key immune cells in the tumor microenvironment.

[0021] Figure 2 shows the natural killer (NK) cell isolation, expansion, and gene editing.

[0022] Figure 3 shows the testing of ARNT guide RNAs. The relative normalized expression of ARNT is shown following targeting of the ARNT gene using gene editing and ARNT gl, ARNT g2, and ARNT g3.

[0023] Figure 4 shows that wild-type (WT) NK cells, but not ARNT KO cells presented decreased killing in the presence of kynurenic acid, a xenobiotic AhR / ARNT agonist.

[0024] Figure 5 shows that hypoxia reduces surface expression of NKG2D on WT NK cells but not on ARNTKO cells.

[0025] Figure 6 shows that ARNTKO NK cells are impacted significantly less under hypoxia compared to WT NK cells.

[0026] Figure 7 shows that adenosine treated WT NK cells showed diminished cytotoxicity. Figure 8 shows that ARNTKO NK cells showed faded expression of adenosine receptor AD0RA2A and AD0RA2B.

[0027] DETAILED DESCRIPTION

[0028] The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment(s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof.

[0029] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein.

[0030] Terminology

[0031] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this disclosure and in the appended claims, the singular forms “a”, “an”, “the”, include plural referents unless the context clearly dictates otherwise.

[0032] The following definitions are provided for the full understanding of terms used in this specification.

[0033] The terms "about" and "approximately" are defined as being “close to” as understood by one of ordinary skill in the art. In one non-limiting embodiment the terms are defined to be within 10%. In another non-limiting embodiment, the terms are defined to be within 5%. In still another nonlimiting embodiment, the terms are defined to be within 1%. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10” as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0034] As used herein, the terms "may," "optionally," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient.

[0035] “Composition” refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, a vector, polynucleotide, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “composition” is used, then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc. "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of' when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of’ shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and / or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure.

[0036] An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition, or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100% or more increase so long as the increase is statistically significant.

[0037] A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100%, or more decrease so long as the decrease is statistically significant.

[0038] The terms “treat,” “treating,” and grammatical variations thereof as used herein, include partially or completely delaying, alleviating, mitigating or reducing the intensity of one or more attendant symptoms of a disorder or condition and / or alleviating, mitigating or impeding one or more causes of a disorder or condition. Treatments according to the disclosure may be applied preventively, prophylactically, palliatively or remedially. Treatments are administered to a subject prior to onset (e.g. , before obvious signs of cancer or solid tumor growth), during early onset (e.g. , upon initial signs and symptoms of cancer or solid tumor growth), or after an established development of cancer or solid tumor growth.

[0039] "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction below, above, or in between the given ranges as compared to native or control levels.

[0040] By “reduce” or other forms of the word, such as “reducing” or “reduction,” means lowering of an event or characteristic (e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control.

[0041] By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.

[0042] The term “administer,” “administering”, or derivatives thereof refer to delivering a composition, substance, inhibitor, or medication to a subject or object by one or more the following routes: oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intrajoint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation or via an implanted reservoir. The term “parenteral” includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrastemal, intrathecal, intrahepatic, intralesional, and intracranial injections or infusion techniques.

[0043] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.

[0044] The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

[0045] As used herein, the term “genetically modified” refers to a living cell, tissue, or organism whose genetic material has been altered using genetic engineering techniques. The genetic modification results in an alteration that does not occur naturally by mating and / or natural recombination. Modified genes can be transferred within the same species, across species (creating transgenic organisms), and across kingdoms. New, exogenous genes can be introduced, or endogenous genes can be enhanced, altered, or knocked out.

[0046] As used herein, the term, “deletion,” also called gene deletion, deficiency, or deletion mutation, refers to part of a chromosome or a sequence of DNA being left out during DNA replication. Deletion, or gene deletions can cause any number of nucleotides to be deleted from a single base to an entire piece of chromosome.

[0047] Variants comprising deletions relative to a reference amino acid sequence or nucleotide sequence are contemplated herein. A “deletion” refers to a change in the amino acid or nucleotide sequence that results in the absence of one or more amino acid residues or nucleotides relative to a reference sequence. A deletion removes at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or 200 amino acids residues or nucleotides. A deletion may include an internal deletion or a terminal deletion (e.g., an N- terminal truncation or a C-terminal truncation or both of a reference polypeptide or a 5 '-terminal or 3 '-terminal truncation or both of a reference polynucleotide).

[0048] Variants comprising a fragment of a reference amino acid sequence or nucleotide sequence are contemplated herein. A “fragment” is a portion of an amino acid sequence or a nucleotide sequence which is identical in sequence to but shorter in length than the reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide / amino acid residue. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides or contiguous amino acid residues of a reference polynucleotide or reference polypeptide, respectively. Fragments may be preferentially selected from certain regions of a molecule, for example the N- terminal region and / or the C-terminal region of a polypeptide or the 5 '-terminal region and / or the 3' terminal region of a polynucleotide. The term “at least a fragment” encompasses the full length polynucleotide or full length polypeptide.

[0049] The terms “immunotherapy” and “immunotherapeutic” refers to the treatment of disease by activating or suppressing the immune system. In cancer treatment, the most effective immunotherapies are cell-based immunotherapies that utilize lymphocytes, macrophages, dendritic cells, natural killer cells, cytotoxic T lymphocytes, etc. to defend the body against cancer by targeting abnormal antigens expressed on the surface of tumor cells.

[0050] The term “cancer” is used to address any neoplastic disease, and is not limited to epithelial neoplasms (surface and glandular cancers; such a squamous cancers or adenomas)). It is used here to describe both solid tumors and hematologic malignancies, including epithelial (surface and glandular) cancers, soft tissue and bone sarcomas, angiomas, mesothelioma, melanoma, lymphomas, leukemias and myeloma.

[0051] The terms "cell," "cell line" and "cell culture" include progeny. It is also understood that all progenies may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Variant progeny that have the same function or biological property, as screened for in the originally transformed cell, are included. The "host cells" used in the present invention generally are prokaryotic or eukaryotic hosts.

[0052] A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular polypeptide or protein after being transcribed and translated. Any of the polynucleotides sequences described herein may be used to identify larger fragments or full-length coding sequences of the gene with which they are associated.

[0053] "Pharmaceutically acceptable carrier" (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents.

[0054] A “nucleic acid” is a chemical compound that serves as the primary information-carrying molecules in cells and make up the cellular genetic material. Nucleic acids comprise nucleotides, which are the monomers made of a 5-carbon sugar (usually ribose or deoxyribose), a phosphate group, and a nitrogenous base. A nucleic acid can also be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). A chimeric nucleic acid comprises two or more of the same kind of nucleic acid fused together to form one compound comprising genetic material.

[0055] A “nucleotide” is a compound consisting of a nucleoside, which consists of a nitrogenous base and a 5-carbon sugar, linked to a phosphate group forming the basic structural unit of nucleic acids, such as DNA or RNA. The four types of nucleotides are adenine (A), cytosine (C), guanine (G), and thymine (T), each of which are bound together by a phosphodiester bond to form a nucleic acid molecule.

[0056] Methods

[0057] AhR mediates responses to exposure to environmental chemicals whereas HIFla regulates responses to low oxygen conditions. AhR expression is enhanced in NK cells upon cytokine stimulation. Previously, it was shown that NK cells treated with AHR agonists Kyn and KA had their cytotoxicity function suppressed with effected the expression of genes involved in regulation of metabolism showing that abolishing AHR signaling pathway to overcome immune suppression holds great promise.

[0058] HIFla, which is constitutively degraded under normoxia, is stabilized and translocates to the nucleus under hypoxic conditions, such as in solid tumors. NK cells in solid tumors have been reported to exhibit an inactive and dysfunctional state. It was also shown that expanded NK cells do not express HIFla in normoxic conditions, but it is highly induced under hypoxia. Additionally, expanded NK cells under hypoxic conditions showed decreased in cytotoxic ability.

[0059] To promote their respective functions, both proteins form a heterodimer with ARNT as a binding partner, characterizing ARNT as a single target that can disrupt both pathways. Herein, the Cas9 / RNP approach targets ARNT in NK cells to permanently overcome the deleterious effects of activating both AhR and HIFla.

[0060] The present disclosure provides methods of treating, preventing, reducing, decreasing, and / or ameliorating a cancer, including but not limited to solid tumor growth, using an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell.

[0061] In one aspect, disclosed herein is a method of treating, preventing, reducing, decreasing, and / or ameliorating a cancer, including but not limited to solid tumor growth, in a subject in need thereof, the method comprising administering to the subject an immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell, wherein the ARNTKO NK cell is resistant to a xenobiotic and hypoxic microenvironment within the cancer.

[0062] As used herein, the terms “hypoxic”, “hypoxia”, and other grammatical variations refer to a state in which oxygen is not available in sufficient amount at the cellular and tissue levels to maintain adequate cellular homeostasis, which can result from inadequate oxygen delivery to cells either due to low blood supply, low oxygen content, or exposure to hypoxia inducing chemicals. As used herein, the term, “xenobiotic” refers to a substance, typically chemical substances, that are foreign to the body or to an ecological system. A xenobiotic substance can be a compound, composition, or chemical found within an organism, but not naturally produced within the organism, or expected to be present within the organism.

[0063] In some embodiments, the method of treating, preventing, reducing, decreasing, and / or ameliorating a cancer comprises an ARNTKO NK cell generated using a CRISPR / Cas9 gene editing system, including but not limited to a Cas9 / ribonucleoprotein (RNP) complex. In some embodiments, the method of treating, preventing, reducing, decreasing, and / or ameliorating a cancer comprises a guide RNA (gRNA) targeting an ARNT gene in the NK cell. In some embodiments, the method of treating, preventing, reducing, decreasing, and / or ameliorating a cancer comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the method of treating, preventing, reducing, decreasing, and / or ameliorating a cancer increases ARNTKO NK cytotoxicity against the cancer relative to a control NK cell.

[0064] In one aspect, disclosed herein is a method of preventing, reducing, decreasing, and / or ameliorating a solid tumor growth, the method comprising administering to a subject comprising a solid tumor an immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell, wherein the ARNTKO NK cell is resistant to a xenobiotic and hypoxic microenvironment of the solid tumor, and wherein the ARNTKO NK cell targets the solid tumor. Herein, the present disclosure describes the use of Cas9 / RNP approach to target ARNT in NK cells to permanently overcome the deleterious effects of activating both AhR and HIFla.

[0065] “CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats) loci refers to certain genetic loci encoding components of DNA cleavage systems, for example, used by bacterial and archaeal cells to destroy foreign DNA (Horvath and Barrangou, 2010, Science 327: 167-170; W02007025097, published 01 March 2007). A CRISPR locus can consist of a CRISPR array, comprising short direct repeats (CRISPR repeats) separated by short variable DNA sequences (called spacers), which can be flanked by diverse Cas (CRISPR-associated) genes.

[0066] As used herein, an “effector” or “effector protein” is a protein that encompasses an activity including recognizing, binding to, and / or cleaving or nicking a polynucleotide target. An effector, or effector protein, may also be an endonuclease. The “effector complex” of a CRISPR system includes Cas proteins involved in crRNA and target recognition and binding. Some of the component Cas proteins may additionally comprise domains involved in target polynucleotide cleavage.

[0067] The term “Cas protein” refers to a polypeptide encoded by a Cas (CRISPR- associated) gene. A Cas protein includes proteins encoded by a gene in a Cas locus and includes adaptation molecules as well as interference molecules. An interference molecule of a bacterial adaptive immunity complex includes endonucleases. A Cas endonuclease described herein comprises one or more nuclease domains. Contemplated herein are any Cas molecules that comprise a Rec3 clamp, as described below.

[0068] As used herein, the term "Cas9 protein" refers to, but is not limited to, Cas9 proteins, Cas9- type proteins encoded by Cas9 orthologs, and synthetic proteins of Cas9. The term "Cas9 protein" as used herein refers to a wild type Cas9 protein from CRISPR-Cas9 type II B systems, Cas9 protein modifications, Cas9 protein variants, Cas9 orthologs and combinations of the same. The term "dCas9" as used herein refers to Cas9 protein variants that are Cas9 proteins deactivated by nuclease, also referred to as "catalytically inactive Cas9 protein", or "enzymatically inactive Cas9". Various Cas9s and their relationship with each other can be found in Gasiunas, et al. (Gasiunas G., Young, J.K., Karvelis, T. et al. A catalogue of biochemically diverse CR1SPR-Cas9 ortho logs. Nat Commun 11, 5512 2020, hereby incorporated by reference in its entirety for its discussion concerning Cas9 molecules).

[0069] A Cas protein is further defined as a functional fragment or functional variant of a native Cas protein, or a protein that shares at least 30%, between 30% and 35%, at least 35%, between 35% and 40%, at least 40%, between 40% and 45%, at least 45%, between 45% and 50%, at least 50%, between 50% and 55%, at least 55%, between 55% and 60%, at least 60%, between 60% and 65%, at least 65%, between 65% and 70%, at least 70%, between 70% and 75%, at least 75%, between 75% and 80%, at least 80%, between 80% and 85%, at least 85%, between 85% and 90%, at least 90%, between 90% and 95%, at least 95%, between 95% and 96%, at least 96%, between 96% and 97%, at least 97%, between 97% and 98%, at least 98%, between 98% and 99%, at least 99%, between 99% and 100%, or 100% sequence identity with at least 50, between 50 and 100, at least 100, between 100 and 150, at least 150, between 150 and 200, at least 200, between 200 and 250, at least 250, between 250 and 300, at least 300, between 300 and 350, at least 350, between 350 and 400, at least 400, between 400 and 450, at least 500, or greater than 500 contiguous amino acids of a native Cas protein, and retains at least partial activity of the native sequence.

[0070] A “functional fragment”, “fragment that is functionally equivalent” and “functionally equivalent fragment” of a Cas endonuclease are used interchangeably herein, and refer to a portion or subsequence of the Cas endonuclease of the present disclosure in which the ability to recognize, bind to, and optionally unwind, nick or cleave (introduce a single or double strand break in) the target site is retained. The portion or subsequence of the Cas endonuclease can comprise a complete or partial (functional) peptide of any one of its domains. The terms “functional variant”, “variant that is functionally equivalent” and “functionally equivalent variant” of a Cas endonuclease or Cas effector protein are used interchangeably herein, and refer to a variant of the Cas effector protein disclosed herein in which the ability to recognize, bind to, and optionally unwind, nick or cleave all or part of a target sequence is retained.

[0071] A Cas endonuclease may also include a multifunctional Cas endonuclease. The term “multifunctional Cas endonuclease” and “multifunctional Cas endonuclease polypeptide” are used interchangeably herein and includes reference to a single polypeptide that has Cas endonuclease functionality (comprising at least one protein domain that can act as a Cas endonuclease) and at least one other functionality, such as but not limited to, the functionality to form a complex (comprises at least a second protein domain that can form a complex with other proteins). In one aspect, the multifunctional Cas endonuclease comprises at least one additional protein domain relative (either internally, upstream (5’), downstream (3’), or both internally 5’ and 3’, or any combination thereof) to those domains typical of a Cas endonuclease.

[0072] As used herein, the term “guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease, including the Cas endonuclease described herein, and enables the Cas endonuclease to recognize, optionally bind to, and optionally cleave a DNA target site. The guide polynucleotide sequence can be a RNA sequence, a DNA sequence, or a combination thereof (a RNA-DNA combination sequence).

[0073] As used herein, the terms “guide polynucleotide / Cas endonuclease complex”, “guide polynucleotide / Cas endonuclease system”,” guide polynucleotide / Cas complex”, “guide polynucleotide / Cas system” and “guided Cas system,” “Polynucleotide-guided endonuclease”, “PGEN” are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease, that are capable of forming a complex, wherein said guide polynucleotide / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site. A guide polynucleotide / Cas endonuclease complex herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any of the known CRISPR systems (Horvath and Barrangou, 2010, Science 327: 167-170; Makarova et al. 2015, Nature Reviews Microbiology Vol. 13: 1 - 15; Zetsche et al. , 2015, Cell 163, 1-13; Shmakov et al., 2015, Molecular Cell 60, 1-13).

[0074] The terms “guide RNA / Cas endonuclease complex”, “guide RNA / Cas endonuclease system”, “guide RNA / Cas complex”, “guide RNA / Cas system”, “gRNA / Cas complex”, “gRNA / Cas system”, “RNA-guided endonuclease” , “RGEN” are used interchangeably herein and refer to at least one RNA component and at least one Cas endonuclease that are capable of forming a complex, wherein said guide RNA / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double-strand break) the DNA target site.

[0075] In some embodiments, the guide polynucleotide or guide RNA of any preceding aspect comprises at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0076] The terms “target site”, “target sequence”, “target site sequence,” target DNA”, “target locus”, “genomic target site”, “genomic target sequence”, “genomic target locus” and “protospacer”, are used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, a locus, or any other DNA molecule in the genome (including chromosomal, chloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide / Cas endonuclease complex can recognize, bind to, and optionally nick or cleave . The target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature.

[0077] As used herein, terms “endogenous target sequence” and “native target sequence” are used interchangeable herein to refer to a target sequence that is endogenous or native to the genome of a cell and is at the endogenous or native position of that target sequence in the genome of the cell. An “artificial target site” or “artificial target sequence” are used interchangeably herein and refer to a target sequence that has been introduced into the genome of a cell. Such an artificial target sequence can be identical in sequence to an endogenous or native target sequence in the genome of a cell but be located in a different position (i.e., a non-endogenous or non-native position) in the genome of a cell.

[0078] A “protospacer adjacent motif’ (PAM) herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide / Cas endonuclease system described herein. The Cas endonuclease may not successfully recognize a target DNA sequence if the target DNA sequence is not followed by a PAM sequence. The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used. The PAM sequence can be of any length but is typically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long.

[0079] An “altered target site”, “altered target sequence”, “modified target site”, “modified target sequence” are used interchangeably herein and refer to a target sequence as disclosed herein that comprises at least one alteration when compared to non-altered target sequence. Such “alterations” include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, (iv) a chemical alteration of at least one nucleotide, or (v) any combination of (i) - (iv).

[0080] In some embodiments, the method of preventing, reducing, decreasing, and / or ameliorating a solid tumor growth comprises an ARNTKO NK cell is generated using a CRISPR / Cas9 gene editing system of any preceding aspect, including but not limited to a Cas9 / ribonucleoprotein (RNP) complex. In some embodiments, the method of preventing, reducing, decreasing, and / or ameliorating a solid tumor growth comprises a guide RNA (gRNA) targeting an ARNT gene in the NK cell. In some embodiments, the method of preventing, reducing, decreasing, and / or ameliorating a solid tumor growth comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. In some embodiments, the method of preventing, reducing, decreasing, and / or ameliorating a solid tumor growth increases ARNTKO NK cytotoxicity against the solid tumor relative to a control NK cell.

[0081] In some embodiments, the cancer or solid tumor growth includes, but is not limited to acoustic neuroma, adenocarcinoma, adrenal gland cancer, anal cancer, angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma), appendix cancer, benign monoclonal gammopathy, biliary cancer (e.g., cholangiocarcinoma), bladder cancer, breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast), brain cancer (e.g., meningioma; glioma, e.g., astrocytoma, oligodendroglioma; medulloblastoma), bronchus cancer, carcinoid tumor, cervical cancer (e.g., cervical adenocarcinoma), choriocarcinoma, chordoma, craniopharyngioma, colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma), epithelial carcinoma, ependymoma, endotheliosarcoma (e.g., Kaposi's sarcoma, multiple idiopathic hemorrhagic sarcoma), endometrial cancer (e.g., uterine cancer, uterine sarcoma), esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett's adenocarinoma), Ewing’s sarcoma, eye cancer (e.g., intraocular melanoma, retinoblastoma), familiar hypereosinophilia, gall bladder cancer, gastric cancer (e.g., stomach adenocarcinoma), gastrointestinal stromal tumor (GIST), head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma (OSCC), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer)), hemangioblastoma, inflammatory myofibroblastic tumors, immunocytic amyloidosis, kidney cancer (e.g., nephroblastoma a.k.a. Wilms' tumor, renal cell carcinoma), liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma), lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung), leiomyosarcoma (LMS), mastocytosis (e.g., systemic mastocytosis), myelodysplastic syndrome (MDS), mesothelioma, myeloproliferative disorder (MPD) (e.g., polycythemia Vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)), neuroblastoma, neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis), neuroendocrine cancer (e.g., gastroenteropancreatic neuroendoctrine tumor (GEP-NET), carcinoid tumor), osteosarcoma, ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma), papillary adenocarcinoma, pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors), penile cancer (e.g., Paget's disease of the penis and scrotum), pinealoma, primitive neuroectodermal tumor (PNT), prostate cancer (e.g., prostate adenocarcinoma), rectal cancer, rhabdomyosarcoma, salivary gland cancer, skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)), small bowel cancer (e.g., appendix cancer), soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma), sebaceous gland carcinoma, sweat gland carcinoma, synovioma, testicular cancer (e.g., seminoma, testicular embryonal carcinoma), thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer), urethral cancer, vaginal cancer and vulvar cancer (e.g., Paget's disease of the vulva).

[0082] Immunotherapeutic Compositions

[0083] The present disclosure also provides an immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell.

[0084] In one aspect, disclosed herein is an immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell and a pharmaceutically acceptable carrier.

[0085] In some embodiments, the “pharmaceutically acceptable carrier” includes, but is not limited to an excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations. The choice of a pharmaceutically acceptable carrier for use in a composition will depend upon the intended route of administration for the composition. The preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington's Pharmaceutical Sciences, 21st Edition, ed. University of the Sciences in Philadelphia, Lippincott, Williams & Wilkins, Philadelphia, PA, 2005. Examples of physiologically acceptable carriers include saline, glycerol, DMSO, buffers such as phosphate buffers, citrate buffer, and buffers with other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as TWEEN (ICI, Inc.; Bridgewater, New Jersey), polyethylene glycol (PEG), and PLURONICS (BASF; Florham Park, NJ). To provide for the administration of such dosages for the desired therapeutic treatment, compositions disclosed herein can advantageously comprise between about 0.1% and 99% by weight of the total of one or more of the subject compounds based on the weight of the total composition including carrier or diluent.

[0086] In some embodiments, the immunotherapeutic composition comprises an ARNTKO NK cell generated using a CRISPR / Cas9 gene editing system of any preceding aspect, including but not limited to a Cas9 / ribonucleoprotein (RNP) complex. In some embodiments, the immunotherapeutic composition comprises an ARNTKO NK cell generated by targeting an ARNT gene in the NK cell. In some embodiments, the immunotherapeutic composition comprises an ARNTKO NK cell generated using SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0087] In some embodiments, the immunotherapeutic composition comprises an ARNTKO NK cell, wherein the ARNT gene, or a fragment thereof, is deleted from the ARNTKO NK cell. In some embodiments, the ARNTKO NK cell is xenobiotic resistant. In some embodiments, the ARNTKO NK cell is hypoxia resistant. In some embodiments, the ARNTKO NK cell is xenobiotic resistant and hypoxia resistant.

[0088] In some embodiments, the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect may be administered in such amounts, time, and route deemed necessary in order to achieve the desired effect. The exact amount of the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the cancer, the particular immunotherapeutic composition or ARNTKO NK cell of any preceding aspect, its mode of administration, its mode of activity, and the like. The immunotherapeutic composition or ARNTKO NK cell of any preceding aspect is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the specific cancer being treated and the severity of the cancer spread or tumor growth; the activity of the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect employed; the specific immunotherapeutic composition or ARNTKO NK cell of any preceding aspect employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific immunotherapeutic composition or ARNTKO NK cell of any preceding aspect employed; the duration of the treatment; drugs used in combination or coincidental with the specific immunotherapeutic composition or ARNTKO NK cell of any preceding aspect employed; and like factors well known in the medical arts.

[0089] The immunotherapeutic composition or ARNTKO NK cell of any preceding aspect may be administered by any route. In some embodiments, the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect is administered via a variety of routes, including oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and / or drops), mucosal, nasal, buccal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and / or inhalation; and / or as an oral spray, nasal spray, and / or aerosol. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect (e.g., its stability in the environment of the subject(s) body), the condition of the subject (e.g., whether the subject is able to tolerate the chosen route of administration), etc.

[0090] The exact amount of immunotherapeutic composition or ARNTKO NK cell of any preceding aspect required to achieve a therapeutically or prophylactically effective amount will vary from subject to subject, depending on species, age, and general condition of a subject, severity of the side effects, identity of the particular compound(s), mode of administration, and the like. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult.

[0091] In some embodiments, the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,

[0092] 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,

[0093] 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75,

[0094] 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more times. In some embodiments, the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect is administered daily. In some embodiments, the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect is administered every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, or more. In some embodiments, the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect is administered every week, every 2 weeks, every 3 weeks, every 4 weeks, or more. In some embodiments, the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect is administered every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every 12 months, or more. In some embodiments, the immunotherapeutic composition or ARNTKO NK cell of any preceding aspect is administered every year, every 2 years, every 3 years, every 4 years, every 5 years, or more.

[0095] A number of embodiments of the disclosure have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.

[0096] By way of non-limiting illustration, examples of certain embodiments of the present disclosure are given below.

[0097] EXAMPLES

[0098] The following examples are set forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art.

[0099] Example 1: Engineering natural killer cells to overcome xenobiotic and hypoxic environments by dismantling AhR-ARNT-HIFla signaling node.

[0100] Both hypoxic and xenobiotic areas are key features of the harsh tumor microenvironment found in solid tumors. The transcription factor Aryl hydrocarbon receptor nuclear translocator (ARNT) is a part of the hypoxia-inducible factor (HIF) pathway, which mediates adaptive responses to ensure tumor survival under hypoxic conditions such as in solid tumors. ARNT is also required by the aryl hydrocarbon receptor (AhR) signaling pathway in response to many environmental toxicants such as kynurenine (Kyn) and kynurenic acid (KA), which cause immune dysfunction. Natural Killers cells (NKs) in solid tumors have been reported to exhibit a dysfunctional state due to these hypoxic and xenobiotic conditions. Herein, it is contemplated that escaping from AhR-ARNT-HIFla signaling could be beneficial for clinical applications due to its ability to overcome both xenobiotic and hypoxic conditions. Previously, it was shown that AHR ligands suppress NK cell cytotoxicities. It was also shown that activation of HIF1 a pathway can restrict NK cell activity. Thus, herein CRISPR Cas9 / RNP approach is used to target ARNT in NKs to overcome the effects AhR-ARNT-HIFla signaling. First, ARNT levels were evaluated by RT-PCR in both WT and ARNTKO NKs. ARNTKO NK cells were successfully generated achieving 90%, 95% and 99% decrease in ARNT at mRNA levels (gRNAl, gRNA2 and gRNA3 respectively). Next, NKs killing ability was evaluated in presence of KA. WTNK+KA had lower killing capacity when compared to ARNTKO+KA NKs. Then, ARNTKO NKs ability to kill tumor cells was evaluated under hypoxia. Both WT and ARNTKO NKs were cultured overnight with cobalt chloride. WTNK cells had a 21.38+12.5% decrease in cell lysis. In contrast, ARNTKO NK cells were impacted significantly less under hypoxia with a 9.54+6.3% decrease in cell lysis. Additionally, ARNTKO NK cells displayed a non-significant decrease of NKG2D, -2%, while WTNK cells presented -20%. Hypoxia-driven accumulation of extracellular adenosine facilitates tumor evasion by engaging cAMP with A2A adenosine receptors. The expression of ADORA2A and 2B was evaluated in both WT and ARNTKO NKs. There was a significant decrease in both ADORA2A and 2B in ARNTKO NK cells. Collectively, ARNTKO NK cells are protected against both xenobiotic and hypoxic features of the hostile tumor microenvironment within solid tumors, improving their clinical efficacy for cancer immunotherapy.

[0101] Example 2: ARNT as a “Two-way Player”.

[0102] ARNTKO NK cells are protected against suppression mediated by AhR agonist. ARNTKO NK cells sustain NKG2D expression under hypoxia. ARNTKO NK cells also present better killing ability under hypoxia. ARNTKO NK cells presented diminished expression of adenosine receptors ADORA2A and ADORA2B. Therefore, the present ARNTKO NK cells work better under both normoxia and hypoxia conditions

[0103] It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims. SEQUENCES

[0104] 1. SEQ ID NO: 1 - ARNT gRNAl

[0105] GUGAAAUUGAACGGCGGCGA

[0106] 2. SEQ ID NO: 2 - ARNT gRNA 2

[0107] AUCACAGUGAAAUUGAACGG

[0108] 3. SEQ ID NO: 3 - ARNT gRNA 3

[0109] GACAUCAGAUGUACCAUCAC

Claims

CLAIMSWhat is claimed is:

1. A method of treating a cancer in a subject in need thereof, the method comprising administering to the subject an immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell, wherein the ARNTKO NK cell is resistant to a xenobiotic and hypoxic microenvironment within the cancer.

2. The method of claim 1, wherein the ARNTKO NK cell is generated using a CRISPR / Cas9 gene editing system.

3. The method of claim 2, wherein the CRISPR / Cas9 gene editing system comprises a Cas9 / ribonucleoprotein (RNP) complex.

4. The method of claim 3, wherein the Cas9 / RNP complex comprises a guide RNA (gRNA) targeting an ARNT gene in the NK cell.

5. The method of claim 4, wherein the gRNA comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

6. The method of any one of claims 1-5, wherein the cancer comprises a solid tumor.

7. The method of any one of claims 1-6, wherein the method increases ARNTKO NK cytotoxicity against the cancer relative to a control NK cell.

8. A method of preventing solid tumor growth, the method comprising administering to a subject comprising a solid tumor an immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell, wherein the ARNTKO NK cell is resistant to a xenobiotic and hypoxic microenvironment of the solid tumor, and wherein the ARNTKO NK cell targets the solid tumor.

9. The method of claim 8, wherein the ARNTKO NK cell is generated using a CRISPR / Cas9 gene editing system.

10. The method of claim 9, wherein the CRISPR / Cas9 gene editing system comprises a Cas9 / ribonucleoprotein (RNP) complex.

11. The method of claim 10, wherein the Cas9 / RNP complex comprises a guide RNA (gRNA) targeting an ARNT gene in the NK cell.

12. The method of claim 11, wherein the gRNA comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

13. The method of any one of claims 8-12, wherein the method increases ARNTKO NK cytotoxicity against the solid tumor relative to a control NK cell.

14. An immunotherapeutic composition comprising an aryl hydrocarbon receptor nuclear translocator knockout (ARNTKO) natural killer (NK) (ARNTKO NK) cell and a pharmaceutically acceptable carrier.

15. The composition of claim 14, wherein the ARNTKO NK cell is generated using a CRISPR / Cas9 gene editing system.

16. The composition of claim 15, wherein the CRISPR / Cas9 gene editing system comprises a Cas9 / ribonucleoprotein (RNP) complex.

17. The composition of claim 16, wherein the Cas9 / RNP complex comprises a guide RNA (gRNA) targeting an ARNT gene in the NK cell.

18. The composition of claim 17, wherein the gRNA comprises SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

19. The composition of any one of claims 14-18, wherein the ARNT gene, or a fragment thereof, is deleted from the ARNTKO NK cell.

20. The composition of any one of claims 14-19, wherein the ARNTKO NK cell is xenobiotic resistant.

21. The composition of any one of claims 14-20, wherein the ARNTKO NK cell is hypoxia resistant.

22. The composition of any one of claims 14-21, wherein the ARNTKO NK cell is xenobiotic resistant and hypoxia resistant.

23. The composition of any one of claims 14-22, wherein the pharmaceutically acceptable carrier comprises an excipient, diluent, salt, buffer, stabilizer, solubilizer, lipid, nanoparticle, or combinations thereof.

Images