Rnai agents for inhibiting expression of ataxin-2 (ATXN2), compositions thereof, and methods of use
Patent Information
- Application Number
- EP2024775437
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-17
- Filing Date
- 2024-03-15
- Publication Date
- 2026-01-21
AI Technical Summary
Current treatments for Spinocerebellar ataxia type 2 (SCA2) lack effective therapeutic options, as the disease is caused by expanded CAG repeats in the ATXN2 gene leading to toxic gain of function in the ATXN2 protein, resulting in progressive neuronal degeneration and no available treatment.
Development of RNAi agents, specifically double-stranded RNAi agents, that target and inhibit the expression of the ATXN2 gene by using sense and antisense strands with complementary sequences to selectively reduce ATXN2 protein levels in central nervous system cells.
The RNAi agents effectively decrease ATXN2 gene expression, providing a therapeutic approach for treating SCA2 and potentially other neurodegenerative diseases by reducing mutant ATXN2 protein activity, offering a novel method for disease management.
Smart Images

Figure IMGF000009_0001 
Figure IMGF000014_0001 
Figure IMGF000014_0002
Abstract
Description
RNAi Agents for Inhibiting Expression of Ataxin-2 (ATXN2), Compositions Thereof, and Methods of Use CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority of United States Provisional Patent Application Serial No.63 / 490,866, filed on March 17, 2023, the contents of each of which are incorporated herein by reference in their entirety. SEQUENCE LISTING
[0002] This application contains a Sequence Listing which has been submitted in XML format and is hereby incorporated by reference in its entirety. The XML copy is named 30701-WO_SEQLIST.xml, was created March 7, 2024, and is 5257 kb in size. FIELD OF THE INVENTION
[0003] The present disclosure relates to RNA interference (RNAi) agents, e.g., double stranded RNAi agents, for inhibition of Ataxin-2 (“ATXN2”) gene expression, compositions that include ATXN2 RNAi agents, and methods of use thereof. BACKGROUND
[0004] Spinocerebellar ataxia type 2 (SCA2) is a dominantly inherited neurodegenerative disease caused by a CAG repeat expansion in exon 1 of the ATXN2 gene that predominantly affects the cerebellum. The CAG repeat expansions results in an expanded polyglutamine tract and toxic gain of function in the ATXN2 protein (Scoles & Pulst, 2018). SCA2 is characterized by progressive ataxia with a 10-year survival of 73% (Diallo et al., 2018). The ATXN2 gene typically contains 22 or fewer CAG repeats, but in individuals with SCA2, the number of CAG repeats in the ATXN2 gene is expanded to 33 or greater. The expanded CAG repeat produces an expanded polyglutamine (polyQ) tract in the ATXN2 protein which results in a toxic gain of function leading to cellular dysfunction and death, particularly in neuronal populations critical for motor control and coordination. The cerebellum, a region of the brain that plays a key role in coordinating movement, is especially affected in SCA2. The progressive degeneration of neurons in the cerebellum and brainstem leads to the characteristic symptoms of SCA2, including ataxia, dysarthria,and oculomotor abnormalities. The exact mechanisms by which the expanded ATXN2 protein causes cell death are under investigation, but may involve disruptions in RNA metabolism
[0005] Ataxin-2 is protein encoded by the ATXN2 gene. Mutations in AXTN2 are known to cause SCA2 in humans. SCA2 is a progressive, degenerative disease with no currently available treatment that is often fatal. Patients affected by SCA2 may experience progressive cerebellar ataxia, slow saccadic eye movements, and other neurologic symptoms such as neuropathy.
[0006] ATXN2 CAG expansion is also associated with parkinsonism and amyotrophic lateral sclerosis (ALS) that can be difficult to distinguish from the idiopathic forms of these diseases. Due to the role of ATXN2 in SCA2 and other neurodegenerative disorders, there is a need for therapeutic compounds that can inhibit expression of ATXN2 in humans. SUMMARY
[0007] There exists a need for novel RNA interference (RNAi) agents (termed RNAi agents, RNAi triggers, or triggers), e.g., double stranded RNAi agents, that are able to selectively and efficiently inhibit the expression of an ATXN2 gene, including for use as a therapeutic or medicament. Further, there exists a need for compositions of novel ATXN2-specific RNAi agents for the treatment of diseases or disorders associated mutant ATXN2 expression and / or disorders that can be mediated at least in part by a reduction in ATXN2 gene expression and / or ATXN2 protein expression.
[0008] The nucleotide sequences and chemical modifications of the ATXN2 RNAi agents disclosed herein, as well as their combination with certain specific pharmacokinetic and pharmacodynamic (PK / PD) modulators suitable for selectively and efficiently delivering the ATXN2 RNAi agents to relevant CNS cells in vivo, differ from those previously disclosed or known in the art. The ATXN2 RNAi agents disclosed herein provide for highly potent and efficient inhibition of the expression of an ATXN2 gene.
[0009] In general, the present disclosure features ATXN2 gene-specific RNAi agents, compositions that include ATXN2 RNAi agents, and methods for inhibiting expression of an ATXN2 gene in vitro and / or in vivo using the ATXN2 RNAi agents and compositions that include ATXN2 RNAi agents described herein. The ATXN2 RNAi agents described herein are able to selectively and efficiently decrease expression of an ATXN2 gene, and thereby reduce the expression of the ATXN2 protein.
[0010] The described ATXN2 RNAi agents can be used in methods for therapeutic treatment (including preventative or prophylactic treatment) of symptoms and diseases including, but not limited to various central nervous system diseases and neurodegenerative diseases (including SCA2 and ALS.)
[0011] In one aspect, the disclosure features RNAi agents for inhibiting expression of an ATXN2 gene, wherein the RNAi agent includes a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and the antisense strand can be partially, substantially, or fully complementary to each other. The length of the RNAi agent sense strands described herein can be 15 to 49 nucleotides in length. The length of the RNAi agent antisense strands described herein each can be 18 to 49 nucleotides in length. In some embodiments, the sense and antisense strands are independently 18 to 26 nucleotides in length. The sense and antisense strands can be either the same length or different lengths. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the antisense strands are independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The RNAi agents described herein, upon delivery to a cell expressing ATXN2 such as endothelial cells, neurons, microglia, and astrocytes, inhibit the expression of one or more ATXN2 gene variants in vivo and / or in vitro.
[0012] The ATXN2 RNAi agents disclosed herein target a human ATXN2 gene (see, e.g., SEQ ID NO:1). In some embodiments, the ATXN2 RNAi agents disclosed herein target a portion of an ATXN2 gene having the sequence of any of the sequences disclosed in Table 1.
[0013] In another aspect, the disclosure features compositions, including pharmaceutical compositions, that include one or more of the disclosed ATXN2 RNAi agents that are able to selectively and efficiently decrease expression of an ATXN2 gene. The compositions that include one or more ATXN2 RNAi agents described herein can be administered to a subject, such as a human or animal subject, for the treatment (including prophylactictreatment or inhibition) of symptoms and diseases associated with ATXN2 mutant protein activity.
[0014] Examples of ATXN2 RNAi agent sense strands and antisense strands that can be used in an ATXN2 RNAi agent are provided in Tables 3, 4, 5, and 6. Examples of ATXN2 RNAi agent duplexes are provided in Tables 7, 8, 9A, and 10. Examples of 19-nucleotide core stretch sequences that may consist of or may be included in the sense strands and antisense strands of certain ATXN2 RNAi agents disclosed herein, are provided in Table 2.
[0015] In another aspect, the disclosure features methods for delivering ATXN2 RNAi agents to neurons, astrocytes, microglia and endothelial cells in a subject, such as a mammal, in vivo. Also described herein are compositions for use in such methods. In some embodiments, disclosed herein are methods for delivering ATXN2 RNAi agents to central nervous system cells (neurons, astrocytes, microglia and endothelial cells) to a subject in vivo. In some embodiments, the subject is a human subject.
[0016] The methods disclosed herein include the administration of one or more ATXN2 RNAi agents to a subject, e.g., a human or animal subject, by any suitable means known in the art. The pharmaceutical compositions disclosed herein that include one or more ATXN2 RNAi agents can be administered in a number of ways depending upon whether local or systemic treatment is desired. Administration can be, but is not limited to, for example, intrathecal, intracerebroventricular, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by intrathecal injection or intracerebroventricular injection.
[0017] In some embodiments, it is desired that the ATXN2 RNAi agents described herein inhibit the expression of an ATXN2 gene in central nervous system cells.
[0018] The one or more ATXN2 RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, an ATXN2 RNAi agent is delivered to cells or tissues by covalently linking the RNAi agent to a targeting group or a lipid moiety.
[0019] A PK / PD modulator can be linked to the 3′ or 5′ end of a sense strand or an antisense strand of an ATXN2 RNAi agent. In some embodiments, a PK / PD modulator is linked to the 3′ or 5′ end of the sense strand. In some embodiments, a PK / PD modulator is linked to the 5′ end of the sense strand. In some embodiments, a PK / PD modulator is linked internallyto a nucleotide on the sense strand and / or the antisense strand of the RNAi agent. In some embodiments, a PK / PD modulator is linked to the RNAi agent via a linker.
[0020] In another aspect, the disclosure features compositions that include one or more ATXN2 RNAi agents that have the duplex structures disclosed in Tables 7, 8, 9A, and 10.
[0021] The use of ATXN2 RNAi agents provides methods for therapeutic (including prophylactic) treatment of diseases or disorders for which a reduction in ATXN2 protein activity can provide a therapeutic benefit. The ATXN2 RNAi agents disclosed herein can be used to treat various neurodegenerative diseases, including SCA2 and ALS. Such methods of treatment include administration of an ATXN2 RNAi agent to a human being or animal having elevated or mutant ATXN2 protein or ATXN2 protein activity beyond desirable levels.
[0022] As used herein, the terms “oligonucleotide” and “polynucleotide” mean a polymer of linked nucleosides each of which can be independently modified or unmodified.
[0023] As used herein, an “RNAi agent” (also referred to as an “RNAi trigger”) means a chemical composition of matter that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., degrades or inhibits under appropriate conditions) translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. As used herein, RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action. RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: small (or short) interfering RNAs (siRNAs), double stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA being targeted (i.e. ATXN2 mRNA). RNAi agents can include one or more modified nucleotides and / or one or more non-phosphodiester linkages.
[0024] As used herein, the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown” when referring to expression of a given gene, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide,protein, or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with the RNAi agents described herein as compared to a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated.
[0025] As used herein, the terms “sequence” and “nucleotide sequence” mean a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature.
[0026] As used herein, a “base,” “nucleotide base,” or “nucleobase,” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. A nucleobase may further be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds that include modified nucleobases) is known in the art.
[0027] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleobase or nucleotide sequence (e.g., RNAi agent sense strand or targeted mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or otherwise suitable in vivo or in vitro conditions) and form a duplex or double helical structure under certain standard conditions with an oligonucleotide that includes the second nucleotide sequence. The person of ordinary skill in the art would be able to select the set of conditions most appropriate for a hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.
[0028] As used herein, “perfectly complementary” or “fully complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, all (100%) of the basesin a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
[0029] As used herein, “partially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
[0030] As used herein, “substantially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
[0031] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used with respect to the nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of an ATXN2 mRNA.
[0032] As used herein, the term “substantially identical” or “substantial identity,” as applied to a nucleic acid sequence means the nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or more, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences substantially identical to those disclosed herein.
[0033] As used herein, the terms “treat,” “treatment,” and the like, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment” may include the prevention, management, prophylactic treatment, and / or inhibition orreduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.
[0034] As used herein, the phrase “introducing into a cell,” when referring to an RNAi agent, means functionally delivering the RNAi agent into a cell. The phrase “functional delivery,” means delivering the RNAi agent to the cell in a manner that enables the RNAi agent to have the expected biological activity, e.g., sequence-specific inhibition of gene expression.
[0035] Unless stated otherwise, use of the symbol as used herein means that any group or groups may be linked thereto that is in with the scope of the inventionsdescribed herein.
[0036] As used herein, the term “isomers” refers to compounds that have identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereoisomers,” and stereoisomers that are non-superimposable mirror images are termed “enantiomers,” or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is termed a “chiral center.”
[0037] As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers are present and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.
[0038] As used in a claim herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. When used in a claim herein, the phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention.
[0039] The person of ordinary skill in the art would readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending upon the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH, maybe protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their state of protonation based on the environment (such as pH), as would be readily understood by the person of ordinary skill in the art. Correspondingly, compounds described herein with labile protons or basic atoms should also be understood to represent salt forms of the corresponding compound. Compounds described herein may be in a free acid, free base, or salt form. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of the invention.
[0040] As used herein, the term “linked” or “conjugated” when referring to the connection between two compounds or molecules means that two compounds or molecules are joined by a covalent bond. Unless stated, the terms “linked” and “conjugated” as used herein may refer to the connection between a first compound and a second compound either with or without any intervening atoms or groups of atoms.
[0041] As used herein, the term “including” is used to herein mean, and is used interchangeably with, the phrase “including but not limited to.” The term “or” is used herein to mean, and is used interchangeably with, the term “and / or,” unless the context clearly indicates otherwise.
[0042] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0043] Other objects, features, aspects, and advantages of the invention will be apparent from the following detailed description, accompanying figures, and from the claims. DETAILED DESCRIPTION RNAi Agents
[0044] Described herein are RNAi agents for inhibiting expression of the ATXN2 (or ATXN2) gene (referred to herein as ATXN2 RNAi agents or ATXN2 RNAi triggers). Each ATXN2 RNAi agent disclosed herein comprises a sense strand and an antisense strand. Thesense strand and the antisense strand each can be 15 to 49 nucleotides in length. The antisense sense strand can be 18 to 30 nucleotides in length. The antisense strand can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 18 to 27 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 19-21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the RNAi agent sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. In some embodiments, the RNAi agent antisense strand is 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,. In some embodiments, a double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.
[0045] Examples of nucleotide sequences used in forming ATXN2 RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. Examples of RNAi agent duplexes, that include the sense strand and antisense strand sequences in Tables 2, 3, 4, 5, 6, are shown in Tables 7, 8, 9A, and 10.
[0046] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5′ end of the antisense strand (e.g., this region may be separated from the 5′ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).
[0047] A sense strand of the ATXN2 RNAi agents described herein includes at least 15 consecutive nucleotides that have at least 85% identity to a core stretch sequence (also referred to herein as a “core stretch” or “core sequence”) of the same number of nucleotides in an ATXN2 mRNA. In some embodiments, a sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence istypically perfectly identical or at least about 85% identical to a nucleotide sequence of the same length (sometimes referred to, e.g., as a target sequence) present in the ATXN2 mRNA target. In some embodiments, this sense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this sense strand core stretch is 17 nucleotides in length. In some embodiments, this sense strand core stretch is 19 nucleotides in length.
[0048] An antisense strand of an ATXN2 RNAi agent described herein includes at least 16 consecutive nucleotides that have at least 85% complementarity to a core stretch of the same number of nucleotides in an ATXN2 mRNA and to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, an antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (e.g., target sequence) of the same length present in the ATXN2 mRNA target. In some embodiments, this antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this antisense strand core stretch is 19 nucleotides in length. In some embodiments, this antisense strand core stretch is 17 nucleotides in length. A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length.
[0049] The ATXN2 RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an ATXN2 RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an ATXN2 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% base paired or 100% base paired.)
[0050] In some embodiments, the antisense strand of an ATXN2 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an ATXN2 RNAi agent disclosedherein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.
[0051] In some embodiments, the sense strand and / or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3′ end, the 5′ end, or both the 3′ and 5′ ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the ATXN2 mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the ATXN2 mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand’s additional nucleotides, if present.
[0052] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extension nucleotides of one strand base pairs with one or more 5′ extension nucleotides of the other strand. In other embodiments, one or more of 3′ extension nucleotides of one strand do not base pair with one or more 5′ extension nucleotides of the other strand. In some embodiments, an ATXN2 RNAi agent has an antisense strand having a 3′ extension and a sense strand having a 5′ extension. In some embodiments, the extension nucleotide(s) are unpaired and form an overhang. As used herein, an “overhang” refers to a stretch of one or more unpaired nucleotides located at a terminal end of either the sense strand or the antisense strand that does not form part of the hybridized or duplexed portion of an RNAi agent disclosed herein.
[0053] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an ATXN2 RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are complementary to the corresponding ATXN2 mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotidescomprise nucleotides that are not complementary to the corresponding ATXN2 mRNA sequence.
[0054] In some embodiments, an ATXN2 RNAi agent comprises a sense strand having a 3′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to or are the identical to nucleotides in the ATXN2 mRNA sequence. In some embodiments, the 3′ sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5′ to 3′).
[0055] A sense strand can have a 3′ extension and / or a 5' extension. In some embodiments, an ATXN2 RNAi agent comprises a sense strand having a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise nucleotides that correspond to or are identical to nucleotides in the ATXN2 mRNA sequence.
[0056] Examples of sequences used in forming ATXN2 RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. In some embodiments, an ATXN2 RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2, 3, or 10. In certain embodiments, an ATXN2 RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3. In some embodiments, an ATXN2 RNAi agent antisense strand includes the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1- 20, 2-20, 1-21, or 2-21, of any ofin Tables 2 or 3. In some embodiments, an ATXN2 RNAi agent sense strand includes the sequence of any of the sequences in Tables 2, 4, 5, or 6. In some embodiments, an ATXN2 RNAi agent sense strand includes the sequence of nucleotides (from 5′ end ^ 3′ end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3- 20, 3-21, or 4-21 of any of thein Tables 2, 4, 5, or 6. In certain embodiments, an ATXN2 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4, 5, 6, or 10.
[0057] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a blunt end. In some embodiments, both endsof an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a “blunt end” refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).
[0058] In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands form a pair (i.e., do not form an overhang) but are not complementary (i.e. form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3' or 5' overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5′ overhang end, a blunt end and a 3′ overhang end, a frayed end and a 5′ overhang end, a frayed end and a 3′ overhang end, two 5′ overhang ends, two 3′ overhang ends, a 5′ overhang end and a 3′ overhang end, two frayed ends, or two blunt ends. Typically, when present, overhangs are located at the 3’ terminal ends of the sense strand, the antisense strand, or both the sense strand and the antisense strand.
[0059] The ATXN2 RNAi agents disclosed herein may also be comprised of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand of the ATXN2 RNAi agent are modified nucleotides. The ATXN2 RNAi agents disclosed herein may further be comprised of one or more modified internucleoside linkages, e.g., one or more phosphorothioate linkages. In some embodiments, an ATXN2 RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2′-modified nucleotide is combined with modified internucleoside linkage.
[0060] In some embodiments, an ATXN2 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an ATXN2 RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, an ATXN2 RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms that are well known in the art are within the scope of the inventions disclosed herein.Modified Nucleotides
[0061] Modified nucleotides, when used in various oligonucleotide constructs, can preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administration of the oligonucleotide construct.
[0062] In some embodiments, an ATXN2 RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2′-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2′-modified nucleotides, inverted nucleotides, modified nucleobase- comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-seco nucleotide mimics (unlocked nucleobase analogues), locked nucleotides, 3′-O-methoxy (2′ internucleoside linked) nucleotides, 2'-F-Arabino nucleotides, 5'-Me, 2'-fluoro nucleotide, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides. 2′-modified nucleotides (i.e., a nucleotide with a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (also referred to herein or in the art as 2′-methoxy nucleotides), 2′-fluoro nucleotides (also referred to herein or in the art as 2′-deoxy-2′-fluoro nucleotides), 2′-deoxy nucleotides, 2′- methoxyethyl (2′-O-2-methoxylethyl) nucleotides (also referred to herein or in the art as 2′- MOE nucleotides), 2′-amino nucleotides, and 2′-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single ATXN2 RNAi agent or even in a single nucleotide thereof. The ATXN2 RNAi agent sense strands and antisense strands can be synthesized and / or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.
[0063] Modified nucleobases include synthetic and natural nucleobases, such as 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me- C), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl(e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2- alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8- azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3- deazaadenine.
[0064] In some embodiments, the 5’ and / or 3′ end of the antisense strand can include abasic residues (Ab), which can also be referred to as an “abasic site” or “abasic nucleotide.” An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1′ position of the sugar moiety. (See, e.g., U.S. Patent No.5,998,203). In some embodiments, an abasic residue can be placed internally in a nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3′ end of the antisense strand. In some embodiments, the 5′ end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab are added to the 3′ end of the sense strand. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.
[0065] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. As used herein, an antisense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the antisense strand being unmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is an unmodified ribonucleotide. Chemical structures for certain modified nucleotides are set forth in Table 11 herein.Modified Internucleoside Linkages
[0066] In some embodiments, one or more nucleotides of an ATXN2 RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case “s”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3′-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3′-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′- 2′. In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2components.
[0067] In some embodiments, a sense strand of an ATXN2 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an ATXN2 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an ATXN2 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an ATXN2 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.
[0068] In some embodiments, an ATXN2 RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioateinternucleoside linkages are between the nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5’ end of the sense strand nucleotide sequence, and another phosphorothioate linkage is at the 3’ end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkage are located at the 5’ end of the sense strand, and another phosphorothioate linkage is at the 3’ end of the sense strand. In some embodiments, the sense strand does not include any phosphorothioate internucleoside linkages between the nucleotides, but contains one, two, or three phosphorothioate linkages between the terminal nucleotides on both the 5’ and 3’ ends and the optionally present inverted abasic residue terminal caps. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage.
[0069] In some embodiments, an ATXN2 RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21- 23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5’ end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5’ end of the antisense strand. In some embodiments, an ATXN2 RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand. Capping Residues or Moieties
[0070] In some embodiments, the sense strand may include one or more capping residues or moieties, sometimes referred to in the art as a “cap,” a “terminal cap,” or a “capping residue.” As used herein, a “capping residue” is a non-nucleotide compound or other moiety that can be incorporated at one or more termini of a nucleotide sequence of an RNAi agent disclosed herein. A capping residue can provide the RNAi agent, in some instances, with certain beneficial properties, such as, for example, protection against exonuclease degradation. In some embodiments, inverted abasic residues (invAb) (also referred to in the art as “inverted abasic sites”) are added as capping residues (see Table 11). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art, and include, for example, inverted abasic residues as well as carbon chainssuch as a terminal C3H7 (propyl), C6H13 (hexyl), or C12H25 (dodecyl) groups. In some embodiments, a capping residue is present at either the 5′ terminal end, the 3′ terminal end, or both the 5′ and 3′ terminal ends of the sense strand. In some embodiments, the 5’ end and / or the 3′ end of the sense strand may include more than one inverted abasic deoxyribose moiety as a capping residue.
[0071] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3′ end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent.
[0072] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues may be linked via phosphate, phosphorothioate (e.g., shown herein as (invAb)s)), or other internucleoside linkages. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3′ end of the antisense strand core stretch sequence, or the 3′ end of the antisense strand sequence, may include an inverted abasic residue. The chemical structures for inverted abasic deoxyribose residues are shown in Table 11 below. ATXN2 RNAi Agents
[0073] The ATXN2 RNAi agents disclosed herein are designed to target specific positions on an ATXN2 gene (e.g., SEQ ID NO:1 (NM_001310123.1)). As defined herein, an antisense strand sequence is designed to target an ATXN2 gene at a given position on the gene when the 5′ terminal nucleobase of the antisense strand is aligned with a position that is 21 nucleotides downstream (towards the 3′ end) from the position on the gene when base pairing to the gene. For example, as illustrated in Tables 1 and 2 herein, an antisense strandsequence designed to target an ATXN2 gene at position 304 requires that when base pairing to the gene, the 5′ terminal nucleobase of the antisense strand is aligned with position 324 of an ATXN2 gene.
[0074] As provided herein, an ATXN2 RNAi agent does not require that the nucleobase at position 1 (5′ ^ 3′) of the antisense strand be complementary to the gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucleotides. For example, for an ATXN2 RNAi agent disclosed herein that is designed to target position 304 of an ATXN2 gene, the 5′ terminal nucleobase of the antisense strand of the of the ATXN2 RNAi agent must be aligned with position 324 of the gene; however, the 5′ terminal nucleobase of the antisense strand may be, but is not required to be, complementary to position 324 of an ATXN2 gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene transcript across a core stretch sequence of at least 16 consecutive nucleotides. As shown by, among other things, the various examples disclosed herein, the specific site of binding of the gene by the antisense strand of the ATXN2 RNAi agent (e.g., whether the ATXN2 RNAi agent is designed to target an ATXN2 gene at position 127, at position 130, at position 136, or at some other position) is an important factor to the level of inhibition achieved by the ATXN2 RNAi agent. (See, e.g., Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).
[0075] In some embodiments, the ATXN2 RNAi agents disclosed herein target an ATXN2 gene at or near the positions of the ATXN2 sequence shown in Table 1. In some embodiments, the antisense strand of an ATXN2 RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target ATXN219-mer sequence disclosed in Table 1.Table 1. ATXN219-mer mRNA Target Sequences (taken from homo sapiens Ataxin-2 (ATXN2) transcript, GenBank NM_001310123.1 (SEQ ID NO:1)) ATXN2 Corresponding Targeted Gene SEQ ID 19-mer Target Sequences Positions of Position (asATXN2 19-me Corresponding Targeted Gene SEQ ID r Target S Positions of Position (as N equences S SE f d tomo sap ens a - , e a _ . : , gene transcript (3755 bases): 1 cccgagaaag caacccagcg cgccgcccgc tcctcacgtg tccctcccgg ccccggggcc 61 acctcacgtt ctgcttccgt ctgacccctc cgacttccga tttcttttga tggaatctat 121 gcaaatatga ggatggttca tatacttaca tcagttgttt gtgatttggt acttgatgcc 181 gcacatgaga aaagtacaga atccagttcg gggccgaaac gtgaagaaat aatggagagt 241 attttgttca aatgttcaga ctttgttgtg gtacagttta aagatatgga ctccagttat 301 gcaaaaagag atgcttttac tgactctgct atcagtgcta aagtgaatgg cgaacacaaa 361 gagaaggacc tggagccctg ggatgcaggt gaactcacag ccaatgagga acttgaggct 421 ttggaaaatg acgtatctaa tggatgggat cccaatgata tgtttcgata taatgaagaa 481 aattatggtg tagtgtctac gtatgatagc agtttatctt cgtatacagt gcccttagaa 541 agagataact cagaagaatt tttaaaacgg gaagcaaggg caaaccagtt agcagaagaa 601 attgagtcaa gtgcccagta caaagctcga gtggccctgg aaaatgatga taggagtgag 661 gaagaaaaat acacagcagt tcagagaaat tccagtgaac gtgaggggca cagcataaac 721 actagggaaa ataaatatat tcctcctgga caaagaaata gagaagtcat atcctgggga 781 agtgggagac agaattcacc gcgtatgggc cagcctggat cgggctccat gccatcaaga 841 tccacttctc acacttcaga tttcaacccg aattctggtt cagaccaaag agtagttaat 901 ggaggtgttc cctggccatc gccttgccca tctccttcct ctcgcccacc ttctcgctac961 cagtcaggtc ccaactctct tccacctcgg gcagccaccc ctacacggcc gccctccagg 1021 cccccctcgc ggccatccag acccccgtct cacccctctg ctcatggttc tccagctcct 1081 gtctctacta tgcctaaacg catgtcttca gaagggcctc caaggatgtc cccaaaggcc 1141 cagcgacatc ctcgaaatca cagagtttct gctgggaggg gttccatatc cagtggccta 1201 gaatttgtat cccacaaccc acccagtgaa gcagctactc ctccagtagc aaggaccagt 1261 ccctcggggg gaacgtggtc atcagtggtc agtggggttc caagattatc ccctaaaact 1321 catagaccca ggtctcccag acagaacagt attggaaata cccccagtgg gccagttctt 1381 gcttctcccc aagctggtat tattccaact gaagctgttg ccatgcctat tccagctgca 1441 tctcctacgc ctgctagtcc tgcatcgaac agagctgtta ccccttctag tgaggctaaa 1501 gattccaggc ttcaagatca gaggcagaac tctcctgcag ggaataaaga aaatattaaa 1561 cccaatgaaa catcacctag cttctcaaaa gctgaaaaca aaggtatatc accagttgtt 1621 tctgaacata gaaaacagat tgatgattta aagaaattta agaatgattt taggttacag 1681 ccaagttcta cttctgaatc tatggatcaa ctactaaaca aaaatagaga gggagaaaaa 1741 tcaagagatt tgatcaaaga caaaattgaa ccaagtgcta aggattcttt cattgaaaat 1801 agcagcagca actgtaccag tggcagcagc aagccgaata gccccagcat ttccccttca 1861 atacttagta acacggagca caagagggga cctgaggtca cttcccaagg ggttcagact 1921 tccagcccag catgtaaaca agagaaagac gataaggaag agaagaaaga cgcagctgag 1981 caagttagga aatcaacatt gaatcccaat gcaaaggagt tcaacccacg ttccttctct 2041 cagccaaagc cttctactac cccaacttca cctcggcctc aagcacaacc tagcccatct 2101 atggtgggtc atcaacagcc aactccagtt tatactcagc ctgtttgttt tgcaccaaat 2161 atgatgtatc cagtcccagt gagcccaggc gtgcaacctt tatacccaat acctatgacg 2221 cccatgccag tgaatcaagc caagacatat agagcagtac caaatatgcc ccaacagcgg 2281 caagaccagc atcatcagag tgccatgatg cacccagcgt cagcagcggg cccaccgatt 2341 gcagccaccc caccagctta ctccacgcaa tatgttgcct acagtcctca gcagttccca 2401 aatcagcccc ttgttcagca tgtgccacat tatcagtctc agcatcctca tgtctatagt 2461 cctgtaatac agggtaatgc tagaatgatg gcaccaccaa cacacgccca gcctggttta 2521 gtatcttctt cagcaactca gtacggggct catgagcaga cgcatgcgat gtatgtttcc 2581 acgggctccc ttgctcagca gtatgcgcac cctaacgcta ccctgcaccc acatactcca 2641 caccctcagc cttcagctac ccccactgga cagcagcaaa gccaacatgg tggaagtcat 2701 cctgcaccca gtcctgttca gcaccatcag caccaggccg cccaggctct ccatctggcc 2761 agtccacagc agcagtcagc catttaccac gcggggcttg cgccaactcc accctccatg 2821 acacctgcct ccaacacgca gtcgccacag aatagtttcc cagcagcaca acagactgtc 2881 tttacgatcc atccttctca cgttcagccg gcgtatacca acccacccca catggcccac2941 gtacctcagg ctcatgtaca gtcaggaatg gttccttctc atccaactgc ccatgcgcca 3001 atgatgctaa tgacgacaca gccacccggc ggtccccagg ccgccctcgc tcaaagtgca 3061 ctacagccca ttccagtctc gacaacagcg catttcccct atatgacgca cccttcagta 3121 caagcccacc accaacagca gttgtaaggc tgccctggag gaaccgaaag gccaaattcc 3181 ctcctccctt ctactgcttc taccaactgg aagcacagaa aactagaatt tcatttattt 3241 tgtttttaaa atatatatgt tgatttcttg taacatccaa taggaatgct aacagttcac 3301 ttgcagtgga agatacttgg accgagtaga ggcatttagg aacttggggg ctattccata 3361 attccatatg ctgtttcaga gtcccgcagg taccccagct ctgcttgccg aaactggaag 3421 ttatttattt tttaataacc cttgaaagtc atgaacacat cagctagcaa aagaagtaac 3481 aagagtgatt cttgctgcta ttactgctaa aaaaaaaaaa aaaaaaaaat caagacttgg 3541 aacgcccttt tactaaactt gacaaagttt cagtaaattc ttaccgtcaa actgacggat 3601 tattatttat aaatcaagtt tgatgaggtg atcactgtct acagtggttc aacttttaag 3661 ttaagggaaa aacttttact ttgtagataa tataaaataa aaacttaaaa aaaatttaaa 3721 aaataaaaaa agttttaaaa actgaaaaaa aaaaa
[0076] In some embodiments, an ATXN2 RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5′ ^3′) is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an ATXN2 agent includes an antisense strand wherein position 1 of the antisense strand (5′ ^3′) is capable of forming a base pair with position 19 of a 19-mer target sequence disclosed in Table 1.
[0077] In some embodiments, an ATXN2 agent includes an antisense strand wherein position 2 of the antisense strand (5′ ^ 3′) is capable of forming a base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an ATXN2 agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5′ ^ 3′) are capable of forming base pairs with each of the respective complementary bases at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.
[0078] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) can be perfectly complementary to an ATXN2 gene, or can be non-complementary to an ATXN2 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) forms an A:U or U:A base pair with the sense strand.
[0079] In some embodiments, an ATXN2 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, an ATXN2 RNAi sense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.
[0080] In some embodiments, an ATXN2 RNAi agent comprises (i) an antisense strand comprising the sequence of nucleotides (from 5′ end ^ 3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.
[0081] In some embodiments, the ATXN2 RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2.enihtndaexte e nnoiti7 7 7 7 0 0 0 0 6 6 6 6 9opgyr eGs2 2 2 2 3 3 3 3 3 3 3 3 5o1 1 1 1 1 1 1 1 1 1 1 1 1h(enisoni= I;esaboelcunyna=N(secneuqeSesaBhctertSeroCdnartSesneSdnadnart nS eudU U U U U U U U G G G G A ei)CsCCCCCCA C A C A A U U U U Ceqn e fSid ec CC CC CA A A A UsnU U U UC CU U U U AeoieeA A A A A A A A A A A A Atsna) B′m3nuqCCCCCCCC A A A A U U U U G G G A G UeA A A A G G G G U UCAtn d SU U n→ngaeA A A A A A A A A A A ACr5 tG G A A A A Aea ′s diG G U U U U U U U U A A A U U U U UAtAiS( an oelA A A A G G G G G U U U U A AeswcNnouU U U U G G G U U U U G A A A A A A A A A A A AACResi hSN U U U U A A A G G G G A U G GU U U U2t(G G U U U U NnA A A A G G G GCACACACAACXA U A N N A U N N U A N N UTA).es2 a DI :e b7 8 9 0 1 2 3 4 5 6 7l oeQO N5 5 5 6 6 6 6 6 6 6 68696bl Eac STundete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecn Ce dACACN AAC C CACACACACNCUCUCU UCNCqCU U U U UCu eeifSi )U U U U U ecU U U UC C C C CG G G G G d A A A A U U U U U A A A A Aes onea)′mnuA A A A U U U U U A A A A A q A C A C A A U U U U UA A A A AB3 e C C U U U U UC C C C CdUC C C C C C C C Cnn SA A A A A A A A A A A A A Aa→r′At5 aesditU U U U U U U U UCACACACACS( a oG G G G G G G G G A A A A A A A AeAU U C C C Csnewlc A A A AC CUCUCUCCACCAC CACne ou C C C CU U U U U A Asi hN U U U U U U U U U U U U Ut SUn (ACACACAC A A A A A G G G G G G G G G G U U U U A A G N N U A G N N U AUC N N DI :QO07172 3 4 5 6 7 8 9 0 1 2 3EN7 7 7 7 7 7 7 7 8 8 8 8Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnA A A NAeCACA ACNG G G N A U U U UC Cud UAqeeifSi )G G G G G G G G G eCUCUCUC A cA A A AA A A A A G G G GCdC C C CU U U U U G G G GCes onea)uU U U U A A A A A U U U U U G G G G G G G UB′m3n qG G U U U U e A A A AU U U U U A A A AUdUnn SG G G GCa→r′ACACACACACUCUCU UCUAt5 aesdiA A A AtC C C C C C C C CC C C CCS( a oG G G G G G G G GC C C CUeA A A A A A U U U UsnenwlA A A couU U U U U U U U U U U U UGA A A A U U U U U G G G GCAesi hN G G G GU UU A A A A Ut S(U U U UCACCUACUACAACACACAC An C C C CAG A U A N N U ACN N A U N N U DI :QO48586 7 8 9 0 1 2 3 4 5 6 7EN8 8 8 8 9 9 9 9 9 9 9 9Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnA A N A A A N A A A N G G GeA A Aud C C C CG G G G G G Gqeeif )A C A C A CCUCUCUCG G G G G G G USid ecG G G G U U Ues onC C CU U U U U U U U U U U Ua)′menuU U U U U U U U U U q U U U U U U U U U UA A A A ACA A A ACACACB3UeUC C C C C C CU U Ud SU U U U U U A A An →n eA A AU U U U A A A A U U Uar′t5 as ditCUCUCUGS( a CGCGCGC U U U UA A Aesn oenwlG G GA A A AAcCACACACCACACAe ou CACACU U U U A A A A A A A A A A A A A A A Asi hA A At SN U U U G G G G A A A A G G G ( A A A A A A A G G GG G G GC C CnU U U U A N NC C C CU U U A A U N N A U N N U A N DI :QO8999 001020304050607080900111EN1 1 1 1 1 1 1 1 1 1 1 1Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnNC C CN U U U NC C CN GeG A A A A U U U U G G G G Gudqeeif )G U U U U U U U U UA A A UCUCUCUC U ASid eces onUC C CAC G G G G G G G G A A A A G e U Ua)u AC U U A A A AUCUCUCUA A A C A U G G G GUB′m3n qU Ue UCUCUCUA A A AUCUCUCUCd SACA A A A G G G GCUn →naeUU U U U U U U UAar′t5 s dit A US( a CUCUCUCC C C C CUCUCUCG Uesn oeCnwlA A A A G G G G G A U U ce ouA A A A AU U U UU U U A A A A ACUCUCUCU U U U G U A A A Asi hA S N G U U U U A A A A A A AUCUCUCUAtn (C A UCG G G G G G G G G U U U U G G G G A A N U A N N A U N N A U N N U DI :QO213114115161718191021222324252EN1 1 1 1 1 1 1 1 1 1 1 1Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnG G G N G G G N A A A NU UeG G G G G G G G A A A AC Cudqeeifi )U U U U U U U U G G G G U U ecA A A A G G G G G G G G G G AU U U US des onA A AC C C CG G e U Ua)u U UU U U U A A A A U U U U U U G G G G G G G G U UB′md3n qUeC C C CA A A A G G G G S U U U U G G G G U U U UUCUCna→naeA A A A U U U U U U U UU Ur′t5 s ditG G G G G G G G G G G GUS( a CUCU UCACAesn oeU U U UnwlU U U U c G G G GU UCUCUUe ouG G G G A A A ACUC A A A AC C C CA A A A A A A A Asi ht SN A A A A A G G G GUCUCUCUC A A U Un (G G G G A A A AUCUCUCUC A A A A U U A A G N N A U N N U A N N U A DI :QO627128 9 0 1 2 3 4 5 6 7 8 912 2 3 3 3 3 3 3 3 3 3 3EN1 1 1 1 1 1 1 1 1 1 1 1Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnU NU U U U N A A A A NC CeC CG G G G G G G G G G G Gudqeeif )U U G G G G G U U U U U A A G GC C C C CG GSid ecU U U U Ue nG G U U U U UC C C C CG Gs o eA A Aa)uU U U UUCUCUCUCUA A C G G G G GACACB′md3n qUeSUCUCUCUCUCUCUG G G G G A A C G G G G G G Gn →naeU UA A A A A U U U U U A Aar′t5 s ditCACAUS( a CUCU UCUC U U U U U G G G Gesn oenwlUce ou CUC A ACG G G A A A A A A A A A A U U A A A A A G G G G G G G A A U U U U U A A A A A Asi hAt SN A A U U U U U G G G G G U U U U A A A An (U UACAC A CACCAC A A A A A AA AN N U AC CA N N U A G N N U A DI :QO041142 3 4 5 6 7 8 9 0 1 2 314 4 4 4 4 4 4 4 5 5 5 5EN1 1 1 1 1 1 1 1 1 1 1 1Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecn C CN A A A A NC C C CNGeG G G G G G G G G G G GGCudqeeif )A A A A A A A A C C C C G G G G G U U U UCU USid ecG G G Ue nG G G A A A A A G G G G G Us o eU U Ua)u ACACAC U U U U U U U A G G G G G A A A A A GB′md3n qA A A A G G G G G UeA A A A U S G G G U U U U U G G G G G Gna→naeA A AA A A A AA A A A AUr′5 s ditG G G A ACGC C C CGCGCGCGCGCCtS( an oA G G G G elU U U G G G G G U U U U UUU UCesnwce ouG G G A A A A A U U U A A A U U U U U U U U U U Asi ht SN A U U U U U U U U A A A A A A G G G G G Gn (ACACAC U U U U U G G A N U AGC G G U U U U U A G N N N U A G N N U DI :QO455 6 7 8 91515 5 5 50616263646566676EN1 1 1 1 1 1 1 1 1 1 1 1Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnG G G N A A A N U U U U NAeC C C C C C C C C C C C Cud Uqeeifi )U U U U C C C C A A A A A ecU U U U A A A A G G G G GCU U U U UAS donU U U G G G G G A ACes ea)uA A A A A A U G G G G A A A AACACACACACCB′md3n qU U U U G G G G UeU U U U GCSG G G G A A A A U U U U U Gn →naeU U U UA A A A A A A A A Aar′t5 s ditC C C CG G G G G G GGS( a CGCG GCGC U Uesn oUenwlcCUCUCUC G U U U U U UCU U Ue ouA A A A U U U U U U U U UUC A A A A G G G G G G G G Usi hGt SN A A A A A A A A A GUCUC UUCUC An (G G G C C C C C AAA ACA A U U U U U U U U G N N A U N N U AUC N N U DI :QO869160 1 2 3 4 5 6 7 8 9 0 117 7 7 7 7 7 7 7 7 7 8 8EN1 1 1 1 1 1 1 1 1 1 1 1Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnA A A NA A A NU U U NC Ce U U U UC C C CA A A A A Audqeeif ) C C C CU U U U U U U UUCUCUCUC A A U USid ecAes onCACACAC U U U U U U U U G G e U Ua)u C CU C U C U U U U U U U U G G G G U U U UUCUCB′md3n qUeC C C CU U U U G G S G G G G U U U U U U U U G G A A A A G G G Gn →naeU U U UU U U UU Uar′5 s ditU U U U U U U UCCCCCCCCC C C CU UtS( an oU U U U elUCUCU UA A A ACA A A A ACAesnwce ouU UCUCU U U U U A A A AACACACAA A G Gsi ht SN A A A A U U U U U U UCU A A ( A A A A A A A A G G G GACA A AU UnG G G GC C CG G A A G N N A U N N A U N N U A DI :QO283 4 5 61818 8 8788898091929394959EN1 1 1 1 1 1 1 1 1 1 1 1Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecn CN G G G G N G G G N G G GeA AU U U U U A A A AA A Audqeeif )A A UCGCGCGCGCGCUCUCUCA A A USid ecU G G Ges onG G G G G G G U U U U U U U e U Ua)u UCUCU UU U UUU U A A A A U U U G G G G A A AB′md3n qG G UeC C C C CA A A A U U U S G G A A A A A U U U U G G Gn →naeU U A A A A A A A A A A A Aar′t5 s dit US( a CUC G G G G GC C C CA A A A AC C C Cesn oA A A enwlA A U U U U U U U U UU U Uce ouA A G G G G G A A A ACACACA G G A A A A A G G G G U Usi hUt SN A A A A A A A U U U U U U U U U U U U Un (G G G G G G G G G G A AAA A G G G G U U U A N N U ACN N U A N N U A G DI :QO697 8 9 0 1 2 31919 9 0 0 0 0405060708090EN1 1 2 2 2 2 2 2 2 2 2 2Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnG NC C C CNC C CNC C CeA A A A A A AU U UU G G GudA Aqeeif )U U U U U G GCGCGCC G G G G G U U USid ecU U U U Ues onU U G G G G G U U U U U U U U Ua)meuU U U U U A A G GU U UG GC C CUCUCUCUCB′d3n qG U U A A A A G G G UeSG GCCCCCCCCCC A A A A G G Gn →naeA AU U U U UU U U U A A Aar′5 s ditA ACGCGCGCGCCCCCCCCC A A AtS( aesn oe U UG G G GnwlcC CU U U U U U U U U A A Ae ouA A G G G G G U U U U U U U U U U U U U U U U U G G Gsi hUt SN U UUCUCU UCUA A A A A A A G G Gn (G G U U U UCUCG U U U U U A N N U AUC U U U G G G N N A U N N U A G DI :QO011 2 3 4 5 6 7 8 9 0 12121 1 1 1 1 1 1 1 2 22232EN2 2 2 2 2 2 2 2 2 2 2 2Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecn CN G G G N A A A N A A A NeG G U U U U U U U U A A A Audqeeif )G G U U A A A A G G G G A A A AACACACACSid eces onU U U G G G G A A A A G G G G G G G G Ua)meuCUC U U U UU U U UU U U A A AC C C CG G G GB′3n qG G A G G G G G G G UeG GCCCCCCCC Gdn →n SG G G G U U U U aeA AA A A A A A A AU U U Uar′t5 s ditA AC C C C C C C CU U U U G GC C C CA AS( aesn oA A e A A A AnwlA AC C C CA A A A ce oh uU U A A A A U U U U G G G G G GAN U U U UCAACAACAACAACACACACsit SA A U U U U A A A A A An (U U A A G G G G G G A A A AA A A AA U N N UC C C CA N N A N N U A N N DI :QO425226 7 8 9 0 1 2 3 4 5 6 722 2 2 2 3 3 3 3 3 3 3 3EN2 2 2 2 2 2 2 2 2 2 2 2Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnG G G G N U U U U NC C C CeU U U U U G G G G G A A A Audqeeif )G G G G G A A A A A G G G G G G G G G G A A A ASid ecG G G Ges onU U U U U G G G G G G G G G U Ua)meuU U U U U U U U U U U U UUG G G GCUCUCUCB′d3n qUeA A A A ACSU U U U U GCGCGCGGCG G G G G U U U Un →naeA A A A AU U U U U A A A Aar′t5 s ditC C C C CU U U U U G G G GS( aU U U U G G G Gesn oU e A A A A Anwlc Ae ou CAACA A AU U U U U A A A A ACACACAACACACACAC G G G G U U Usi hUt SN U U U U U A A A A A A A A A A A C C C Cn (A A A G G G G GACACACACAC A A A A A U A G N N U A G N N U A G N DI :QO839230 1 2 3 4 5 6 7 8 9 0 124 4 4 4 4 4 4 4 4 4 5 5EN2 2 2 2 2 2 2 2 2 2 2 2Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnN A A A N G G G G NC C C CeA G G G GA A A A AC C C Cudqeeif )G AUCUCUCUCC C C C CA A A A U U U USid ecA A A A Aes onG G G G G U U U U U U U U U e U Ua)u UC U U U U U U U A A A A A A A A AACACACACB′md3n qG G G G G G G G G UeU U U U U U G G A A Ana→n SG G G G G G G A aeA A A A AU U U U U U U U Ur′t5 s ditG G G G GCCCCCCCCC CUCUCUCUS( aesn oG U U U U enwlA cA A A AC C C CCC U U U Ue ouGCA A ACACACA A A A U U U U UACACACACsi ht SN U A G G G G Un ( CA A A A A U U U UAU CAU A U U U A U A U U A A N U A N N UCACAGCANCNCUCA ACCCN DI :QO253254 5 6 7 8 9 0 1 2 3 4 525 5 5 5 5 5 6 6 6 6 6 6EN2 2 2 2 2 2 2 2 2 2 2 2Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnNG G G NG G G G NU U U NeCG G G GC C C C CG G G Gudqeeif )A U U U U G G G G G A A A A AUCUCUCUCSid ecU U U U Ues onU eAG G G G G G G G G U U U U U U U U U U U U U U U U Ua)muCA A A U U U U U U U U UB′d3n qA G Ue C C C C UCUCUnSAC C C CAACUCUACU U U U G G G Gn → aeUA A A AA AA A A Aar′t5 s ditCCS( a CCCCCCCCGCGC CGCGU U U Uesn oU G enwlU U U U U U U U U UCUCUCUCU ce ouACUCUCUCUC G G G G G U U U U A A A A A A A Asi hAt SN U A A A A U U U U U A A A A G G G G G Gn (AC G G G A A A A U U U U U UUU U G G G G A N U A N N U ACN N A U N N DI :QO667 8 9 0 12626 6 7 72737475767778797EN2 2 2 2 2 2 2 2 2 2 2 2Sdete egrnea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →n ′a 5r (tSesneSQ ESecnU U U U NC C C CN A A A NeU U U U U U U U U Uud A A A Aqeeif )ACACACACACCCCCCCCCCCC C C CSid ecU U U Ues onG G G G G G G G G G U U U U e A Aa)uA A A U U U U U U U U U U A A A A AUCUCUCUCB′md3n qU U U U A A A A A UeU A A A A S G G G G G A A A A A G G G Gn →naeU U U U UU U U U U U U U Uar′5 s ditC C C C CCCCCCCCCCCACACACAtS( aesn oA A A A A enwlA A A A A U U U U U U U UCU ce ouG G G G G U U U U U U U U U U U U U G G G G G G G G Gsi hUt SN G G G G G A ( A A A A AAA CAA A A U U U U C A CACAC G G G GnA AAA A U U U U A U ACN N U ACN N U A N N DI :QO081282 3 4 5 6 7 8 9 0 1 2 328 8 8 8 8 8 8 8 9 9 9 9EN2 2 2 2 2 2 2 2 2 2 2 2Sdete egr ea T snoi et cis neouPqg en Sid deniofiptsneerdrIofCoecneuqeSes )′a3Bd →′n5n qar (UetSA A A A A G G G G US nG G G G G U U Ueas sA AU U UAA AAA A AC C CUCn aAnC C C C CU U U UeSw A A A A A U U U U o A A A A A A A A A h U U U U N G G G N S(:QO E0 1 2 3 4 5 6 7 8SN 4D54545454545454545e IcnA A A A NC C CNeU U U U U U U U Uudqeeif )U U U U U A A A A ASid ecG G G G G A A Aes onU U U U U G G G G eu UA A A CU UCU UA A AAa)B′mn q CUC CC C CACd3Ue Unn S CUCCUCUC G G Ga→eA A A A A A A AG Ar′a dC C C C C C C C Ct5(sitU U U U U G G G GSaesn oenwlA A A A A A A A A ce ouA A A A A U U U U Asi hG G G G G A A At SN A A A An (AA A A A A CACACACAC U U U U G G G G A U A G N N U A N N DI :QO4952962972982999001020EN2 2 3 3 3S
[0082] The ATXN2 RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the ATXN2 RNAi agents having the sense and antisense strand sequences that comprise or consist of any of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.
[0083] In some embodiments, the antisense strand of an ATXN2 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an ATXN2 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.
[0084] As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.
[0085] Certain modified ATXN2 RNAi agent sense and antisense strands are provided in Table 3, Table 4, Table 5, Table 6, and Table 10. Certain modified ATXN2 RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. Certain modified ATXN2 RNAi agent sense strands, as well as their underlying unmodified nucleobase sequences, are provided in Tables 4, 5, and 6. In forming ATXN2 RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Tables 3, 4, 5, and 6, as well as in Table 2, above, can be a modified nucleotide.
[0086] The ATXN2 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0087] In some embodiments, an ATXN2 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3.
[0088] In some embodiments, an ATXN2 RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3, Table 4, Table 5, Table 6, or Table 10.
[0089] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Tables 4, 5 and 6.
[0090] As used in Tables 3, 4, 5, 6, and 10, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups: A = adenosine-3′-phosphate C = cytidine-3′-phosphate G = guanosine-3′-phosphate U = uridine-3′-phosphate I = inosine-3′-phosphate a = 2′-O-methyladenosine-3′-phosphate as = 2′-O-methyladenosine-3′-phosphorothioate c = 2′-O-methylcytidine-3′-phosphate cs = 2′-O-methylcytidine-3′-phosphorothioate g = 2′-O-methylguanosine-3′-phosphate gs = 2′-O-methylguanosine-3′-phosphorothioate i = 2′-O-methylinosine-3′-phosphate is = 2′-O-methylinosine-3′-phosphorothioate t = 2′-O-methyl-5-methyluridine-3′-phosphate ts = 2′-O-methyl-5-methyluridine-3′-phosphorothioate u = 2′-O-methyluridine-3′-phosphate us = 2′-O-methyluridine-3′-phosphorothioate Af = 2′-fluoroadenosine-3′-phosphate Afs = 2′-fluoroadenosine-3′-phosporothioate Cf = 2′-fluorocytidine-3′-phosphate Cfs = 2′-fluorocytidine-3′-phosphorothioate Gf = 2′-fluoroguanosine-3′-phosphate Gfs = 2′-fluoroguanosine-3′-phosphorothioate Tf = 2′-fluoro-5′-methyluridine-3′-phosphate Tfs = 2′-fluoro-5′-methyluridine-3′-phosphorothioate Uf = 2′-fluorouridine-3′-phosphate Ufs = 2′-fluorouridine-3′-phosphorothioate dT = 2′-deoxythymidine-3′-phosphate AUNA = 2′,3′-seco-adenosine-3′-phosphate AUNAs = 2′,3′-seco-adenosine-3′-phosphorothioate CUNA = 2′,3′-seco-cytidine-3′-phosphateCUNAs = 2′,3′-seco-cytidine-3′-phosphorothioate GUNA= 2′,3′-seco-guanosine-3′-phosphate GUNAs = 2′,3′-seco-guanosine-3′-phosphorothioate UUNA= 2′,3′-seco-uridine-3′-phosphate UUNAs = 2′,3′-seco-uridine-3′-phosphorothioate a_2N = see Table 11 a_2Ns = see Table 11 (invAb) = inverted abasic deoxyribonucleotide-5′- phosphate, see Table 11 (invAb)s = inverted abasic deoxyribonucleotide-5′- phosphorothioate, see Table 11 s = phosphorothioate linkage p = terminal phosphate (as synthesized) vpdN = vinyl phosphonate deoxyribonucleotide cPrpa = 5’-cyclopropyl phosphonate-2′-O-methyladenosine-3′-phosphate (see Table 11) cPrpas = 5’-cyclopropyl phosphonate-2′-O-methyladenosine-3′- phosphorothioate (see Table 11) cPrpu = 5’-cyclopropyl phosphonate-2′-O-methyluridine-3′-phosphate (see Table 11) cPrpus = 5’-cyclopropyl phosphonate-2′-O-methyluridine-3′- phosphorothioate (see Table 11) (Alk-SS-C6) = see Table 11 (C6-SS-Alk) = see Table 11 (C6-SS-C6) = see Table 11 (6-SS-6) = see Table 11 (C6-SS-Alk-Me) = see Table 11 (NH2-C6) = see Table 11 -C6- = see Table 11 -C6s- = see Table 11 -L6-C6- = see Table 11 -L6-C6s- = see Table 11 LP183s = see Table 11 LP183rs = see Table 11 cC16 = see Table 11 aC16 = see Table 11 gC16 = see Table 11 uC16 = see Table 11 ALNA = see Table 11 c16s = see Table 11 C22s = see Table 11HO-C16s = see Table 11 LP293 = see Table 11 LP310 = see Table 11
[0091] As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence (such as, for example, by a phosphorothioate linkage “s”), when present in an oligonucleotide, the nucleotide monomers are mutually linked by 5’-3’- phosphodiester bonds. As the person of ordinary skill in the art would clearly understand, the inclusion of a phosphorothioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides. Further, the person of ordinary skill in the art would readily understand that the terminal nucleotide at the 3’ end of a given oligonucleotide sequence would typically have a hydroxyl (-OH) group at the respective 3’ position of the given monomer instead of a phosphate moiety ex vivo. Additionally, for the embodiments disclosed herein, when viewing the respective strand 5’ ^ 3’, the inverted abasic residues are inserted such that the 3’ position of the deoxyribose is linked at the 3’ end of the preceding monomer on the respective strand (see, e.g., Table 11). Moreover, as the person of ordinary skill would readily understand and appreciate, while the phosphorothioate chemical structures depicted herein typically show the anion on the sulfur atom, the inventions disclosed herein encompass all phosphorothioate tautomers (e.g., where the sulfur atom has a double-bond and the anion is on an oxygen atom). Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the ATXN2 RNAi agents and compositions of ATXN2 RNAi agents disclosed herein.
[0092] Certain examples of targeting groups and linking groups used with the ATXN2 RNAi agents disclosed herein are included in the chemical structures provided below in Table 11. Each sense strand and / or antisense strand can have any targeting groups or linking groups listed herein, as well as other targeting or linking groups, conjugated to the 5′ and / or 3′ end of the sequence.DI .QO283 4 5 6 7 8 9 0 1 2 3 4 4 5 6 7 8 90EN9898989898989899999999999999999999999 01002003004005006000S1 1 1 1 1 1 1( daccfcf acafgfufcfgfugf gagagfgfgfcfcf ga cc gf ufuuc af caac aarUtcfafA Gfc G fgfuf uf uCf fGfff f f f fnUUGf G Cg uAf f CcCuUcAcAU UfAf f fc c g Gu CaCg GuUaUcAcUuUa CuUfUfGfUff ffCfCffUf ffSCeuCcUUGg a gUu uUuGg u u u uCUuAg u gCg uGACusf fafuf f fAfuf fAf f f f f f fgf f f f f f fufgf fnAAa AAUc g UuUgAaUUAgAgUcUcUAUUAUUcUAU ecsiff acf ff cf f fgf uff f f fa cfufufufaf fcauftCGfCfUAUCUUUUCAAAaGfGGUUUAAfUfCUnaAaugac aacua uuc uucac g aga ucau agu au ugacacugcaaga auccag g a g c gccauucucuaacaaudueaauifuf gaaca gu uugufuf caucgcfuf caauc c cfufufugfagfua uuguc a c cfu a u uucaga gufiU daGf ffCUGfo faUfAcAa u a aAuAaUfg UaGaAgAgUuUffgCaAcGf fa UaGf fu UgUf fg AgUfaCuAf f f f fUAAf fAf f fAf f fAfAf f fUf f f f f f fMsgs UssGs s s UsAsUs sUsUs s sGUsAsGs AUs AAsUsfusfasscscsf gsf gssfas gsf csf asf gsf ususgsf ussf assas gsf asf assas gssas usasAsGfCfs UsGff f fffffff fU ACsA usU usG usA usGGU ua asG usUCu asUG uusA usCusUCu asGG usu usa ususus s s s susasudSnASASASASASASASASASASASASASASASASASASASASASASASASASA a-r5-t 67-69-61-73-75-77-79-71- - - - - - - - - - - - - - - - -83858789898193959799 1 3 5 7 9 1 9SDI 5S45 5 5 5 5 5 5 5 5 5 5 5 5 5 5 595060606060616261414141414141414141414145141414141414141414141414141A MMMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A A ADI .7080900111219 9 3 3 3 4 3 3 3 3 5 6 3 5 6 5 5 5 3 7 8 9QO0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1ES)'3→′5(ecneuqeSesaBgniylrednUDIQES'′( dnaCfCfu u u u u u u u u cgAAAUAuf f f f fAfAAf f f f f arg c u cacaua_aAuG tf fufgf uf gfcfAAAAA UcfcfcfcfcfcfAcUcf fcUfAcAAAA fcfcfcfcf fAufufcfcUf faUAfSA euU sfufAcU fcCfuG fufafUaUaUUUaUaU fafafaf faf fafUaU fa UaUaUcfaf fAcA fcfafafufAafnA esgU ifufUaUgUUU fufu cfgUUcUcUcUUccg UUccUgcgUfucUccU g UcUc afUaUUfaf cUgcG gaaCaatU ncAfacU uc GguUfu cu g Ag g g g gu u caafucuacu u uuacacaccafgu f f g g f g gU fAcU fcfUf u uU Ccaca cfucu cacagU uc Uf fg cgUucU fcg cfufacfA cdggcuc uc cu cAa a a aAaAAaa aAa a ca uc uc AAACaeaifafaf uff afuaf afai U UfafafafUUUUafaf a a aaUauauau faUf aaUau faUfUaafaa fAaaagfuau fU duU ofaUfAaCACfafcfafsasasas sUs s s s s s s s ssasas sa asasasasa a a a aUaf aUausasU ascsgMsGsfsf f f fsf f f fsfsfsfsfsfafa a sfsfsfsfcsUU sf as s UssUsfasaGGG fcsfassGsGfIGGGGGGGGGGf fGGAU fsfsaspapuspupus spupus s s s s s spupupupupupupuspus GGs s s spupupu u u a uAsUsGsACsGsr r r r r r r r r r r r r r r r rprprprprpru u asa u uPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcdSnASASASASASASASASASASASASASAS S S S S S S S S S S S S Sa -r 1- - - -AAAAAAAAAAAAAAt D 336353739-31-45-66-68-69-60-71-72-73- - - - - - - - - - - - - -74757779789002030405 6 7 2 4S46 6 6 6 6 0 0 0 0 00 0 0 4 4S I 0 0 0 0 0 0 0 2 3 3 3 3 3 3 3 3 31414141414161616161616161616161616161616161616161616161A MMMMMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A A A A ADI .0212223242526 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 942 3 3 3QO2 2 2 2 3 3 3 3 3 3 3 3 3 3 4 4 0 4 4 4 4ES)'3→′5(ecneuqeSesaBgniylrednUDIQES'′( dn A arcGgCGGaGCcGGaUgGgAcUgGuUgGACgGgAgAUAUuUuUuuufU tf fcUUfuUf fgUAf fgf f f f f f f fagUAfgf f f fufgfcf f f f fg AUgUaAcUUcUa UUUUUUUUUAAAAufSg ufua fufcf f fcf f f gfac ggcfaaa gfgfgfgfA esfnAgAffc Uu CuAfg GfAAGGCGUCfCf fGfCGfUffUAAAAgas uUcg g uagaugg g c cGg u g u gCc c u u u u uea uiaauu ac gag at cgcu u aauca a u u agu a g a acacacacnacucu ugagcu cu gg au gaauggcucu u uucaucgcucc u ucaaa augc cacccu cucacucucucucuAf fUUff fdCAff f fea aAaCaGaGAfu Ufff fu UgCuAgAf f fuf f f f f f f fu GuAgAAAGAUAAAfg Afg Afg AgifgfiGfasAf f f f fas Us AsGsAsGfsaUfsUf f f f f f fcfc cfufu cfa gf f f f fs A usUAAU gscsas sUUAfgscsas UsAsAfscUsAfs UsUsUsUUU usus sdousafs agsus us ass s s sus s saa ass as g a us sususMCf ssC ff f sf fff f f fsf f f fsf sf fff sfsfsf f f f fasGCusasCusUA usasCusG usU usU usG usGUUGAC CACUGGGGGG usasusus s s s sus s s sas s s sp p p p p p p p p p p p p p pupapapup pupapap pupupupur r r r r r r r r r r r r r r r rpP P P P P P P Pr r r r r r r r r r rc c c c c c c cPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcdSnASASASASASASASASASASASASASASASASAS S S S S S S S S S Sa -r 6- - - - - -AAAAAAA- AAAAt D 48340352354356358- 350- 362- 364- 366- 368- 360- 372-74-76- - - - - - - - - - -7870828486888594364849405S IS63 3 3 3 3 3 3 3 3 3 3 5 5 5 5 51616161616161616161616161616161616161616161616161616161A MMMMMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A A A A ADI .3434343434343 3 4 5 752 0 7 7 7 6 7 7 7 7 7 7 7 5 5 5QO4 4 4 4 0 1 1 0 0 0 4 0 0 0 0 0 0 4 1 1 1ES)'3→′5(ecneuqeSesaBgniylrednUDIQES'′( dnfUfcfUfUf acf acfcfAUGUgfgfgfgfgfufufgf saAcu u ugf f fart ufuU fufuU fufU f UufU f UufUuufuf AfufcfAAAAAAAAcUUufufu u u gfgfu gfuf fAAA AcfcfcfSAAAAAufAufA es gfgfg gfgfAgfAgfAgngfAcfufgfAgAf f ffgfAAAUc UfcAAA gufg uufUUU Aafafafe A siu AauuaA fuAgfufAgAufAfUcU AuAaa Acu uGauuUcUgcfgUfgUf aUcgac fgUAgcac guUcUcUctanccaccCcAaccuaaccuaac ucacgaac c u a aca uacucgcg accaccaA c NaAcacucagAcac guguguAua f fcg UUcu uaccu c uc f ff f a aua cuaug g gU N a UAC C u uauauauAuUgUf cN UgcfcfcfAgaAauAAAdf a a agf agf agfg ufafafafufufu u u u u u u u Ta a aeifUguguguUgisfUgfUfUGUUUUf f f f f u u u dauauaudusosf ussus ssususUsuusUsU uus suscs s s s s UUUUUu u u u ssc asc cscscscscscscsc c c c asasaM Gf f f f f f f f fsf fsf f f f f f f fsfsfsfsfsfsfsfs G usG usG usG usG usG usGGsfIAUGAAAAAAAAAAAAGGG usususususasusasus s s s s s s s s s s s sp p p p p p p p p p p p p p pupupupupupupupupupupu u ur r r r r r r r r r r r r r r rp p pP P P P P P Pr r r r r r r r r r r rc c c c c c cPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcdSnASASASASASASASASASASASASASASASAS S S S S S S S S S S Sa -r 1- - - - - -AAAAAAAAAAAAt D 5255354575859-50-62-63-66-68-60-72-71- - - - - - - - - - - - -12131516171819112223 7 8 9S65 5 5 5 5 5 5 5 5 52 2 2 2S I 5 5 5 9 9 9 9 9 9 9 9 9 9 9 9 9 91616161616161616161616161616161616161616161616161616161A MMMMMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A A A A ADI .5151846131612 2 2 9 2 2 9 9 2 0 0 0 0 0 0 0 0 0 1 3 3 3QO1 1 1 4 1 1 4 4 1 5 5 5 5 5 5 5 5 5 5 4 4 4ES)'3→′5(ecneuqeSesaBgniylrednUDIQES'′( dnua 2af_ ufufu gfgfgfgfgfufgfgfGufufufufgfu usu ufcfuf actAuf aAAfGGGGGUGfGGu gfGGGGUfGfGcGUAfrScfAccfcfcfA f UUUcfufuUfUufufufufu ufUgfgfg g u g g ufg u gU AfUfUufUUfUf fUf fGf fAfufesU nafUaafafafUa ufufUUUu uUuaufufUcUUgfUgAAesiUfUcUfucUcUAuAufuAfuAf a fuAcfuAAuaUccuUcUucfuUfUuc ufufuf fua gaUUUuUAccautcng Uucg g gcgu u uga auc c uau ucacaA Nuacuafu cAau ucucaca uccucA Ncu ccuf uccu ucacA NaccA cf uccfcfcffAAAcf uaucac uaucuUuCNfcacacAc fuUCu ua aUaac cuCuc accucUc fa a uc fUUfUdA ia Aa a aAa afafa a a aAcacAfafafa a aUu uaUaa aef a aaiuuauau aUUf f f f a acaAAAf f fcacaca f ggugudaausasasauas s UUUUu u u s s s AAAa a a Au s sosfa s s s sasasasasasasasasasusu u u u u u u u u u u uM GfGfGfGfGfGfGfGfGfGfGfGfGfGfGfsfsfsfsfsfsfsfsfsfsfsfsfsusususususUUUUUUUUUUGGG usususususususus s s s s s sus s s s s s s sp p p p p p p p p p p p pupupupupupup pupupupupu u u ur r r r r r r r r r r r r r rp p p pP P P P P Pr r r r r r r r r r r r rc c c c c cPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcPcdSnASASASASASASASASASASASASASASAS S S S S S S S S S S S Sa -r 0- - - - -AAAAAAAAAAAAAt D 31932343537-38-39-30-42-43-44-45-47-48- - - - - - - - - - - - -49203132333436373832 6 7 8S69 9 9 9 9 9 9 9 9 94 8 8 8S I 9 9 9 9 0 0 0 0 0 0 0 0 0 0 1 1 11616161616161616161616161616171717171717171717171717171A MMMMMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A A A A ADI .3 167 9 0QO4 1 2 0 4 5ES)'3→′5(ecneu uACUCqeNCAUU GGUS dUUCUCCAGeesiG G fiUUGUUUG ABdUUA CAUUaoGUC CGUUgmAUA AnnUGAAUCUUCiylUAr C UCUA CGACACUCe naCUGUGUAdUAnsaUAAAUUnA GACUUC CUAUAA woUCU h UAUCU UA GUCAU S(G UCUAAGU U U U U U UDI .QO78889809192939EN6 6 6 6 6 6 6S)'a3usc u s→gs′ugu sagcsacgs gs5gsf f f(aAUg cguUf sud ga uff cAgcncGf uug ufaf CrutUfgC ffufAfGGgSufUuUc Acgfuf fU esAgf fUAfCUcaUufufneasiu gata uu acacU ggAcncccugu uAuaNa ucaAuaafffUcACUAua ucdgeifcfufaf uucfafaffU isuUsUsU csA gUUsdosfassfsf csf asf usfM GfsCusUsAAGU pupus s s spu u u ur r rprprp pPcPcPcPcPrcPrcPcdS SnAS Sa -Ar 9- AA 7 -2- 3 8 0tSDI81900410880989S7 0 01 2 2 21 2 2021A MMMM91 1A9 9A A A ACACACDI .2535455565758 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5QO0 0 0 0 0 050506060606 606 6 6 6 60707 7 7 7 7E N S1 1 1 1 1 1 1 1 1 1 101 101010101 1 10101010101)seiteioMgnippaCro,setagujnoC,srekniLtuohtiWnwohS(seecsuccaguaga cnn a u acucu ucagcu uc caac ac a guacc uugua u caee uuS aucgcguuaauuuuugauuucaaauucacuauauuccuagauuuucaucccaucaguuaqeduaauuc uSeidf c a ug agacacaac ufugaaacuugf aagaa g ugucuaacaaacaguauaagaugf uciuafufuf uaf gagacfufGf gacuf ga Uf guf gaf und ucugagfuf augagfaf ua Gf gufa U A Gr o f fUfGA Af fCUfGfA Uf fCU GfCC UfCAfCCfGfUf f fGf fAAfAf fCf f f f f f f fGftSMGf f fA UAGaAfAaeGUUf ffsu u uGuGaC f cU u Aaaafcc CuUfuCc f UagaC fC C CfA A AfUfUau Gf fa Gfa GaUaGfu Afa AaAuUfa GacaaUunaeggguaa c u caa aua c aaaca c aac a c cgaucuStgauagauccagaua gaa gaaNg ga ga uucg gu gag g ugc a c ccN g g g 2 ucacc c g gac aaa u N anegugagauc auuacggacg2 c uu_auccugc_gauug g uuucaccg c augauccggggau 2 guc _ ug c a gA2 LNNLNLNLNL L L L L L L L L L L L L L L L L L L LD -S-S-S-NS-NS-NS-NS-NS-NS-N N NS-S-S-NS-N N N NS-S-S-S-N N N N NS-S-S-S- -N-XITdS S S S S S S S S S S SS S S-4-6-8-0-2-4-6-8-0-S S2-4-6- -S-S-S-S-S-S-S-S-S-S-An6 6 6 7 7 7 7 7 8 8 8 888092949698900204 6 8 0. aet5 5 5 5 5 5 5 5 5 50 0 0 14 r45 5 5 5 5 5 5 5 6 6 6 6 6 6lS 14141414141414141414141414141414141414141414141baMMMMMMMMMMMMMMMMMMMMMMMMTA A A A A A A A A A A A A A A A A A A A A A A ADI .677787970 1 2 4 9 6 9 4 5 3 4 5 9 3 3 3 4 5 5 6 7QO8 8 8 6 7 6 6 7 7 8 8 8 7 8 8 8 8 8 8 8 8)'3→′5(ecneuqeSesaBgniylrednU Ies aca aaucu a acucuca a c ucacacacucaca acacacacu aanuueagaucuuaggauauaaauc acua u u u u uuu u u uug cSadgaau caau aua uua aua a auu a a a a a auauuuu g uug u g uuauu cauca gu auuuuuu u uuuuuuuu gauuuuuu u c uuuuu u gge aifciacuggucgagufaf acf aauagaagguggua ucfcf ucfugu Gfcgg g g g gfg g gugac uuf aca a a aCfcfc c cf fAacf acacaugudfGG Gf f fAGf fAfC G GfGfGfGGfcfGfGf f foGf f f fAf CfAf f fC Gf f f f f f fAf fGfUfUfMAfAUfACA UUAfCA GaGfA AfA A AfGa A A A C GAfaCauAffaUaC f ffaAAC f f fauUaGAcaUfu UaUf f fU a UaUaUa af fgUaUf f fa UaUaAfU gaaua g gaaaa a gaaac a c g g g g gug g g guauugcaggu agaucg c aua cagu a u uuauc cgguNuu u u u ufu u u u uaa aua a aAa aua a accau u u g uua c c gcg c 2 gug gugugugugugu uuga c u caggcaguuu a c c aug acgg c a a a acg gg c cuac u uc a u _ c c c c c c c cgccLNLNLNLNLNLNLNLNLNLNLNLNLNLNLNLNLNL L L L L L L LD- - - - - - - - - - - - - - - - -N-N-N-N-N-N-N-N-ISdSSSSSSSSSS S S S S S S S S S S S S S S S S S S Sn -a8- - - -S-S-S-S-S-S-S-S S S S S S S S S S S S Sr2032343638304697989990-01-07-66-78-72-65- - - - - - -969799910101434t6S46146146146146 6 9 9 9 9 0 0 0 0 0 2 2 2 2 2 3 3 3 314141414141415151616161616161616161616161MMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A ADI .889809192 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 3 4 5QO9 9 9 9 9 9 9 9 0 0 0 0 0 0 0 0 0 0 9 9 9)'3→′5(ecneuqeSesaBgniylrednU Ieusga ucaga ua anagu agaca aaacuca a acuuuga auaguauau aecuuuacguuacau uc uaaa acugauuaaucaagauau ugcu au g u caagu u a u u u gcuaSuacguuu uuu aua caa cua augug a aug uuude uaa c gu gcca caaga uugcguu au cu gaagccaifcigggagu ucaaacu ugca uccaggcgcaagaaaucgggugua ac g gau ua ua c g g g ca ucdufafu a aaoCffG Afff u uAffCffGC ffCfu ufAf fufCfAfafCfu a u ufCffCf f f fa u a u aafGfGfCAffCf ffAfCf ff ufGfGC ffCfM Uff CUfAfGUfAffCAf CfCUfUf C C G CffAGG CCGC A GfC f fACUGfGfff ffCff f f ffCfa AaUa uAuGu aUa uGa aUaCaUGaCGaUaUAuG gauc g a uac g c u c c g c a cauac cac c aacaguccc guc c c gac c a c u auc a c u guc u u acc gacaguccacacu ucgcugguu auu cuu c g acacuuac u u cga ucg u g aau guc gacau ucau ucgucu a c agugccggac c c c cgg c c c cug cg c c cgag cggc c gg a u c c a c a u a c cgacLNLNLNLNLNLNLNLNLNLNLNLNLNLNLNLNLNL L L L L L L LD- - - - - - - - - - - - - - - - -N-N-N-N-N-N-N-N-ISdSSSSSSSSSS S S S S S S S S S S S S S S S S S S Sn -a5- - - -S-S-S-S-S-S-S S S S S S S S S S S-S S Sr47494153555759516365-67-69-61-73-75-77-79- - - - - -718385878980919t3S63163163163163 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 316161616161616161616161616161616161616161MMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A ADI .693070460 1 1 1 2 7 5 2 0 3 7 5 4 4 5 5 6 7 8 1 1QO1 1 1 1 1 7 5 8 8 1 7 8 1 1 1 1 1 1 1 1 1)'3→′5(ecneuqeSesaBgniylrednU Ies acaca ucacac aaana c acauuaacuua a acacaca a _ 2 aaacaceauuaguaaa acSauc cacaua aa aagagcuaguaguagauauauaaaa auaua_uauauaaaacdcuagc uaucaua gcgu cea uaaau u u a a u u u uuuu u u u cugug auauuug g g g g g gauauaicfi gguugccgggggfgUgfgfggcgguaaggacgcfgf uaugaafua agufuaguguggfggudfu u uoAf f fufGfAfAfufAfufAfAfUUf fuAfa u aGf f fuGAuGaGa a aGfAfufcf fuf faf f f fufAM Uf G CUAf fUfAff GfGACf ffUUfuUAA UCAGaafGfGfGfGf ufUAu AGa A A A AufaU uaGaCfuCfCuCu u f faCuCfuC f ffuGAaCf faCuC f f f f f f ffCu UaAAAAAAACu ufcuuccuaaa aaa a aua a g a a gaaaaacacaca ac aA cu c gaugafa auguGuguguuca c agcccacu ucuc cu c c c c c c c a agauc c a a a a a g guagcug c c c c c c u c c ugu u gacacg g g g gaucuccccacuuuuucucucugcuuaguggcccuccgcgaccaccaccaccccuucucLNLNLNLNLNLNLNLNLNLNLNLNLNLNLNLNLNL L L L L L L LD- - - - - - - - - - - - - - - - -N-N-N-N-N-N-N-N-ISdSSSSSSSSSS S S S S S S S S S S S S S S S S S S Sn -a2- - - -S-S-S S S S-S-S S S S S S-S S S S S-S S- r939493354745-56-51-656769-61-74-10-26-3146- - - - -482539304144858t3S63163165165165 5 5 5 5 5 5 5 9 9 9 9 9 0 0 0 0 0 1 116161616161616161616161616171717171717171MMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A ADI .7 4138514 7 2 1 0 5 3 6 2 4 7 4 5QO7 6 7 8 8 8 9 0 5 5 9 7 1 1)'3→′5(ecneuqeSesaBgniylrednU I)'3→′5(dnartSea a u a a a us a a a anau cucaua c u c g u g caaa aagauau g u uagucaauu uagcauaae gau uuu c a ua aua acau caaauuS adag u g u a ggu guc uag a uca gugeaiu ufau a afgicau gugcugau a a g a uga gaucggc acuc ucu agafudgu cgfGuf fafufufuf gafafufuf gafufaaugaU ffGufoMG GafAufGAfAf fGfAfUfA CACfAffUfffAf C fG Uf Uf f Cf GfGffUfGf C f fGef AfAuffAfditCUC CAACG GC CouaAa aAaUGuAAeluaccga uuccauaaauaacaggu aaca ucucccaggugaa aua c cugc a a g c c a cuu u a g accccca nuaccu g ucguacuuc a aaaug acgeuggccaaccuucugaucagggacccccgguagugcaugcccnisLonNLD -NL-NL-NL-NL L L L L L L L L-N-N-N-N-N-N-N-N-N- L L LedIS adSS S S S S S S S S S S S S Nn -Sa6-S-S-S-S S S S S S S S S -N0-N8-1onir75600103-94-95-96-98-99-90- - -0103050488 858 3mat3S76 5 5 0 0 0 0 0 0 1 1 1 11718181020202020202020202021490600-02=MMMMMMMMMMMMMMS S S NA A A A A A A A A A A A A AC C C 2_aQ.2 3 4 556 7 8595061626364 5 6 7 8 9 0 1 2EDO505050 05050 0 0 0 0 0 060606 6 6 6 7 7 7S IN1 1 1 1 1 1 1 1 1 1 1 1 1 101010101010101)' edA G A 3it→oAAAUAAAU U AAACUA UAAAA ′elc UCCG UAAC UAUACUCA AC AGA UACUG 5( uA AUAGC GCAUCA UCGU AUC A ACU UAUACUUU CUsn aecu cuaSfuau gaucgagcgcGfagccu ggUfggguugcuuacagc g u gag a gagad Uf fafafafufaf fafeifAfGfU U G A AfC UfA Gf faAfufuf fufuf f ffU C C UfG C CfUfiGfCfGffAf ffUfAffGfGa faAfAfA fAfacUfcfUf ffCfCfCffAffAfAffUfdoGuUMauUgguu GuG C Aac C Uaa uuacc uauCaaaga CuGaaG U Gaa acuA A AaacaauUcacgg aaugagacc g uaucg a ucaaacacNa gagacgNa2gcaa g augac acuu g g ggc a uagaug gag uc as) asuuacg cgacg2gc uu_ u cugc_ c gcg u ggcca a ggauuuucaccug u cgg aub)s sb)b)sb)sb)sascs s s s s s s sascs sgs sb)b)b)b)b)b)b)b)b) ) ) ) ) ) )AvA A A A A A Ab b b b b b bnvnvnvA A A A A A A A A A A A Anvnvnvnvnvnvnvnvnvnv v v v v v v vi(i(i(i(i(i(i(i(i(i(i(i(i( ni( ni( ni( ni( ni( ni( ni( ni(C C C C C C C C C C C CD- -I SS- - - -C C C C C C C C CS- - - - - - - - - - - - - - --SS S S-S-S-SS-SS S-S-SS S-S-SS-SS-SS S-S-SS-SS-SS S S S S-S-S-S-S Sdn 4a66686072747678 0 2 4 6 8 0 2 4 6 8 0-2-4r 5 5 5 5 5 5 57585858585859595959 9 0 0 0t 41414 4 4 4 4 4 4 4 4 4 4 4 4 45454646464S1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1MMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A AQ.3 475 6 7 8 970 18284 97669 475 3 4 5 9 3 3 3 4 5EDO70 070707070 080 0 060 0 06 7 8 8 8 7 8 8 8 8 8S I0 0 0 0 0 0 0 0 0 0 0 0)'3→′5(ecneuqeSesaBgniylrednU Ieasauugu u ug u ga ua uu u u u u uau ungfe uGfcagc c g gaguua g caa aaugagggga ucaucfgGfcgg g g g gf ug g gua aca a aCf f a aSafdeC Af fuCfuGfGfcGfa a u uGfAfCf fcAfu uGf fGAf fcCfGfcGfcGfcGfAcG Gfcf fcGfGiffiU Ga fGf f f f f fAf f fCfA Af ffUfAfCfA U UfAfC A Ga fGf f f f ffA AfAfAfAfAfGafAffAdfaoGcaaaUfuAaCuAaUaCf faAaAaCuUf faaGcaAaaaUuUaUaUaUfaUU aafgUaUfaUaMaau cgg ua augauacag gguaaa a acg ccag a cguu caa ucg ug guuaug g g uauauau fgugugauuuNa g g gc2 guuaucuu uaug uu agaccu ucc gNa u u u uauAuau uaugcug gac 2 gug gcg g g g g gcgc_s) asgscs) usucs) as) gs) as) usucsascusc_sacsgsacsgsccsacsacsacsacsgscsb)b)b b)b b b b b)b)b)b)b)b)b) ) ) ) ) ) ) ) ) )A A A A A A A A A A A A A A AbAbAbAbAbAbAbAbAbAbv v v v v v v v v v v v v v v vAn ( n( n( nv(n( n( n( nv v v v v v v vi i i i i i i i( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni(C-C-C-C-C-C-C-C-C-C-C C C C C C C C C C C C C C CDISSS S S S S S S S S-S-S-S-S-S-S-S-S-S- - - - - --S S S S S S S S S S S S S S S S S SSSSSSSSSSSSSdn 6-a 08-00-18-20-32-34-36-38- - - -30469798- - - - - - - - - - - -999001076678 2 5 6 7 9 1r 6 6 6 6 6 6 6 6 6 6 9 9 9 9 0 0 0 070629292929203t414141414141414 4 4 4 4 4 4 5 5 6 6 6 6 6 6 6 6 6S1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1MMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A AQ.586 788 9 0919293 4 59697 8 9 0 1 2 3 4 5 6 7 8 9EDO080 08080 0 0 09090 0 0909 9 0 0 0 0 0 0 0 0 0 0S I0 0 1 1 1 1 1 1 1 1 1 1)'3→′5(ecneuqeSesaBgniylrednU Ies u a g uacu g c ca caagau cguau cangeac u cag aguc a uc u cag auggaaguua ucgg gS ca gfug g guaacug a c ggc c a a ucg gug aua c g gdeGfuUfu afu a a aUfCfAfAfCf fu uCfCfu uAf fuAfaCfu a u u aCfCf fGf fa u a uAf fAfCfGiffiAf f fGf ffCfGfU U Af fGf f f fCf f f f fGf fCf fCf f f ffG U A CfU U C CfGfCfA G G C CfG C A GdoUaAuUfuCfaAaAfaUfaCfuAaCfuGfuCfaUaGuGaGf f f faUaCaUaGaCf faCaGfaUfaUaMguaauu g c guacaucc ga u c gucccacagc uac ccuaccg cuu aa cuc au c cac u gc c a cuc ucu aagccug aga u c c g cuc cgc gga uuu uuaca uuc ugu ccuacu c ucuacuacugg u g a u ggc g c u uua g c cgs) gscuscascsgsgs) gs) casgscg ascscu cscscsgcscasccscascsguscasccscsgsb)b)b)b)b)b b b)b)b)b) )b) ) ) ) ) ) ) ) ) ) ) )A A A A A A A A A A AbAAbAbAbAbAbAbAbAbAbAb b bv v v v v v v v v v v v v vA A Anv(n( nv(nv(nv(nv v v v v v vi i i i i i( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni(C-C-C-C-C-C-C-C-C-C C C C C C C C C C C C C C C CDISSSSSSSSSSSSSSSSS-SS-SS-SS-SS- -SSSS-SS-SS-SS-SS-SS-SS- - - -SSSSSSSSSd-n1-a 01-43-45-47- - -494153- - -555759- - - - -5163656769- - - - - - -617375 7 9 1 3-5-7r 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 373737383838383t616161616161616 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6S1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1MMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A AQ.3 4 5969307 4 0 1 1 1 2 7 55280 317 584 4 5 5 6 7EDO9090 0 0 101601111111111708 7 1 1 1 1 1 1S I0 0 0 1 0 0 1 1 1 1 1 1)'3→′5(ecneuqeSesaBgniylrednU Iesgacuccauccgcgucagagag gfag agug gcuguaagucucug g g g g gguau a a a anueg a c g g c g g gUS afafufgf g g u g a g f f gafugufugugCfuCfu u uAfGfAfuAfuAfuA AfUf fuAfa u aGfUf fuAfGAuGaGa aG ufcf fuf faf f fdeGiffiAfCf f f f f f fU fUfU G C UfUfU fAufUf fAf f fGGAffAfA U CfA afafUAGufAGGafGAfAdfoAaCuGfuCfaUfaGaCuCfuCCuufaCuCuCf fuGuAaCfaCuCuUf f f f f faAaAaAaAaAaAaMccgagc uac cu c auc ucaagaagaagfa aGagaa a a gguca ccaa a gcua a c c c ccucuac c c c c cgacuc cua u u u u u u u gcc a u g g ucacaagagagagcuggau c g cucuc c c cuucc cgugu ucg c c a a a acs) gscg cs) cscas) csusuu u uscscscsgususasusgcsccsuscgscgsccsccsccsccscsb)b b)b b)b)b)b)b)b)b)b) ) ) ) ) ) ) ) ) ) ) ) )A A A A A A A A A A A AbAbAbAbAbAbAbAbAbAbAb b bv v v v v v v v v v v v v vA A An ( n( nv(n( n ( nv v v v v v v v v vi i i i i i( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni( ni(C-C-C-C-C-C-C-C-C-C C C C C C C C C C C C C C C CDISSSSSSSSSSSSSSSSS-SS-SS-SS-SS-SS-SS-SS-SS-SS- - - - - - -SSSSSSSSSSSSSSSd-n9-a 80-91-92-93-94-93- - - - - - - - - - - - -354745565165676961741026 1-6-8-5-9-0r 3 3 3 3 3 3 5 5 5 5 5 5 5 5 5 5 9 939494920303040t616161616161616 6 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7S1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1MMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A AQ.8E11 1 7 4138514677281808593065254n97 4 5 wSDIO1111170 1 0 1 0 0 0 0 0 0 1 0 0 0701111o)'3→′5(ecneuqeSesaBgniylrednU I3 )→b)b)b) ) ) ) ) ) ) ) )p′A A )b b b)Ab bAbAb)Ab b)Ab b)b b)Ab b) ) iAb b l5vA(nv vinini A AvvnvAinivnvinivnivAnivnvAvAvAini ninivnvAnivnvAvAini ni vhnt iiw d(s(s(s ni(s(s( (s(s(s(s(s(s(si( (s(s(s( (na a aaa c(sacac sa ucauaca u a ac sa aua as suaca nw raca a a uaa g ug u g acu atuSuacacug uaauaauuuacau g u uaauaggauauacaaau g u auc ouaaauuu hSe gsaun uauga afgeg ga guuuaugauaauguu gacaugg aucuaug g( fgau ggcgauga gau gac acc cu agafu seSafGudeG uf fcgGcA ufuf f ga uGf fuGAfuga acuguga uGf f aa uGga cnAfCfAfCfGfUUf fif fC G uf fGeufiAA fuuffGaAfAf fUfAfUfAfCfUf fGfCfAAfqeCCufuCf fAUf fCfCf f fCfGfUf fGfCfu ACf fSdoAaMcu f ucaaaAaa Aa aAa uuacguccauA Aaaa a aG Uuacaggu aGaca u u uAaAadncucccagggauacccarggaugcuccgcuaacuagguccgcuaa ccu uuucuaaagaaagccugc atuacgScc gg ac u c gac gg cc c g ca euu u)cca c u a gac c gu gcc sscscsus s s sususa g u c nb)b)b)b)b) ) ) )s)s)s)s)s)s)s)s)s)s)s)eSAvA A A AbAbAbAbAbAbAbAbAbAbAbAbAbAbAbAtnvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi( nvi (nv nie(ni ( gA C-C-C-C-C-C-C-C-C-C-C-C-C-C-C-C C2DISSS S S Sd -S SS SSSSSSSSSSSSS- -SSSSSS S C-C-C- N X n1-S4-S- -S5- - - - - - -S S8- - -1- - 048818 T.1a4r085867 6001039495969 99900 03050 8t 71717376758580000000000001 1 1 1 58143 A 1060 .6elS 1 1 1 1 1 1 1 2 2 2 2 2 202020202 9 0 0 ebMMMMMMMMMMMMMMMMMS S S lb aA A A A A A A A A A A A A A A A AC C Ca TTnidenartSesneSgnidnopserroCeaga gua aga a a ugu a a a uauau aau uauau a agas ugu fgu ug g cgc ucu ca aaa faa a ua aagnea a A a auauaca acuc uc g g g G g g ca cc cuaSudgugugugugu u g cueciac cg g a uc cua u u u u u u u gcc a u ugg u c g cucuc c c cuucc cguggfi s) acs) acs) as) gcs) ccs) ccs) cs) gas) cgs) ccs) cas) cs) uu u u u cs) us) cs) cs) cs) gs) us) as) us) gs) cs)dbAbAbAbAbAb b b b b b b b b b b b b b b b b b boMviv v v vAvAvAvAvAvAvA A A A A A A A A A A A An(n n n n n n n n n nvnvnvnvnvnvnvnv v v v v vsi)(s i)(s i)(s i)(s i)(s i)(s i)(s i)(s i)(s i)(s i)(s i)(s i)(s i(s i(s i(s i(ns i(ns i(ns i(ns i(ns i(ns i(s6 6 6 6 6 6 6 6 6 6 6 6 6)6)6)6)6) )6) ) )6)6)C C C C C C C C C C C6 6 6 6HHC C C C C C C C C C C C CNNH NH NH NH NH NH NH NHHHHHHHHHHHHHHH (-(- (-(-(- (- (- (-(-N(-N(-N(-N(-N(-N(-N(-N(-N(-N(-N(-N(-N(-N(-N( 33 3 3 3 3 3 3 3 3 3 3 3 3-8 8 8 8 83 3 3 3 3 3 3 3 3 31 1 1 1 1818181818181818 8 8 8 8 8 8 8 8 8 8 8P P P P P P P P P P P P1P1P1P1P1P1P1P1 1 1 1 1L L L L L L L L L L L L L L L L L L LPLPLPLPLPLS SIS SSSSSSSSSSSSSS S S S S S S S S S S S S S S SD -2-5-6-7-9-1-1-S9-S0-S1-S2-S3-S S S4-3-5-S S S S S S S S7-5-6-1-5- - - -dn6a2929 9 9 0 0 8 9 9 9 9 9 3 4 4 5 5 6 676961763r6t162162162 3 3 3161616163 3 3 3161616163 5 5 5161616165165165165165165165169161SMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A AdenartSesneSgnidnopserroCes a a a a a ua Aa aga uauaa a agu a a uauguaaga ancecc cacacc cacacaagaagccucacaaguaccacgaacccu cuc c gggaagua caa ucd a a a agau u a u g a uu aa c ucSg g g g u ge cicc cc c c g a cu c a a u c guuccga ugg c acg ugcug g cfi s) ccs) ccs) cs) uus) cus) cgs) ccs) ac cs) cs) us) us) us) aas) gs) ccs) cs) gu c as) as) gs) us) as) cus) cs)dbAbAbAbAb b b b b b b b b b b b b b b b b b b boMviv v vAvA A A A AA A A AvA AvA AvA A A A AvAn(n n n nvnvnvnvnvnvnvnvn nvn nv v v v v vsi)(s i)(s i)(s i)(s i)(s i)(s i)(s i)(s i)(s i)(s i(s i(s i(s i(s i(ns i(ns i(ns i(ns i(ns i(ns i(ns i(ns i(s6 6 6 6 6 6 6 6 6) )6) )6) )6)6)6)6) ) )6)6)C C C C C C C C C6C6CC6CC6CC C C C6C6CC C6HHHHHHHHHHHHH HCN H NHHHH NHH HH NNH (-N( 3 -N(-N(-N(-N(-N(-N(-N(-N(-N(-N(-N(- (-N(-N(-N(- (-N( N( N( ( (N(83 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3-3-3 -3-3-3-31818 818 8 8 8 9 9 9 9 9 929 9292929 98 8 8 8PP1P P1P1P1P1P2LP2P2P2P2LP2 2 21 1 1 1LL L L L L L L L L LPLPLPLPLPLPLPLPLPLPLPLS ISSSSSSSSSSSS S S S S S S S S S S S S SD - - - -S S S-S-S-S-S-S-S-S-S S S S7 9 1 3d8n25-393041-44-85-856001039495969899-90- - -0103050464 5 5262626a0r70t170 017170171 1 6 5 5 0 0 0 0 0 0 1 1 1 11717171818102020202020202020202000002000SMMMMMMMMMMMMMMMMMMMMS S S SA A A A A A A A A A A A A A A A A A A AC C C CdenartSesneSgnidnopserroCes a uca a a u a a f f fUfUfGf fCf fAfAfUfCn uuguguguauafCfe gu a a a ccccca GfCfGfAfUfAfGfGaaaAfAfAfacUcfUfCfCfS N d2ae _gu uugcgu g a gcg G U Ucuccgac uau uu GuGaCuAaccCuUuCaa ga CuGaGaUaiafi s) gsasgscsuscscs gggguag aac u cccag ua aag aauagaacaNaagca cga gadb)oAb)b)b)b)b)b)b agagugc aac cNg g g 2 u acc cMvAivAvAvAvAvAvAv uagauc auuacgacg2_cuucuc_acugugaucn(ns s s sgscsusascsgsgsususcscsussi)(ns i(ns i(ns i(ns i(ni(ni()b)b)b)b)b)b)b)b)b)b)b)b)b)b)b)b6)C6)C6)C6)sC6)sC6)sC6)C6 ACvA A A A A A A A A A A A A A Anivnvinivnivnivnivnvnivnv v v v v v vininini nini ni nHHHHHHHH(s(s(s(s( (i( ( ( ( ( ( ( ( (i(N(- N(N(N(N(N(N(N( )3- 7)7)7)s7)s7)s7)s7)s7)s7)s7)s7)s7)s7)s7)s7)783-3-3-3-3-3-0 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3181818 8 9 9 13GGGGGGGGGGGGGGGG PP P1P1P2P2P PA NA (NAAAAAAAAAAAAAA LL L L L L L L(N(N(N(N(N(N(N(N(N(N(N(N(N(N( S ISSSSSSSSSSSS S S S S S S S S SD 5 7 1 0 2 0 8 1 - - - - - -S S-S-S-S-S-S S S Sd565 5 6 6 4 8 8n 2621313138 8 346668607274-767870828486-88-80-92-949ar0t000000005014906000 545145 5 5 5 5 5 5 5 5 5 5 5 5 5141414141414 4 4 4 4 4 4 4 4SSCSCSCSCSCSCSCS1 1 1 1 1 1 1 1 1CMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A AdenartSesneSgnidnopserroCes fGfCf f fCf fGf f f f fCfAf fUfCfGf fAfCfGfneCfA A A U U GaGS Gf f f f fac fA A U A C A U C G U U AfUf fCf f fCf f f f f f fG U A CAf f f fCduA A AeaacaauUcaGcaaaa uAcaauAaaUaagaA A Agaaa uU Cau aAga ag UaCuAa ugifaiuucgaguggaugg uug u a u a gac uuucc gacuccc gdg aa c gga cua c aca c g u c a a aogggccaacaa uN ggau 2 gg guu ucuuug uu aga ccgug a a u c cua u c ucuacg cua ugMaus) csgsgsucsc_sasgascsusucsasgcsasucsgscu ascsccsgsgsgscsgsb)b)b)b)b)b) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )A A A A A AbAbAbAbAbAbAbAb b b b b b b b b b bv v v v v v v v v v v v vAvAvAvAvAvA A A A AvAn(n n n n n n n n nv v v v vi s in n n n n n n n n n n n n n)(s i)(s i)(s i)(si )(si )(s i)(s i)(si )(s i)(si )(s i)(si )(s i)(s i)(si )(si )(si )(si )(s i)(s i(si(s i(s7 7 7 7 7 7 7 7 7 7 7) ) ) )3 3 37 7 7 7 7 7 7 7 7 7 7 7 7GGG3G3G3G3G3G3G3G3G3G3G3G3G3G3G3G3G3G3G3G3G3G A NAAAAAAAAAAAAAAA (N(N(N(N(N(N(N(N(N(N(N(N(N(N(NA (NA (NA (NA (NA (NAAA (N( N( N( SS S S SISSSSSSSSS SSSSSSSSSSSS S S S S S S S S SD -6-8-0-2-4-6-8-0-8-0-S2-S4-S6-S S S8-0-1-S3-S5-S7-S S S S9-1- - -dn9a595060 0 0 0 1 2 3 3 3 3 3 4 4 4 4 4 4 5355575r4t14146146146146146 6 61414146 6 6 6 6 3 3 3 3 3 3 3 3 314141414141616161616161616161SMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A AdenartSesneSgnidnopserroC→a a a′gucaa agcucaa a cuuugug u guacugugcucu a5(aduacu a u uccaua caagcaguaa aua cu au gugugu u aug acau a a a a uugaaaaau ggug ana c aaurt cc aa a aggcgcau gca gagaaucggu agugu uaauucg acgggugcugcf uauagaf ucS ufuesCfu ufAfCfuAfaCfufafufufaf aafufafufufGuGgfC C G G C A C A C G G uf fAufufneUffUf ffCfCfGffCf f f f ffA G G C Cf fCfAf fAGafAGaGf f f f fG GCf f f f f fUfuf fSGduCecaUuaGuGa aUaC U GaC GaUaU CuCuA A Cuifc cc c g caaacauac cg ac c aac a aa aua a auiudcuacgcuug uc aac uuc ucu aauc ccccc cogauc gaa uugu uuaca uuucaugu ccg g a a gMcgg) cacuucccgcgcgcacccucacugugcacc gucuccgcgucs s s s s s s s sc c g c u c c ub) ) ) ) ) ) ) )s)s)s)s)s)s)s)s)s)s)s)AbAbAbAbAbAbAbAbAbAbAbAbAb b b b b b bviv(s iviv v v v vAvA A A A A An n n ninv v v v v v v v v v vini ninini ni ni ni ninin ninininin)(s) (s) (s) (s) (s) (s(s(s(s(s(s(s(s i(s(s(s(s(s i(s7 7 7) ) ) ) ) ) ) ) ) ) ) ) ) )3 3 37373737373737373737373737 7 7 7 7GGGGGGGGGGGGGGG3G3G3G3G3G A NAAAAAAA (N(N(N(N(N(N(NA (NA (NA (NA (NA (NA (NA (NA (NA (NA (NA (NA (N( SS S S S S S S S S S S SIS S S S S S S S SS S S S S S SD -9-1-3-S S S S S S S S S S S5-7-9-1-3-5-7-9-1-3-5-7-4- - - -dn5a36r636636636636637637 7 7 7 8 8 8 8 1021464676363636363636363 9696969637t1 1 1 1 1 1 1 1 1 1 1 1 1 161 1 1 1 1 1SMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A
[0093] The ATXN2 RNAi agents disclosed herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0094] As shown in Table 5 above, certain of the example ATXN2 RNAi agent nucleotide sequences are shown to further include reactive linking groups at one or both of the 5’ terminal end and the 3’ terminal end of the sense strand. For example, many of the ATXN2 RNAi agent sense strand sequences shown in Table 5 above have a (NH2-C6) linking group at the 5’ end of the nucleotide sequence. Other linking groups, such as a (6-SS-6) linking group or a (C6-SS-C6) linking group, may be present as well or alternatively in certain embodiments. Such reactive linking groups are positioned to facilitate the linking of targeting ligands, targeting groups, and / or PK / PD modulators to the ATXN2 RNAi agents disclosed herein. Linking or conjugation reactions are well known in the art and provide for formation of covalent linkages between two molecules or reactants. Suitable conjugation reactions for use in the scope of the inventions herein include, but are not limited to, amide coupling reaction, Michael addition reaction, hydrazone formation reaction, inverse–demand Diels–Alder cycloaddition reaction, oxime ligation, and Copper (I)- catalyzed or strain-promoted azide- alkyne cycloaddition reaction cycloaddition reaction.
[0095] In some embodiments, targeting ligands, can be synthesized as activated esters, such as tetrafluorophenyl (TFP) esters, which can be displaced by a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to the ATXN2 RNAi agents disclosed herein. In some embodiments, targeting ligands are synthesized as azides, which can be conjugated to a propargyl or DBCO group, for example, via Copper (I)- catalyzed or strain-promoted azide- alkyne cycloaddition reaction.
[0096] Additionally, certain of the nucleotide sequences can be synthesized with a dT nucleotide at the 3’ terminal end of the sense strand, followed by (3’ ^ 5’) a linker (e.g., C6- SS-C6). The linker can, in some embodiments, facilitate the linkage to additional components, such as, for example, a lipid or one or more targeting ligands. As described herein, the disulfide bond of C6-SS-C6 is first reduced, removing the dT from the molecule, which can then facilitate the conjugation of the desired component. The terminal dT nucleotide therefore is not a part of the fully conjugated construct.
[0097] In some embodiments, the antisense strand of an ATXN2 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3 or Table 10. In some embodiments, the sense strand of an ATXN2 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4, Table 5, Table 6, or Table 10.
[0098] In some embodiments, an ATXN2 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, an ATXN2 RNAi agent antisense strand comprises the sequence of nucleotides (from 5’ end ^ 3’ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1- 24, or 2-24 of any of the sequences in Table 2, Table 3, or Table 10. In certain embodiments, an ATXN2 RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.
[0099] In some embodiments, an ATXN2 RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, an ATXN2 RNAi agent sense strand comprises the sequence of nucleotides (from 5’ end ^ 3’ end) 1- 17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2- 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24, of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10. In certain embodiments, an ATXN2 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.
[0100] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) can be perfectly complementary to an ATXN2 gene, or can be non-complementary to an ATXN2 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) is a U, A, or dT (or a modified version of U, A or dT). In some embodiments,nucleotide at position 1 of the antisense strand (from 5’ end ^ 3’ end) forms an A:U or U:A base pair with the sense strand.
[0101] In some embodiments, an ATXN2 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or10. In some embodiments, an ATXN2 RNAi sense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.
[0102] In some embodiments, an ATXN2 RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5′ end ^ 3′ end) 2-18 or 2-19 of any of theantisense strand sequences in Table 2, Table 3, or Table 10, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.
[0103] A sense strand containing alisted in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3 provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the ATXN2 RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 3 or Table 10. Certain representative sequence pairings are exemplified by the Duplex ID Nos. shown in Tables 7, 8, and 9A.
[0104] In some embodiments, an ATXN2 RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the Duplex ID Nos. presented herein. In some embodiments, an ATXN2 RNAi agent consists of any of the Duplex ID Nos. presented herein. In some embodiments, an ATXN2 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an ATXN2 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, and / or other non-nucleotide group wherein the targeting group, linking group, and / or other non-nucleotide group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, an ATXN2 RNAi agent includes the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an ATXN2 RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non-nucleotide group is covalently linked to the sense strand or the antisense strand.
[0105] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7, 8, 9A, or 10, and comprises a targeting group. In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7, 8, 9A, or 10, and comprises one or more lipid moieties.
[0106] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7, 8, 9A, or 10, and comprises a lipid moiety. In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 2, 7, 8, 9A, or 10, and comprises one or more lipid moieties.
[0107] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 7, 8, 9A, and 10.
[0108] In some embodiments, an ATXN2 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand / sense strand duplexes of Tables 7, 8, 9A, and 10, and comprises a lipid moiety.
[0109] In some embodiments, an ATXN2 RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Tables 7, 8, 9A, and 10.
[0110] Table 7. ATXN2 RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. AS AS SS SS D l AS ID modified unmodified SS ID modified unmodifiedAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ IDAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ IDAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ IDAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ IDAS AS SS SS Duplex AS ID modified unmodified S modified unmodified SEQ ID SEQ ID S ID SEQ ID SEQ ID
[0111] Table 8. ATXN2 RNAi Agent Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. (Shown with Targeting Ligand Conjugates) SS SS AS AS difi d difi d difi d difiedSS SS AS AS Duplex SS ID modified unmodified modified unmodified SEQ ID SEQ ID AS ID SEQ ID SEQ ID
[0112] Table 9A. Conjugate Duplex ID Numbers Referencing Position Targeted On ATXN2 (ATXN2) Gene AC Duplex Targeted ATXN2 )AC Duplex Targeted ATXN2 IDSS ID AS ID DuplexGene Position ).Q O ESN267D571582 4 7 2 3 3 4 5 6 7 858565657575858585858585I)setuausu uususussss ustid ( U A A AacucaG AWeisf )idf f f fr nC U U Ucggaf fAfAfAfAfAfedboaacu ca U U U U U U Uguiaaaga augugucscs auuca a a a a augugug g gugm M g a a a )uyLl ulcu b)ugucgucgcAb gu a auaua auavAN v2a_gu u u u u uugcgcgcgcg gNuu a a a n n ac cs si i g a a a a a aDIF()eb)sb)sb)b (s) (ss))sb)sb)sb)sb)s s sb)b)b)btdanAgavAuj rt nivAnvAnv6 6 A A A A A A A AnC C vnvnvnvnvnv vnvno S (es - s i)(s i(s i(HH sN N i(s i(s i(s i(s i(ni(i(ni(36 -)6 -)6 -)6(-(- -)6 -)6 -)6 -)s6 -)s6 -)s6 -)- s).n0e1 C 3 C 3 C 3 3 3 3 3 3 3 3 3 3636C 8 8 8 8C8 8 8C8C8C8C8C8C C C1SPH1PH1PH1PH1P1P1PH1PH1PH1PH1PH18PH18PH1H eLN( LN( LN( LN( L L LN( LN( LN( LN( LN( LN( LN(PLN(lba re889080061 046491092 3 2 3 4 5 6 7090906464646 6 6T D]I b2 2 2 24 4 431Cm02 2 2 2 2 2 2 2 2 2Au00C00C00C00C00C00 0 0 0 0 0 0 0C0C0C0C0C0 0 0 010N [ A A A A A A A A A ACACACACA.Q O ESN9809192919293D5 5 5 5 6 696IasDI .Q O676 7 8 9 0 197 7 7 7 8 8EN9 9 9 9 9 9Sg)nbit Aevgr)ab)b)b) nb)b) i(sTAdvAvAvAvAb avAvaaetni ni nia(gs(as(ni ni ni uuas( (as sa (s gaujcucucaucauun agc uouauauauau gaauafC)’uuuuuuuuaugh 3uGftgiagagagacgafAfw^ c c c c u’f f f f fGu Aad5e( GfGfGfGfGf fi Accf )AidfAfAfAfAfufagdnUoaaUaUaUaCuAacMgi gyL ug gau uguaaua cslluauauauccgca)bugcgcgcgcuccgAvFa(s) asgscsuscsnib) ) ) ) )(sdnAb b b b b )vAvAvA A A6a n n nvnv v Crt i(i(i(i(ni(ni(H Ses - s)- s)s)s)s)s)N(- n36e 836 -36 -36 -36 -36S1 C8PH1 C8C8C9C9C 01LN(PH1LN(PH1LN(PH2LN(PH2H3LN(PLN(PLDr 8Ieb694607170 1 2324242482989 25Cm000000030030000Au C C C C C C0N A A A A A ACA
[0114] In some embodiments, an ATXN2 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an ATXN2 RNAi agent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, an ATXN2 RNAi agent is prepared or provided as a pharmaceutically acceptable sodium or potassium salt The RNAi agents described herein, upon delivery to a cell expressing an ATXN2 gene, inhibit or knockdown expression of one or more ATXN2 genes in vivo and / or in vitro. Targeting Groups, Linking Groups, Lipid moieties, and Delivery Vehicles
[0115] In some embodiments, an ATXN2 RNAi agent contains or is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, a linking group, a pharmacokinetic / pharmacodynamic (PK / PD) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery, or attachment of the RNAi agent. The non-nucleotide group can be covalently linked to the 3′ and / or 5′ end of either the sense strand and / or the antisense strand. In some embodiments, an ATXN2 RNAi agent contains a non-nucleotide group linked to the 3′ and / or 5′ end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5′ end of an ATXN2 RNAi agent sense strand. A non-nucleotide group can be linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.
[0116] In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.
[0117] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEGlinker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which in some instances can serve as linkers.
[0118] A targeting group, with or without a linker, can be attached to the 5′ or 3′ end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10. A linker, with or without a targeting group, can be attached to the 5′ or 3′ end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10.
[0119] The ATXN2 RNAi agents described herein can be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5′-terminus and / or the 3′-terminus. The reactive group can be used subsequently to attach a targeting moiety using methods typical in the art.
[0120] For example, in some embodiments, the ATXN2 RNAi agents disclosed herein are synthesized having an NH2-C6group at the 5′-terminus of the sense strand of the RNAi agent. The terminal amino group subsequently can be reacted to form a conjugate with, for example, a group that includes a lipid moiety. In some embodiments, the ATXN2 RNAi agents disclosed herein are synthesized having one or more alkyne groups at the 5′-terminus of the sense strand of the RNAi agent.
[0121] In some embodiments, targeting groups are linked to the ATXN2 RNAi agents without the use of an additional linker. In some embodiments, the targeting group is designed having a linker readily present to facilitate the linkage to an ATXN2 RNAi agent. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents can be linked to their respective targeting groups using the same linkers. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers.
[0122] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery vehicle. The linking group can be linked to the 3′ and / or the 5′ end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5′ or 3′ end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5′ end of an RNAi agent sense strand. Examples of linking groups, include but are not limited to: C6-SS-C6, 6-SS-6, reactive groups such a primary amines (e.g., NH2-C6) and alkynes, alkyl groups, abasic residues / nucleotides, amino acids,tri-alkyne functionalized groups, ribitol, and / or PEG groups. Examples of certain linking groups are provided in Table 11.
[0123] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group, pharmacokinetic modulator, or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage can optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description. In some embodiments, an ATXN2 RNAi agent is conjugated to a polyethylene glycol (PEG) moiety, or to a hydrophobic group having 12 or more carbon atoms, such as a cholesterol or palmitoyl group.
[0124] In some embodiments, an ATXN2 RNAi agent is linked to one or more lipid moieties. Lipid moieties may enhance the pharmacodynamic or pharmacokinetic properties of the RNAi agent. In some embodiments, the lipid moiety may be conjugated to a linker at the 3′ or 5′ end of a sense strand or an antisense strand of an RNAi agent described herein. In some embodiments, a lipid moiety may be linked at both the 3′ or 5′ end of either the sense strand or the antisense strand of an RNAi agent described herein.
[0125] In some embodiments, a lipid moiety may be conjugated to an ATXN2 RNAi agent by reacting an ATXN2 RNAi agent comprising an amine-comprising linker, for example, (NH2-C6) (see table 11). In some embodiments, the amine-comprising linker may be located on the 5′ end of the sense strand or the antisense strand of an ATXN2 RNAi agent. In some embodiments, the amine-comprising linker may be located on the 3′ end of the sense strand or the antisense strand of an RNAi agent.
[0126] In some embodiments, an RNAi agent comprising an amine-comprising linker, such as (NH2-C6) or (NH2-C6)s, may be reacted with a lipid comprising an activated ester moiety. Example lipids with activated ester moieties include LP183-p, LP293-p, and LP310-p as shown in Table 11 below.
[0127] In some embodiments, an ATXN2 RNAi agent may be conjugated to a lipid moiety using phosphoramidite synthesis. Synthesizing oligonucleotides using phosphoramidites is well-known in the art. In some embodiments, a lipid moiety may be conjugated to the 5′ endof the sense strand or the antisense strand of an ATXN2 RNAi agent using a phosphoramidite. In some embodiments, a lipid moiety may be conjugated to the 3′ end of the sense strand or the antisense strand of an ATXN2 RNAi agent using a phosphoramidite. In some embodiments, a phosphoramidite selected from HO-C16-p, C16-p, or C22-p, all as shown in Table 11 below, may be used to conjugate a lipid moiety to an ATXN2 RNAi agent.
[0128] In some embodiments, ATXN2 RNAi agents may comprise a lipid moiety on an internal nucleotide (i.e., not on the 3′ or 5′ terminal nucleotides.) In some embodiments, an internal nucleotide may be linked to the 2′ position of ribose. In some embodiments ATXN2 RNAi agents may comprise aC16, uC16, cC16, or gC16 as shown in Table 11 below.
[0129] Any of the ATXN2 RNAi agent nucleotide sequences listed in Tables 2, 3, 4, 5, 6, and 10, whether modified or unmodified, can contain 3′ and / or 5′ targeting group(s), linking group(s), and / or lipid moieties. Any of the ATXN2 RNAi agent sequences listed in Tables 3, 4, 5, 6, and 10, or are otherwise described herein, which contain a 3′ or 5′ targeting group, linking group, and / or lipid moiety can alternatively contain no 3′ or 5′ targeting group, linking group, or lipid moiety, or can contain a different 3′ or 5′ targeting group, linking group, or lipid moiety including, but not limited to, those depicted in Table 11. Any of the ATXN2 RNAi agent duplexes listed in Tables 7, 8, 9A and 10, whether modified or unmodified, can further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 11, and the targeting group or linking group can be attached to the 3′ or 5′ terminus of either the sense strand or the antisense strand of the ATXN2 RNAi agent duplex.
[0130] Examples of certain modified nucleotides, capping moieties, lipid moieties, and linking groups are provided in Table 11. Table 11. Structures Representing Various Modified Nucleotides, Capping Moieties, lipid moieties and Linking Groups (wherein indicates the point of connection)linkage towards 5' end linkage towards 3' end S S O
[0131] Alternatively, other linking groups known in the art may be used. In many instances, linking groups can be commercially acquired or alternatively, are incorporated into commercially available nucleotide phosphoramidites. (See, e.g., International Patent Application Publication No. WO 2019 / 161213, which is incorporated herein by reference in its entirety).
[0132] In some embodiments, an ATXN2 RNAi agent is delivered without being conjugated to a targeting ligand or pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as being “naked” or a “naked RNAi agent”).
[0133] In some embodiments, an ATXN2 RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate delivery of the ATXN2 RNAi agent to the cell or tissue of choice, for example, to a CNS cell in vivo. In some embodiments, an ATXN2 RNAi agent is conjugated to a lipid moiety.
[0134] In some embodiments, a delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.
[0135] In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art for nucleic acid delivery. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesteryl and cholesteryl derivatives), encapsulating in nanoparticles, liposomes, micelles, conjugating to polymers or DPCs (see, for example WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), by iontophoresis, or by incorporation into other delivery vehicles or systems available in the art such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or proteinaceous vectors. In some embodiments the RNAi agents can be conjugated to antibodies having affinity for CNS cells. In some embodiments, the RNAi agents can be linked to targeting ligands that have affinity for CNS cells or receptors present on CNS cells. Pharmaceutical Compositions and Formulations
[0136] The ATXN2 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as “medicaments”). In some embodiments, pharmaceutical compositions include at least one ATXN2 RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of ATXN2 mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering an ATXN2 RNAi agent linked to a targeting ligand or lipid moiety as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) areadded to the pharmaceutical compositions that include an ATXN2 RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.
[0137] The pharmaceutical compositions that include an ATXN2 RNAi agent and methods disclosed herein decrease the level of the target mRNA in a cell, group of cells, group of cells, tissue, organ, or subject, including by administering to the subject a therapeutically effective amount of a herein described ATXN2 RNAi agent, thereby inhibiting the expression of ATXN2 mRNA in the subject. In some embodiments, the subject has been previously identified or diagnosed as having a disease or disorder that can be mediated at least in part by a reduction in ATXN2 expression. In some embodiments, the subject has been previously diagnosed with having one or more neurodegenerative diseases such as SCA2 and ALS. In some embodiments the neurodegenerative disease is SCA2.
[0138] In some embodiments the subject has been previously diagnosed with having neurodegenerative disease.
[0139] Embodiments of the present disclosure include pharmaceutical compositions for delivering an ATXN2 RNAi agent to a CNS cell in vivo. Such pharmaceutical compositions can include, for example, an ATXN2 RNAi agent conjugated to a lipid moiety.
[0140] In some embodiments, the described pharmaceutical compositions including an ATXN2 RNAi agent are used for treating or managing clinical presentations in a subject that would benefit from the inhibition of expression of ATXN2. In some embodiments, a therapeutically or prophylactically effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed ATXN2 RNAi agents can be used to decrease the number, severity, and / or frequency of symptoms of a disease in a subject.
[0141] In some embodiments, the described ATXN2 RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutics. A second therapeutic can be another ATXN2 RNAi agent (e.g., an ATXN2 RNAi agent that targets a different sequence within an ATXN2 gene). In some embodiments, a second therapeutic can be an RNAi agent that targets the ATXN2 gene. An additional therapeutic can also be a small molecule drug, antibody, antibody fragment, and / or aptamer. The ATXN2 RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions.
[0142] The described pharmaceutical compositions that include an ATXN2 RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of ATXN2 mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions that include an ATXN2 RNAi agent thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more ATXN2 RNAi agents, thereby preventing or inhibiting the at least one symptom.
[0143] In some embodiments, one or more of the described ATXN2 RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.
[0144] The route of administration is the path by which an ATXN2 RNAi agent is brought into contact with the body. In general, methods of administering drugs, oligonucleotides, and nucleic acids, for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The ATXN2 RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, in some embodiments, the herein described pharmaceutical compositions are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration. In some embodiments, the pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intracerebroventricularly, intraarticularly, intraocularly, or intraperitoneally, or topically.
[0145] The pharmaceutical compositions including an ATXN2 RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intracerebroventricular, intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via inhalation, intranasal administration, oropharyngeal aspiration administration, or intratrachealadministration. For example, in some embodiments, it is desired that the ATXN2 RNAi agents described herein inhibit the expression of an ATXN2 gene in the CNS.
[0146] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.
[0147] As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., ATXN2 RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients can act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and / or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.
[0148] Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti- foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.
[0149] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by themaintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0150] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0151] Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.
[0152] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No.4,522,811.
[0153] The ATXN2 RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for thedosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
[0154] A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or comprise the herein defined RNAi agents may be used as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce a pharmacological, therapeutic, or preventive result.
[0155] In some embodiments, the methods disclosed herein further comprise the step of administering a second therapeutic or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic is another ATXN2 RNAi agent (e.g., an ATXN2 RNAi agent that targets a different sequence within the ATXN2 target). In other embodiments, the second therapeutic can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.
[0156] In some embodiments, described herein are compositions that include a combination or cocktail of at least two ATXN2 RNAi agents having different sequences. In some embodiments, the two or more ATXN2 RNAi agents are each separately and independently linked to lipids.
[0157] Described herein are compositions for delivery of ATXN2 RNAi agents to central nervous system cells. Furthermore, compositions for delivery of ATXN2 RNAi agents to cells, including neurons, astrocytes, microglia and endothelial cells, in vivo, are generally described herein.
[0158] Generally, an effective amount of an ATXN2 RNAi agent disclosed herein will be in the range of from about 0.0001 to about 20 mg / kg of body weight, e.g., from about 0.001 to about 5 mg / kg of body weight. In some embodiments, an effective amount of an ATXN2 RNAi agent will be in the range of from about 0.01 mg / kg to about 3.0 mg / kg of body weight per dose. In some embodiments, an effective amount of an ATXN2 RNAi agent will be in the range of from about 0.03 mg / kg to about 2.0 mg / kg of body weight per dose. In some embodiments, an effective amount of an ATXN2 RNAi agent will be in the range of fromabout 0.01 to about 1.0 mg / kg of dose per body weight. In some embodiments, an effective amount of an ATXN2 RNAi agent will be in the range of from about 0.50 to about 1.0 mg / kg of dose per body weight. The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can be smaller than the optimum. In some embodiments, a dose is administered daily. In some embodiments, a dose is administered weekly. In further embodiments, a dose is administered bi-weekly, tri-weekly, once monthly, or once quarterly (i.e., once every three months).
[0159] For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an ATXN2 RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, peptide, and / or an aptamer.
[0160] The described ATXN2 RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. Methods of Treatment and Inhibition of ATXN2 Expression
[0161] The ATXN2 RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from a reduction and / or inhibition in expression of ATXN2 mRNA and / or a reduction in ATXN2 protein levels.
[0162] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) having a disease or disorder for which the subject would benefit from reduction in mutant ATXN2 protein, including but not limited to, Spinocerebellar ataxia Type 2 and ALS. Treatment of a subject can include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more ATXN2 RNAi agents described herein. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. Administration of a pharmaceutical composition described herein can be to a human being or animal.
[0163] Mutant ATXN2 activity is known to promote neurodegenerative disorders. In some embodiments, the described ATXN2 RNAi agents are used to treat at least one symptom mediated at least in part by a reduction in mutant ATXN2 levels, in a subject. The subject is administered a therapeutically effective amount of any one or more of the described ATXN2 RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby treating the subject by preventing or inhibiting the at least one symptom.
[0164] In certain embodiments, the present disclosure provides methods for treatment of diseases, disorders, conditions, or pathological states mediated at least in part by ATXN2 gene expression, in a patient in need thereof, wherein the methods include administering to the patient any of the ATXN2 RNAi agents described herein.
[0165] In some embodiments, the ATXN2 RNAi agents are used to treat or manage a clinical presentation or pathological state in a subject, wherein the clinical presentation or pathological state is mediated at least in part by a reduction in ATXN2 expression. The subject is administered a therapeutically effective amount of one or more of the ATXN2 RNAi agents or ATXN2 RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising an ATXN2 RNAi agent described herein to a subject to be treated.
[0166] In a further aspect, the disclosure features methods of treatment (including prophylactic or preventative treatment) of diseases or symptoms that may be addressed by a reduction in mutant ATXN2 levels, the methods comprising administering to a subject in need thereof an ATXN2 RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10. Also described herein are compositions for use in such methods.
[0167] The described ATXN2 RNAi agents and / or compositions that include ATXN2 RNAi agents can be used in methods for therapeutic treatment of disease or conditions caused by enhanced or elevated mutant ATXN2 levels. Such methods include administration of an ATXN2 RNAi agent as described herein to a subject, e.g., a human or animal subject.
[0168] In another aspect, the disclosure provides methods for the treatment (including prophylactic treatment) of a pathological state (such as a condition or disease) mediated at least in part by ATXN2 expression, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10.
[0169] In some embodiments, methods for inhibiting expression of an ATXN2 gene are disclosed herein, wherein the methods include administering to a cell an RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2, Table 3, or Table 10.
[0170] In some embodiments, methods for the treatment (including prophylactic treatment) of a pathological state mediated at least in part by ATXN2 expression are disclosed herein, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.
[0171] In some embodiments, methods for inhibiting expression of an ATXN2 gene are disclosed herein, wherein the methods comprise administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.
[0172] In some embodiments, methods for the treatment (including prophylactic treatment) of a pathological state mediated at least in part by ATXN2 expression are disclosed herein, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising the sequence of any of the sequences in Table 3 or Table 10.
[0173] In some embodiments, methods for inhibiting expression of an ATXN2 gene are disclosed herein, wherein the methods include administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising the sequence of any of the sequences in Table 3 or Table 10.
[0174] In some embodiments, methods of inhibiting expression of an ATXN2 gene are disclosed herein, wherein the methods include administering to a subject an ATXN2 RNAi agent that includes a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4, Table 5, Table 6, or Table 10, and the antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3 or Table 10. In other embodiments, disclosed herein are methods of inhibiting expression of an ATXN2 gene, wherein the methods include administering to a subject an ATXN2 RNAi agent that includes a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, Table5, Table 6, or Table 10, and the antisense strand consisting of the modified sequence of any of the modified sequences in Table 3 or Table 10.
[0175] In some embodiments, methods for inhibiting expression of an ATXN2 gene in a cell are disclosed herein, wherein the methods include administering one or more ATXN2 RNAi agents comprising a duplex structure of one of the duplexes set forth in Tables 7, 8, 9A, and 10.
[0176] In some embodiments, the gene expression level and / or mRNA level of an ATXN2 gene in certain CNS cells of subject to whom a described ATXN2 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the ATXN2 RNAi agent or to a subject not receiving the ATXN2 RNAi agent. In some embodiments, ATXN2 mRNA or ATXN2 protein levels in certain CNS cells of a subject to whom a described ATXN2 RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the ATXN2 RNAi agent or to a subject not receiving the ATXN2 RNAi agent. The gene expression level, protein level, and / or mRNA level in the subject may be reduced in a cell, group of cells, and / or tissue of the subject. In some embodiments, the ATXN2 mRNA levels in certain CNS cells subject to whom a described ATXN2 RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the ATXN2 RNAi agent or to a subject not receiving the ATXN2 RNAi agent.
[0177] A reduction in gene expression, mRNA, and protein levels can be assessed by any methods known in the art. Reduction or decrease in ATXN2 mRNA and / or ATXN2 protein levels are collectively referred to herein as a decrease in, reduction of, or inhibition of ATXN2 expression. The Examples set forth herein illustrate known methods for assessing inhibition of ATXN2 expression and ATXN2 gene expression. Cells, Tissues, Organs, and Non-Human Organisms
[0178] Cells, tissues, organs, and non-human organisms that include at least one of the ATXN2 RNAi agents described herein are contemplated. The cell, tissue, organ, or non-human organism is made by delivering the RNAi agent to the cell, tissue, organ, or non- human organism. Additional Illustrative Embodiments
[0179] Provided here are certain additional illustrative embodiments of the disclosed technology. These embodiments are illustrative only and do not limit the scope of the present disclosure or of the claims attached hereto.
[0180] Embodiment 1. An RNAi agent for inhibiting expression of a Ataxin-2 (ATXN2) gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.
[0181] Embodiment 2. The RNAi agent of embodiment 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3.
[0182] Embodiment 3. The RNAi agent of embodiment 1 or embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.
[0183] Embodiment 4. The RNAi agent of any one of embodiments 1-3, wherein at least one nucleotide of the ATXN2 RNAi agent is a modified nucleotide or includes a modified internucleoside linkage.
[0184] Embodiment 5. The RNAi agent of any one of embodiments 1-4, wherein all or substantially all of the nucleotides are modified nucleotides.
[0185] Embodiment 6. The RNAi agent of any one of embodiments 4-5, wherein the modified nucleotide is selected from the group consisting of: 2′-O-methyl nucleotide, 2′- fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2'-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino- modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3′-O-methyl nucleotide.
[0186] Embodiment 7. The RNAi agent of embodiment 5, wherein all or substantially all of the nucleotides are modified with 2′-O-methyl nucleotides, 2′-fluoro nucleotides, or combinations thereof.
[0187] Embodiment 8. The RNAi agent of any one of embodiments 1-7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3.
[0188] Embodiment 9. The RNAi agent of any one of embodiments 1-8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.
[0189] Embodiment 10. The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3 and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.
[0190] Embodiment 11. The RNAi agent of any one of embodiments 1-10, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.
[0191] Embodiment 12. The RNAi agent of embodiment 11, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.
[0192] Embodiment 13. The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.
[0193] Embodiment 14. The RNAi agent of embodiment 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.
[0194] Embodiment 15. The RNAi agent of embodiment 14, wherein the RNAi agent has two blunt ends.
[0195] Embodiment 16. The RNAi agent of any one of embodiments 1-15, wherein the sense strand comprises one or two terminal caps.
[0196] Embodiment 17. The RNAi agent of any one of embodiments 1-16, wherein the sense strand comprises one or two inverted abasic residues.
[0197] Embodiment 18. The RNAi agent of embodiment 1, wherein the RNAi agent comprises a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7, Table 8, Table 9A, or Table 10.
[0198] Embodiment 19. The RNAi agent of embodiment 18, wherein all or substantially all of the nucleotides are modified nucleotides.
[0199] Embodiment 20. The RNAi agent of embodiment 19, wherein all or substantially all of the nucleotides are modified nucleotides.
[0200] Embodiment 21. The RNAi agent of any one of embodiments 19-20, wherein the sense strand further includes inverted abasic residues at the 3’ terminal end of the nucleotide sequence, at the 5’ end of the nucleotide sequence, or at both.
[0201] Embodiment 22. The RNAi agent of any one of embodiments 1-21, wherein the RNAi agent is linked to a lipid moiety.
[0202] Embodiment 23. The RNAi agent of embodiment 22, wherein the lipid moiety is selected from the group consisting of: O
[0203] Embodiment 24. The RNAi agent of embodiment 22 or embodiment 23, wherein the lipid moiety is conjugated to the sense strand.
[0204] Embodiment 25. The RNAi agent of embodiment 24, wherein the lipid moiety is conjugated to the 5’ terminal end of the sense strand.
[0205] Embodiment 26. A composition comprising the RNAi agent of any one of embodiments 1-25, wherein the composition further comprises a pharmaceutically acceptable excipient.
[0206] Embodiment 27. The composition of embodiment 26, further comprising a second RNAi agent capable of inhibiting the expression of Ataxin-2 gene expression.
[0207] Embodiment 28. The composition of any one of embodiments 26-27, further comprising one or more additional therapeutics.
[0208] Embodiment 29. The composition of any of embodiments 26-28, wherein the RNAi agent is a sodium salt.
[0209] Embodiment 30. The composition of any of embodiments 26-29, wherein the pharmaceutically acceptable excipient is water for injection.
[0210] Embodiment 31. The composition of any of embodiments 26-29, wherein the pharmaceutically acceptable excipient is a buffered saline solution.
[0211] Embodiment 32. A method for inhibiting expression of an ATXN2 gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of any one of embodiments 1-25 or the composition of any one of embodiments 26-31.
[0212] Embodiment 33. The method of embodiment 32, wherein the cell is within a subject.
[0213] Embodiment 34. The method of embodiment 33, wherein the subject is a human subject.
[0214] Embodiment 35. The method of any one of embodiments 32-34, wherein following the administration of the RNAi agent the Ataxin-2 (ATXN2) gene expression is inhibited by at least about 30%.
[0215] Embodiment 36. A method of treating one or more symptoms or diseases associated with enhanced or elevated membrane ATXN2 activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of embodiments 26-31.
[0216] Embodiment 37. The method of embodiment 36, wherein the disease is a neurodegenerative disease.
[0217] Embodiment 38. The method of embodiment 37, wherein the neurodegenerative disease is spinocerebellar ataxia type 2 (SCA2).
[0218] Embodiment 39. The method of embodiment 37, wherein the disease is ALS.
[0219] Embodiment 40. The method of any one of embodiments 32-39, wherein the RNAi agent is administered at a dose of about 0.01 mg / kg to about 5.0 mg / kg of body weight of the subject.
[0220] Embodiment 41. The method of any one of embodiments 32-40, wherein the RNAi agent is administered at a dose of about 0.03 mg / kg to about 2.0 mg / kg of body weight of the subject.
[0221] Embodiment 42. The method of any of embodiments 32-41, wherein the RNAi agent is administered in two or more doses.
[0222] Embodiment 43. Use of the RNAi agent of any one of embodiments 1-25, for the treatment of a disease, disorder, or symptom that is mediated at least in part by mutant ATXN2 activity and / or ATXN2 gene expression.
[0223] Embodiment 44. Use of the composition according to any one of embodiments 26- 31, for the treatment of a disease, disorder, or symptom that is mediated at least in part by Ataxin-2 (ATXN2) activity and / or Ataxin-2 (ATXN2) gene expression.
[0224] Embodiment 45. Use of the composition according to any one of embodiments 26- 31, for the manufacture of a medicament for treatment of a disease, disorder, or symptom that is mediated at least in part by Ataxin-2 (ATXN2) and / or Ataxin-2 (ATXN2) gene expression.
[0225] Embodiment 46. The use of any one of embodiments 43-45, wherein the disease is a neurodegenerative disease.
[0226] Embodiment 47. A method of making an RNAi agent of any one of embodiments 1- 25, comprising annealing a sense strand and an antisense strand to form a double- stranded ribonucleic acid molecule.
[0227] Embodiment 48. The method of embodiment 47, wherein the sense strand comprises a lipid moiety.
[0228] Embodiment 49. The method of embodiment 48, comprising conjugating a lipid moiety to the sense strand.EXAMPLES Example 1. Synthesis of ATXN2 RNAi Agents.
[0230] ATXN2 RNAi agent duplexes disclosed herein were synthesized in accordance with the following:
[0231] A. Synthesis. The sense and antisense strands of the ATXN2 RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 Å or 600Å, obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2′-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2′-O-methyl phosphoramidites that were used included the following: (5′- O-dimethoxytrityl-N6-(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidite, 5′-O-dimethoxy-trityl-N4-(acetyl)-2′-O-methyl-cytidine- 3′-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5′-O-dimethoxytrityl-N2- (isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5′-O-dimethoxytrityl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidite. The 2′-deoxy-2′-fluoro-phosphoramidites carried the same protecting groups as the 2′-O-methyl RNA amidites. 5′-dimethoxytrityl-2′-O-methyl- inosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia). The inverted abasic (3′-O-dimethoxytrityl-2′-deoxyribose-5′-O-(2- cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5′-(4,4'- Dimethoxytrityl)-N6-(benzoyl)-2′,3′-seco-adenosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite, 5′-(4,4'-Dimethoxytrityl)-N-acetyl-2′,3′-seco-cytosine, 2′- benzoyl-3′-[(2-cyanoethyl)-(N,N-diiso-propyl)]-phosphoramidite, 5′-(4,4'-Dimethoxytrityl)- N-isobutyryl-2′,3′-seco-guanosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite, and 5′-(4,4'-Dimethoxy-trityl)-2′,3′-seco-uridine, 2′-benzoyl-3′-[(2- cyanoethyl)-(N,N- diiso-propyl)]-phosphoramidite. TFA aminolink phosphoramidites were also commercially purchased (ThermoFisher). Linker L6 was purchased as propargyl- PEG5-NHS from BroadPharm (catalog # BP-20907) and coupled to the NH2-C6group from an aminolink phosphoramidite to form -L6-C6-, using standard coupling conditions. The linker Alk-cyHex was similarly commercially purchased from Lumiprobe (alkynephosphoramidite, 5’-terminal) as a propargyl-containing compound phosphoramidite compound to form the linker -Alk-cyHex-. In each case, phosphorothioate linkages were introduced as specified using the conditions set forth herein. The cyclopropyl phosphonate phosphoramidites were synthesized in accordance with International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et. al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)).
[0232] Tri-alkyne-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3Å) were added.5-Benzylthio-1H- tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2′ O-Me), and 60 seconds (2′ F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was employed.
[0233] Alternatively, tri-alkyne moieties were introduced post-synthetically (see section E, below). For this route, the sense strand was functionalized with a 5′ and / or 3′ terminal nucleotide containing a primary amine. TFA aminolink phosphoramidite was dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3Å) were added.5-Benzylthio-1H- tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2′ O-Me), and 60 seconds (2′ F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was employed.
[0234] B. Cleavage and deprotection of support bound oligomer. After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% to 31% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30°C. The solution was evaporated and the solid residue was reconstituted in water (see below).
[0235] C. Purification. Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ-5PW 13µm column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE HealthcareXK 16 / 40 column packed with Sephadex G-25 fine with a running buffer of 100mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into an appropriate buffer or solvent system via tangential flow filtration.
[0236] D. Annealing. Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1× PBS (Phosphate-Buffered Saline, 1×, Corning, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at −15 to −25°C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1× PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor (0.050 mg / (mL∙cm)) and the dilution factor to determine the duplex concentration.
[0237] E. Synthesis of Lipids
[0238] If lipids described herein are not included in Example 1E, it is to be assumed that the compounds are commercially available.
[0239] Synthesis of LP183 phosphoramiditeby compound 1 (4.931 g) dropwise at room temperature. Then the mixture was stirred at room temperature for 2h. The mixture was then filtered. The white solid was dried overnight. Product is as white solid, yield, 4.267g, 74%. LC-MS: calculated [M+H] 356.35, found 356.63.
[0241] To a mixture of compound 1 (2.54 g) in 120 mL DCM was added compound 3 (0.61 g) followed by compound 2 (5.37 g) dropwise at room temperature. Then the mixture was stirred at room temperature overnight.5 mL TEA was added followed by Celite. After removing solvent in vacuo, the residue was loaded on a 40g column by dry method. Hexanes (2% TEA) to 50% EtOAc (2% TEA) in Hexanes (2% TEA) as gradient was used to purify the product. Product is a white waxy solid, yield 3.462 g, 87%. LC-MS: calculated [M+H] 556.46, found 556.64.
[0242] Synthesis of LP293-p F F COMU O NEt3OH rt h mg) inDMF was added compound 2 (48.9 mg) under ambient conditions. The reaction was stirred until full conversion was observed by LC-MS. Conversion was not able to be clearly observed by LC-MS, and instead, reaction was allowed to stir for 30 min. until bright yellow color (before the addition of compound 2) transitioned to a honey orange color and all material was observed to be mainly dissolved. The reaction mixture was then washed with water, extracted with DCM, dried over Na2SO4, filtered, and concentrated under vacuum. The residue was purified by CombiFlash® via DCM liquid-load onto a 12-g column with a gradient hexanes to 100% EtOAc in which product eluted at 30% B. The product was concentrated under vacuum to provide a white solid residue and confirmed by 1H NMR in CDCl3.
[0244] Synthesis of LP-310p
[0245] To the solution of 1 in DCM was added DIPEA (0.057 mL), COMU (0.077 g) and 2 (0.0300 g) at room temperature. After stirring at room temperature for 2h, the reaction was quenched with 0.1N HCl. The organic layer was washed with brine. After removing the solvent, the residue was loaded on a 4g column. Hexanes to 50% Hexanes in EtOAc as gradient was used to purify. Product was a white solid, 46mg, 44%. LC-MS: calculated [M+H] 422.36, found 422.61. O O 4N H COMU, DIPEA N Cl / Dioxanetemperature overnight. After removing the solvent in vacuo, the residue was placed under high vacuum for 3h. Then the residue was dissolved in DCM at room temperature, then COMU (0.0700 g), DIPEA (0.038 mL) and 2 (0.036 g) were added at room temperature. After stirring at room temperature for 2h, the solvent was removed in vacuo. The residue was loaded on a 4g column. Hexanes to 50% Hexanes in EtOAc as gradient was used to purify. Product was a white solid, 21mg, 38%. LC-MS: calculated [M+H] 514.29, found 514.61.
[0247] Synthesis of HO-C16 phosphoramiditemL THF.4,4‘-Dimethoxytrityl chloride (2.2 g, 6.6 mmol) was added slowly as a solid. After 2 h, the reaction was concentrated by rotary evaporation, and the product was purified by column chromatography (25% ethyl acetate / 75% hexane).
[0249] DMT-O-C16-OH (0.200 g), Bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.227 mL) and BisDiisopropylammonium tetrazolide (0.0611 g) were dissolved in anhydrous DCM at room temperature. The reaction was capped and stirred overnight. Conversion was determined via LC-MS (0.25M NH4 HCO3:H2O buffer system). Celite® was added to the reaction mixture and it was concentrated under vacuum until a white powder remained. The mixture was loaded dry onto a silica column (12 gram) using a EtOAc / Hexanes (1%Triethylamine) solvent system to prevent hydrolysis from the silica gel.[1]The product was characterized by31PNMR,1HNMR, and LC-MS.
[0250] Synthesis of C16 phosporamidite
[0251] (2.88 mL)and BisDiisopropylammonium tetrazolide (0.778 g) were dissolved in a solution of DCM at room temperature. The reaction was capped and stirred overnight. Conversion was determined via LC-MS (0.25M NH4 HCO3:H2O buffer system). Celite® was added to the reaction mixture and it was concentrated under vacuum until a white powder remained. The mixture was loaded dry onto a silica column (12 gram) using a s EtOAc / Hexanes (1% Triethylamine) solvent system to prevent hydrolysis from the silica gel. The desired product was not retained on the column and came out shortly after being loaded. The isolated product was then charaterized by LC-MS,1HNMR and31PNMR. Final yield: 856.5 mg (93.8%).
[0252] Synthesis of C22 phosporamidite
[0253] Docosanol (1.10 g), Bis(diisopropylamino)(2-cyanoethoxy)phosphine (2.1 mL) and BisDiisopropylammonium tetrazolide (0.577 g) were dissolved in a solution of DCM at room temperature. The reaction was capped and stirred overnight. Conversion was determined via LC-MS (0.25M NH4HCO3:H2O buffer system). Celite® was added to the reaction mixture and it was concentrated under vacuum until a white powder remained. The mixture was loaded dry onto a silica column (12 gram) pretreated with 3 mL of triethylamine using a EtOAc / Hexanes (1% Triethylamine) solvent system to prevent hydrolysis from the silica gel. The isolated product was then charaterized by LC-MS,1HNMR and31PNMR. Final yield: 2.1085 g (118.8%).
[0254] Synthesis of phosphoramidite for aC16 internal nucleotidewas added in 2 portions (15 min apart) into a cold solution of adenosine 1 (12.5 g, 46.77 mmol) in anhydrous DMF (250 mL). The cooling bath was removed, the reaction mixture wasstirred for 1.5h at RT and 1-bromohexadecane (18 g, 59 mmol) was added. Following 16 h of stirring at RT ethanol (5 mL) was added, stirred for 15 min, DMF was removed on a rotavapor, and toluene was evaporated twice to get rid of residual DMF. The product was isolated on CombiFlash following solid load with 40g of silica gel using 220g SiO2column. Eluent: DCM (A) - 20% MeOH in DCM (B), B= 0 – 20%, 15 min, then 20% for 5 min. Product was dried in vacuo ON. Yield 2.726 g. Calculated: MW 491.68. Found: MS (ES, positive): 492.46 [M+H]+.
[0256] Compound 3: A solution of compound 2 (2.7 g, 5.49 mmol) in anhydrous pyridine (40 mL) was cooled on an ice bath and TMS-Cl (2.25 mL, 17.73 mmol) was added. The reaction mixture was stirred for 30 min on ice bath, benzoyl chloride (1.5 mL, 12.9 mmol) was added, the cooling bath was removed in 30 min, stirring was continued overnight. In 16 h the reaction mixture was cooled on ice bath, water (7.5 mL) was added, stirred for additional 30 min. Concentrated NH4OH (7.5 mL) was added and all volatiles were removed on a rotavapor. To get rid of side bis-acylated adduct, the crude material was dissolved in MeOH (125 mL) and treated with NH4OH (13 mL) for 25 min. The solvent was removed on a rotavapor and toluene was evaporated once. CombiFlash® purification was performed using solid load with silica gel (18 g) on 80 g column using eluent: DCM – 20% MeOH in DCM, 0 - 20%, 50 min. Yield 2.66g. Calculated: MW 595.79 Found: MS (ES, positive): 596.53 [M+H]+.
[0257] Compound 4: Compound 3 (1.55g, 2.60 mmol) was dried by successive evaporations of toluene and anhydrous pyridine using dry rotavapor. It was dissolved in anhydrous pyridine (10 mL), and DMAP (12 mg, 0.1 mmol) was added followed by dimethoxytrityl chloride (965 mg, 2.9 mmol). The reaction was stirred for 16 h at RT. All volatiles were removed on a rotavapor, the residual pyridine was removed by evaporation of toluene. The residue was partitioned between DCM and aqueous NaHCO3. The organic phase was separated, the aqueous was extracted with DCM, combined organic phases were dried (Na2SO4) and concentrated. The product was isolated on CombiFlash® using 40 g column, eluent: hexane (A) – ethyl acetate (B) + 1% of Et3N, B= 20-60%, 40 min. Yield 1.845 g. Calculated: MW 898.16. Found: MS (ES, positive): 899.65 [M+H]+.
[0258] Compound 5: Compound 4 (1.845 g, 2.052 mmol) was dried by 2 evaporations of toluene. It was dissolved in anhydrous DCM (30 mL), diisopropylammonium tetrazolide (176 mg, 1.03 mmol) and dry molecular sieves (100 mg) were added and stirred for 30 min. 2-Cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (804 mg, 2.67 mmol) was addedand stirring was continued for 16 h. The reaction mixture was diluted 3 times with anhydrous DCM, filtered, and stirred with 150 mL of cold NaHCO3solution for 5 min. Organic phase was separated, aqueous was extracted with DCM, combined organic phases were washed with NaHCO3, and dried (Na2SO4). The product was isolated on CombiFlash® using 40 g column, eluent: hexane (A) – ethyl acetate (B) + 1% of Et3N, B= 15-60%, 30 min. Yield 1.386 g. Calculated: MW 1098.38. Found: MS (ES, positive): 1099.17 [M+H]+.
[0259] Synthesis of phosphoramidite for gC16 internal nucleotide
[0260] Compound 2: A solution of N2-Isobutyrylguanosine 1 (5g, 14.15 mmol) in anhydrous DMF (120 mL) was added into a cold flask with sodium hydride (60% dispersion in mineral oil, 1.3g, 32.55 mmol). The cooling bath was removed, the reaction mixture was stirred for 3h at RT and 1-bromohexadecane (5.61 g, 18.4 mmol) was added.The reaction mixture was stirred at 50°C for 72 h and EtOH (2 mL) was added. DMF was removed on a rotavapor, and toluene was evaporated twice to get rid of residual DMF. The product was isolated on CombiFlash® following solid load with 30g of silica gel using 120g column. System for separation: A= DCM : EtOAc (1:1); B = DCM:EtOAc:MeOH (9:9:2). B=0 – 100%, 50 min. Kept fraction B = 32-70%. Yield 2.45 g.Calculated: MW 577.77. Found: MS (ES, positive): 579.39 [M+H]+.
[0261] Compound 3: Compound 2 (2.129 g, 3.69 mmol) was dried by 2 evaporations of toluene followed by one evaporation of anhydrous pyridine. It was dissolved in anhydrous pyridine (40 mL), dimethoxytrityl chloride (1.375 g, 4.06 mmol) and DMAP (18 mg, 0.148 mmol) were added and stirred overnight. All volatiles were removed on a rotavapor followed by 2 evaporations of toluene. The residue was taken in DCM (150 mL) and stirred with NaHCO3(50 mL) for 3 min. The organic phase was separated, the aqueous phase was extracted with DCM, combined organic phases were washed with NaHCO3, and dried (Na2SO4). The product was isolated on CombiFlash® using 40 g column, eluent: hexane (A) – ethyl acetate (B) + 1% of Et3N, B= 20-90%, 40 min. Kept fraction B= 58-70%. Yield 1.606 g. Calculated: MW 880.14. Found: MS (ES, positive): 881.34 [M+H]+.
[0262] Compound 4: Compound 3 (1.4 g, 1.59 mmol) was dried by 2 evaporations of toluene. It was dissolved in anhydrous DCM (30 mL), diisopropylammonium tetrazolide (136 mg, 0.8 mmol) and dry molecular sieves (100 mg) were added and stirred for 30 min. 2-Cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (767 mg, 2.54 mmol) was added and stirring was continued for 16 h. Et3N (0.3 mL) was added followed by silica gel (6g). The mixture was concentrated in vacuo and solid loaded on CombiFlash®. Product was isolated using 40 g column, eluent: hexane(A) – ethyl acetate(B) + 1% of Et3N, B= 20-90%, 35 min. Yield 836 mg. Calculated: MW 1080.36. Found: MS (ES, positive): 1081.38 [M+H]+.
[0263] Synthesis of phosphoramidite for uC16 internal nucleotidemmol) were suspended in anhydrous pyridine (120 mL) and treated with tert- butyl(chloro)diphenylsilane (25.6 g, 93.14 mmol). The reaction mixture was stirred at RT for 48 h. Pyridine was removed on a rotavapor, The residual pyridine was co-evaporated with toluene. The residue was dissolved in ethyl acetate (200 mL), washed with 10% H3PO4 (75 mL), 5% NaCl, and brine, then dried with Na2SO4. Compound 2 was isolated following CombiFlash® purification using two 120 g SiO2 columns, eluent DCM (A) - 20% MeOH (B) in DCM, B= 0-60%. Yield 14 g. Calculated: MW 464.59. Found: MS (ES, positive): 465.71 [M+H]+.
[0265] Compound 3: Hexadecanol (49.6 g, 204.4 mmol) was dried in vacuo overnight. It was dissolved in dry diglyme (38 mL) with heating and cooled to RT. AlMe3 (2M solution in heptane, 31.25 mL, 62.5 mmol) was slowly added under flow of N2and the reaction mixture was heated at 110°C until methane evolution ceased (30 min). It was cooled to RT, and dry uridine derivative 2 (13.2 g, 28.39 mmol) was added as a solid, dry diglyme was added (30 mL). The reaction was heated at 140°C for 18 h. It was partitioned between 10%H3PO4 (300 mL) and EtOAc (200 mL). The aqueous layer was extracted with EtOAc; combined organic phases were washed twice with 5% NaCl, brine, and dried with Na2SO4. Following filtration and concentration the crude solid was dried by evaporation of toluene and kept in vacuo overnight. Crude product 3 (115.8 g) was directly used in the following step.
[0266] Compound 4: Crude compound 3 was dissolved in THF (130 mL), triethylamine trishydrofluoride (18 mL, 114 mmol) was added, and the reaction mixture was stirred for 3 days. The product was partitioned between EtOAc (300 mL) and 5% aqueous NaCl (250 mL). Organic phase was separated, the aqueous phase was extracted with EtOAc, combined organic phases were washed with brine, dried (Na2SO4), and concentrated to dryness. Product 4 was isolated following CombiFlash® purification on two 220 g SiO2 columns applying solid load with 60 g of silica gel. Eluent: DCM (A), 10% MeOH in DCM (B), B= 0-60% in 60 min. Product was dried by 2 evaporations of toluene. Yield 5.63 g. Calculated: MW 468.64. Found: MS (ES, positive): 469.52 [M+H]+; 491.52 [M+Na]+.
[0267] Compound 5: Compound 4 (5.63 g, 12 mmol), 4,4’-dimethoxytrytyl chloride (5.2 g, 15.36 mmol), and DMAP (293 mg, 2.4 mmol) were dissolved in anhydrous pyridine (40 mL), Et3N (2.17 mL, 15.36 mmol) was added and stirred for 16 h. The reaction was quenched with MeOH (0.6 mL), stirred for 15 min, pyridine was removed in vacuo, the residue was partitioned between EtOAc (230 mL) and 5% aqueous NaCl (230 mL). The organic phase was separated, aqueous phase was extracted with EtOAc, combined organic phases were washed with brine and dried over Na2SO4. CombiFlash® purification using 120g SiO2 column, eluent: Hexane(A) -EtOAc (B), B= 10-50% 60 min. Yield 8.271 g. Calculated: MW 771.01. Found: MS (ES, positive): 772.35 [M+H]+.
[0268] Compound 6: Compound 5 (2.33 g, 3.024 mmol) was dried by 2 evaporations of anhydrous ACN and placed in high vacuo for 2h. The dry compound 5 was dissolved in anhydrous DCM (40 mL) and stirred with diisopropylammonium tetrazolide (704 mg, 4.11 mmol) and molecular sieves for 20 min.2-Cyanoethyl N,N,N',N'- tetraisopropylphosphorodiamidite (1.404 g, 4.66 mmol) was added, the reaction mixture was stirred for 16 h at RT, diluted to 100 ml with anhydrous DCM, the solid was filtered, and shaken with cold NaHCO3 (100 mL) for 5 min. The organic layer was separated, washed with NaHCO3, dried (Na2SO4) and product was purified on CombiFlash® using 40 g SiO2 column. Eluent: hexane (A) – EtOAc (B) with 1% Et3N, B= 15-50%. Yield 2g. Calculated: MW 971.23. Found: MS (ES, positive): 972.17 [M+H]+.
[0269] Synthesis of phosphoramidite for cC16 internal nucleotideof cC16 (11.687g, 15.15 mmol) was dissolved in anhydrous pyridine (100 mL) and cooled on ice bath. TMS-Cl (7.8 mL, 61 mmol) was added, the cooling bath was removed, reaction was stirred for 30 min at RT and cooled on an ice bath again.
[0271] In a separate flask 1,2,4-triazole (35 g, 50.7 mmol) was suspended in anhydrous CAN (200 mL), cooled on ice bath, POCl3(11.2 mL, 120 mmol) was slowly added over 10 min, and stirred for 5 min at 0°C. Et3N (84 mL, 595 mmol) was added slowly over 30 min and stirred at 0°C for 30 min.
[0272] The cooled content with silylated Uracil derivative from the fist flask was quickly added in one portion to the mixture with 1,2,4-triazole, stirred for 10min and cooling bath was removed. The stirring was continued for 5h at RT. The reaction mixture was concentrated to 1 / 3 of its volume on a rotavapor, diluted with EtOAc (600 mL), and washedwith 5% NaCl (2 x 400 mL). An aqueous phase was back-extracted with EtOAc (200 mL). Combined EtOAc layers were washed with brine and dried (Na2SO4). The EtOAc solution was filtered and concentrated and dried in vacuo to obtain crude derivative 2 (17.46 g).
[0273] Compound 3: Crude compound 4 was dissolved in dry dioxane (220 mL) in thick wall 1L RB flask, concentrated ammonium hydroxide solution (50 mL) was added, the flask was sealed with rubber septa, and the reaction mixture was stirred for 40 h at RT. All volatiles were removed on a rotavapor. Toluene was evaporated twice to dry the residue. Product was isolated on a CombiFlash following solid load with 35g of silica gel using 220g SiO2 column. Eluent: DCM (A) - 10%MeOH in DCM (B), B= 0 – 45%, 60 min. Yield 7.81. Calculated: MW 770.02. Found: MS (ES, positive): 770.31 [M+H]+, 1541.24 [2M+H]+.
[0274] Compound 4: Compound 3 (6.94 g, 9 mmol) was dried by evaporation of anhydrous DMF and was dissolved in anhydrous DMF (60 mL). Acetic anhydride (1.75 mL, 18 mmol) was added and stirred at RT for 16 h. NaHCO3 solution (250 mL) was added and product was extracted with DCM (2 x 200 mL). It was washed with brine (50 mL), dried (Na2SO4), concentrated and dried by 2 successive evaporations of toluene. CombiFlash® purification was performed using 120 g SiO2 column, eluent: DCM (A), 5%MeOH in DCM (B), B= 0- 40% 60 min. Yield 6.55 g. Calculated: MW 812.06. Found: MS (ES, positive): 813.36 [M+H]+.
[0275] Compound 5: Compound 4 (6.55 g, 8.07 mmol) was dried by 2 evaporations of toluene. It was dissolved in anhydrous DCM (166 mL) and stirred with diisopropylammonium tetrazolide (2.188 g, 12.78 mmol) and molecular sieves (500 mg) for 20 min.2-Cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (4.376 g, 14.52 mmol) was added, the reaction mixture was stirred for 16 h at RT, diluted to 300 ml with anhydrous DCM, the solid was filtered, and shaken with cold NaHCO3 (150 mL) for 5 min. Organic layer was separated, washed with NaHCO3, dried (Na2SO4) and product was purified on CombiFlash® using 120 g SiO2 column. Eluent: hexane (A) – EtOAc (B), B= 10-50%, 60 min. Yield 6.29 g. Calculated: MW 1012.28. Found: MS (ES, positive): 1013.89 [M+H]+. Example 2. In Vivo Knockdown of ATXN2 in Mice
[0276] On Study day 1, C57bl / 6 mice were subcutaneously injected with either saline or 3 mg / kg (mpk) of compound formulated in saline, with an injection volume of 200 μL / 20 g of animal weight, according to Table 12 below:Table 12: Dosing groups for the mice of Example 2. Group ID Animals dosed Group 1 (Saline) n=4
[0277] Four (n= ) mce were ose n eac group. ce were njec e su cutaneously on day 1. On day 8, mice were euthanized and the 50 mg of liver from each animal was collected. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 13 below:Table 13. Relative expression of ATXN2 mRNA in liver analyzed by qPCR for each of the dosing groups of Example 2. Group Average (n=4) r ) 4931858815669
[0278] As sown n a e , every os ng group s owe an mprovement in knockdown over the saline-administered group. AD10271 showed the greatest knockdown (~76% reduction of ATXN2) in the liver. Example 3. In Vivo Knockdown of ATXN2 in Mice
[0279] On Study day 1, C57bl / 6 mice were intracerebroventricularly injected with either aCSF (artificial cerebrospinal fluid), 50 μg of compound formulated in aCSF, or 200 μg of compound formulated in aCSF, with an injection volume of 10 μL, according to Table 14 below: Table 14: Dosing groups for the mice of Example 3. Group ID Animals dosed AC Duplex Number G 1 CSF 3 N / AGroup 8 (50 μg LP183-AD10520) n=4 AC002091 Group 9 (200 μg LP183-AD10520) n=4 AC002091ice were dosed. Mice were injected intracerebroventricularly on day 1. On day 12, mice were euthanized and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord and cerebellum. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 15 below: Table 15. Relative expression of ATXN2 mRNA in thoracic spinal cord and cerebellum analyzed by qPCR for each of the dosing groups of Example 3. Thoracic Spinal Cord Cerebellum Gr A rGroup Averager h) 38 098232379057415893601428
[0281] As shown in Table 15, most dosing groups showed a dose-dependent improvement in knockdown over the aCSF-administered group in both tissues. AC002089 showed the greatest knockdown at both the 50 μg (~35% reduction of ATXN2) and 200 μg (~66%reduction of ATXN2) dose levels in the thoracic spinal cord. AC002089 also showed the greatest reduction of ATXN2 at both dose levels in the cerebellum. Example 4. In Vivo Knockdown of ATXN2 in Mice
[0282] On Study day 1, C57bl / 6 mice were intracerebroventricularly injected with either aCSF (artificial cerebrospinal fluid), 100 μg of compound formulated in aCSF, with an injection volume of 10 μL, according to Table 16 below: Table 16: Dosing groups for the mice of Example 4. Group ID Animals dosed AC Duplex Number Group 1 (aCSF) n=4 N / A
[0283] Four (n=4) mice were dosed in each group. Mice were injected intracerebroventricularly on day 1. On day 8, mice were euthanized and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex and cerebellum. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 17 below: Table 17. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, and cortex analyzed by qPCR for each of the dosing groups of Example 4. Thoracic Spinal Cord CerebellumGroup Average (n=4)Group Average (n=4)Error Error Rel. Error Error h) 1283527019191928A060345525375
[0284] As shown in Table 17, all dosing groups showed an improvement in knockdown over the aCSF-administered group in all tissues. Except for AC02091, the RNAi agent dosed in all groups targeted position 499 of ATXN2. All groups showed impressive knockdown, withAC002463 demonstrating the greatest reduction of ATXN2 in Thoracic Spinal cord and cerebellum. Example 5. In Vivo Knockdown of ATXN2 in Mice
[0285] On Study day 1, C57bl / 6 mice were intracerebroventricularly injected with either aCSF (artificial cerebrospinal fluid), 100 μg of compound formulated in aCSF, with an injection volume of 10 μL, according to Table 18 below: Table 18: Dosing groups for the mice of Example 5. Group ID Animals dosed AC Duplex Number Group 1 (aCSF) n=4 N / A
[0286] Four (n=4) mice were dosed in each group. Mice were injected intracerebroventricularly on day 1. On day 8, mice were euthanized and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the cerebellum. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 19 below:Table 19. Relative expression of ATXN2 mRNA in cerebellum analyzed by qPCR for each of the dosing groups of Example 5. Cerebellum Group Average (n=4) r h) 97180189175514
[0287] As sown n a e , a os ng groups s owe an mprovemen n nockdown over the aCSF-administered group in cerebellum. Each RNAi agent dosed to groups 2-14 targeted position 499 of hATXN2. Example 6. In Vivo Knockdown of ATXN2 in Mice
[0288] On Study day 1, C57bl / 6 mice were intracerebroventricularly injected with either aCSF (artificial cerebrospinal fluid), 100 μg of compound formulated in aCSF, with an injection volume of 10 μL, according to Table 20 below: Table 20: Dosing groups for the mice of Example 6. Group ID Animals dosed 1 F 4Group 7 (100 μg LP183-AD11529) n=4 Group 8 (100 μg LP183-AD11530) n=4
[0289] Fourwere injected intracerebroventricularly on day 1. On day 8, mice were euthanized and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex and cerebellum. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 21 below: Table 21. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, and cortex analyzed by qPCR for each of the dosing groups of Example 6. Thoracic Spinal Cord Cerebellum Grou Avera e (n=4)Group Average (n=4)r h) 112241359338889321179100 μg LP183-AD11531 0.898 0.116 0.13310100 μg LP183-AD11532 1.042 0.138 0.159rovement in knockdown over the aCSF-administered group in at least one of the selected tissues. AD11534 (targeting position 499 of hATXN2) showed the greatest reduction of ATXN2 in the thoracic spinal cord and the cortex. Example 7. In Vivo Knockdown of ATXN2 in Mice
[0291] On Study day 1, C57bl / 6 mice were intracerebroventricularly injected with either aCSF (artificial cerebrospinal fluid) or 100 μg of compound formulated in aCSF, with an injection volume of 10 μL, according to Table 22 below: Table 22: Dosing groups for the mice of Example 7. Group ID Animals dosed Group 1 (aCSF) n=3
[0292] Three (n=3) mice were dosed in each group. Mice were injected intracerebroventricularly on day 1. On day 8, mice were euthanized and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord and cerebellum. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 23 below: Table 23. Relative expression of ATXN2 mRNA in thoracic spinal cord and cerebellum analyzed by qPCR for each of the dosing groups of Example 7. Thoracic Spinal Cord Cerebellum Group Average (n=3)Group Average (n=3)r h) 2017 24 71 33 71 57 66 75 13 00 38 36 10 36 35 44 86 38
[0293] As shown in Table 23, all dosing groups showed an improvement in knockdown over the aCSF-administered group in both tissues. AD11650 showed the greatest reduction of ATXN2 in the thoracic spinal cord, and AD11629 showed the greatest reduction of ATXN2 in the cerebellum.Example 8. In Vivo Knockdown of ATXN2 in Mice
[0294] On Study day 1, C57bl / 6 mice were intracerebroventricularly injected with either aCSF (artificial cerebrospinal fluid), 100 μg of compound formulated in aCSF, with an injection volume of 10 μL, according to Table 24 below: Table 24: Dosing groups for the mice of Example 8. Group ID Animals dosed Group 1 (aCSF) n=4
[0295] Four(n=4) mice were dosed in each group. Mice were injected intracerebroventricularly on day 1. On day 8, mice were euthanized and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex and cerebellum. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 25 below: Table 25. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum and cortex analyzed by qPCR for each of the dosing groups of Example 8. Thoracic Spinal Cord Cerebellum ) r h) 022100 μg LP183-AD11914 0.364 0.087 0.114 0.542 0.083 0.0993100 μg LP183-AD11915 0.337 0.082 0.109 0.477 0.080 0.096579447183615508649172167
[0296] As shown in Table 25, all dosing groups showed an improvement in knockdown over the aCSF-administered group in all of the selected tissues, with AD11916 showing the greatest knockdown in both the cortex and cerebellum.Example 9. In Vivo Knockdown of ATXN2 in Mice
[0297] On Study day 1, C57bl / 6 mice were intracerebroventricularly injected with either aCSF (artificial cerebrospinal fluid), 100 μg of compound formulated in aCSF, with an injection volume of 10 μL, according to Table 26 below: Table 26: Dosing groups for the mice of Example 9. Group ID Animals dosed Group 1 (aCSF) n=3
[0298] Three (n=3) mice were dosed in each group. Mice were injected intracerebroventricularly on day 1. On day 8, mice were euthanized and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex and cerebellum. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 27 below: Table 27. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, and cortex analyzed by qPCR for each of the dosing groups of Example 9. Thoracic Spinal Cord Cerebellum )Group Rel. Error Error Rel. Error Error # Description Exp. (Low) (High) Exp. (Low) (High) 1000 0114 0129 1000 0189 0232779335850324642377586445364324
[0299] As shown in Table 27, all dosing groups showed an improvement in knockdown over the aCSF-administered group in at least two of the selected tissues. AD12008 showed significant knockdown in the cortex.Example 10. In Vivo Knockdown of ATXN2 in Cynomolgus Monkeys
[0300] On Study day 1, cynomolgus monkeys were injected with either artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or a compound formulation containing 60 mg of AD13051 in aCSF according to Table 28 below: Table 28: Dosing groups for the non-human primates of Example 10. Group ID Animals dosed Group 1 (aCSF)-Day 29 n=3
[0301] Three ( eys were dosed in groups 2, 3, an, in group 5 (trigger treated). Monkeys were injected intrathecally on day 1. On study day 29, animals from Groups 1 and 2 were euthanized and brain and spinal cord tissue was collected from each animal. On study day 85, animals from Group 3 were euthanized and brain and spinal cord tissue was collected from each animal. On study day 168, animals from Group 4 were euthanized and brain and spinal cord tissue was collected from each animal. On study day 253, animals from Group 5 were euthanized and brain and spinal cord tissue was collected from each animal.
[0302] Intrathecal injection in NHPs is a challenging procedure and mis-dosing is commonly observed due to the limited space and accessibility leading to improper placement of the injection needle and leakage of the test article. To adjust for mis-dosing in analysis of protein and expression levels, mis-dosing criteria was defined such that improperly dosed animals are excluded.
[0303] The mis-dosing criteria are solely based on tissue distribution of siRNA compound. Cynomolgus monkeys were determined mis-dosed and excluded from the analysis, if approximately 50% or more of the brain tissue regions analyzed have compound concentrations lower than 25% of group mean. Out of the overall twenty-six (26) NHP which received test article, ten (10) animals were identified as mis-dosed and the protein expression level data were excluded from the analysis. Three animals were excluded from Group 2, two animals were excluded from group 3, three animals were excluded from group 4, and two animals were excluded from group 5 for misdosing.
[0304] Tissues were lysed in RIPA buffer (Thermo Fisher, #89901). with protease / phosphatase inhibitors added (Halt, #87786). Total protein concentration was calculated for each sample using BCA (Pierce Protein Assay Kit #23225), and all samples were diluted to 5 mg / ml or as appropriate using RIPA lysis buffer.3uL of each diluted tissue sample was combined with 1.5uL of 5x Sample Mix (from the JESSTMEZ Standard Pack 3, #PS-ST03EZ-8) and 3uL of 0.1x Sample Buffer (final sample concentration of 2 mg / mL). Samples were then spun down, boiled for ten minutes at 70°C, spun down again, and cooled on ice. Samples were mixed gently by pipetting up and down prior to loading on the JESS plate (JESS 66-440 kDa separation module, #SM-W008). The JESS plate was loaded per Simple Western instructions. Briefly, 3uL of sample (2 mg / mL) was loaded per well of the plate. ATXN2 primary antibody (BD Biosciences, #611378) was diluted 1:400, and α-actinin (CellSignaling, #6487) was diluted 1:100 and loaded on the plate. Secondary antibodies including anti-Mouse (for ATXN2, from the JESS anti-Mouse detection module, #DM-002) and anti-Rabbit (for α-actinin, from the JESS anti-Rabbit detection module, #DM-001) were also loaded. After all reagents were added per Simple Western instructions, the plate was loaded onto the instrument and run using the JESS default RePlex protocol (onboard instrument protocol, JESS Replex Module, RP-001).
[0305] Average results for each group, relative to Group 1, are shown in Table 29 below: Table 29. Relative amount of ATXN2 protein in various tissues analyzed by JESSTMfor each of the dosing groups of Example 10. Thoracic Spinal Cord Cerebellum GA3 343 3 d 360 mg AD13051 Day 295.13 4.42 3 10.95 2.27 360 mg AD13051 Day 8511.63 2.20 4 41.45 17.95 43 3 3 343 3 3 343 3 3 343 3
[0306] ATXN2 protein reduction in the CNS tissue samples reached maximum at study day 29 with a mean reduction of approximately 80-90% in all major brain regions assessed. This overall ATXN2 protein reduction of 80-90% observed at day 29 started to recover over time to approximately 50-70% at day 85, to approximately 50% on day 169 and to less than 50% at day 253, exact values vary across the specific tissues. Focusing on the cerebellum, a primary brain region affected in SCA2 patients, ATXN2 protein showed a reduction of approximately 83% at day 29, 50% at day 85, 64% at day 169, and approximately 8% at day 253. The lumbar spinal cord, which is closest to the injection site, showed the strongest and most consistent ATXN2 protein reduction over time with approximately 95% reduction at day 29, 88% at day 85, 81% at day 169 and 75% at day 253. Example 11. In Vivo Knockdown of ATXN2 in Cynomolgus Monkeys
[0307] On Study day 1, cynomolgus monkeys were injected with either artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or a compound formulation containing 5 mg, 15 mg, or 30 mg of AD13051 in aCSF according to Table 28 below: Table 30: Dosing groups for the non-human primates of Example 11. Group ID Animals dosed Group 1 (aCSF) n=4
[0308] Four (n eys were dosed in groups 2, 3, and 4 (trigger treated). Monkeys were injected intrathecally on day 1. On study day 29, animals were euthanized and brain and spinal cord tissue was collected from each animal.
[0309] Intrathecal injection in NHPs is a challenging procedure and mis-dosing is commonly observed due to the limited space and accessibility leading to improper placement of the injection needle and leakage of the test article. To adjust for mis-dosing in analysis of protein and expression levels, mis-dosing criteria was defined such that improperly dosed animals are excluded.
[0310] The mis-dosing criteria are solely based on tissue distribution of siRNA compound. Cynomolgus monkeys were determined mis-dosed and excluded from the analysis, if approximately 50% or more of the brain tissue regions analyzed have compoundconcentrations lower than 25% of group mean. Out of the overall twenty-six (26) NHP which received test article, ten (10) animals were identified as mis-dosed and the protein expression level data were excluded from the analysis. Three animals were excluded from Group 2, one animal was excluded from group 3, and three animals were excluded from group 4 for misdosing.
[0311] Tissues were lysed in RIPA buffer (Thermo Fisher, #89901). with protease / phosphatase inhibitors added (Halt, #87786). Total protein concentration was calculated for each sample using BCA (Pierce Protein Assay Kit #23225), and all samples were diluted to 5 mg / ml or as appropriate using RIPA lysis buffer.3uL of each diluted tissue sample was combined with 1.5uL of 5x Sample Mix (from the JESSTMEZ Standard Pack 3, #PS-ST03EZ-8) and 3uL of 0.1x Sample Buffer (final sample concentration of 2 mg / mL). Samples were then spun down, boiled for ten minutes at 70°C, spun down again, and cooled on ice. Samples were mixed gently by pipetting up and down prior to loading on the JESS plate (JESS 66-440 kDa separation module, #SM-W008). The JESS plate was loaded per Simple Western instructions. Briefly, 3uL of sample (2 mg / mL) was loaded per well of the plate. ATXN2 primary antibody (BD Biosciences, #611378) was diluted 1:400, and α-actinin (CellSignaling, #6487) was diluted 1:100 and loaded on the plate. Secondary antibodies including anti-Mouse (for ATXN2, from the JESS anti-Mouse detection module, #DM-002) and anti-Rabbit (for α-actinin, from the JESS anti-Rabbit detection module, #DM-001) were also loaded. After all reagents were added per Simple Western instructions, the plate was loaded onto the instrument and run using the JESS default Replex protocol (onboard instrument protocol, JESS Replex Module, RP-001).
[0312] Average results for each group, relative to Group 1, are shown in Table 31 below: Table 31. Relative amount of ATXN2 protein in various tissues analyzed by JESSTMfor each of the dosing groups of Example 11. Thoracic Spinal Cord Cerebellum 3 353dGroup AverageGroup AverageRel. Rel. 4 3534 3534 353
[0313] Maximum ATXN2 protein reduction was observed in spinal cord, closest to the intrathecal injection site, with a 75% reduction at 5 mg and ~90% at 15 mg and 30 mg doses in the lumbar region and 35-40% reduction at 5 mg and 60-70% at 15 mg and 30 mg in cervical and thoracic regions respectively. In the cerebellum and the major cortical regions analyzed in this study, maximal ATXN2 protein reduction was already achieved at the lowestdose of 5 mg with approximately 58% reduction in Cerebellum and approximately 67%, 75% and 54% reduction in frontal, temporal and motor cortex, respectively. Example 12. In Vivo Knockdown of ATXN2 in Mice
[0314] On Study day 1, C57bl / 6 mice were intracerebroventricularly injected with either aCSF (artificial cerebrospinal fluid), or with 18.75 μg, 37.5 μg, 75 μg, 150 μg or 300 μg of compound formulated in aCSF, with an injection volume of 10 μL, according to Table 26 below: Table 32: Dosing groups for the mice of Example 12. Group ID Animals dosed Group 1 (aCSF) n=4
[0315] Four(n=4) mice were dosed in each group. Mice were injected intracerebroventricularly on day 1. On day 8, mice were euthanized and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 33 below: Table 33. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, and cortex analyzed by qPCR for each of the dosing groups of Example 12. Thoracic Spinal Cord Cerebellum ) r )1 aCSF 1.000 0.232 0.302 1.000 0.087 0.095 218.75 μg AD119160.729 0.147 0.184 0.852 0.174 0.218918726650243062782) r ) 90 41554774326101844750
[0316] As shown in Table 33, each of AD11916 and AD13051 show a dose-dependent increase in knockdown in all tissues assayed, with especially high knockdown in the thoracic spinal cord. AD13051, linked to an LP-293 PK / PD modulator, generally showed increased knockdown of ATXN2 over AD11916, linked to LP-183. Example 13. In Vivo Knockdown of ATXN2 in Mice
[0317] On Study day 1, C57bl / 6 mice were intracerebroventricularly injected with either aCSF (artificial cerebrospinal fluid), or with 18.75 μg, 37.5 μg, 75 μg, 150 μg or 300 μg of compound formulated in aCSF, with an injection volume of 10 μL, according to Table 26 below: Table 32: Dosing groups for the mice of Example 12. Group ID Animals dosedGroup 2 (18.75 μg AD12008) n=4 Group 3 (37.5 μg AD12008) n=4
[0318] Four. were injected intracerebroventricularly on day 1. On day 8, mice were euthanized and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were taken from the thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed by qPCR for ATXN2 knockdown. Average results for each group are shown in Table 33 below: Table 33. Relative expression of ATXN2 mRNA in thoracic spinal cord, cerebellum, cortex and brainstem analyzed by qPCR for each of the dosing groups of Example 12. Thoracic Spinal Cord Cerebellum GA 4)r ) 58 77620442013344178349)Group Rel. Error Error Rel. Error Error # Description Exp. (Low) (High) Exp. (Low) (Hi) 37 36588201040338944070, increase in knockdown in all tissues assayed, with especially high knockdown in the thoracic spinal cord. AD13052, linked to an LP-293 PK / PD modulator, generally showed increased knockdown of ATXN2 over AD12008, linked to LP-183. Example 13. In Vivo Knockdown of ATXN2 in Mice
[0320] A transgenic mouse model, BAC-Q22, which expresses the hATXN2 gene with a normal number of 22 CAG repeats, was used for this experiment. On study day 1, mice were administered an ICV injection of aCSF, or AD13051 at different concentrations (Table 34). Clinical observations were done at 3 and 24 hours post-dose, and daily health checks were performed during the study. On study day 15, animals were weighed, then were humanely euthanized by administration of isoflurane followed by transcardial perfusion. Thoracic spinal cord and cerebellum were collected for downstream analysis. Table 34. Dosing Groups for the mice of Example 34. Group N Treatment Concentration Dosing Total Injection # f T t Arti l V l m Am nt D
[0321] RNA was extracted from frozen tissue and purified using the Qiagen RNeasy Mini Kit (Cat. No.74106) according to the standard protocol. Reverse transcription wasperformed using ThermoFisher High-Capacity cDNA Reverse Transcription Kit (Cat. No. 4368814) according to manufacturer instructions. qPCR was performed on a Quantstudio 12K Flex Real-Time PCR System (Applied Biosystems) with Human ATXN2 Taqman Assay ID Hs00268077_m1 and Mouse beta-actin (mACTB) Taqman Assay ID Mm02619580_g1 (ThermoFisher)
[0322] For the RNA from spinal cord tissue, qPCR was performed in quadruplicate using hATXN2 and mACTB Taqman assays multiplexed. Quantitation of each transcript was determined using a standard curve. After normalizing hATXN2 to mACTB in each reaction, the average of the quadruplicate wells was determined for each RNA sample.
[0323] For the RNA from cerebellum tissue, hATXN2 and mACTB reactions were performed separately for each animal sample in quadruplicate and triplicate, respectively. The delta Ct method was used to determine the hATXN2 expression level normalized to mACTB after averaging Ct replicates for each sample.
[0324] Protein extracts were prepared by homogenization of mouse cerebella in extraction buffer (25 mM Tris-HCl pH 7.6, 300 mM NaCl, 0.5% Nonidet P-40, 2 mM EDTA, 2 mM MgCl2, 0.5 M urea and protease inhibitors; Sigma; cat# P-8340) followed by centrifugation at 4°C for 20 min at 16,100 × g. Only supernatants were used for Western blotting to determine the steady-state levels of proteins. Protein extracts were resolved by SDS-PAGE and transferred to Hybond P membranes (Amersham Bioscience Inc., USA). After blocking with 5% skim milk in 0.1% Tween 20 / PBS, the membranes were incubated with primary antibodies in 5% skim milk in 0.1% Tween 20 / PBS for 2 hrs at room temperature or overnight at 4°C. After washing in 0.1% Tween 20 / PBS, the membranes were incubated with the corresponding secondary antibodies conjugated with HRP in 5% skim milk in 0.1% Tween 20 / PBS for 2 hrs at room temperature and washed again. Signals were detected by using the Immobilon Western Chemiluminescent HRP Substrate (Millipore Inc., USA; cat# WBKLSO100) according to the manufacturer’s protocol. The intensity of proteins was determined using the ImageJ software analysis system and proteins were quantitated as a ratio to β-Actin. The ATXN2 monoclonal antibody (BD Biosciences Inc., Cat. No.611378) was used at 1:4000. The secondary antibody was goat anti-mouse IgG-HRP (1:5000) (Sigma Inc., Cat. No. A2304). The ACTB monoclonal antibody was HRP-conjugated and used at 1:10,000 (Sigma-Aldrich, Cat. No. A3854).
[0325] Reductions in hATNX2 mRNA and protein are shown in Tables 35 and 36, respectively.Table 35. Relative expression of hATXN2 mRNA in spinal cord and cerebellum analyzed by qRT-PCR for each of the dosing groups of Example 13. Spinal Cord Cerebellum Group AverageGroup Averager ) 46 82253162Cerebellum Group Average r 4 111*
[0326] AD13051 shows a generally dose-dependent response in mice expressing hATXN2. AD13051 demonstrated deep ATXN2 protein knockdown at a dose as low as 30 μg. OTHER EMBODIMENTS
[0327] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
Claims:
1. An RNAi agent for inhibiting expression of a Ataxin-2 (ATXN2) gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.
2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3.
3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.
4. The RNAi agent of any one of claims 1-3, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage.
5. The RNAi agent of any one of claims 1-4, wherein all or substantially all of the nucleotides are modified nucleotides.
6. The RNAi agent of any one of claims 4-5, wherein the modified nucleotide is selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2'-F-arabino nucleotide, 2′- methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O- methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′- alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3′-O-methyl nucleotide.
7. The RNAi agent of claim 5, wherein all or substantially all of the nucleotides are modified with 2′-O-methyl nucleotides, 2′-fluoro nucleotides, or combinations thereof.
8. The RNAi agent of any one of claims 1-7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3.
9. The RNAi agent of any one of claims 1-8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.
10. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3 and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.
11. The RNAi agent of any one of claims 1-10, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.
12. The RNAi agent of claim 11, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.
13. The RNAi agent of claim 12, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.
14. The RNAi agent of claim 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.
15. The RNAi agent of claim 14, wherein the RNAi agent has two blunt ends.
16. The RNAi agent of any one of claims 1-15, wherein the sense strand comprises one or two terminal caps.
17. The RNAi agent of any one of claims 1-16, wherein the sense strand comprises one or two inverted abasic residues.
18. The RNAi agent of claim 1, wherein the RNAi agent comprises a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7, Table 8, Table 9A, or Table 10.
19. The RNAi agent of claim 18, wherein all or substantially all of the nucleotides are modified nucleotides.
20. The RNAi agent of claim 19, wherein all or substantially all of the nucleotides are modified nucleotides.
21. The RNAi agent of any one of claims 19-20, wherein the sense strand further includes inverted abasic residues at the 3’ terminal end of the nucleotide sequence, at the 5’ end of the nucleotide sequence, or at both.
22. The RNAi agent of any one of claims 1-21, wherein the RNAi agent is linked to a lipid moiety.
23. The RNAi agent of claim 22, wherein the lipid moiety is selected from the group consisting of:Owherein indicates the point of connection to the RNAi agent.
24. The RNAi agent of claim 22 or claim 23, wherein the lipid moiety is conjugated to the sense strand.
25. The RNAi agent of claim 24, wherein the lipid moiety is conjugated to the 5’ terminal end of the sense strand.
26. A composition comprising the RNAi agent of any one of claims 1-25, wherein the composition further comprises a pharmaceutically acceptable excipient.
27. The composition of claim 26, further comprising a second RNAi agent capable of inhibiting the expression of Ataxin-2 gene expression.
28. The composition of any one of claims 26-27, further comprising one or more additional therapeutics.
29. The composition of any of claims 26-28, wherein the RNAi agent is a sodium salt.
30. The composition of any of claims 26-29, wherein the pharmaceutically acceptable excipient is water for injection.
31. The composition of any of claims 26-29, wherein the pharmaceutically acceptable excipient is a buffered saline solution.
32. A method for inhibiting expression of an ATXN2 gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of any one of claims 1-25 or the composition of any one of claims 26-31.
33. The method of claim 32, wherein the cell is within a subject.
34. The method of claim 33, wherein the subject is a human subject.
35. The method of any one of claims 32-34, wherein following the administration of the RNAi agent the Ataxin-2 (ATXN2) gene expression is inhibited by at least about 30%.
36. A method of treating one or more symptoms or diseases associated with enhanced or elevated membrane ATXN2 activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of claims 26-31.
37. The method of claim 36, wherein the disease is a neurodegenerative disease.
38. The method of claim 37, wherein the neurodegenerative disease is spinocerebellar ataxia type 2 (SCA2).
39. The method of claim 37, wherein the disease is ALS.
40. The method of any one of claims 32-39, wherein the RNAi agent is administered at a dose of about 0.01 mg / kg to about 5.0 mg / kg of body weight of the subject.
41. The method of any one of claims 32-40, wherein the RNAi agent is administered at a dose of about 0.03 mg / kg to about 2.0 mg / kg of body weight of the subject.
42. The method of any of claims 32-41, wherein the RNAi agent is administered in two or more doses.
43. Use of the RNAi agent of any one of claims 1-25, for the treatment of a disease, disorder, or symptom that is mediated at least in part by mutant ATXN2 activity and / or ATXN2 gene expression.
44. Use of the composition according to any one of claims 26-31, for the treatment of a disease, disorder, or symptom that is mediated at least in part by Ataxin-2 (ATXN2) activity and / or Ataxin-2 (ATXN2) gene expression.
45. Use of the composition according to any one of claims 26-31, for the manufacture of a medicament for treatment of a disease, disorder, or symptom that is mediated at least in part by Ataxin-2 (ATXN2) and / or Ataxin-2 (ATXN2) gene expression.
46. The use of any one of claims 43-45, wherein the disease is a neurodegenerative disease.
47. A method of making an RNAi agent of any one of claims 1-25, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.
48. The method of claim 47, wherein the sense strand comprises a lipid moiety.
49. The method of claim 48, comprising conjugating a lipid moiety to the sense strand.