Lipoprotein lipase expression constructs, viral particles, and therapeutic applications thereof
Patent Information
- Application Number
- EP2024769605
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-14
- Filing Date
- 2024-03-11
- Publication Date
- 2026-01-21
AI Technical Summary
Current treatments for lipoprotein lipase deficiency (LPLD) are inadequate, with no curative options available and existing therapies like Alipogene Tiparvovec (Glybera) being costly and limited by high dosages and short-term efficacy.
Development of recombinant nucleic acid molecules and AAV viral particles expressing the gain-of-function mutation S447X in human lipoprotein lipase, optimized for improved expression and delivery via intramuscular, intravenous, or subcutaneous routes, using novel AAV serotypes and modified promoters to enhance therapeutic efficacy at lower doses.
The recombinant AAV viral particles demonstrate significant therapeutic efficacy in treating LPLD, achieving long-term normalization of plasma triglycerides and reduced frequency of pancreatitis events at significantly lower doses compared to Glybera, with improved biodistribution and expression profiles.
Smart Images

Figure CA2024050295_19092024_PF_FP_ABST
Abstract
Description
LIPOPROTEIN LIPASE EXPRESSION CONSTRUCTS. VIRAL PARTICLES. AND THERAPEUTIC APPLICATIONS THEREOFCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority from U.S. Provisional Application No. 63 / 490,105 filed March 14, 2023 and entitled “LIPOPROTEIN LIPASE EXPRESSION CONSTRUCTS, VIRAL PARTICLES, AND THERAPEUTIC APPLICATIONS THEREOF”, the contents of which are expressly incorporated by reference for all purposes.FIELD
[0002] The present disclosure relates generally to nucleic acid expression constructs for expressing lipoprotein lipase. More particularly, the present disclosure relates to improved recombinant expression constructs and viral particles for expression of human lipoprotein lipase, for treatment of lipoprotein lipase deficiency (LPLD).BACKGROUND
[0003] Lipoprotein lipase (LPL) is a critical enzyme responsible for maintaining lipoprotein metabolism and energy homeostasis1-3. LPL is primarily synthesized within skeletal muscle cells and adipose tissue. Following production, LPL is secreted and bound to the luminal surface of blood vessels via heparin sulfate proteoglycans, where it breaks down triglycerides (Tg) within chylomicrons and very low-density lipoproteins (VLDL) and facilitates the uptake of free fatty acids within adjacent tissues1-3.
[0004] Lipoprotein lipase deficiency (LPLD) (type I hyperlipoproteinemia) is a rare monogenetic autosomal recessive disease characterized by mutations within the LPL gene that results in a complete lack of catalytically active LPL protein4-6. LPLD is characterized by severe accumulation of chylomicrons within the blood, resulting in plasma lactescence (milky plasma) and hypertriglyceridemia (HTG)4-6. Prolonged HTG is a key factor associated with disease progression and the cause of severe complications, including hepatosplenomegaly, eruptive xanthomas, unbearable abdominal pain, leading to potentially lethal episodes of pancreatitis, chronic pancreatic insufficiency and diabetes4-6.
[0005] There are currently no curative treatments available for LPLD. Lipid-lowering drugs and strict adherence to a low fat diet (less than 10-15% total caloric intake) are used for management but are ineffective at completely normalizing HTG and chylomicronemia and preventing some ofthe life-threatening complications associated with LPLD1-6. Enzyme replacement therapy is unfeasible due to the short-half life of LPL within blood7. To this end, Alipogene Tiparvovec (Glybera™) was developed, and was the first European Medicines Agency (EMA)-approved adeno-associated virus (AAV) gene replacement therapy product for the treatment of LPLD8-12.
[0006] AAV is a non-pathogenic virus that is commonly used as a vector to safely and effectively deliver exogenous genetic material in an in vivo setting13-15. Glybera™ is a AAV gene replacement therapy product for the treatment of LPLD in adult patients suffering from severe recurrent pancreatitis attacks despite strict dietary fat restrictions. Glybera™ was administered via a series of intramuscular (IM) injections in order to deliver a functional copy of a LPL transgene within skeletal muscle, which is one of the natural sites of LPL production. Glybera™ comprised of a protein shell derived from adeno-associated virus serotype 1 (AAV1), a cytomegalovirus (CMV) promoter driving a human LPLS447X(hLPLS447X) transgene, a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) and two flanking adeno-associated virus serotype 2 (AAV2)-derived inverted terminal repeats (ITR). Glybera™ delivered a naturally occurring, gain of function hLPLS447Xvariant, present in approximately 20-25% of the general population16-18. The hLPLS447Xvariant is associated with increased lipolytic function via increased lipoprotein uptake, along with an anti-atherogenic, cardio-protective lipid profile resulting in decreased plasma Tg and increased high-density lipoprotein cholesterol9’11’16-19.
[0007] Extensive pre-clinical and clinical evidence shows long-term safety and efficacy of Glybera8’920-25. In a mouse model of LPLD, a single dose of Glybera™ administered at a dose of 8x1012genome copies / kg (gc / kg) within skeletal muscle via an IM injection resulted in complete resolution of chylomicronemia and life-long normalization of plasma Tg9 10. Similar potency was observed in a naturally-occurring feline model of LPLD carrying a mutant allele encoding a catalytically inactive LPL protein8. Clinical studies in LPLD patients treated with a single dose of Glybera™ at either 3x1011gc / kg or 1x1012gc / kg illustrated that the treatment is safe, well tolerated and resulted in detectable transgene expression within the injected muscle that is associated with a transient reduction in plasma Tg for up to 12 weeks post-treatment22-2426. Even though plasma Tg levels rebounded after 12 weeks of treatment, there was a long-term improvement in postprandial chylomicron metabolism, a lower frequency and severity of pancreatitis events, and an overall reduction in health care resource use for up to 6 years post-treatment22-2426.
[0008] Glybera™ was produced using insect cells and recombinant baculovirus technology and was priced at approximately $1.2 million USD per patient. Due to economic considerations, potentially related to the use small-scale manufacturing processes, Glybera™ was withdrawnfrom the market in 2017. Since the original development of Glybera™, there have been tremendous advances in the understanding of AAV biology and in the development of more efficient large-scale AAV manufacturing processes.
[0009] It is, therefore, desirable to develop products for treatment of LPLD that is more efficacious or administrable at lower doses compared to Glybera.SUMMARY
[0010] It is an object of the present disclosure to obviate or mitigate at least one disadvantage of previous approaches.
[0011] In a first aspect, there is described a recombinant nucleic acid molecule for expressing human lipoprotein lipase (hLPL) comprising the gain of function mutation S447X (hLPLS447X) or a polypeptide having at least 80% sequence identity thereto and comprising the mutation S447X, the recombinant nucleic acid molecule comprising: a transcriptional unit comprising: a promoter for driving expression of the hLPLS447Xor the polypeptide having at least 80% sequence identity thereto, the promoter comprising the sequence of any one of SEQ ID NOs: 13 to 16 or a sequence having at least 80% sequence identity thereto, a coding nucleic acid that encodes the hLPLS447Xor the polypeptide having at least 80% sequence identity thereto, and a polyadenylation signal, wherein the recombinant nucleic acid molecule optionally comprises a truncated WPRE comprising the sequence of SEQ ID NO: 19 or comprising a fragment of the sequence of SEQ ID NO: 18, which is positioned downstream with respect to the coding nucleic acid molecule.
[0012] In one aspect, there is provided a vector comprising the recombinant nucleic acid molecule as defined herein. In one embodiment, the vector is a plasmid vector. In one embodiment, the plasmid is an adeno-associated virus (AAV) transfer plasmid.
[0013] In one aspect, there is provided a host cell comprising the nucleic acid molecule as defined herein. In one embodiment, the host cell is a cell line. In one embodiment, the host cell is a human cell. In one embodiment, the host cell is a human cell line.
[0014] In one aspect, there is provided a recombinant viral particle comprising the recombinant nucleic acid molecule as defined herein.
[0015] In one aspect, there is provided a recombinant AAV viral particle (rAAV) comprising the nucleic acid molecule as defined herein.
[0016] In one aspect, there is provide a composition comprising the recombinant nucleic acid molecule as defined herein, the vector as described herein, the recombinant viral particle asdescribed herein, or the rAAV as described herein together with an acceptable excipient, diluent, or carrier.
[0017] In one aspect, there is provide a pharmaceutical composition comprising the recombinant nucleic acid molecule as defined herein, the vector as described herein, the recombinant viral particle as described herein, or the rAAV as described herein together with a pharmaceutically acceptable excipient, diluent, or carrier.
[0018] In one aspect, there is provided a method of delivering the recombinant nucleic acid molecule as defined herein to a cell comprising contacting the cell with the vector or the recombinant viral particle as defined herein.
[0019] In one aspect, there is provided a method of delivering the recombinant nucleic acid molecule as defined herein to a cell comprising contacting the cell with the rAAV as defined herein.
[0020] In one aspect, there is provided a method of treating plasma lipidemia comprising administering to a subject the rAAV as defined herein.
[0021] In one aspect, there is provided a method of treating lipoprotein lipase deficiency in a subject comprising administering to a subject the rAAV as defined herein.
[0022] In one aspect, there is provided a use, for delivering the recombinant nucleic acid molecule as defined herein to a cell, of the vector or the recombinant viral particle as defined herein.
[0023] In one aspect, there is provided a use of the rAAV as defined herein for delivering the recombinant nucleic acid molecule as defined herein.
[0024] In one aspect, there is provided a use of the rAAV as defined herein for treatment of plasma lipidemia.
[0025] In one aspect, there is provided a use of the rAAV as defined herein for treatment of lipoprotein lipase deficiency in a subject.
[0026] In one aspect, there is provided the rAAV as defined here for use in treatment of plasma lipidemia in a subject.
[0027] In one aspect, there is provided the rAAV as defined here for use in treatment of lipoprotein lipase deficiency in a subject.
[0028] In one embodiment, the rAAV is for intramuscular (IM), intravenous (IV), or subcutaneous (SQ) use.
[0029] In one aspect, there is provided a kit for use in delivering the recombinant nucleic acid molecule as defined herein to a cell, comprising the vector or the recombinant viral particle as defined herein together with instructions for delivery to a cell.
[0030] In one aspect, there is provided a kit for use in delivering the recombinant nucleic acid molecule as defined herein, comprising the rAAV as defined herein together with instructions for delivery to a cell.
[0031] In one aspect, there is provided a kit for use in treatment of plasma lipidemia, comprising the rAAV as defined herein together with instructions for treatment of plasma lipidemia.
[0032] In one aspect, there is provided a kit for use for treatment of lipoprotein lipase deficiency in a subject, comprising the rAAV as defined herein together with instructions for treatment of lipoprotein lipase deficiency.
[0033] In one aspect, there is provided a method of producing recombinant AAV viral particles (rAAVs) comprising transfecting cells with a transfer plasmid comprising the recombinant nucleic acid molecule as defined herein, wherein the cells express AAV components required for packaging the recombinant nucleic acid molecule into rAAV particles, culturing the cells to produce the rAAVs, and isolating the rAAVs.
[0034] Other aspects and features of the present disclosure will become apparent to those ordinarily skilled in the art upon review of the following description of specific embodiments in conjunction with the accompanying figures.BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Embodiments of the present disclosure will now be described, by way of example only, with reference to the attached Figures.
[0036] Figure 1 depicts a structural diagram of the adenovirus (adenovirus serotype 5 [Ad5]) vector expression cassette encoding hLPLS447X(AdV-hLPLS447X) used for rescue of LPL- / - pups (C.O, codon-optimized; ITR; inverted terminal repeat; ^P, packaging signal).
[0037] Figure 2 depicts structural diagrams of novel AAV serotypes and expression cassettes encoding luciferase (luc) (ITR; inverted terminal repeat, WPRE, Woodchuck Hepatitis Virus (WHV) posttranscriptional regulatory element; hGH, human growth hormone).
[0038] Figure 3 depicts structural diagrams of novel AAV serotypes and expression cassettes encoding hLPLS447X tested in LPL- / - mice (C.O, codon-optimized; ITR; inverted terminal repeat, WPRE, Woodchuck Hepatitis Virus (WHV) posttranscriptional regulatory element; bGH, bovine growth hormone; hGH, human growth hormone).
[0039] Figure 4 provides a study overview summarizing the experimental protocol in which 6- 8 week old (w.o) wild-type mice were treated with novel AAV-luciferase formulations and followed for 60 days post-AAV treatment, with bioluminescence imaging (BLI) at the indicated timepoints.
[0040] Figure 5 shows in vivo mouse BLI imaging of luciferase expression in wild-type mice following administration of novel AAV-luc formulations injected via IM, IV or SQ-flank (n=2-3 mice / group, representative images shown at time (day) of peak luciferase expression).
[0041] Figure 6 depicts quantification and kinetics of whole-body luciferase expression, individually measured in the dorsal and ventral view, following treatment with novel AAV-luc formulations (n=2-3 mice / group).
[0042] Figure 7 depicts in vivo mouse BLI imaging of luciferase expression in wild-type mice following administration of novel AAV-luc formulations injected via the SQ-hock (n=2-3 mice / group, representative images shown at time (day) of peak luciferase expression, mice from SQ-hock group were only imaged at day 60 post-AAV treatment, vehicle treated mice showed negligible luciferase signal, data not shown).
[0043] Figure 8 depicts quantification and kinetics of whole-body luciferase expression, individually measured in the dorsal and ventral view, following treatment with novel AAV-luc formulations at study endpoint (day 60 post-AAV treatment) (n=2-3 mice / group).
[0044] Figure 9 depicts ex vivo organ BLI of luciferase expression in wild-type mice following administration of novel AAV-luciferase administration via IM, IV, SQ-flank or SQ-hock at study endpoint (day 60) (n=2-3 mice / group, representative images shown).
[0045] Figure 10 shows a study overview summarizing the experimental protocol in which primary human muscle skeletal cells (HSkMCs) were differentiated into myotubes and infected with novel AAV-hLPLS447Xformulations or Glybera at a MOI of 1x105gc / cell in 96-well plates and assessed for LPL expression and activity 4 days following infection.
[0046] Figure 11 depicts hLPL protein expression in primary human myotubes infected with AAV-hLPLS447Xformulations, a vehicle control, or Glybera.
[0047] Figure 12 depicts LPL protein expression in primary human myotubes infected with AAV-hLPLS447Xformulations, a vehicle control, or Glybera normalized against total protein. Results from a representative microplate are shown. Data are expressed as fold change relative to Glybera-treated myotubes, n=10-12 wells / group [3 independent experiments], One-way ANOVA. Fisher’s LSD: p<0.05 * vs Glybera, # vs AAV1 pVR59.
[0048] Figure 13 shows secreted lipolytic LPL activity in conditioned media from primary human myotubes infected with AAV-hLPLS447X formulations, a vehicle control, or Glybera (data expressed as fold change relative to Glybera-treated myotubes, n=10-12 wells / group [3 independent experiments], One-way ANOVA. Fisher’s LSD: p<0.05 * vs Glybera, # vs AAV1 pVR59.
[0049] Figure 14 depicts a study overview summarizing an experimental protocol in which mouse C2C12 myoblasts were differentiated into myotubes and infected with novel AAV- hLPLS447Xformulations or Glybera at a MOI of 1x105gc / cell in 96-well plates and assessed for LPL expression and activity 4 days following infection.
[0050] Figure 15 depicts hLPL protein expression in mouse C2C12 myotubes infected with AAV-hLPLS447Xformulations, a vehicle control, or Glybera.
[0051] Figure 16 depicts LPL protein expression in mouse C2C12 myotubes infected with AAV- hLPLS447Xformulations, a vehicle control, or Glybera normalized against total protein. Results from a representative microplate are shown. Data are expressed as a fold change relative to Glybera-treated myotubes, n=6-8 wells / group [2 independent experiments], One-way ANOVA. Fisher’s LSD: p<0.05 * vs Glybera, # vs AAV1 pVR59.
[0052] Figure 17 depicts secreted lipolytic LPL activity in conditioned media from mouse C2C12 myotubes infected with AAV-hLPLS447Xformulations or Glybera (data expressed as fold change relative to Glybera-treated myotubes, n=6-8 wells / group [2 independent experiments], One-way ANOVA. Fisher’s LSD: p<0.05 * vs Glybera, # vs AAV1 pVR59.
[0053] Figure 18 depicts a study overview summarizing an experimental protocol in which HepG2 cells were infected with novel AAV-hLPLS447Xformulations, a vehicle control, or Glybera at a MOI of 1x105gc / cell in 96-well plates and assessed for LPL expression and activity 3 days following infection.
[0054] Figure 19 depicts hLPL protein expression in HepG2 cells infected with AAV-hLPLS447Xformulations, a vehicle control, or Glybera.
[0055] Figure 20 depicts LPL protein expression in HepG2 cells infected with AAV-hLPLS447Xformulations, a vehicle control, or Glybera normalized against total protein. Results from a representative microplate are shown. Data are expressed as a fold change relative to Glybera- treated HepG2 cells, n=12 wells / group [3 independent experiments], One-way ANOVA. Fisher’s LSD: p<0.05 * vs Glybera, # vs AAV8 pVR59.
[0056] Figure 21 depicts secreted lipolytic LPL activity in conditioned media from HepG2 cells infected with AAV-hLPLS447Xformulations or Glybera (data expressed as fold change relative to Glybera-treated HepG2 cells, n=12 wells / group [3 independent experiments], One-way ANOVA. Fisher’s LSD: p<0.05 * vs Glybera, # vs AAV8 pVR59).
[0057] Figure 22 depicts plasma from treated and untreated LPL- / - pups. Untreated pups exhibit hyperlipidemia (milky plasma) and die within 24-48h after birth. LPL- / - pups injected intramuscularly with AdV-hLPLS447X(1x108pfu / pup) via IM survive to adulthood and exhibitpronounced hyperlipemia (representative images shown, arrow indicates time of rescue, d.o: days old. n=4-8 mice / group).
[0058] Figure 23 depicts plasmid triglyceride levels in LPL+ / + pups at 24 hours after birth and LPL- / - pups at 24 and 48 hours after birth. LPL- / - pups exhibit significantly elevated plasma Tg, compared to LPL+ / + pups (plasma Tg graphed on a log scale. n=4-8 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs LPL+ / + 24h, # vs LPL- / -24h).
[0059] Figure 24 depicts plasmid cholesterol levels in LPL+ / + pups at 24 hours after birth and LPL- / - pups at 24 and 48 hours after birth. LPL- / - pups exhibit significantly elevated plasma Tc, compared to LPL+ / + pups (plasma Tg graphed on a log scale. n=4-8 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs LPL+ / + 24h, # vs LPL- / -24h).
[0060] Figure 25 depicts plasma LPL activity in LPL+ / + and LPL- / - mice at 30, 60, and 90 days old. Rescued adult LPL- / - mice do not express plasma lipolytic LPL activity (n=4-6 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs LPL+ / +).
[0061] Figure 26 depicts plasma triglyceride levels in LPL+ / + and LPL- / - mice at 30, 60, and 90 days old. Rescued adult LPL- / - mice do not express plasma lipolytic LPL activity (n=4-6 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs LPL+ / +).
[0062] Figure 27 depicts plasma cholesterol levels in in LPL+ / + and LPL- / - mice at 30, 60, and 90 days old. Rescued adult LPL- / - mice do not express plasma lipolytic LPL activity (n=4-6 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs LPL+ / +).
[0063] Figure 28 depicts a study overview summarizing an experimental protocol in which LPL- / - mice were rescued at birth with an intramuscular injection of AdV-hLPLS447X, treated with novel AAV-hLPLS447Xformulations at 2-3 months (m.o) of age, and followed for 80 post-AAV treatment, with blood samples being routinely collected at the indicated timepoints.
[0064] Figure 29 depicts plasma samples from control LPL+ / + mice or LPL- / - mice following IM administration of a vehicle control, Glybera, or novel AAV-hLPLS447Xformulations at the indicated doses (arrow indicates time of AAV treatment, representative images shown, n=3-4 mice / group), showing correction of visible hyperlipidemia in mice treated with AAV-hLPLS447Xformulations.
[0065] Figure 30 depicts correction of plasma Tg following IM treatment with Glybera or novel AAV-hLPLS447Xformulations at the indicated doses (plasma Tg graphed on a log scale, lower shaded area outlines the normal range of plasma Tg observed in vehicle-treated LPL+ / + mice, top shaded area outlines the range of plasma Tg observed in vehicle-treated LPL- / - mice, n=12 vehicle-treated LPL+ / + mice, n=9 vehicle-treated LPL- / - mice [vehicle-treated mice pooled fromall routes of administration], n=3-4 AAV-treated LPL- / - mice / group. Two-way ANOVA. Fisher’s LSD: only non-significance vs LPL+ / + noted on the graphs).
[0066] Figure 31 depicts plasma samples from control LPL+ / + mice or LPL- / - mice following IV administration of a vehicle control, Glybera, or novel AAV-hLPLS447Xformulations at the indicated doses (arrow indicates time of AAV treatment, representative images shown, n=3-4 mice / group), showing correction of visible plasma hyperlipidemia in mice treated with AAV-hLPLS447Xformulations.
[0067] Figure 32 depicts plasma samples from control LPL+ / + mice or LPL- / - mice following SQ (flank or hock) administration of a vehicle control, Glybera, or novel AAV-hLPLS447Xformulations at the indicated doses (arrow indicates time of AAV treatment, representative images shown, n=3-4 mice / group), showing correction of visible plasma hyperlipidemia in mice treated with AAV-hLPLS447Xformulations.
[0068] Figure 33 depicts correction of plasma Tc following IM treatment with Glybera or novel AAV-hLPLS447X formulations at the indicated doses (bottom shaded area outlines the normal range of plasma Tc observed in vehicle-treated LPL+ / + mice, top shaded area outlines the range of plasma Tc observed in vehicle-treated LPL- / - mice, n=12 vehicle-treated LPL+ / + mice, n=9 vehicle-treated LPL- / - mice [vehicle-treated mice pooled from all routes of administration], n=3-4 AAV-treated LPL- / - mice / group. Two-way ANOVA. Fisher’s LSD: only non-significance vs LPL+ / + noted on the graphs).
[0069] Figure 34 depicts correction of plasma Tg following IV treatment with Glybera or novel AAV-hLPLS447X formulations at the indicated doses (plasma Tg graphed on a log scale, bottom shaded area outlines the normal range of plasma Tg observed in vehicle-treated LPL+ / + mice, top shaded area outlines the range of plasma Tg observed in vehicle-treated LPL- / - mice, n=12 vehicle-treated LPL+ / + mice, n=9 vehicle-treated LPL- / - mice [vehicle-treated mice pooled from all routes of administration], n=3-4 AAV-treated LPL- / - mice / group. Two-way ANOVA. Fisher’s LSD: only non-significance vs LPL+ / + noted on the graphs).
[0070] Figure 35 depicts correction of plasma Tc following IV treatment with Glybera or novel AAV-hLPLS447Xformulations at the indicated doses (bottom shaded area outlines the normal range of plasma Tc observed in vehicle-treated LPL+ / + mice, top shaded area outlines the range of plasma Tc observed in vehicle-treated LPL- / - mice, n=12 vehicle-treated LPL+ / + mice, n=9 vehicle-treated LPL- / - mice [vehicle-treated mice pooled from all routes of administration], n=3-4 AAV-treated LPL- / - mice / group. Two-way ANOVA. Fisher’s LSD: only non-significance vs LPL+ / + noted on the graphs).
[0071] Figure 36 depicts Correction of plasma Tg following SQ-flank treatment with Glybera or novel AAV-hLPLS447Xformulations at the indicated doses (plasma Tg graphed on a log scale, bottom shaded area outlines the normal range of plasma Tg observed in vehicle-treated LPL+ / + mice, top shaded area outlines the range of plasma Tg observed in vehicle-treated LPL- / - mice, n=12 vehicle-treated LPL+ / + mice, n=9 vehicle-treated LPL- / - mice [vehicle-treated mice pooled from all routes of administration], n=3-4 AAV-treated LPL- / - mice / group. Two-way ANOVA. Fisher’s LSD: only non-significance vs LPL+ / + noted on the graphs).
[0072] Figure 37 depicts correction of plasma Tc following SQ-flank treatment with Glybera or novel AAV-hLPLS447X formulations at the indicated doses (bottom shaded area outlines the normal range of plasma Tc observed in vehicle-treated LPL+ / + mice, top shaded area outlines the range of plasma Tc observed in vehicle-treated LPL- / - mice, n=12 vehicle-treated LPL+ / + mice, n=9 vehicle-treated LPL- / - mice [vehicle-treated mice pooled from all routes of administration], n=3-4 AAV-treated LPL- / - mice / group. Two-way ANOVA. Fisher’s LSD: only nonsignificance vs LPL+ / + noted on the graphs).
[0073] Figure 38 depicts correction of plasma Tg following SQ-hock treatment with Glybera or novel AAV-hLPLS447Xformulations at the indicated doses (plasma Tg graphed on a log scale, bottom shaded area outlines the normal range of plasma Tg observed in vehicle-treated LPL+ / + mice, top shaded area outlines the range of plasma Tg observed in vehicle-treated LPL- / - mice, n=12 vehicle-treated LPL+ / + mice, n=9 vehicle-treated LPL- / - mice [vehicle-treated mice pooled from all routes of administration], n=3-4 AAV-treated LPL- / - mice / group. Two-way ANOVA. Fisher’s LSD: only non-significance vs LPL+ / + noted on the graphs).
[0074] Figure 39 depicts correction of plasma Tc following SQ-hock treatment with Glybera or novel AAV-hLPLS447X formulations at the indicated doses (bottom shaded area outlines the normal range of plasma Tc observed in vehicle-treated LPL+ / + mice, top shaded area outlines the range of plasma Tc observed in vehicle-treated LPL- / - mice, n=12 vehicle-treated LPL+ / + mice, n=9 vehicle-treated LPL- / - mice [vehicle-treated mice pooled from all routes of administration], n=3-4 AAV-treated LPL- / - mice / group. Two-way ANOVA. Fisher’s LSD: only non- significance vs LPL+ / + noted on the graphs).
[0075] Figure 40 left panel depicts plasma Tg measured pre- and post-intravenous Intralipid administration in LPL+ / + and LPL- / - mice treated with vehicle, Glybera or AAV8 pVR59 via IM at HD (n=3-4 mice / group. Two-way ANOVA: Fisher’s LSD: p<0.05 * vs Glybera, # vs vehicle-treated LPL- / - mice,Avs vehicle-treated LPL+ / + mice). The right panel depicts plasma Tg measured pre- and post-intravenous Intralipid administration in LPL+ / + and LPL- / - mice treated with vehicle,Glybera or AAV8 pVR59 via IM at HD (n=3-4 mice / group. Two-way ANOVA: Fisher’s LSD: p<0.05* vs Glybera, # vs vehicle-treated LPL- / - mice,Avs vehicle-treated LPL+ / + mice).
[0076] Figure 41 depicts hLPL protein expression in the plasma (post-heparin) of LPL- / - mice at study endpoint (day 80) following treatment with vehicle control, Glybera, or AAV-hLPLS447Xformulations administered via IM at the indicated doses (n=3-4 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs vehicle-treated LPL- / - mice, # vs Glybera).
[0077] Figure 42 depicts lipolytic hLPL-specific activity in the plasma (post-heparin) of LPL- / - mice at study endpoint (day 80) following treatment with vehicle control, Glybera, or AAV- hLPLS447Xformulations administered via IM at the indicated doses (orange shaded area outlines the normal range of endogenous LPL activity in vehicle-treated LPL+ / + mice, n=3-4 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs vehicle-treated LPL- / - mice, # vs Glybera).
[0078] Figure 43 depicts hLPL protein expression in the plasma (post-heparin) of LPL- / - mice at study endpoint (day 80) following treatment with vehicle control, Glybera, or AAV-hLPLS447Xformulations administered via IV at the indicated doses (n=3-4 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs vehicle-treated LPL- / - mice, # vs Glybera).
[0079] Figure 44 depicts lipolytic hLPL-specific activity in the plasma (post-heparin) of LPL- / - mice at study endpoint (day 80) following treatment with vehicle control, Glybera, or AAV- hLPLS447Xformulations administered via IV at the indicated doses (orange shaded area outlines the normal range of endogenous LPL activity in vehicle-treated LPL+ / + mice, n=3-4 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs vehicle-treated LPL- / - mice, # vs Glybera).
[0080] Figure 45 depicts hLPL protein expression in the plasma (post-heparin) of LPL- / - mice at study endpoint (day 80) following treatment with vehicle control, Glybera, or AAV-hLPLS447Xformulations administered via SQ-flank or SQ-hock at the indicated doses (n=3-4 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs vehicle-treated LPL- / - mice, # vs Glybera).
[0081] Figure 46 depicts lipolytic hLPL-specific activity in the plasma (post-heparin) of LPL- / - mice at study endpoint (day 80) following treatment with vehicle control, Glybera, or AAV- hLPLS447Xformulations administered via SQ-flank or SQ-hock at the indicated doses (orange shaded area outlines the normal range of endogenous LPL activity in vehicle-treated LPL+ / + mice, n=3-4 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs vehicle-treated LPL- / - mice,# vs Glybera).
[0082] Figure 47 depicts quantification of AAV vector genomes (VG) in the quad and liver of LPL- / - mice treated with Glybera or AAV8 pVR59 administered at the indicated doses via IM, IV, SQ-flank or SQ-hock (dotted line indicates the average background values [vg / ng DNA] observedfrom vehicle treated mice, data below this level are considered negative, n=3-4 mice / group. T- tests: p<0.05 * vs Glybera).
[0083] Figure 48 depicts quantification of fold difference in hLPLS447XmRNA expression in the quad and liver of LPL- / - mice treated with AAV8 pVR59 administered at the indicated doses via IM, IV, SQ-flank or SQ-hock, expressed relatively to LPL- / - mice injected with Glybera at HD (data normalized against 18s rRNA for AACt determination, data expressed as log fold change relative to Glybera administered via the same route of administration, n=3-4 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs Glybera).
[0084] Figure 49 depicts Western blots showing LPL protein expression in the quad and liver of LPL- / - mice treated with control vehicle, Glybera at high dose (1x1012gc / kg) or AAV8 pVR59 administered at the indicated doses via IM, IV, or SQ-flank and SQ-hock
[0085] Figure 50 depicts LPL protein expression in the quad and liver of LPL- / - mice treated with control vehicle, Glybera at high dose (1x1012gc / kg) or AAV8 pVR59 administered at the indicated doses via IM, IV, or SQ-flank and SQ-hock normalized against total protein, data expressed as log fold change relative to vehicle-treated LPL- / - mice, n=2-4 mice / group. One-way ANOVA: Fisher’s LSD: p<0.05 * vs vehicle-treated LPL- / - mice, # vs Glybera administered via the same route of administration.
[0086] Figure 51 depicts hLPL transgene expression assessed via immunohistochemistry in the quad and liver of LPL- / - mice treated with Glybera at high dose (1x1012gc / kg) or AAV8 pVR59 administered at the indicated doses via IM, IV, SQ-flank or SQ-hock (scale bar = 20pm, representative micrographs shown).
[0087] Figure 52 depicts a schematic and experimental results for constructs bearing deletions of WPRE. Panel A shows a schematic representation of AAV8 pVR80 with deletion of WPRE compared to AAV8 pVR59. Panel B shows intracellular hLPLS447X protein expression in mouse myotubes treated with AAV8 pVR80 or AAV8 pVR59, with relative signal intensity quantified using densitometry relative to expression in vehicle treatment shown Panel C. Panel D shows secreted hLPLS447X protein expression, while Panel E shows lipolytic hLPLS447X activity in conditioned media from mouse myotubes treated with AAV8 pVR80 or AAV8 pVR59.
[0088] Figure 53 depicts plasma samples from a LPLD + / + mice or a mouse model of LPLD (LPL- / - mice) following intramuscular administration of control vehicle, AAV8 pVR80, or AAV8 pVR59 at 1x1012gc / kg, showing correction of visible hyperlipidemia in mice treated with AAV8 pVR59 or AAV8 pVR80.
[0089] Figure 54 depicts (top graph) correction of plasma triglycerides (Tg) levels following IM treatment with vehicle control, AAV8 pVR80, or AAV8 pVR59 at the indicated doses in LPL- / - mice; and (bottom graph) correction of plasma cholesterol levels (Tc) following IM treatment with vehicle control, AAV8 pVR80, or AAV8 pVR59 at the indicated doses in LPL- / - mice.
[0090] Figure 55 provides a diagram of constructs with reduced number of CpGs. The description and nucleotide sequence of the elements making up each construct appear in Tables 4 and 6. The number of CpGs in each element is indicated above the corresponding element. The total number of CpGs in each construct is indicated on the right side of the construct sequence.
[0091] Figure 56 depicts intracellular hLPLS447X protein expression in primary human myotubes treated with CpG-depleted AAV8-LPLD vectors compared to AAV8 pVR59.
[0092] Figure 57, panel A depicts signal intensity from Figure 56 quantified using densitometry (data expressed as fold change relative to vehicle treated cells, normalized against total protein, representative microplate shown, n=12 wells, 3 independent experiments. One-Way ANOVA, Fisher’s LSD: p<0.05 * AAV8 pVR59, # vs vehicle). Panel B shows secreted hLPLS447X protein expression in conditioned media of primary human myotubes treated with CpG-depleted AAV8- LPLD vectors compared to AAV8 pVR59 (n=12wells / group, 3 independent experiments. One-way ANOVA. Fisher’s LSD: p<0.05 * AAV8 pVR59, # vs vehicle). Panel C shows lipolytic hLPLS447X activity in conditioned media from primary human myotubes treated with CpG-depleted AAV8- LPLD vectors compared to AAV8 pVR59 (data expressed as fold change relative to vehicle treated cells, n=6-12 wells / group, 3 independent experiments. One-Way ANOVA, Fisher’s LSD: p<0.05 * AAV8 pVR59, # vs vehicle).
[0093] Figure 58 depicts intracellular hLPLS447X protein expression in primary human myotubes treated with immunostimulatory CpG-depleted AAV8-LPLD vectors compared to AAV8 pVR59.
[0094] Figure 59, panel A shows relative signal intensity from Figure 58 quantified using densitometry, (data expressed as fold change relative to vehicle treated cells, normalized against total protein, representative microplate shown, n=12 wells, 3 independent experiments. One-Way ANOVA, Fisher’s LSD: p<0.05 * AAV8 pVR59, # vs vehicle). Panel B shows secreted hLPLS447X protein expression in conditioned media of primary human myotubes treated with immunostimulatory CpG-depleted AAV8-LPLD vectors compared to AAV8 pVR59 (n=12wells / group, 3 independent experiments. One-way ANOVA. Fisher’s LSD: p<0.05 * AAV8 pVR59, # vs vehicle). Panel C shows Lipolytic hLPLS447X activity in conditioned media fromprimary human myotubes treated with immunostimulatory CpG-depleted AAV8-LPLD vectors compared to AAV8 pVR59 (data expressed as fold change relative to vehicle treated cells, n=6- 12 wells / group, 3 independent experiments. One-Way ANOVA, Fisher’s LSD: p<0.05 * AAV8 pVR59, # vs vehicle).
[0095] Figure 60 shows that, following intramuscular (IM) treatment of novel CpG-depleted AAV8-LPLD vectors (1x1012gc / kg) in adult LPL- / - mice, only AAV8 pNC182 resulted in a pronounced correction of plasma lipemia, with plasma becoming visually indistinguishable from LPL+ / + as early as day 10 post-treatment, similar to AAV8 pVR59 (n=3 mice / group, representative images shown, black arrows indicate the time of administration of the novel AAV formulation).
[0096] Figure 61 shows that IM treatment of AAV8 pNC812 in adult LPL- / - mice resulted in a complete normalization of plasma Tg. Similar to AAV8 pVR59, with plasma Tg being indistinguishable from control LPL+ / + mice. (n=3 LPL- / - mice / group, plasma Tg is presented on a log scale, t-test at day 60 vs LPL+ / +).
[0097] Figure 62 depicts a study overview summarizing the experimental protocol in 2-3- month-old LPL- / - mice
[0098] Figure 63 shows IM treatment with AAV8 pNC182, at the indicated doses, in adult LPL- / - mice resulted in a correction of plasma lipemia, with plasma becoming visually indistinguishable from LPL+ / + as early as day 10 post-treatment, and remained persistent for up to 180 days, similar to AAV8 pVR59 treated mice (n=7 mice / group, representative images shown).
[0099] Figure 64 shows that IM treatment of AAV8 pVR59 in adult LPL- / - mice resulted in > 95% reduction in plasma Tg at doses greater than 1x1012gc / kg.
[0100] Figure 65 shows that while AAV8 pNC182 treatment in adult LPL- / - mice resulted in > 96% reduction in plasma TG at doses greater than 5x1011gc / kg, with plasma TG being indistinguishable from control LPL+ / + mice with vectors for up to 180 days. (n=5-7 LPL- / - mice / group, plasma Tg is presented on a log scale, t-test at day 180 vs LPL+ / +, average % reductions from baseline at day 180 shown on graph).DETAILED DESCRIPTION
[0101] Generally, the present disclosure provides recombinant nucleic acid molecules for improved expression of human lipoprotein lipase (hLPL). Also described are recombinant AAV viral particles comprising the recombinant nucleic acid, which may be used in therapeutic applications, such as treating plasma lipidemia and / or lipoprotein lipase deficiency. Furtherdescribed are modes of administration of AAV8 serotype particles that are improved compared to the same amount of alipogene tiparvovec (Glybera™).
[0102] Recombinant Nucleic Acid Molecule
[0103] In one aspect, there is described a recombinant nucleic acid molecule for expressing human lipoprotein lipase (hLPL) comprising the gain of function mutation S447X (hLPLS447X) or a polypeptide having at least 80% sequence identity thereto and comprising the mutation S447X, the recombinant nucleic acid molecule comprising: a transcriptional unit comprising: a promoter for driving expression of the hLPLS447Xor the polypeptide having at least 80% sequence identity thereto, the promoter comprising the sequence of any one of SEQ ID NOs: 13 to 16 or a sequence having at least 80% sequence identity thereto, a coding nucleic acid that encodes the hLPLS447Xor the polypeptide having at least 80% sequence identity thereto, and a polyadenylation signal, wherein the recombinant nucleic acid molecule optionally comprises a truncated woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) comprising the sequence of SEQ ID NO: 19 or comprising a fragment of the sequence of SEQ ID NO: 18, which is positioned downstream with respect to the coding nucleic acid molecule.
[0104] Table 6 is a master table of reference sequences referred to herein.
[0105] As used herein, “hLPLS447X” will be understood as human lipoprotein lipase (hLPL) bearing the naturally occurring gain of function mutation S447X. The sequence of hLPLS447Xis depicted in SEQ ID NO: 3. This mutation is present in approximately 20-25% of the general population and is associated with increased lipolytic function via increased lipoprotein uptake, along with an anti-atherogenic, cardio-protective lipid profile resulting in decreased plasma Tg and increased high-density lipoprotein cholesterol.
[0106] As used herein, “transcriptional unit” will be understood as a sequence of nucleotides that encodes an RNA molecule, along with the sequences necessary for its transcription, such as a promoter, an RNA-coding sequence, and a terminator, such as a polyadenylation signal.
[0107] As used herein, “promoter” will be understood as a sequence of nucleotides to which proteins bind to initiate transcription of an RNA molecule.
[0108] As used herein, “WPRE” will be understood as woodchuck hepatitis virus posttranscriptional regulatory element, which is used in molecular biology to increase transgene expression from a variety of viral vectors. When transcribed, WPRE creates a tertiary structure that enhances expression. The WPRE sequence used in Glybera™ is depicted in SEQ ID NO: 18. It has surprisingly been found that truncating or removing the WPRE can improve expression of hLPLS447Xaccording to some embodiments.
[0109] As used herein, “truncation” or “truncated” and grammatical variations thereof will be understood as referring to a nucleic acid molecule or polypeptide that is shorter than the corresponding naturally occurring nucleic acid or polypeptide. Truncations may be 5' and / or 3' truncations in the case of nucleic acid molecules, and N- and / or C-terminal truncations in the case of polypeptides. For example, the truncated WPRE is shorter than the full-length WPRE depicted in SEQ ID NO: 18.
[0110] As used herein, “polyadenylation signal” will be understood as a signal sequence (often comprising AALIAAA in the RNA molecule), which results in cleavage of an RNA catalyzed by cleavage and polyadenylation specificity factor (CPSF) and addition of a poly(A) tail by polynucleotide adenylyltransferase.
[0111] Where a nucleic acid feature or molecule is described as “encoding” or “coding for” a polypeptide, it will be readily understood that there are numerous ways the polypeptide could be encoded according to the degeneracy of the genetic code.
[0112] Where “percent sequence identity” is referred to, this is to be determined across a full-length alignment of the variant molecule or subject molecule to the parent molecule or reference molecule. These determinations can be readily made, for example, using the “Blast 2 Sequences” tool at the website of the National Centre for Biotechnology Information (NCBI). Sequence variants referred to herein will be generally understood to encompass (i) nucleic acid insertions, deletions, and / or substitutions, or (ii) amino acid insertions, deletions, and / or substitutions, wherein the resultant variant molecule retains substantially the same function as the parent molecule from which it is described. This can be readily tested with the assays described herein.
[0113] Where nucleic acid or amino acid sequences having a particular percent sequence identity to a reference sequence are specified, in some embodiments these sequences will have substantially the same activity as the parent molecule from which they are derived. In some embodiments, they will have the same activity as the parent molecule for which they are derived. Thus, for example, where a recombinant nucleic acid molecule for expressing hLPL is described as having a particular percent sequence identity to a reference sequence, in some embodiments the recombinant nucleic acid molecule will express hLPL at the same level as the reference sequence.
[0114] In one embodiment, the recombinant nucleic acid molecule is for expressing a polypeptide having at least 90% sequence identity to the hLPLS447X(SEQ ID NO: 3), wherein thecoding nucleic acid molecule encodes a polypeptide having at least 90% sequence identity to thehLPLS447X
[0115] In one embodiment, the recombinant nucleic acid molecule is for expressing a polypeptide having at least 95% sequence identity to the hLPLS447X, wherein the coding nucleic acid molecule encodes a polypeptide having at least 95% sequence identity to the hLPLS447X.
[0116] In one embodiment, the recombinant nucleic acid molecule is for expressing a polypeptide having at least 99% sequence identity to the hLPLS447X, wherein the coding nucleic acid molecule encodes a polypeptide having at least 99% sequence identity to the hLPLS447X.
[0117] In one embodiment, the recombinant nucleic acid molecule is for expressing the hLPLS447X, wherein the coding nucleic acid molecule encodes the hLPLS447X.
[0118] In one embodiment, the promoter has at least 90% sequence identity to the sequence of any one of SEQ ID NO: 13 to 16. In one embodiment, the promoter has at least 95% sequence identity to the sequence of any one of SEQ ID NO: 13 to 16. In one embodiment, the promoter has at least 99% sequence identity to the sequence of any one of SEQ ID NO: 13 to 16.
[0119] In one embodiment, the promoter comprises the sequence of any one of SEQ ID NO: 13 to 16.
[0120] In some embodiments, promoters described herein lead to improved expression of hLPLS447Xas compared to a construct derived from Glybera™.
[0121] SEQ ID NO: 13 is what is known in the art as a “CAG” or “CAGG” promoter. This synthetic promoter comprises a ubiquitously-expressing cytomegalovirus promoter early enhancer fused to the promoter, first exon, and first intron of the chicken beta-actin gene promoter (CAG promoter) and the splice acceptor of the rabbit beta-globin gene. In one embodiment, the promoter has at least 90% sequence identity to the sequence of SEQ ID NO: 13. In one embodiment, the promoter has at least 95% sequence identity to the sequence of SEQ ID NO: 13. In one embodiment, the promoter has at least 99% sequence identity to the sequence of SEQ ID NO: 13. In one embodiment, the promoter comprises the sequence of SEQ ID NO: 13. In one embodiment, the promoter consists of the sequence of SEQ ID NO: 13.
[0122] SEQ ID NO: 14 corresponds to the CAGG promoter modified to remove certain CpGs. In one embodiment, the promoter has at least 90% sequence identity to the sequence of SEQ ID NO: 14. In one embodiment, the promoter has at least 95% sequence identity to the sequence of SEQ ID NO: 14. In one embodiment, the promoter has at least 99% sequence identity to the sequence of SEQ ID NO: 14. In one embodiment, the promoter comprises the sequence of SEQ ID NO: 14. In one embodiment, the promoter consists of the sequence of SEQ ID NO: 14.
[0123] SEQ ID NO: 15 corresponds to the CAGG promoter modified to mutate immunostimulatory CpGs. In one embodiment, the promoter has at least 90% sequence identity to the sequence of SEQ ID NO: 15. In one embodiment, the promoter has at least 95% sequence identity to the sequence of SEQ ID NO: 15. In one embodiment, the promoter has at least 99% sequence identity to the sequence of SEQ ID NO: 15. In one embodiment, the promoter comprises the sequence of SEQ ID NO: 15. In one embodiment, the promoter consists of the sequence of SEQ ID NO: 15.
[0124] SEQ ID NO: 16 is a modified version of the CAGG promoter in which the first intron of chicken beta-actin is replaced with a short SV40 intron, with modification to remove CpGs in the SV40 intron. In one embodiment, the promoter has at least 90% sequence identity to the sequence of SEQ ID NO: 16. In one embodiment, the promoter has at least 95% sequence identity to the sequence of SEQ ID NO: 16. In one embodiment, the promoter has at least 99% sequence identity to the sequence of SEQ ID NO: 16. In one embodiment, the promoter comprises the sequence of SEQ ID NO: 16. In one embodiment, the promoter consists of the sequence of SEQ ID NO: 16.
[0125] In some embodiments, the promoter comprises a CMV enhancer, a chicken beta-actin promoter, and the first intron of the chicken beta-actin gene; or comprises sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity thereto. These features may be modified to mutate or remove immunostimulatory CpGs. These features may also be modified to mutate or remove additional CpGs.
[0126] In some embodiments, the promoter comprises a CMV enhancer, a chicken beta-actin promoter, and an SV40 intron; or comprises sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity thereto. These features may be modified to mutate or remove immunostimulatory CpGs. These features may also be modified to mutate or remove additional CpGs.
[0127] In one embodiment, the polyadenylation signal is:
[0128] - a bovine growth hormone (bGH) polyadenylation signal (hGH polyA) comprising the sequence of SEQ ID NO: 20 or comprising a sequence having at least 80% sequence identity thereto,
[0129] - a human growth hormone (hGH) polyadenylation signal (hGH polyA) comprising the sequence of SEQ ID NO: 21 or comprising a sequence having at least 80% sequence identity thereto, or
[0130] - a human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22 or comprising a sequence having at least 80% sequence identity thereto.
[0131] In one embodiment, the polyadenylation signal has at least 90% sequence identity to the bGH polyadenylation signal of SEQ ID NO: 20. In one embodiment, the polyadenylation signal has at least 95% sequence identity to the bGH polyadenylation signal of SEQ ID NO: 20. In one embodiment, the polyadenylation signal has at least 99% sequence identity to the bGH polyadenylation signal of SEQ ID NO: 20. In one embodiment, the polyadenylation signal is the bGH polyadenylation signal (bGH polyA) comprising or consisting of the sequence of SEQ ID NO:20.
[0132] In one embodiment, the polyadenylation signal has at least 90% sequence identity to the hGH polyadenylation signal of SEQ ID NO: 21 . In one embodiment, the polyadenylation signal has at least 95% sequence identity to the hGH polyadenylation signal of SEQ ID NO: 21. In one embodiment, the polyadenylation signal has at least 99% sequence identity to the hGH polyadenylation signal of SEQ ID NO: 21. In one embodiment, the polyadenylation signal is the hGH polyadenylation signal (hGH polyA) comprising or consisting of the sequence of SEQ ID NO:21.
[0133] In embodiment, the coding nucleic acid molecule comprises the sequence of any one of SEQ ID NOs: 4, and 6 to 9; or comprises a sequence having at least 80% sequence identity thereto. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 4, and 6 to 9. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs: 4, and 6 to 9. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to any one of SEQ ID NOs: 4, and 6 to 9. In one embodiment, the coding nucleic acid molecule comprises or consists of the sequence of any one of SEQ ID NOs: 4, and 6 to 9.
[0134] SEQ ID NO: 4 depicts a nucleic acid sequence encoding hLPLS447X. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 4. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 4. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 4. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQID NO: 4. In one embodiment, the coding nucleic acid comprises or consists of the sequence of SEQ ID NO: 4.
[0135] In one embodiment, the coding nucleic acid is codon-optimized according to the cell type in which it is intended to be expressed. For example, in one embodiment the coding nucleic acid is codon-optimized for expression in human cells. SEQ ID NO: 6 depicts an exemplary codon- optimized nucleic acid sequence encoding hLPLS447X. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 6. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 6. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 6. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 6. In one embodiment, the coding nucleic acid comprises or consists of the sequence of SEQ ID NO: 6.
[0136] In one embodiment, the coding nucleic acid is modified to remove or reduce CpG dinucleotides. SEQ ID NO: 7 depicts an exemplary nucleic acid sequence with a reduced number of CpGs compared to SEQ ID NOs: 4 and 6. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 7. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 7. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 7. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 7. In one embodiment, the coding nucleic acid comprises or consists of the sequence of SEQ ID NO: 7.
[0137] In one embodiment, the coding nucleic acid is both codon-optimized and modified to remove or reduce CpGs. SEQ ID NO: 8 depicts an exemplary sequence having such features. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 8. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 8. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 8. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 8. In one embodiment, the coding nucleic acid comprises or consists of the sequence of SEQ ID NO: 8.
[0138] In one embodiment, the coding nucleic acid is modified to mutate immunostimulatory CpGs. SEQ ID NO: 9 depicts an exemplary sequence having such features in addition to being codon-optimized. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 9. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 9. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 9. In one embodiment, the coding nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 9. In one embodiment, the coding nucleic acid comprises or consists of the sequence of SEQ ID NO: 9.
[0139] In one embodiment, the transcriptional unit is flanked by 5' and 3' inverted terminal repeats (ITRs).
[0140] As used herein, “inverted terminal repeats” refers to the palindromic, or at least partially palindromic sequences present at the end of adeno-associated virus (AAV) viral genomes. They are cis-elements required for genome rescue, replication, packaging, and vector persistence. In biotechnology, they are used to make an AAV transfer plasmid for packaging of transgenes into recombinant AAV particles (rAAV).
[0141] In one embodiment, the 5' and 3' ITRs are from an adeno-associated virus of serotype 2 (AAV2) and comprise, respectively, the sequences of SEQ ID NOs: 10 and 11 , or sequences having at least 80% sequence identity thereto. In one embodiment, the 5' and 3' comprise sequences having at least 90% sequence identity to SEQ ID NOs: 10 and 11 , respectively. In one embodiment, the 5' and 3' comprise sequences having at least 95% sequence identity to SEQ ID NOs: 10 and 11 , respectively. In one embodiment, the 5' and 3' comprise sequences having at least 95% sequence identity to SEQ ID NOs: 10 and 11 , respectively. In one embodiment, the 5' and 3' ITRs comprise, respectively, the sequences of SEQ ID NOs: 10 and 11. In one embodiment, the 5' and 3' ITRs consist of, respectively, the sequences of SEQ ID NOs: 10 and 11.
[0142] In one embodiment, the truncated WPRE is present in the recombinant nucleic acid molecule.
[0143] In some embodiments, the truncated WPRE comprises a sequence shorter than SEQ ID NO: 18. In some embodiments, the truncated WRPE is shorter than SEQ ID NO: 18 and hasat least 80%, 85%, 90%, 95%, or 95% sequence identity to SEQ ID NO: 18 across an aligned portion.
[0144] SEQ ID NO: 19 depicts one exemplary truncated WPRE comprising a sequence modification. SEQ ID NO: 19 contains an open-reading frame (ORF) encoding a truncated peptide of the woodchuck hepatitis virus X protein (WHX), which is a transcriptional activator implicated in the development of liver tumors. The truncation is relative to SEQ ID NO: 18. The truncated WPRE of SEQ ID NO: 19 has mutations in the X-protein promoter and in the ATG so that X-protein (and / or portion of it) will not be produced. In some embodiments, the truncated WPRE comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity to the sequence of SEQ ID NO: 19. In one embodiment, the truncated WPRE comprises the sequence of SEQ ID NO: 19. In one embodiment, the truncated WPRE consists of the sequence of SEQ ID NO: 19.
[0145] In one embodiment, the recombinant nucleic acid molecule comprises a sequence at least 80% sequence identity to the sequence of SEQ ID NO: 33 (from pVR59). In one embodiment, the recombinant nucleic acid molecule comprises a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 33 (from pVR59). In one embodiment, the recombinant nucleic acid molecule comprises a sequence having at least 95% sequence identity to the sequence of SEQ ID NO: 33 (from pVR59). In one embodiment, the recombinant nucleic acid molecule comprises a sequence having at least 99% sequence identity to the sequence of SEQ ID NO: 33 (from pVR59). In one embodiment, the recombinant nucleic acid molecule comprises the sequence of SEQ ID NO: 33 (from pVR59). In one embodiment, the recombinant nucleic acid molecule consists of the sequence of SEQ ID NO: 33 (from pVR59).
[0146] In one embodiment, the recombinant nucleic acid molecule does not comprise either the WPRE or any truncation thereof. In one embodiment, the recombinant nucleic acid molecule is entirely free of both WPRE and WPRE-derived sequences.
[0147] In one embodiment, the recombinant nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 35 (from pVR80). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 90% sequence identity to the sequence of SEQ ID NO: 35 (from pVR80). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 95% sequence identity to the sequence of SEQ ID NO: 35 (from pVR80). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 99% sequence identity to the sequence of SEQ ID NO: 35 (from pVR80). In one embodiment, the recombinant nucleic acid moleculecomprises the sequence of SEQ ID NO: 35 (from pVR80). In an embodiment, the recombinant nucleic acid molecule consists of the sequence of SEQ ID NO: 35 (from pVR80).
[0148] In one embodiment, the polyadenylation signal is the human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22 or a sequence having at least 80% sequence identity thereto. In one embodiment, the polyadenylation signal is the human p-globin polyadenylation signal comprising a sequence of SEQ ID NO: 22 or the sequence having at least 85% sequence identity thereto. In one embodiment, the polyadenylation signal is the human p- globin polyadenylation signal comprising the sequence of SEQ ID NO: 22 or a sequence having at least 90% sequence identity thereto. In one embodiment, the polyadenylation signal is the human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22 or a sequence having at least 95% sequence identity thereto. In one embodiment, the polyadenylation signal is the human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22 or a sequence having at least 98% sequence identity thereto. In one embodiment, the polyadenylation signal is the human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22.
[0149] In one embodiment, the recombinant nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 37 (from pNC201). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 90% sequence identity to the sequence of SEQ ID NO: 37 (from pNC201). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 95% sequence identity to the sequence of SEQ ID NO: 37 (from pNC201). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 99% sequence identity to the sequence of SEQ ID NO: 37 (from pNC201). In one embodiment, the recombinant nucleic acid molecule comprises the sequence of SEQ ID NO: 37 (from pNC201). In an embodiment, the recombinant nucleic acid molecule consists of the sequence of SEQ ID NO: 37 (from pNC201).
[0150] In one embodiment, the recombinant nucleic acid molecule comprises a sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 38 (from pNC182). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 90% sequence identity to the sequence of SEQ ID NO: 38 (from pNC182). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 95% sequence identity to the sequence of SEQ ID NO: 38 (from pNC182). In one embodiment, the recombinant nucleic acid molecule comprises a sequence that is at least 99% sequence identity to the sequence of SEQ ID NO: 38 (from pNC182). In one embodiment, the recombinant nucleic acid moleculecomprises the sequence of SEQ ID NO: 38 (from pNC182). In an embodiment, the recombinant nucleic acid molecule consists of the sequence of SEQ ID NO: 38 (from pNC182).
[0151] In one embodiment, the recombinant nucleic acid molecule is a single stranded DNA (ssDNA) molecule, a double stranded DNA (dsDNA) molecule, a single stranded RNA (ssRNA) molecule, or a double stranded RNA (dsRNA) molecule.
[0152] In one embodiment, the recombinant nucleic acid molecule is a double stranded DNA (dsDNA) molecule.
[0153] In one embodiment, the recombinant nucleic acid molecule is a single stranded DNA (ssDNA) molecule.
[0154] Jn one embodiment, the recombinant nucleic acid molecule is a double stranded RNA (dsRNA) molecule.
[0155] In one embodiment, the recombinant nucleic acid molecule is a single stranded RNA (ssRNA) molecule.
[0156] In one embodiment, the recombinant nucleic acid molecule is a messenger RNA (mRNA).
[0157] Vectors, Plasmids, Host Cells, and Viral Particles
[0158] In one aspect, there is provided a vector comprising the recombinant nucleic acid molecule as defined herein. In one embodiment, the vector is a plasmid vector. In one embodiment, the plasmid is an adeno-associated virus (AAV) transfer plasmid.
[0159] In one aspect, there is provided a host cell comprising the nucleic acid molecule as defined herein. In one embodiment, the host cell is a cell line. In one embodiment, the host cell is a human cell. In one embodiment, the host cell is a human cell line.
[0160] In one aspect, there is provided a recombinant viral particle comprising the recombinant nucleic acid molecule as defined herein.
[0161] In one aspect, there is provided a recombinant AAV viral particle (rAAV) comprising the nucleic acid molecule as defined herein.
[0162] An “rAAV” will be understood as an AAV viral particle that lacks endogenous viral DNA and is essentially a protein-based nanoparticle engineered to traverse the cell membrane, where it can ultimately traffic and deliver exogenous DNA cargo into the nucleus of a cell. An rAAV can be produced by replacing the wild type AAV open reading frames with a desired nucleic acid molecule.
[0163] In one embodiment, the rAAV has capsid proteins of serotype 8 (AAV8).
[0164] In one embodiment, the rAAV has capsid proteins of serotype 1 (AAV1).
[0165] Compositions
[0166] In one aspect, there is provide a composition comprising the recombinant nucleic acid molecule as defined herein, the vector as described herein, the recombinant viral particle as described herein, or the rAAV as described herein together with an acceptable excipient, diluent, or carrier.
[0167] In one aspect, there is provide a pharmaceutical composition comprising the recombinant nucleic acid molecule as defined herein, the vector as described herein, the recombinant viral particle as described herein, or the rAAV as described herein together with a pharmaceutically acceptable excipient, diluent, or carrier.
[0168] Delivery and Therapeutic Methods, Uses, and Kits
[0169] Methods
[0170] In one aspect, there is provided a method of delivering the recombinant nucleic acid molecule as defined herein to a cell comprising contacting the cell with the vector or the recombinant viral particle as defined herein.
[0171] In one aspect, there is provided a method of delivering the recombinant nucleic acid molecule as defined herein to a cell comprising contacting the cell with the rAAV as defined herein.
[0172] In one aspect, there is provided a method of treating plasma lipidemia comprising administering to a subject the rAAV as defined herein.
[0173] In one aspect, there is provided a method of treating lipoprotein lipase deficiency in a subject comprising administering to a subject the rAAV as defined herein.
[0174] In one embodiment, the step of administering is intramuscular (IM) administration, intravenous (IV) administration, or subcutaneous (SQ) administration.
[0175] In one embodiment, the step of administering is the IM administration. In one embodiment, the rAAV is of the AAV8 serotype and the rAAV is administered at an amount that is about one tenth of an amount of Glybera™ required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about twice as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about five times as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of Glybera™.
[0176] In one embodiment, the step of administering is IV administration. In one embodiment, the rAAV is of the AAV8 serotype and the rAAV is administered at an amount that is about one hundredth of an amount of Glybera™ required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount ofGlybera™. In one embodiment, the rAAV of serotype AAV8 is at least about fifty times as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about one hundred times as efficacious as an equivalent amount of Glybera™.
[0177] Uses
[0178] In one aspect, there is provided a use, for delivering the recombinant nucleic acid molecule as defined herein to a cell, of the vector or the recombinant viral particle as defined herein.
[0179] In one aspect, there is provided a use of the rAAV as defined herein for delivering the recombinant nucleic acid molecule as defined herein.
[0180] In one aspect, there is provided a use of the rAAV as defined herein for treatment of plasma lipidemia.
[0181] In one aspect, there is provided a use of the rAAV as defined herein for treatment of lipoprotein lipase deficiency in a subject.
[0182] In one embodiment, the rAAV is for intramuscular (IM), intravenous (IV), or subcutaneous (SQ) use.
[0183] In one embodiment, the rAAV is for IM use. In one embodiment, the rAAV is of the AAV8 serotype and is for use at an amount that is about one tenth of an amount of Glybera™ required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about twice as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about five times as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of Glybera™.
[0184] In one embodiment, the rAAV is for IV use. In one embodiment, the rAAV is of the AAV8 serotype and is for use at an amount that is about one hundredth of an amount of Glybera™ required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about fifty times as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about one hundred times as efficacious as an equivalent amount of Glybera™.
[0185] In one aspect, there is provided the rAAV as defined here for use in treatment of plasma lipidemia in a subject.
[0186] In one aspect, there is provided the rAAV as defined here for use in treatment of lipoprotein lipase deficiency in a subject.
[0187] In one embodiment, the rAAV is for intramuscular (IM), intravenous (IV), or subcutaneous (SQ) use.
[0188] In one embodiment, the rAAV is for IM use. In one embodiment, the rAAV is of the AAV8 serotype and is for use at an amount that is about one tenth of an amount of Glybera™ required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about twice as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about five times as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of Glybera™.
[0189] In one embodiment, the rAAV is for the IV use. In one embodiment, the rAAV is of the AAV8 serotype and is for use at an amount that is about one hundredth of an amount of Glybera™ required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about fifty times as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about one hundred times as efficacious as an equivalent amount of Glybera™.
[0190] Kits
[0191] In one aspect, there is provided a kit for use in delivering the recombinant nucleic acid molecule as defined herein to a cell, comprising the vector or the recombinant viral particle as defined herein together with instructions for delivery to a cell.
[0192] In one aspect, there is provided a kit for use in delivering the recombinant nucleic acid molecule as defined herein, comprising the rAAV as defined herein together with instructions for delivery to a cell.
[0193] In one aspect, there is provided a kit for use in treatment of plasma lipidemia, comprising the rAAV as defined herein together with instructions for treatment of plasma lipidemia.
[0194] In one aspect, there is provided a kit for use for treatment of lipoprotein lipase deficiency in a subject, comprising the rAAV as defined herein together with instructions for treatment of lipoprotein lipase deficiency.
[0195] In one embodiment, the instructions are for intramuscular (IM), intravenous (IV), or subcutaneous (SQ) use.
[0196] In one embodiment, the instructions are for the IM use. In one embodiment, the rAAV is of the AAV8 serotype and is for use an amount that is about one tenth of an amount of Glybera™ required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at leastabout twice as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about five times as efficacious as an equivalent amount of Glybera™ . In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of Glybera™.
[0197] In one embodiment, the instructions are or IV use. In one embodiment, the rAAV is of the AAV8 serotype and is for use an amount that is about one hundredth of an amount of Glybera™ required to achieve the same effects. In one embodiment, the rAAV of serotype AAV8 is at least about ten times as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about fifty times as efficacious as an equivalent amount of Glybera™. In one embodiment, the rAAV of serotype AAV8 is at least about one hundred times as efficacious as an equivalent amount of Glybera™.
[0198] Where efficacy is referred to in the method, use, and kit embodiments described herein an above, this may be assessed in terms of expression of hLPL hLPLS447X.
[0199] Where amounts are specified in comparison to Glybera, in the method, use, and kit embodiments described herein an above, it will be understood that equivalent viral particle counts are intended to be compared. Thus, for example, expression per viral particle could be compared. Thus, for example, if an effective dose of Glybera is 1x1013gc / kg, an rAAV that is described as ten times more efficacious could be used at 1x1012gc / kg. For example, if an effective dose of Glybera is 1x1013gc / kg, an rAAV that is described as one hundred times more efficacious could be used at 1x1011gc / kg.
[0200] Production Methods for rAAVs
[0201] In one aspect, there is provided a method of producing recombinant AAV viral particles (rAAVs) comprising transfecting cells with a transfer plasmid comprising the recombinant nucleic acid molecule as defined herein, wherein the cells express AAV components required for packaging the recombinant nucleic acid molecule into rAAV particles, culturing the cells to produce the rAAVs, and isolating the rAAVs.
[0202] In one embodiment, the cells express AAV rep and cap proteins, AAV E2 and E4A proteins and AAV virus-associated (VA) RNAs.
[0203] In one embodiment, the method further comprises transfecting or co-transfecting the cells with: a plasmid encoding AAV rep and cap proteins, and a helper plasmid encoding AAV E2 and E4A proteins and AAV virus-associated (VA) RNAs.
[0204] In one embodiment, the rAAVs are of adeno-associated virus serotype 8.
[0205] In one embodiment, the rAAVs are of adeno-associated virus serotype 1.
[0206] In one embodiment, the method is an in vitro method.
[0207] EXAMPLES
[0208] Overview
[0209] Herein, the biodistribution properties and efficacy of several novel AAV gene therapy formulations were designed, tested and compared against Glybera. To this end, the AAV1 serotype as originally utilized in Glybera was used, or a novel AAV serotype, adeno-associated virus serotype 8 (AAV8) was used. The AAVs encoded either a luciferase (luc) transgene (biodistribution studies) or a hLPLS447Xtransgene (efficacy studies), driven by either the synthetic CAG promoter comprising a ubiquitously-expressing cytomegalovirus promoter early enhancer fused to the promoter, first exon, and first intron of the chicken beta-actin gene and the splice acceptor of the rabbit beta-globin gene, or a muscle-specific AUSEx4 promoter2728. The CAG promoter is sometimes referred to as the “CAGG” promoter and is part of the “pCAGGS” expression vector. It is not a promoter alone in the strict sense, as it includes a part of the transcribed sequence (the first exon and the first intron of chicken beta-actin gene) and enhancer elements.
[0210] AAV formulations were administered via IM injection, as originally utilized for Glybera, or via novel routes of administration, including intravenous (IV) and subcutaneous (SQ) routes in wild-type mice (biodistribution studies) and in a mouse model of LPLD (efficacy studies). In summary, these studies identify a novel AAV-hLPLS447Xformulation utilizing the AAV8 serotype in conjunction with a CAG promoter, (AAV8 pVR59) that results in skeletal muscle and / or hepatic transgene expression, depending on the route of administration, which results in a significant improvement in therapeutic efficacy compared to Glybera at 10-fold lower doses in a mouse model of LPLD. These studies suggest that it is feasible to redevelop a superior AAV-based gene therapy product for the treatment of LPLD that can ultimately be delivered at lower doses and in turn be available to patients at significantly lower costs compared to Glybera.
[0211] Materials and Methods
[0212] Adenovirus production
[0213] Recombinant adenovirus (human adenovirus serotype 5 AE1 / E3) encoding the hLPLS447Xtransgene (AdV- hLPLS447X) driven by a CMV promoter was used for rescue of neonatal LPL- / - mice, as described previously9 11. AdV- hLPLS447Xwas produced by VectorBuilder (Chicago, Illinois). AdV- hLPLS447Xexpression cassette design is provided in Figure 1. AdV- hLPLS447Xwas further amplified, using BMAdEI # 78-42 and SF-BMAdR#281 cell lines as described previously29. AdV-hLPLS447Xwas purified by ultracentrifugation using double CsCIgradients, as described previously30. Infectious titers were determined and calculated as the median tissue culture infective dose (TCID50) / ml31. Successful expression and enzymatic activity of hLPLS447Xfollowing infection was confirmed in HEK293A cells (data not shown).
[0214] Design and cloning of novel AAV expression cassettes
[0215] Novel AAV expression cassette formulations were constructed using the pAAV-MCS promoterless expression vector with inverted terminal repeats (ITR) from AAV2 and the human growth hormone (hGH) polyadenylation signal (hGH PolyA) (Cell Biolabs). Sequences of all expression cassettes were confirmed by Sanger sequencing (Genome Quebec). AAV expression cassettes encoding the luc transgene driven by a ubiquitously-expressing cytomegalovirus promoter enhancer fused to the chicken beta-actin (CAG) promoter (referred to as pVR52) were constructed by replacing the c2G4 antibody gene from pAAV-c2G4 (Robert et al, 2018) with the firefly luc gene derived from pGL3-Promoter cloning vector (Promega, GenBank: U47298.2), WPRE589bpfrom pCDH-CuO-MCS-T2A-copGFP, System Biosciences, Palo Alto, CA) and hGH polyA27’32. AAV expression cassettes encoding the luc transgene driven by a CMV promoter (referred to as pVR61) or the muscle specific promoter AUSEx4 (referred to as pVR56) were constructed by replacing the CAG promoter from pVR52 with the CMV promoter or the AUSEx4 promoter, respectively28. All AAV-luc expression cassette designs are depicted in Figure 2, which shows structural diagrams of novel AAV serotypes and expression cassettes encoding luc (ITR; inverted terminal repeat, WPRE, Woodchuck Hepatitis Virus (WHV) posttranscriptional regulatory element; hGH, human growth hormone). The expression cassette for Glybera (pVR58), exactly as described previously, consisting of a CMV promoter, hLPLS447Xtransgene, WPRE729bpand a bovine growth hormone (bGH) polyadenylation signal (bGH PolyA) was synthesized by GenScript for cloning into pAAV-MCS8’920-25. A novel codon-optimized hLPLS447Xtransgene (C.O hLPLS447X) for maximizing protein expression was developed and synthesized by GenScript. Novel AAV expression cassettes encoding the C.O hLPLS447Xtransgene driven by a CAG promoter (referred to as pVR59), was constructed by replacing the luc transgene in pVR52 with the C.O hLPLS447Xtransgene. AAV expression cassettes encoding the C.O hLPLS447Xtransgene driven by AUSEx4 (referred to as pVR60) was constructed by replacing the CAG promoter of pVR59 with the AUSEx4 promoter28. A control AAV expression cassette (referred to as pVR67) to assess the impact of the change in the WPRE sequence (WPRE729bpand WPRE589bp) and the PolyA sequence (bGH PolyA and hGH PolyA) was constructed by replacing WPRE729bpand bGH polyA sequence from pVR58 with the novel WPRE589bpsequence and hGH polyA isolated from pVR59. A control AAV expression cassette (refereed to as pVR74) to assess the impact of codon-optimization of the hLPLS447Xtransgene was constructed by replacing the luc transgene from pVR61 with C.O hLPLS447Xtransgene isolated from pVR60. Some of the AAV-hLPLS447Xexpression cassette designs are provided in Figure 3.
[0216] The presence of unmethylated CpG motifs within an AAV vector has been shown to lead to the activation of a deleterious TLR9-mediated immune response which has been associated with drastically reduced treatment longevity and clinical failure. To reduce the number of CpG motifs in AAV8 pVR59, several constructs were created and tested where 1) WPRE element has been removed, 2) the CAG promoter has been replaced with the NRC CB promoter with a lower CpG count, 3) the sequence of the LPL transgene has been modified by removing all CpG motifs and 4) a polyadenylation signal that does not contain any CpG motifs has been used (human p- globin polyA). These new DNA elements (nucleotide sequences listed in Table 6) were ordered from a gene synthetizing company and they were assembled into the constructs described in Table 4 and Figures 52 and 55 using standard methods of molecular biology.
[0217] Based on the relatively poor efficacy associated with elimination of CpG motifs within the AAV8 pVR59-based variants, another round of optimization was carried out, this time focusing on the removal of specifically immunostimulatory CpG elements from AAV8 pVR59. Immunostimulatory CpG with the following sequence: R-D-C-G-Y-Y (where R = A or G; D = A, G or T; Y = C or T) were replaced by neutral CpG in which the nucleotide 5’ to the C-G is replaced by a C (example: AGCGCC became ACCGCC). DNA elements without immunostimulatory CpG were ordered from a gene synthetizing company and assembled into the constructs described in Table 4 and Figure 55 using standard method of molecular biology.
[0218] AAV production
[0219] HEK293SF-3F6 cells were used for AAV production33. Briefly, HEK293SF-3F6 cells were grown and maintained as a suspension culture in serum-free BalanCD HEK293 medium (FujiFilm) supplemented with 4 mM L-Glutamine (Cytiva), propagated at 37°C in 5% CO2. HEK293SF-3F6 cells were triple transfected at a mass ratio of 1 :1 :1 for AAV production using PEI Pro (Polyplus). The total plasmids were supplied at 1 pg / ml culture volume and PEI Pro to DNA ratio was 2:1. The rep / cap plasmid contained the rep of AAV2 serotype and capsid of either AAV1 or AAV8 (GENEMEDI). The transgene expression cassette plasmids contained the ITR-to-ITR sequences encoding the luc or hLPLS447Xtransgenes, as described above. The adenovirus helper-functions were supplied by pHelper plasmid that contained genes for E4 and E2A proteins and VA RNAs (Cell Biolabs). AAV productions were done in 5 L Thomson Optimum Growth™ Flasks with a working volume of 2.5 L in an incubator on a rotary shaker at a speed of 110 rpmwith a shaking throw of 25 mm at 37°C. Transfected cells were harvested at 72 hours (h) post transfection.
[0220] AAV lysis and purification
[0221] AAV lysis was carried out as described previously with slight modifications34. Briefly, 72h following transfection of HEK293SF-3F6 cells, 1 % (v / v) of lysing buffer concentrate (200 mM MgCh, 1% Triton X-100) and 1% (v / v) of freshly diluted Benzonase 2.5 units / mL (U / rnL) (Merck) was introduced to the cells. After 2h of incubation at 37°C with agitation, concentrated MgSC t was added to obtain a final concentration of 37.5 mM, the solution was incubated further for 30 minutes (min), as described previously35. The addition of MgSC t was necessary to avoid AAV aggregation and AAV binding to other cellular components released during lysis. The lysed harvest was clarified using 5" SUPRAcaplOO NP5LPDH41 0.5-15 pm 0.025 m2(PALL) filters at a flow rate of 167 ml / min (flux of 400LMH). Filters were pre-wetted with 2.5L of Milli-Q® water at 600 ml / min and conditioned with 10mM Tris pH 7.5 and 0.1 % Kolliphor® P 188. The clarified material was then concentrated with tangential flow filtration (TFF) using hollow fibers with surface area of 1600cm2, 70kDa Molecular weight cut off (Repligen®). Prior to use, the hollow fiber membranes were washed with Milli-Q water by permeating 2 ml / cm2. The crossflow rate was supplied by a MasterFlex® L / S Standard Digital Drive pump (Cole Palmer) at 552 ml / min to get maximum shear rate at the inlet of the hollow fiber of 3000 sec1with a constant transmembrane pressure (TMP) of 5 psi using a KrosFlo® Digital Pressure Monitor (Repligen). TFF was done in a continuous mode where the fresh feed was continuously added in vacuum sealed reservoir at the rate of permeate flow. The starting lysate was concentrated by approximately 30-fold. The membrane was rinsed with 10 ml of the Buffer A (20mM Tris pH 7.5, 150 mM MgSO4) and the final retentate volume containing AAV was approximately 80 ml. The TFF concentrate was then purified by iodixanol step gradient protocol, as described previously36, lodixanol concentration gradients of 15, 25, 40 and 54% were generated. The 15% iodixanol concentration also contained 600 mM MgSO4 to avoid aggregation of AAV with other cellular proteins and negatively charged nuclear or cellular components. Solutions were ultracentrifuged at 385,000 x g for 1 h and 35 min (Beckman Optima L-80 XP). After ultracentrifugation, 5 ml of solution was withdrawn from 2 mm below the 40 / 54% interface. The pooled purified AAVs containing iodixanol was first diluted in Buffer A and iodixanol concentration was reduced by TFF using 70kD Mol wt cut off hollowfiber (Repligen) equilibrated with the dilution buffer containing 0.1% Kolliphor P 188 at TMP of 2.5 psi with pump flow rates of 106 ml / min that generated shear rate of 4000 sec1at the inlet of the hollowfiber. The concentration was followed by diafiltration with 20 mM Tris 75 mM SodiumCitrate, pH 7.5 by 10 diafiltration volumes in continuous mode. The membrane was rinsed with formulation buffer and pooled to the diafiltered and concentrated AAV to get the final volume between 2 and 4 ml. Kolliphor P 188 was added to get the final concentration of 0.001% (w / v) before freezing aliquots.
[0222] AAV titer quantification using digital droplet PCR
[0223] The concentration of purified AAVs was quantified by digital droplet (ddPCR) using the Bio-Rad® QX200 droplet generator and reader, along with the Eppendorf® Master Cycler X50s. Briefly, purified AAV preparations were diluted in 0.05% Pluronic, 2 pg / ml Sheared Salmon Sperm DNA and were added to the master mix containing EvaGreen® supermix, 0.4 mg / ml BSA and 0.1 pM of each, forward and reverse primer, targeting the ITR regions (GGAACCCCTAGTGATGGAGTT, CGGCCTCAGTGAGCGA). Thermal cycling was carried out according to the Bio-Rad protocol with the following modifications: the first step, enzyme activation, was increased to 95°C for 10 min, the annealing and the extension steps were performed at 59°C for 1 min, and 72°C for 30 s, respectively, and the cycles were repeated 35 times. Data was acquired and analyzed using QX Manager™ Software. The final concentrations of the AAV preparations were adjusted to > 1x1012genome copies / ml (gc / ml).
[0224] Human and mouse cell culture studies
[0225] Human primary skeletal muscle cells (HSkMCs) were purchased from ATCC, propagated in Skeletal Muscle Cell Growth Medium (Promocell) and differentiated into myotubes using Skeletal Muscle Differentiation Medium (Promocell) on fibronectin coated plates. C2C12 mouse myoblasts were purchased from ATCC, propagated in 10% fetal bovine serum in DMEM (4500 mg / L glucose) (Hyclone) supplemented with Glutamax® (Thermo Fisher) and differentiated into myotubes using 2% horse serum in DMEM (4500 mg / L glucose) (Hyclone®) supplemented with Glutamax (Thermo Fisher). Mature human or mouse myotubes (4 days post-differentiation) were pre-treated with hydroxyurea (2mM, 18h) and infected with AAV-hLPLS447Xformulations at a multiplicity of infection (MOI) of 1x105gc / cell, or otherwise indicated in black, clear-bottom 96-well plates. H eparin-treated (Fresenius Kabi) (20U / ml, 4h) conditioned media and cells were collected 4 days following infection for downstream analysis. Human hepatocellular carcinoma cell line (HepG2) was purchased from ATCC and propagated in 10% fetal bovine serum in DMEM (4500 mg / L glucose) (Hyclone) supplemented with Glutamax (Thermo Fisher). HepG2 cells were pretreated with hydroxyurea (2mM, 18h) and infected with AAV-hLPLS447Xformulations at a MOI of 1x105gc / cell, or otherwise indicated in black, clear-bottom 96-well plates. H eparin-treated(Fresenius Kabi) (20U / ml, 4h) conditioned media and cells were collected 2 days following infection for downstream analysis. All cell lines were propagated at 37°C in 5% CO2.
[0226] Animals
[0227] LPL- / - mice were obtained via breeding as described previously9 11. LPL- / - pups shortly after birth (within 24-48h) exhibit extreme HTG and chylomicronemia resulting in severe cyanosis and neonatal death37. LPL- / - pups were rescued on the day of birth by IM administration (1 injection site / hindlimb) of 1x108plaque forming units (pfu) of AdV-hLPLS447X, as described previosuly9 11. Genotypes were determined by PCR-based genotyping after weaning. C57BL / 6J wild-type mice used for biodistribution studies were purchased from Charles River. All animals were maintained on a C57BL / 6J background and raised on regular rodent diet with free access to water. All procedures involving animals were performed in accordance with protocols from the CCAC (Canadian Council for Animal Care).
[0228] Administration of AAV formulations in mice
[0229] For AAV-luc biodistribution studies, C57BL / 6J were enrolled in studies at 6-8 weeks of age. For AAV-LPLD efficacy studies, LPL- / - mice or control LPL+ / + littermates were enrolled into studies at 2-3 months of age. Mice were administered with either 1x1012gc / kg of AAV-luc formulations (Figure 2) by either IM, IV, or SQ route of administration. Mice were administered with either 1x1011gc / kg (LD, low dose) or 1x1012gc / kg (HD, high dose) of AAV-hLPLS447Xformulations (Figure 3) by either IM, IV, or SQ route of administration. IM injections were administered to anesthetized mice within the hindlimb via one or two injection sites I hindlimb. IV injections were administered via the tail vein or retro-orbitally to anesthetized mice. SQ injections were either administered in the flanks (SQ-Flank) via 4 injection sites or in the hock (SQ-Hock) via 1 injection site / leg, as described previously38. A sterile PBS AAV dilution buffer containing 0.001 % Pluronic was used for all studies after confirming no impact on primary study outcomes (plasma triglycerides) after administration of an AAV-luc formulation in wild-type mice (data not shown).
[0230] AAV-luc bioluminescence imaging (BLI)
[0231] After AAV-luc administration, bioluminescence imaging (BLI) of AAV-luc expression in mice was performed twice a week for a period of 60 days using an IVIS-Lumina III (Perkin Elmer; Massachusetts, USA) preclinical imager. Briefly, prior to each imaging scan, animals were anesthetized with 2.5% isoflurane, injected SQ with 150 mg / Kg D-luciferin (Perkin Elmer) and imaged in dorsal and ventral position 20 min later (at the peak of bioluminescence emission). The conditions for BLI acquisition were as follows: open emission filter, blocked excitation filter, autoexposure time and binning medium. At the end of the experiment (day 60 after AAV-luc administration), animals were sacrificed under deep anesthesia and the organs (liver, muscle, spleen, heart, skin, white adipose tissue and brain) collected and imaged ex vivo. Images were analyzed for total flux (p / s) with the Living Image 4.1 software (PerkinElmer).
[0232] In vivo plasma lipid assessment
[0233] Fasted (4 h) blood samples were collected via the saphenous vein in Microvette® CB 300 Lithium-heparin coated tubes (Sarstedt Inc) before AAV-hLPLS447Xadministration (day 0) and then at regular intervals (day 10, 20, 40 and 80) for the duration of the experiment after AAV- hLPLS447Xadministration. Plasma was collected by centrifugation at 3,500xg for 5 min at 4°C. Plasma Tg were assessed using the colorimetric Infinity™ Triglycerides Liquid Stable Reagent (Thermo Fisher). Plasma total cholesterol (Tc) were assessed using the colorimetric Infinity Cholesterol Liquid Stable Reagent (Thermo Fisher). Absorbance values (500nm) were measured using a POLARstar® Omega plate reader (BMG Labtech), with concentrations (mg / dl) extrapolated using either a Glycerol Standard Calibrator (Sigma) for triglycerides or a Cholesterol Standard Calibrator (Pointe Scientific).
[0234] Lipoprotein lipase (LPL) assessment
[0235] For LPL assessment in plasma, fasted (4 h) plasma was collected via the saphenous vein 10 min after IV (retro-orbital) injection of 0.1 U / g heparin (Fresenius Kabi) in Microvette CB 300 Lithium-heparin coated tubes (Sarstedt Inc). Plasma was collected by centrifugation at 3,500xg for 5 min at 4°C. Plasma LPL protein was assessed using a home-made sandwich ELISA. Briefly, high binding ELISA plates (Corning) were coated with an IgY-LPL antibody (peptide sequence: CHDKSLNKKSGG, produced by Pacific Immunology), diluted plasma samples were loaded, and human LPL was detected using a mouse monoclonal antibody specific against human LPL (LPL-5D2) (Bio-Rad). Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP (Thermo Fisher) was used for detection, followed by colorimetric development using 1-Step™ Ultra TMB-ELISA Substrate Solution (Thermo Fisher). Absorbance values (450nm) were measured using a POLARstar Omega plate reader (BMG Labtech), with concentrations (ng / ml) extrapolated using recombinant human recombinant hLPL (Novus Biologicals).
[0236] For lipolytic LPL activity assessment in plasma, EnzChek™ Lipase Substrate, green fluorescent, 505 / 515 (Thermo Fisher) was used, as described previously39. Briefly, plasma lipase activity was assessed using: 25pl of diluted (1 :100) plasma samples mixed with a 25pl of 4x LPL activity buffer (0.6M NaCI, 80mM Tris-HCI, pH8.0, 0.05% Zwittergent, 6% FA-Free BSA), along with 25pl of 4pM EnzChek lipase substrate solution. Plasma samples from AAV-hLPLS447X-treatedmice were incubated with or without LPL-5D2 antibody (Bio-Rad) to specifically inhibit human LPL (30 min, room temperature [RT]). In cases where LPL activity was measured from LPL+ / + mice (mLPL, mouse LPL), plasma was incubated with or without nANGPTL4 (recombinant protein produced in house, pNIC-Bio3 ANG4 26-164 plasmid provided generously by Dr. Saskia B. Neher) to inhibit both mouse (endogenous LPL) and human LPL (30 min, RT). Fluorescence values (485nm ex I 510nm em) were measured using a POLARstar Omega plate reader set at 37°C (BMG Labtech), with LPL activity (1 mU / ml =1 pmol / ml / min) extrapolated using a BODIPY (500 / 510) C1 C12 dye standard (Thermo Fisher Scientific). Subtraction of total lipase activity (uninhibited samples) from LPL inhibited (uninhibited samples - human LPL inhibition) allowed for calculation of LPL specific activity3940. Lipolytic LPL activity assessments in conditioned media from cultured cells was carried out as described above following heparin treatment (Fresenius Kabi) (20U / ml, 4h) to release cell surface bound LPL and prevent re-uptake.
[0237] High fat load (post-prandial) clearance test
[0238] Clearance of a high fat load was assessed using Intralipid. Briefly, mice were injected IV (tail vein) with 10% Intralipid (20% stock Intralipid solution diluted 1 :1 in sterile PBS, max volume of 250pl injected in a 25g mouse) (Sigma). Blood samples were taken pre-administration of intralipid, followed by sampling at 30 min, 1 h, 2h and 3h post infusion for determination of plasma triglycerides clearance. Peak of plasma triglycerides was set at 30 min post- Intralipid infusion and % plasma triglyceride clearance was calculated for up to 3h post-lntralipid infusion, at which point LPL+ / + mice were observed to clear >95% of plasma triglycerides.
[0239] Total anti-AAV and anti-hLPL IgG measurement
[0240] Total AAV and hLPL IgG antibody titers (neutralizing and non-neutralizing) in the plasma of mice before AAV-hLPLS447Xadministration (day 0) and at study endpoint (day 80) were measured using ELISA. Briefly, high binding ELISA plates (Corning) were coated with 1x108gc / well of either AAV1 or AAV8 particles (for detection of anti-AAV antibodies) or 50ng / well of recombinant human recombinant hLPL (Novus Biologicals) (for detection of anti-hLPL antibodies). 1 :1000 diluted plasma samples were loaded and mouse IgG against AAV or hLPL were detected using a peroxidase-labelled anti-mouse IgG (H&L) antibody (Jackson Immunoresearch Labs), followed by colorimetric development using 1-Step™ Ultra TMB-ELISA Substrate Solution (Thermo Fisher). Absorbance values (450nm) were measured using a POLARstar Omega plate reader (BMG Labtech).
[0241] Tissue collection
[0242] Anesthetized mice were cardiac perfused with ice-cold PBS. Tissues were either snap- frozen in liquid nitrogen dry ice or fixed in 10% buffered formalin for histological analysis.
[0243] Western blotting
[0244] Snap-frozen tissues were sonicated in T-PER™ Tissue Protein Extraction Reagent (Thermo Fisher), supplemented with Protease and Phosphatase Inhibitor (Thermo Fisher), centrifuged (15 min, 13,000 rpm, 4°C), protein concentration quantified and samples boiled in NuPAGE™ LDS Sample Buffer (Thermo Fisher) containing NuPAGE™ Sample Reducing Agent (Thermo Fisher). Proteins were separated on NuPAGE™ Bis-Tris Mini Protein Gels (Thermo Fisher) in NuPAGE™ MES SDS running buffer (Thermo Fisher) and transferred onto 0.45 pm Amersham™ Hybond® P Western blotting membranes (Amersham). Membranes were blocked with Superblock™ (Thermo Fisher), incubated with primary antibodies (overnight, 4°C) and detected using either Alexa Fluor® (Thermo Fisher) or IRDye® (Li-Cor) 800 labelled secondary antibodies (30 min, RT) (antibodies and dilutions used are provided in Table 1).Table 1 : Antibodies used in the study for specific applications at their working dilutions.Antibody Application Dilution / Amount Source hLPL-lgY ELISA 5ug / ml Pacific biolabs (custom-made) hLPL-lgY Immunofluorescence 1 :100 Pacific biolabs (custom-made)LPL-5D2 ELISA 1 :2000 Bio-Rad (MCA5641)LPL-5D2 In cell western 1 :1000 Bio-Rad (MCA5641)Human / Mouse Lipoprotein Western Blotting 1 :2,000 Novus Biologies (AF7197)Lipase / LPL Antibody Goat anti-Chicken IgY, Immunofluorescence 1 :1000 Thermo Fisher (A32931)Alexa Fluor Plus 488 Goat anti-Mouse IgG, HRP ELISA 1 :20,000 Thermo Fisher (31430)Donkey anti-Goat, Alexa Western Blot / In cell western 1 :2,000 Thermo Fisher (A-21084)Fluor 680 IRDye® 800CW Goat anti- Western Blot / In cell western 1 :2,000 Licor (926-32210)Mouse IgG Peroxidase-labelled anti- ELISA 1 :20,000 Jackson Immunoresearch Labs mouse IgG (H&L) (115-035-044)
[0245] Relative target protein expression was normalized against total protein using Revert™ 700 Total Protein Stain (Li-Cor). All blots were scanned using the Odyssey® Infrared Imaging system (Li-Cor). Densitometry on band intensities was performed using Imaged.
[0246] In cell Western blotting
[0247] Cells plated in black, clear-bottom 96-well plates were fixed in 4%PFA (10 min, RT), followed by blocking with Superblock™ (Thermo Fisher), incubated with primary antibodies (overnight, 4°C) and detected using IRDye (Li-Cor) 800 labelled secondary antibodies (30 min, RT) (antibodies and dilutions used are provided in Table 1). Relative target protein expression was normalized against total protein using CellTag™ 700 Stain (Li-Cor). All plates were scanned using the Odyssey Infrared Imaging system (Li-Cor) and quantification of fluorescence intensity was performed using Imaged.
[0248] Quantitative real-time PCR
[0249] RNA was extracted and purified using RNeasy® Plus Mini Kit (Qiagen) from snap-frozen tissues, following manufactures’ recommendations. A one-step quantitative real-time PCR (qRT- PCR) on 5ng of RNA was carried out using QuantiNova® SYBR Green RT-PCR Kit (Qiagen), following manufactures’ recommendation on the Applied Biosystems 7500 / 7500 Fast Real-Time PCR System. Hs_LPL_1_SG QuantiTect® Primer Assay (QT00036771 , Qiangen) was used to detect the hLPLS447Xtransgene in Glybera (AAV1 pVR58) and a hLPL_1 QuantiNova LNA PCR Custom Assay (GeneGlobe ID - SCB0420509-200, Qiagen) was used to detect the C.O hLPLS447Xtransgene in AAV8 pVR59. Mm_Rn18s_3_SG QuantiTect® Primer Assay (QT0244807518s, Qiagen) was used to detect 18s for normalization. Transgene mRNA expression and fold changes were calculated using the AACT method.
[0250] Tissue Vector Genome Quantification using ddPCR
[0251] DNA was extracted and purified using the Qiagen DNeasy® Blood & Tissue kit (Qiagen) from snap-frozen tissues, following manufactures’ recommendations. AAV viral vector genomes were quantified determined by ddPCR, as described above. Briefly, DNA was diluted in water and 4 ul of each sample were added to 16 ul master mix containing Supermix for Probes (no dUTP, Bio-Rad), 2 U Msel, 0.4 mg / ml BSA, 950 nM of each, forward and reverse primers (ATCCTGGTTGCTGTCTCTTTAT, GAATTGTCAGTGCCCAACAG), and 250 nM probe (56- FAM / CTGTCAGCT / ZEN / CCTTTCCGGGACTTT / 3IABkFQ). Thermal cycling was carried out according to the Bio-Rad protocol with the following modifications: an additional restriction digestion step at 37°C for 60 min was added prior to enzyme activation; annealing and extension were done in two steps, at 59.1°C for 60 s and 72°C for 30 s, respectively. The total number of cycles was reduced to 35. Data was represented as AAV vector genome copies normalized to ng of tissue DNA (gc / ng DNA).
[0252] Histological Analysis
[0253] LPL expression in formalin fixed tissues was examined using immunohistochemistry. Briefly, tissue sections underwent antigen retrieval in a pre-heated steamer with IHC Select Citrate Buffer (Sigma) for 20 min, followed by permeabilization and blocking with eBioscience IHC / ICC Blocking Buffer - High Protein (30 min, RT) (Thermo Fisher). Sections were incubated with the IgY-LPL antibody (peptide sequence: CHDKSLNKKSGG, produced by Pacific Immunology), (overnight, 4°C), followed by detection using an Alexa Fluor Plus 488 labelled secondary antibody (30 min, RT) (Thermo Fisher) (antibodies and dilutions used are provided in Table 1). Slides were mounted in EverBrite TrueBlack® Hardset with DAPI Mounting Medium (Biotium). All micrographs were captured at 10x magnification using the Zeiss Axiovert® A1 microscope.
[0254] Statistical Analysis
[0255] Statistical analyses were performed using GraphPad Prism® 9. A Student’s t-test or One- or Two-way ANOVA were used to determine statistical significance between two or more groups of data, respectively. Post hoc significance of pairwise comparisons was assessed using Fisher’s LSD, unless otherwise noted. A p-value <0.05 (two-tailed) was considered significant. Data are presented as mean±SD. The number of biological samples (n) is indicated in the figure legends.
[0256] Results
[0257] In vivo biodistribution of novel AAV formulations
[0258] To investigate the biodistribution properties and kinetics of transgene expression of the AAV formulations when administered via different routes of administration, wild-type mice were injected with novel AAV formulations encoding a luc transgene. Structural diagrams of novel AAV formulations encoding luc are provided in Figure 2. Adult wild-type mice were injected with 1x1012gc / kg of novel AAV formulations encoding luc via several routes of administration, including IM, IV, SQ-flank and SQ-hock, and followed for assessment of luciferase transgene expression over a period of 60 days following AAV injection, as outlined in Figure 4, which provides a study overview summarizing the experimental protocol in which 6-8 week old (w.o) wild-type mice were treated with novel AAV-luciferase formulations and followed for 60 days post-AAV treatment, with bioluminescence imaging (BLI) at the indicated timepoints.
[0259] Firstly, the IM route of administration resulted in robust and stable transgene expression after about 2-weeks post treatment, which was localized near the site of injection, regardless of the AAV formulation utilized (Figures 5, 6). However, luciferase expression was lower in mice injected with AAV-luc formulations driven by the muscle specific AUSEx4 promoter compared tothe CMV and CAG promoters regardless of the AAV capsid serotype. The SQ-flank route of administration resulted in stable transgene expression near the site of injection, regardless of the AAV formulation utilized. A similar transduction pattern and expression kinetics were observed in the mice injected via the SQ-hock, an area of the mouse which lacks panniculus carnosus muscle under the skin that has been previously reported to be highly transduced via the SQ-flank route of administration (Figures 7, 8)38. As expected, luciferase expression was dramatically reduced in mice injected SQ with AAV-luc formulations driven by the muscle specific AUSEx4 promoter (Figures 5, 6, 7, and 8). AAV1 capsid containing formulation resulted in the weakest transduction when delivered via IV. On the other hand, AAV8 capsid containing formulations when delivered via IV resulted in the most prominent hepatic transgene expression, which surprisingly, was transient, peaking around day 14-18 post injection, with no readily detectible expression found elsewhere. Furthermore, when comparing between AAV capsids, AAV1 capsid containing formulations, including the Glybera-equivalent formulation (AAV1 pVR61), when administered via localized route of administration, including IM and SQ, resulted in localized transgene expression near the site of administration, with no detectable expression found within other regions of the mouse, including the liver (Figure 5). On the other hand, AAV8 capsid containing formulations using the CAG promoter, resulted in hepatic transduction in conjunction with localized transgene expression near the site of administration when injected via IM and SQ.
[0260] Next, luc transgene expression was assessed at study endpoint ex vivo within the tissue of mice injected with the novel AAV-luc formulations. Similar to the in vivo findings, AAV8 capsid containing formulations resulted in the most prominent localized luc expression, either within the skeletal muscle via the IM route or adipose, skin via the SQ-flank and hock route, and hepatic luc transgene expression, regardless of the route of administration (Figure 9). Conversely, AAV1 capsid containing formulations while resulting in localized transgene expression depending on the route of administration (skeletal muscle for IM and adipose and skin for SQ-flank and hock), did not result in any detectable hepatic transduction when administered via IM or SQ. The systemic IV route of administration most prominently transduced the liver regardless of the AAV capsid and formulation utilized, although expression was substantially stronger with AAV8 capsid containing formulations compared to the AAV1 capsid containing formulations.
[0261] In vitro assessments of novel AAV-hl_PLS447Xformulations compared to Glybera
[0262] hLPLS447Xtransgene production and lipolytic activity resulting from novel AAV-hLPLS447Xgene therapy formulations was first confirmed compared to Glybera in vitro. The expression cassette of Glybera (AAV1 pVR58) along with the novel AAV-hLPLS447Xexpression cassettedesigns are summarized in Figure 3. The novel AAV-hLPLS447Xformulations utilize a C.O hLPLS447Xtransgene along with a shorter optimized WPRE sequence (WRPE529bP) and a hGH PolyA. Glybera utilized the wild-type, non-codon-optimized hLPLS447X transgene, along with a longer WPRE sequence (WPRE729bP) and a bGH PolyA (Figure 2A). In vitro assessments were carried out in mouse myotubes, human myotubes derived from primary human skeletal muscle cells and a human hepatocellular carcinoma HepG2 cell line. In human myotubes infected with novel AAV-hLPLS447Xformulations, as described in Figure 10, both AAV1 pVR67 or AAV1 pVR74 resulted in increased hLPL protein expression (Figures 11, 12) and lipolytic activity (Figure 13) compared to Glybera. Furthermore, formulations utilizing the AAV1 serotype, particularly AAV1 pVR59, resulted in significantly higher hLPL protein expression and lipolytic activity compared to formulations utilizing the AAV8 serotypes. Furthermore, significantly elevated hLPL protein expression and lipolytic activity was observed following infection with AAV1 pVR59, AAV1 pVR60 and AAV8 pVR59 compared to Glybera (Figures 11, 12, 13). Similar trends were observed in mouse C2C12 derived myotubes infected with novel AAVS447Xformulations, as described in Figure 14. In summary, in C2C12 derived myotubes, formulations based on the AAV1 serotype were generally more efficacious compared to formulations based on the AAV8 serotype, with AAV1 pVR59 being the most efficacious compared to Glybera (Figures 14, 15, 16, 17). In a human hepatocyte cell line, HepG2, infected with novel AAVS447Xformulations, as described in Figure 18, both AAV1 pVR67 or AAV1 pVR74 resulted in increased hLPL protein expression (Figures 19, 20) and lipolytic activity (Figure 21) compared to Glybera. However, as opposed to myotubes, in HepG2 cells, AAV8 pVR59 resulted in significantly elevated transduction, resulting in increased hLPL protein and lipolytic activity compared to Glybera and the other AAV1 -based formulations (Figures 19, 20, 21). The AAV formulations driven by the muscle specific promoter, AUSEx4, including AAV1 pVR60 and AAV8 pVR60, were not effective at expressing LPL in HepG2 cells compared to Glybera (Figures 19, 20, 21).
[0263] Mouse model of LPLD
[0264] To determine the efficacy of novel AAV-hLPLS447Xgene therapy formulations compared to Glybera in vivo, LPL- / - mice were utilized. LPL- / - mice possess a homozygous recessive mutation in the LPL gene, resulting in a complete lack of LPL protein37. LPL- / - pups exhibit severe plasma lipemia shortly after initiation of suckling (Figure 22). Following suckling, LPL- / - pups exhibit extreme HTG, characterized by a 320-fold increase in plasma Tg (Figure 23), along with a 3-fold elevation in plasma Tc (Figure 24). Within 24-48h after birth, LPL- / - pups become cyanotic and die. As shown previously, LPL- / - pups were rescued to adulthood with a AdV-hLPLS447Xdelivered IM at 1x108pfu immediately following birth9 11. Structural diagram of the AdV- hLPLS447Xexpression cassette to rescue LPL- / - pups encoding hLPLS447Xis provided in (Figure 1). Adenovirus-derived hLPLS447Xtransgene expression and activity is lost after approximately 30 days following administration at birth (Figure 25). Consequently, rescued adult LPL- / - mice exhibit pronounced LPLD phenotypes, including plasma lipemia (Figure 22), severe HTG characterized by a 110-fold and 4-fold increased in fasting plasma Tg and Tc, respectively (Figures 26 and 27). In order to determine the efficacy of novel AAV-hLPLS447Xgene therapy formulations compared to Glybera, rescued adult LPL- / - mice were treated with Glybera or novel AAV-hLPLS447Xformulations. AAV-hLPLS447Xexpression cassette designs are summarized in Figure 3. AAVs were injected at either 1x1011gc / kg (low dose: LD) or 1x1012gc / kg (high dose: HD) via IM, IV, SQ- Flank or SQ-Hock, as summarized in Figure 28.
[0265] Enhanced correction of visible hyperlipidemia following treatment with novel AAV-hLPLS447Xformulations in LPL- / - mice compared to Glybera
[0266] First assessed was the impact of C.O of the LPLS447Xtransgene and the use of a hGH PolyA sequence in an AAV-hLPL formulation compared to Glybera. In accordance with the in vitro results, treatment with AAV1 pVR67 or AAV1 pVR74 at HD in LPL- / - mice resulted in a significant improvement in therapeutic efficacy compared to Glybera, as observed via a visible improvement in plasma lipemia (Figure 29), that was associated with a significantly increased reduction in fasting plasma Tg (-82.16% and -82.80% reduction from baseline for AAV1 pVR67 and AAV1 pVR74, respectively) compared to Glybera (-59.56% reduction from baseline) (Figure 30). However, neither AAV1 pR67 or AAV1 pVR74 was sufficient at normalizing plasma Tg levels to LPL+ / + mice levels. These results suggested a C.O hLPLS447Xtransgene in combination with a hGH PolyA sequence can be utilized increase the potency of Glybera. Thus, all novel AAV- hLPLS447Xformulations tested in vivo for comparison against Glybera included a codon-optimized hLPLS447Xtransgene in combination with a hGH PolyA sequence. Based on these initial results, Glybera was not assessed at the LD.
[0267] As seen in previous studies at a comparable dose, subtle clearance in plasma lipemia was observed following IM treatment with Glybera at HD (Figure 28). An intermediate clearance was achieved after 20 days of IM treatment with AAV1 pVR59 at HD, with slight clearance observed at the 10-fold LD. Surprisingly, complete clearance was observed within 10 days of IM treatment with AAV8 pVR59 at HD, with intermediate clearance observed at the 10-fold LD, which was visibly clearer compared to Glybera administered at a 10-fold HD. IM administration of AAV1pVR60 or AAV8 pVR60 resulted in very subtle clearance of plasma lipemia throughout the study duration, which was not visibly different compared to Glybera.
[0268] IV administration of AAV8 pVR59 at HD resulted in complete clearance of plasma lipemia within 10 days of treatment, similar to what was observed via the IM route of administration (Figure 31). Surprisingly, near-complete clearance was seen at the 10-fold LD, which was visibly clearer compared to Glybera administered at a 10-fold HD. Furthermore, complete clearance was achieved after 20 days of IV administration with AAV1 pVR59 at HD, with moderate clearance observed at the 10-fold LD. Moderate clearance was observed following treatment with Glybera at HD via IV. Interestingly, LPL- / - mice treated with Glybera administered via IV exhibited slightly improved plasma lipemia clearing when compared LPL- / - mice treated with Glybera administered via IM (Figures 29, 31).
[0269] Plasma lipemia clearing was similar whether the AAV-hLPLS447Xformulations were administered SQ via the flanks or the hock (Figure 32). More specifically, visible lipemia in LPL- / - mice plasma was cleared and undistinguishable from LPL+ / + mice plasma within 10 days of SQ treatment (hock and flank) with AAV8 pVR59 at HD, similar to what was observed via the IM and IV route of administration. Intermediate clearance was seen at a 10-fold lower dose (LD) of AAV8 pVR59. Complete clearance was achieved after 10 days of administration with AAV1 pVR59 at HD via the flanks or hock, with moderate clearance observed at the 10-fold LD. Similar to the LD AAV1 pVR59 treated group, a moderate clearance was observed following treatment with Glybera at HD via the flanks or hock, both of which were not visibly different compared to LPL- / - mice treated with Glybera administered via IV (Figure 31).
[0270] These results collectively suggest that AAV8 pVR59, regardless of the route of administration, is the most effective compared to Glybera at clearing plasma lipemia resulting from excessive chylomicron accumulation in LPLD.
[0271] Enhanced correction of hypertriglyederdemia following administration of novel AAV-hLPLS447Xfor LPL gene therapy in LPL- / - mice compared to Glybera
[0272] Vehicle-treated LPL- / - mice exhibited plasma Tg levels of approximately 6243.48 ± 375.58 mg / dl, with normal levels in vehicle-treated LPL+ / + mice being around 100.83 ± 31.03 mg / dl throughout the study duration. Plasma lipids levels and treatment efficacies at study endpoint (day 80 post-AAV treatment), measured as percent (%) change from baseline (pretreatment) in plasma Tg and Tc in LPL- / - mice are summarized in Table 2.Table 2: Summary of therapeutic efficacy following treatment with novel AAV-hLPLS447X formulations in LPL- / - mice compared to Glybera
[0273] In accordance with the plasma lipemia clearance results, IM treatment with Glybera at 1x1012gc / kg resulted in a consistent lowering of plasma Tg to approximately 3700 mg / dl at study endpoint, equivalent to a -60% decrease (Figure 30 and Table 2). Strikingly, IM treatment with AAV8 pVR59 at HD resulted in a complete normalization of plasma Tg levels to 105. mg / dl at study endpoint, equivalent to a -98.5% decrease. Treatment with a 10-fold lower dose (LD) of AAV8 pVR59 resulted in a lowering of plasma Tg to 2370.04 ± 340.20 mg / dl, equivalent to a - 67.80% decrease. Intermediate levels of plasma Tg lowering efficacies were observed in LPL- / - treated via IM with AAV1 pVR59 in a dose-dependent manner, with significantly lower efficacy observed with AAV1 pVR60 or AAV8 pVR60, none of which were a significant improvement over AAV8 pVR59 compared to Glybera. Plasma Tc was normalized in LPL- / - mice treated IM with AAV1 pVR59 and AAV8 pVR59, but not with Glybera, AAV1 pVR60 or AAV8 pVR60 at HD (Figure 33 and Table 2).
[0274] IV treatment with Glybera at HD resulted in a steady lowering of plasma Tg to approximately 2945 mg / dl at study endpoint, equivalent to a 54% decrease from baseline (Figure 34 and Table 2). IV treatment with AAV8 pVR59 at 1x1012gc / kg resulted in a complete normalization of plasma Tg levels to 93.19 ± 4.30mg / dl at study endpoint, equivalent to a -98.69% decrease, similar to what was observed via the IM route of administration. Treatment with a 10-fold lower dose (LD) of AAV8 pVR59 resulted in a consistent lowering of plasma Tg to approximately 1092.44 ± 674.45 mg / dl, equivalent to a -84.72% decrease from baseline, significantly more effective than a 10-fold higher dose of Glybera (HD). Treatment with AAV1 pVR59 at HD via IV resulted in an -87.17% plasma Tg lowering, while a 10-fold lower dose (LD) resulted in a -68.93% decrease in plasma Tg, which was also significantly more effective than a 10-fold higher dose (HD) of Glybera. Plasma Tc was normalized in LPL- / - mice treated IV with AAV1 pVR59 and AAV8 pVR59, but not with Glybera at HD (Figure 35 and Table 2).
[0275] Plasma triglyceride was lowered whether lowering was the AAV-hLPL formulations were administered SQ via the flanks or the hock (Figure 35, 3I and Table 2). SQ treatment via the hock with Glybera at HD resulted in plasma Tg lowering to approximately 2514.81 ± 633.46 mg / dl at study endpoint, equivalent to a -62.89% decrease from baseline. SQ treatment via the hock with AAV8 pVR59 at HD resulted in a near normalization of plasma Tg levels to 229.46 ± 168.78 mg / dl at study endpoint, equivalent to a -96.54% decrease, which is slightly less effective when compared to what was observed via IM (-98.54% decrease) or IV (-98.69% decrease) administration of AAV8 pVR59. Treatment with a 10-fold lower dose (LD) of AAV8 pVR59 resulted in a consistent lowering of plasma Tg to approximately 1581.29 ± 121.84 mg / dl, equivalent to a - 76.61 % decrease, which is significantly more effective than a 10-fold higher dose (HD) of Glybera. SQ treatment via the hock with AAV1 pVR59 at HD also resulted in near-normalization of plasma Tg to 270.10 ± 10.01 mg / dl, associated with a -96.17% decrease. A 10-fold lower dose (LD) of AAV1 pVR59 resulted in a -62.41% decrease in plasma Tg, which was equally as effective as a 10-fold higher dose (HD) of Glybera. Plasma Tc was normalized in LPL- / - mice treated SQ via the hock with AAV1 pVR59 and AAV8 pVR59 at HD, and with AAV8 pVR59 at LD, but not with Glybera at HD (Figures 37, 38, 39, and Table 2).
[0276] In summary, AAV8 pVR59 was the most effective AAV-hLPLS447Xformulation at normalizing plasma lipids in LPL- / - mice via all routes of administration tested. More importantly, AAV8 pVR59 was found to be equally effective at a 10-fold lower dose of what was originally required to achieve similar therapeutic plasma Tg lowering efficacy with Glybera in previous reports9.
[0277] Enhanced functional improvement in clearance of a high fat load in AAV8-pVR59 treated LPL- / - mice compared to Glybera.
[0278] LPL- / - mice exhibit a profound impairment in their ability to respond to a high fat load. After establishing superiority of AAV8 pVR59 at reducing fasting plasma Tg in LPL- / - mice compared to Glybera, the effectiveness of this formulation at normalizing the ability of LPL- / - miceto clear a high fat load was assessed. Briefly, vehicle-treated LPL+ / + mice or LPL- / - mice treated with vehicle or IM Glybera or IM AAV8 pVR59 (30 days post-treatment) at HD, were injected IV with a high fat load (Intralipid). Plasma samples were collected at baseline (pre-lntralipid treatment) and at regular intervals up to 3 hrs pot-lntralipid treatment. Vehicle-treated wild-type mice effectively clear more the Intralipid load within 3h post-infusion (Figure 40, Left Panel, associated with more than 95% reduction in plasma Tg (Figure 40, Right Panel). Conversely, vehicle-treated LPL- / - mice exhibit significantly reduced clearance of plasma Tg compared to LPL+ / + mice (Figure 40, Left Panel), with only approximately 11% clearance of plasma Tg following Intralipid infusion within 3h (Figure 40, Right Panel). LPL- / - treated IM with Glybera exhibited approximately 40% clearance of plasma Tg following Intralipid infusion within 3h, which while it was a significant improvement over vehicle-treated LPL- / - mice, was not sufficient at completely clearing the fat load, as observed in LPL+ / + mice. Strikingly, LPL- / - mice treated IM with AAV8 pVR59 exhibited approximately 86% clearance of plasma Tg following Intralipid infusion within 3h, which was not significantly different compared to wild-type mice. Thus, while Glybera was not able to normalize the ability of LPL- / - mice to clear a high fat load, AAV8 pVR59 treatment resulted in complete normalization, undistinguishable from LPL+ / + mice.
[0279] Transgene expression and activity in the plasma of LPL- / - mice following administration of novel AAV-hLPLS447Xformulations
[0280] hLPLS447Xtransgene expression and lipolytic activity in the post-heparin plasma of LPL- / - mice treated with novel AAV-hLPLS447Xformulations was assessed using an ELISA specific for hLPL and a hLPL enzymatic activity assay. Vehicle-treated mice expressed negligible levels of hLPL protein and hLPL activity in post-heparin plasma. LPL+ / + mouse plasma contained on average of 344 mll / mL of endogenous mLPL lipolytic activity.
[0281] IM treatment with AAV8 pVR59 at HD resulted in plasma hLPL expression of 1212 ng / ml, which was approximately 3-fold, 2-fold, 6-fold, and 6-fold higher than what was observed in the plasma collected from Glybera, AAV1 pVR59, AAV1 pVR60 and AAV8 pVR60 treated LPL- / -mice, respectively (Figure 41). Correspondingly, IM treatment with AAV8 pVR59 at HD resulted in a plasma hLPL activity level of 268 mll / mL, which fell within the normal range of endogenous mLPL activity observed in an LPL+ / + mouse (Figure 42). Plasma hLPL activity levels from AAV8 pVR59 treated mice were 3.5-fold, 1.5-fold, 4-fold and 4-fold higher than what was observed in the plasma collected from Glybera, AAV1 pVR59, AAV1 pVR60 and AAV8 pVR60 treated LPL- / - mice, respectively. Treatment with a 10-fold lower dose of AAV8 pVR59 (LD) resulted in 1.6-fold higher hLPL activity compared to Glybera administered at a 10-fold higher dose.
[0282] IV treatment with AAV8 pVR59 at HD resulted in plasma hLPL expression of 1841. ng / ml, which was approximately 4.5-fold and 1.5-fold higher than what was observed in the plasma collected from Glybera and AAV1 pVR59 treated LPL- / -mice, respectively (Figure 43). Treatment with a 10-fold lower dose of AAV8 pVR59 (LD) resulted in transgene protein expression of 977. ng / ml, which was 2- higher than what was observed in the plasma collected from Glybera- treated LPL- / - mice at a 10-fold higher dose. IV treatment with AAV8 pVR59 at HD resulted in a plasma hLPL activity level of 635 mU / mL, which fell within the normal range of endogenous mLPL activity observed in an LPL+ / + mouse, but was significantly higher than what was observed via the IM route of administration (Figure 44). Plasma hLPL activity levels from AAV8 pVR59 treated mice were 5-fold and 2-fold higher than what was observed in the plasma collected from Glybera and AAV1 pVR59 treated LPL- / - mice, respectively. Treatment with a 10-fold lower dose of AAV8 pVR59 at HD resulted in 2-fold higher hLPL activity compared to Glybera administered at a 10- fold higher dose.
[0283] Similar to IM and IV routes of administration, SQ administration via the hock of AAV8 pVR59 resulted in plasma hLPL expression of 1214 ng / ml, which was approximately 7-fold and 2.5-fold higher than what was observed in the plasma collected from Glybera and AAV1 pVR59 treated LPL- / - mice, respectively (Figure 45). Transgene expression derived from AAV8 pVR59 administered via SQ hock was comparable to IM-treated AAV8 pVR59 in LPL- / - mice, but 1 .5-fold lower than what was observed via IV administration of AAV8 pVR59. Plasma hLPL activity levels from AAV8 pVR59 treated mice were 5-fold and 2-fold higher than what was observed in the plasma collected from Glybera and AAV1 pVR59 treated LPL- / - mice, respectively (Figure 46). SQ hock treatment with AAV8 pVR59 at HD resulted in a plasma hLPL activity level of 349.26 ± 77.50 mU / mL, which fell within the normal range of endogenous mLPL activity observed in an LPL+ / + mouse, which was comparable to the IM route of administration, but was significantly lower than what was observed via the IV route of administration. Interestingly, AAV1 pVR59 treatment also resulted in normalized level hLPL activity in LPL- / - mice at the HD which was not significantly different to what was achieved via treatment with AAV8 pVR59. However, plasma hLPL activity levels from AAV8 pVR59 treated mice were 3-fold higher than what was observed in the plasma collected from Glybera treated LPL- / - mice. No significant differences were observed within the novel formulation when comparing between hock and flank routes of SQ administration.
[0284] AAV vector genome biodistribution and hl_PLS447Xtransgene expression in the skeletal muscle and liver of LPL-Z- mice following administration of AAV8 pVR59 compared to Glybera.
[0285] Using ddPCR, quantification of AAV vector genomes (VG) present within skeletal muscle (quad) and liver of LPL- / - mice treated with Glybera and AAV8 pVR59 at study endpoint was undertaken. Overall, as expected, there was a dose response observed in the presence of increased amount of AAV VG found within the liver and skeletal muscle of LPL- / - treated with AAV8 pVR59 regardless of the route of administration (Figure 47). AAV8 pVR59 treated mice via IM, IV or SQ-Hock at HD had significantly higher VG present within the liver compared to Glybera treated mice. AAV vector copies were not significantly different within the skeletal muscle of mice treated with Glybera or AAV8 pVR59 via IM or IV. SQ-Flank-treated AAV8 pVR59 mice exhibited elevated AAV VG copies compared to Glybera within the skeletal muscle. Interestingly, mice treated via IV with either Glybera or AAV8 pVR59 had the lowest amount of detectable AAV VG present within the liver or skeletal muscle.
[0286] Next, using qRT-PCR, hLPL transgene mRNA expression was analyzed within the skeletal muscle (quad) and liver of LPL- / - mice treated with Glybera and AAV8 pVR59 at study endpoint. IM-treated AAV8 pVR59 mice at HD exhibited 70-fold and 52-fold higher levels of hLPL mRNA in the liver and quad, respectively, compared to IM-treated Glybera mice (Figure 48). IV- treated AAV8 pVR59 mice at HD exhibited 93-fold and 6-fold higher levels of hLPL mRNA in the liver and quad, respectively, compared to IV-treated Glybera mice. SQ-Flank treated AAV8 pVR59 mice at HD exhibited 0.6-fold and 5-fold higher levels of hLPL mRNA in the liver and quad, respectively, compared to SQ-Flank-treated Glybera mice. SQ-Hock treated AAV8 pVR59 mice exhibited 2-fold and 9-fold higher levels of hLPL mRNA in the liver and quad, respectively, compared to SQ- Hock-treated Glybera mice. In the livers of LPL- / - mice treated with AAV8 pVR59 at the LD, there was 3-fold and 10-fold higher expression compared to Glybera treated mouse livers at HD. In the quads of LPL- / - mice treated with AAV8 pVR59 at the LD, there was 3-fold and 2-fold higher expression compared to Glybera treated mouse quads at HD.
[0287] Using western blotting and immunohistochemistry, expression of the hLPL transgene was next analyzed and localized within the skeletal muscle and liver of LPL- / - mice treated with Glybera and AAV8 pVR59 at study endpoint. IM-treated Glybera mice exhibited LPL expression within the injected muscle, whereas IV administration resulted in primarily liver specific LPL expression (Figure 49). SQ administration of Glybera also resulted in weak liver specific LPL expression. LPL protein expression was readily detected within livers of LPL- / - mice treated withAAV8 pVR59 regardless of the route of administration. Furthermore, IM-treated AAV8 pVR59 tread LPL- / - mice, in contrast to Glybera, while exhibiting skeletal muscle expression of the LPL transgene, also showed prominent expression within the liver, in a dose dependent manner. SQ route of administration with AAV8 pVR59 was stronger at inducing the liver compared to Glybera, but equal to Glybera at transducing skeletal muscle. Western blots quantified are provided in Figure 50.AAV8 pVR59 treatment resulted in strong, wide-spread hepatic expression of the hLPLS447Xtransgene, localized at the plasma membranes within hepatocytes regardless of the route of administration, albeit treatment via the IV route of administration exhibited the strongest liver (hepatocyte) expression (Figure 51). IM route of administration was required with either AAV8 pVR59 or Glybera to obtain prominent hLPLS447Xexpression at the plasma membrane of individual myocytes. Furthermore, regardless of the route of administration and site of transduction, effective release and secretion of the LPL transgene into circulation following IV heparin infusion was observed, and was detected within the plasma of LPL- / - mice treated with Glybera or AAV8 pVR59. However, increased liver and skeletal muscle-localized expression with AAV8 pVR59 resulted in increased secretion of plasma LPL, which was associated with superior clearance of plasma Tg, compared to Glybera.AWPRE Constructs
[0288] A construct, pVR80, was generated to test the effects of full deletion of the WPRE element used in Glybera.
[0289] Figure 52, Panel A shows a Schematic representation of AAV8 pVR80 with deletion of WPRE compared to AAV8 pVR59. Figure 52, Panel B shows intracellular hLPLS447X protein expression in mouse myotubes treated with AAV8 pVR80 or AAV8 pVR59, with relative signal intensity quantified using densitometry relative to expression in vehicle treatment shown in Figure 52, Panel C (hLPLS447X protein expression normalized against total protein, representative microplate images shown, n=6 wells / group [2 independent experiments], One-way ANOVA. Fisher’s LSD: p<0.05 * vs Vehicle). Figure 52, Panel D shows secreted hLPLS447X protein expression, while Figure 52, Panel E shows lipolytic hLPLS447X activity in conditioned media from mouse myotubes treated with AAV8 pVR80 or AAV8 pVR59 (LPL activity data expressed as fold change relative to LPL activity in vehicle-treated cells, n=12 wells / group [3 independent experiments], One-way ANOVA. Fisher’s LSD: p<0.05 * vs Vehicle).
[0290] Figure 53 shows correction of visible hyperlipidemia following intramuscular administration of AAV8 pVR80 or AAV8 pVR59 at 1x1012gc / kg in a mouse model of LPLD (LPL- / - mice) (arrow indicates time of AAV treatment, representative images shown, n=3-5 mice / group).
[0291] Figure 54 shows (top graph) correction of plasma triglycerides (Tg) following IM treatment with AAV8 pVR80 or AAV8 pVR59 at the indicated doses in LPL- / - mice (plasma Tg graphed on a log scale, shaded area outlines the normal range of plasma triglycerides observed in vehicle-treated LPL+ / + mice, n=3-5 mice / group. Two-way ANOVA. Fisher’s LSD: only nonsignificance vs LPL+ / + mice noted on the graphs). The bottom graph shows correction of plasma cholesterol (Tc) following IM treatment with AAV8 pVR80 or AAV8 pVR59 at the indicated doses in LPL- / - mice (shaded area outlines the normal range of plasma Tc observed in vehicle-treated LPL+ / + mice, n=3-5 mice / group. Two-way ANOVA. Fisher’s LSD: only non-significance vs LPL+ / + mice noted on the graphs).
[0292] Surprisingly, AAV8 pVR80 was as effective as AAV8 pVR59 in correcting visible hyperlipidemia and correcting plasma triglycerides following intramuscular administration.
[0293] CpG-deleted LPL Constructs
[0294] Constructs were generated in which CpG motifs (“dCpG”) were deleted from LPL, or in which immunostimulatory CpGs were mutated (“dCpG-S”) - see SEQ ID NOs: 7 to 9 for the hLPLS447X-encoding portion. Additional constructs are summarized in Table 4:Table 4: Additional Constructs
[0295] Under “enhancer” in the above, “NRC CMV” indicates a CMV enhancer which was modified by removing 5 CpGs. “EF1a” indicates the EF1a enhancer.
[0296] Under “promoter” in the above, “CBA” in the above indicates the chicken beta-actin promoters. “NRC CBA” indicates a version of CBA which was modified by removing 1 CpG.“EF1a” indicates the EF1a promoter.
[0297] Under “intron” in the above, “CAGG” indicates intron 1 of chicken beta-actin, as used in the CAGG promoter. “NRC SV40” indicates an SV40 intron modified to remove two CpGs in the intron. “EF1a” indicates elongation factor 1a wild type sequence.
[0298] In the above under “LPL-S447X”, “Opt” indicates codon-optimized, dCpG indicatesCpGs are removed or mutated, and dCpG-Opt indicates that both modifications are present. “Wt” indicates wild type sequence.
[0299] Table 5 presents the CpG content of these constructs.Table 5: CpG Content of Constructs
[0300] CpG-deleted LPL Constructs Results
[0301] The presence of CpG dinucleotides within an AAV gene therapy has been predicted to trigger an immune response in humans, which could lead to premature therapeutic failure. To address this issue, CpG-depleted formulations were developed based on AAV8 pVR59 (Figure 55) and examined their efficacy in mouse skeletal muscle cells. Removal of CpG elements in the promoter (by replacing the CAGG intron with the SV40 intron) and therapeutic transgene (AAV8 pNC152, AAV8 pNC162 and AAV8 pNC163) resulted in a significant reduction in levels of intracellular hLPL transgene expression, secreted LPL expression, and activity (Figure 56,Figure 57 Panels A-C).
[0302] Based on the absence of any superior optimized variants compared to AAV8 pVR59 in our in vitro testing, another round of optimization was pursued. This time, removing the immunostimulatory CpG elements from the AAV8 pVR59 transfer vector. Two new AAV8 pVR59- based variants with an optimized version of hLPL without CpG and reduced number of immunostimulatory CpG elements in the promoter (AAV8 pNC182 and AAV8 pNC201) were designed, generated, and tested. Both AAV8 pNC182 and AAV8 pNC201 showed comparable levels of intracellular hLPL transgene expression, secreted LPL expression, and activity compared to AAV8 pVR59 in mouse skeletal muscle cells (Figure 58, Figure 59 Panels A-C).
[0303] the in vivo efficacy of AAV8 pNC182 and AAV8 pNC201 were next validated compared to AAV8 pVR59 in a short-term study in LPL- / - mice. Intramuscular delivery of these CpG- depleted vectors in LPL- / - mice revealed AAV8 pNC182 to be equally efficacious as AAV8 pVR59 in normalizing plasma lipemia (Figure 60) and plasma triglyceride levels (Figure 61).
[0304] A long-term efficacy study comparing AAV8 pNC182 to AAV8 pVR59 in LPL- / - mice was conducted, as outlined in Figure 62. AAV8 pNC182, delivered intramuscularly, led to complete correction of plasma lipemia in adult LPL- / - mice. Notably, plasma lipid levels became visually indistinguishable from those of LPL+ / + mice as early as day 10 post-treatment and remained persistently normalized for up to 180 days similar to what was observed in AAV8 pVR59-treated mice (Figure 63).
[0305] AAV8 pVR59 (Figure 64) resulted in over a 95% reduction in plasma triglyceride (Tg) levels at doses exceeding 1x1012gc / kg, whereas AAV8 pNC182 (Figure 65) achieved over a 96% reduction in plasma Tg levels at doses as low as 5x1011gc / kg. Furthermore, plasma Tg levels remained indistinguishable from those of control LPL+ / + mice treated with vectors for up to 180 days. These findings suggest that AAV8 pNC182 exhibits superior efficacy profile at lower doses compared to AAV8 pVR59 in LPLD mice.
[0306] Discussion
[0307] In the current study, using Glybera as a benchmark, several novel AAV gene therapy formulations for the treatment of LPLD were developed. The studies revealed a novel AAV8- based formulation, AAV8 pVR59, that is associated with superior long-term therapeutic efficacy at lower doses compared to Glybera in a mouse model of LPLD.
[0308] For testing the therapeutic efficacy of the AAV formulations, LPL- / - mice rescued at birth using AdV-hLPLS447X treatment were utilized. Rescued adult LPL- / - mice exhibit pronounced LPLD phenotypes, including plasma lipemia, severe HTG with plasma Tg levels as high as 10,000mg / dl, reduced plasma HDL-c and impaired fat tolerance. Plasma Tg levels are one of the most useful surrogate markers of determining the risk of pancreatitis, a common life-threatening manifestation of LPLD in humans. Rescued LPL- / - mice do not show any signs of pancreatitis. However, in humans with LPLD, the risk of pancreatitis drastically increases as plasma Tg levels are elevated above 800 mg / dL. Thus, in the current studies, therapeutic efficacy was assessed by measuring plasma Tg reduction in LPL- / - mice. Treatment with AAV8 pVR59 but not Glybera, or any other novel AAV formulation, administered at a dose of 1x1012gc / kg, resulted in normalization of plasma Tg to levels that are no longer considered a risk factor for the development of pancreatitis in humans. Previous studies showed that a 10-fold higher dose(1x1013gc / kg) of Glybera is required to obtain a similar normalization of plasma Tg. Thus, AAV8 pVR59 was determined to be equally effective at a 10-fold lower dose of what was originally required to achieve a similar plasma Tg lowering therapeutic efficacy with Glybera.
[0309] The promoter is an important DNA regulatory element within an AAV gene therapy formulation that is responsible for mediating onset, strength and localization of transgene expression at the cellular level. The ubiquitous CMV promoter was utilized in Glybera to rapidly drive strong expression of the hLPLS447X transgene within the injected skeletal muscle. Recent studies have shown that transgenes driven by a CMV promoter using AAV vectors may be prone to promoter silencing within several organs such as the liver and that sustained expression is dependent on the choice of promoter.
[0310] For the novel AAV formulations, a hybrid ubiquitous CAG promoter or a muscle specific AUSEx4 promoter was tested for ability to drive hLPLS447X transgene expression. To this end, it was observed that AAV formulations utilizing the ubiquitously expressing, hybrid CAG promoter resulted in increased transgene expression compared to formulations utilizing the AUSEx4 muscle specific promoter or the CMV promoter. Furthermore, no significant loss was detected of secreted transgene expression within plasma of LPL- / - mice or in plasma Tg lowering efficacy for up to 180 days post-treatment, with either the CMV-based Glybera formulation or the CAG-based AAV8 pVR59 formulation, suggesting that, at least in mice, promoter silencing does not negatively impact long- term therapeutic efficacy.
[0311] For the therapeutic transgene, either a native hLPLS447Xtransgene, as utilized in Glybera, or a novel high-protein expression codon-optimized hLPLS447Xtransgene was used. The hLPLS447Xmutation is a gain of function variant present within 20-25% of the general population, which is associated increased lipolytic function via increased lipoprotein uptake, along with an anti-atherogenic, cardio-protective lipid profile. Previous studies suggested that hLPLS447Xis significantly more effective at normalizing plasma Tg compared to wild-type hLPL in LPL- / - mice. Glybera delivered a non-codon-optimized hLPLS447X transgene, while all of the novel AAV formulations described here, including AAV8 pVR59, delivered a codon-optimized hLPLS447Xtransgene, which has been optimized to maximize transgene expression, potentially allowing for increased therapeutic efficacies to be achieved at lower doses.
[0312] LPL is primarily synthesized within skeletal muscle cells and adipose tissue. Following production, LPL is secreted and bound to the luminal surface of blood vessels via heparin sulfate proteoglycans, where it breaks down Tg within chylomicrons and VLDL 1-6. The transduction properties of an AAV serotype are primarily dependent on the interaction between viral capsidproteins and target specific cell surface receptors 14. The AAV1 serotype was selected for Glybera due its excellent tropism towards skeletal muscle cells.
[0313] For the novel AAV formulations described here, either the AAV1 or AAV8 serotype was utilized, with the aim of targeting the skeletal muscle and / or liver as the primary organs for hLPLS447X gene transfer. The in vitro studies showed that both human and mouse myotubes and HepG2 (liver cell line) are able to produce and secrete functionally active hLPLS447X protein following treatment with novel AAV-hLPLS447X formulations. The in vivo biodistribution studies revealed increased skeletal muscle transduction efficacies following IM administration of an AAV1 -based compared to an AAV8-based formulation.
[0314] Conversely, stronger tropism of AAV8-based formulations towards the liver was observed compared to AAV1 -based formulations regardless of the ROA. Other groups have shown that the AAV8 serotypes exhibit a more uniform tissue transduction pattern throughout the hindlimb, abdominal, and thoracic regions compared to other serotypes including AAV1 , with the hindlimb skeletal muscle being the next most common area of transduction after liver hepatocytes, when delivered systemically via an IV ROA.
[0315] Glybera delivered the hLPLS447Xtransgene to human skeletal muscle via a series of 30- 40 IM injections under epidural anesthesia. Based on previous data from Glybera in mice, cats and in humans, along with current findings, it is evident that the IM ROA is effective for obtaining skeletal muscle-specific expression of hLPLS447Xwhen paired with an AAV1 -based formulation, such as Glybera. In the current studies, it was observed that AAV8-based formulations, such as AAV8 pVR59, when delivered into skeletal muscle via an IM ROA, are useful for obtaining more widespread hLPLS447Xwithin the injected skeletal muscle and liver.
[0316] An intra-adipose ROA has been tested with AAV formulations in mouse pre-clinical studies and they been shown to be effective at delivering transgenes to a wide variety of adipose tissues, including white and brown adipose. However, LPLD patients often have very low levels of adipose tissue, which may result in inefficient adipose-gene transfer, making the intra-adipose ROA challenging.
[0317] A systemic IV ROA is easier to administer, less painful to the patients compared to the previously utilized IM ROA, and potentially exhibit improved efficacy when paired with an AAV8- based formulation such as AAV8 pVR59 due to its superior ability to transduce the liver compared to an AAV1 -based formulation such as Glybera.
[0318] The efficacy of IV-delivered AAV gene therapy formulations for the treatment of LPLD has not been previously tested. Since AAV8 exhibits strong liver tropism, it was hypothesized thatIV systemic delivery of AAV8 pVR59 would result in enhanced hepatic gene transfer, allowing for increased secreted hLPLS447Xexpression, leading to enhanced therapeutic efficacies compared to an AAV1 -based formulation such as Glybera. Wild-type mice have approximately 100 ng / ml - 600 ng / ml of circulating LPL within plasma, while healthy humans have approximately 400 ng / ml of hLPL within plasma, secreted primarily from adipose tissue and skeletal muscle. In the current mouse studies, it was observed plasma hLPLS447Xlevels of around 1000 ng / mg following IM delivery of AAV8 pVR59 locally within the skeletal muscle, with expression prominently being derived from a combination of the injected skeletal muscle and liver. When AAV8 pVR59 was delivered via an IV injection, increased plasma hLPLS447Xlevels of around 1500 ng / ml - 2000 ng / ml were observed, which was predominantly derived from the transduced liver. AAV8 pVR59 treatment, via either ROA, on average yielded 2-4-fold higher plasma hLPLS447Xexpression compared to Glybera. When comparing between the two routes of administration, a superior efficacy was observed with AAV8 pVR59 using doses as low as 1x1011gc / kg via IV and 1x1012gc / kg via IM, a 100-fold lower dose and a 10-fold lower dose, respectively, compared to the Glybera-effective dose of approximately 1x1013gc / kg from previous studies.
[0319] Endogenous LPL transcript is almost absent in normal adult livers of mice. Consequently, the implications of hepatic LPL expression following AAV-based gene transfer are not well understood. The findings presented herein suggest improved efficacy following hepatic gene transfer of hLPLS447X. It is evident that the liver is capable of producing functional LPL protein that is secreted into circulation, which can then be utilized to improve plasma lipoprotein metabolism.
[0320] There is evidence suggesting that gene transfer to the liver in combination with other key target organs such as the skeletal muscle may be beneficial. Liver-directed gene transfer has been shown to assist in avoiding immune toxicity through inducing transgene tolerance via the activation of transgene product specific regulatory T cells in a dose- dependent manner. Thus, it is likely that IM administration of AAV8 pVR59, through transduction of a combination of the liver and the skeletal muscle, is able to evoke a tolerogenic response that may improve transgene longevity compared to the use of Glybera or another AAV1 formulation that does not effectively transduce the liver. Indeed, our studies showed long-term transgene expression, up to 180 days, along with stable therapeutic plasma lipid lowering efficacies following IM delivery of AAV8 pVR59.
[0321] .
[0322] Following the identification of AAV8 pVR59 as a potential candidate for AAV-based LPL gene replacement therapy, it was sought to optimize this vector to mitigate potential immunogenicity observed in humans. Unmethylated CpG dinucleotides within AAV have been shown in clinical studies to elicit TLR9-driven cytotoxic CD8+ T-cell responses, leading to rapid transgene elimination and clinical failure. Cell culture and mouse studies do not fully model these immune responses. However, it's desirable to minimize CpGs within AAV8 pVR59 to reduce potential immunogenicity in humans, while maintaining therapeutic efficacy. AAV8 pVR59 contains 341 CpGs (7.4% of the total sequence).
[0323] To this end, novel AAV8 pVR59-based formulations were developed with reduced CpG content. Initially, four variants (AAV8 pVR80, AAV8 pNC152, AAV8 pNC162, and AAV8 pNC163) modified to minimize CpG dinucleotides (Figures 52 and 55 / Tables 4 and 5) were developed and tested. CpG reduction involved removing the WPRE sequence, using a shortened CAG promoter (CB promoter), employing a CpG-depleted hLPLS447Xopen reading frame (ORF), or utilizing a h - Globin polyA. While removal of the WPRE alone (AAV8 pVR80), had no impact of transgene expression of efficacy in vivo in LPL- / - mice, the formulations with CpG deletion (AAV8 pNC152, AAV8 pNC162, and AAV8 pNC163) exhibited significantly lower transgene expression in vitro and were ineffective at normalizing plasma lipemia and Tg in LPL- / - mice.
[0324] Considering these results, two additional AAV8 pVR59-based variants were developed with reduced immunostimulatory CpGs within the promoter region (pNC201) and an optimized hLPLS447Xtransgene without CpG (pNC201 and pNC182; Figure 55).
[0325] AAV8 pNC182 demonstrated comparable hLPL transgene expression and activity in vitro in mouse skeletal muscle cells to AAV8 pNC201 and AAV8 pVR59. Notably, AAV8 pNC182 normalized plasma lipemia and Tg at lower doses over 180 days compared to AAV8 pVR59.
[0319] In summary, we developed and tested the efficacy of novel AAV-hLPLS447X gene therapy formulations were developed and tested in a mouse model of LPLD.Table 6: Master Table of Sequences
[0326] In the preceding description, for purposes of explanation, numerous details are set forth in order to provide a thorough understanding of the embodiments. However, it will be apparent to one skilled in the art that these specific details are not required.
[0327] The above-described embodiments are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art. The scope of the claims should not be limited by the particular embodiments set forth herein, but should be construed in a manner consistent with the specification as a whole.
[0328] REFERENCES
[0329] 1. Olivecrona, G. Role of lipoprotein lipase in lipid metabolism. Curr. Opin.Lipidol. 27, 233-241 (2016).
[0330] 2. Merkel, M., Eckel, R. H. & Goldberg, I. J. Lipoprotein lipase: Genetics, lipid uptake, and regulation. Journal of Lipid Research vol. 43 1997-2006 (2002).
[0331] 3. Goldberg, I. J. Lipoprotein lipase and lipolysis: central roles in lipoprotein metabolism and atherogenesis. J. Lipid Res 37, 693-707 (1996).
[0332] 4. Banks, P. A. et al. Practice guidelines in acute pancreatitis. Am. J.Gastroenterol. 101 , 2379-2400 (2006).
[0333] 5. Goldberg, R. B. & Chait, A. A Comprehensive Update on theChylomicronemia Syndrome. Front. Endocrinol. (Lausanne). 11 , 830 (2020).
[0334] 6. Chait, A. & Brunzell, J. D. Chylomicronemia syndrome. Adv. Intern. Med.37, 249-273 (1992).
[0335] 7. Liu, G. et al. Phenotypic correction of feline lipoprotein lipase deficiency by adenoviral gene transfer. Hum. Gene Ther. 11 , 21-32 (2000).
[0336] 8. Ross, C. J. D. et al. Correction of feline lipoprotein lipase deficiency with adeno-associated virus serotype 1 -mediated gene transfer of the lipoprotein lipase S447X beneficial mutation. Hum. Gene Ther. 17, 487-499 (2006).
[0337] 9. Ross, C. J. D. et al. Long-term correction of murine lipoprotein lipase deficiency with AAV1 -mediated gene transfer of the naturally occurring LPLS447X beneficial mutation. Hum. Gene Ther. 15, 906-919 (2004).
[0338] 10. Rip, J. et al. Gene therapy for lipoprotein lipase deficiency: Working toward clinical application. Hum. Gene Ther. 16, 1276-1286 (2005).
[0339] 11. Ross, C. J. D. et al. Complete rescue of lipoprotein lipase-deficient mice by somatic gene transfer of the naturally occurring LPLS447X beneficial mutation. Arterioscler. Thromb. Vase. Biol. 25, 2143-2150 (2005).
[0340] 12. Kastelein, J. J. P., Ross, C. J. D. & Hayden, M. R. From MutationIdentification to Therapy: Discovery and Origins of the First Approved Gene Therapy in the Western World, https: / / home.liebertpub.com / hum 24, 472-478 (2013).
[0341] 13. Kuzmin, D. A. et al. The clinical landscape for AAV gene therapies. Nat.Rev. Drug Discov. 20, 173-174 (2021).
[0342] 14. Keeler, A. M. & Flotte, T. R. Recombinant Adeno-Associated Virus GeneTherapy in Light of Luxturna (and Zolgensma and Glybera): Where Are We, and How Did We Get Here? Annu. Rev. Virol. 6, 601-621 (2019).
[0343] 15. Wang, D., Tai, P. W. L. & Gao, G. Adeno-associated virus vector as a platform for gene therapy delivery. Nat. Rev. Drug Discov. 18, 358-378 (2019).
[0344] 16. Rip, J. et al. Lipoprotein lipase S447X: A naturally occurring gain-of- function mutation. Arterioscler. Thromb. Vase. Biol. 26, 1236-1245 (2006).
[0345] 17. Glee, S. M., Loubser, O., Collins, J., Kastelein, J. J. P. & Hayden, M. R.The LPL S447X cSNP is associated with decreased blood pressure and plasma triglycerides, and reduced risk of coronary artery disease. Clin. Genet. 60, 293-300 (2001).
[0346] 18. Wittrup, H. H., Nordestgaard, B. G., Steffensen, R., Jensen, G. & Tybjarg-Hansen, A. Effect of gender on phenotypic expression of the S447X mutation in LPL: the Copenhagen City Heart Study. Atherosclerosis 165, 119-126 (2002).
[0347] 19. Hayne, C. K., Lafferty, M. J., Eglinger, B. J., Kane, J. P. & Neher, S. B.Biochemical Analysis of the LPL Truncation Variant, LPLS447X Reveals Increased Lipoprotein Uptake. Biochemistry 56, 525 (2017).
[0348] 20. Stroes, E. S. et al. Intramuscular administration of AAV1-lipoprotein lipaseS447X lowers triglycerides in lipoprotein lipase-deficient patients. Arterioscler. Thromb. Vase. Biol. 28, 2303-2304 (2008).
[0349] 21. Carpentier, A. C. et al. Effect of alipogene tiparvovec (aav1-lpls447x) on postprandial chylomicron metabolism in Lipoprotein lipase-deficient patients. J. Clin. Endocrinol. Metab. 97, 1635-1644 (2012).
[0350] 22. Gaudet, D. et al. Long-term retrospective analysis of gene therapy withAlipogene Tiparvovec and its effect on lipoprotein lipase deficiency-induced pancreatitis. Hum. Gene Ther. 27, 916-925 (2016).
[0351] 23. Bryant, L. M. et al. Lessons learned from the clinical development and market authorization of Glybera. Hum. Gene Ther. Clin. Dev. 24, 55-64 (2013).
[0352] 24. Gaudet, D. et al. Efficacy and long-term safety of alipogene tiparvovec(AAV1-LPLS447X) gene therapy for lipoprotein lipase deficiency: an open-label trial. Gene Ther. 20, 361-369 (2013).
[0353] 25. Scott, L. J. Alipogene tiparvovec: A review of its use in adults with familial lipoprotein lipase deficiency. Drugs 75, 175-182 (2015).
[0354] 26. Gaudet, D., Methot, J. & Kastelein, J. Gene therapy for lipoprotein lipase deficiency. Curr. Opin. Lipidol. 23, 310-320 (2012).
[0355] 27. Hitoshi, N., Ken-ichi, Y. & Jun-ichi, M. Efficient selection for high- expression transfectants with a novel eukaryotic vector. Gene 108, 193-199 (1991).
[0356] 28. Blain, M. et al. Strong muscle-specific regulatory cassettes based on multiple copies of the human slow troponin I gene upstream enhancer. Hum. Gene Ther. 21 , 127- 134 (2010).
[0357] 29. Gilbert, R. et al. Establishment and validation of new complementing cells for production of E1-deleted adenovirus vectors in serum-free suspension culture. J. Virol. Methods 208, 177-188 (2014).
[0358] 30. Bourbeau, D. et al. Improvement of antitumor activity by gene amplification with a replicating but nondisseminating adenovirus. Cancer Res. 67, 3387-3395 (2007).
[0359] 31. Elahi, S. M. et al. A rapid Focus-Forming Assay for quantification of infectious adenoviral vectors. J. Virol. Methods 297, 114267 (2021).
[0360] 32. Robert, M. A. et al. Gene Transfer of ZMapp Antibodies Mediated byRecombinant Adeno-Associated Virus Protects Against Ebola Infections. Hum. Gene Ther. 29, 452-466 (2018).
[0361] 33. Cote, J., Garnier, A., Massie, B. & Kamen, A. Serum-free production of recombinant proteins and adenoviral vectors by 293SF-3F6 cells. Biotechnol. Bioeng. 59, 567- 575 (1998).
[0362] 34. Chahal, P. S., Schulze, E., Tran, R., Montes, J. & Kamen, A. A. Production of adeno-associated virus (AAV) serotypes by transient transfection of HEK293 cell suspension cultures for gene delivery. J. Virol. Methods 196, 163-173 (2014).
[0363] 35. Chahal, P. S., Aucoin, M. G. & Kamen, A. Primary recovery and chromatographic purification of adeno-associated virus type 2 produced by baculovirus / insect cell system. J. Virol. Methods 139, 61-70 (2007).
[0364] 36. Zolotukhin, S. et al. Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther. 1999 66 6, 973-985 (1999).
[0365] 37. Weinstock, P. H. et al. Severe hypertriglyceridemia, reduced high density lipoprotein, and neonatal death in lipoprotein lipase knockout mice. Mild hypertriglyceridemia with impaired very low density lipoprotein clearance in heterozygotes. J. Clin. Invest. 96, 2555-2568 (1995).
[0366] 38. Kamala, T. Hock immunization: A humane alternative to mouse footpad injections. J. Immunol. Methods 328, 204 (2007).
[0367] 39. Basu, D., Manjur, J. & Jin, W. Determination of lipoprotein lipase activity using a novel fluorescent lipase assay. J. Lipid Res. 52, 826-832 (2011).
[0368] 40. Lafferty, M. J., Bradford, K. C., Erie, D. A. & Neher, S. B. Angiopoietin-likeProtein 4 Inhibition of Lipoprotein Lipase: EVIDENCE FOR REVERSIBLE COMPLEX FORMATION * J. Biol. Chem. 288, 28524-28534 (2013).
[0369] 41. W, X. et al. Gene therapy vectors based on adeno-associated virus type 1.J. Virol. 73, 100-102 (1999).
[0370] 42. Nakai, H. et al. Adeno-Associated Viral Vector-Mediated Gene Transfer ofHuman Blood Coagulation Factor IX Into Mouse Liver. Blood 91 , 4600-4607 (1998).
[0371] 43. Guo, Z. S., Wang, L. H., Eisensmith, R. C. & Woo, S. L. C. Evaluation of promoter strength for hepatic gene expression in vivo following adenovirus-mediated gene transfer. Gene Ther. 3, 802-810 (1996).
[0372] 44. Baskar, J. F. et al. The enhancer domain of the human cytomegalovirus major immediate-early promoter determines cell type-specific expression in transgenic mice. J. Virol. 70, 3207-3214 (1996).
[0373] 45. Zincarelli, C., Soltys, S., Rengo, G. & Rabinowitz, J. E. Analysis of AAVSerotypes 1-9 Mediated Gene Expression and Tropism in Mice After Systemic Injection. Mol. Ther. 16, 1073-1080 (2008).
[0374] 46. Batty, P. & Lillicrap, D. Hemophilia gene therapy: Approaching the first licensed product. HemaSphere (2021) doi:10.1097 / HS9.0000000000000540.
[0375] 47. Crudele, J. M. & Chamberlain, J. S. AAV-based gene therapies for the muscular dystrophies. Hum. Mol. Genet. 28, R102-R107 (2019).
[0376] 48. Stone, D. et al. Gene Transfer in Adeno-Associated Virus SeropositiveRhesus Macaques following Rapamycin Treatment and Subcutaneous Delivery of AAV6, but Not Retargeted AAV6 Vectors. Hum. Gene Ther. 32, 96-112 (2021).
[0377] 49. Donahue, B. A. et al. Selective Uptake and Sustained Expression of AAVVectors Following Subcutaneous Delivery. J. Gene Med. 1 , 31-42 (1999).
[0378] 50. Ferreira, V. et al. Immune responses to intramuscular administration of alipogene tiparvovec (AAV1-LPLS447X) in a phase II Clinical trial of lipoprotein lipase deficiency gene therapy. Hum. Gene Ther. 25, 180-188 (2014).
[0379] 51. Ferreira, V., Petry, H. & Salmon, F. Immune responses to AAV-vectors,The Glybera example from bench to bedside. Front. Immunol. 5, 1-15 (2014).
[0380] 52. Verdera, H. C., Kuranda, K. & Mingozzi, F. AAV Vector Immunogenicity inHumans: A Long Journey to Successful Gene Transfer. Mol. Ther. 28, 723-746 (2020).
[0381] 53. Kishimoto, T. K. & Samulski, R. J. Addressing high dose AAV toxicity - ‘one and done’ or ‘slower and lower’? https: / / doi.org / 10.1080 / 14712598.2022.2060737 1-5 (2022) doi: 10.1080 / 14712598.2022.2060737.
[0382] 54. Normand, T. et al. Geographic distribution and genealogy of mutation 207 of the lipoprotein lipase gene in the French Canadian population of Quebec. Hum. Genet. 89, 671-675 (1992).
[0383] 55. Minnich, A. et al. Prevalence of alleles encoding defective lipoprotein lipase in hypertriglyceridemic patients of French Canadian descent. J. Lipid Res. 36, (1995).
[0384] 56. Boutin, S. et al. Prevalence of serum IgG and neutralizing factors against adeno-associated virus (AAV) types 1 , 2, 5, 6, 8, and 9 in the healthy population: implications for gene therapy using AAV vectors. Hum. Gene Ther. 21 , 704-712 (2010).
[0385] 57. Muraine, L. et al. Transduction Efficiency of Adeno-Associated VirusSerotypes After Local Injection in Mouse and Human Skeletal Muscle. Hum. Gene Ther. 31 , 233- 240 (2020).
[0386] All references referred to herein are incorporated by reference in their entireties.
Claims
WHAT IS CLAIMED IS:
1. A recombinant nucleic acid molecule for expressing human lipoprotein lipase (hLPL) comprising a gain of function mutation S447X (hLPLS447X), or a polypeptide having at least 80% sequence identity thereto and comprising the gain of function mutation S447X, the recombinant nucleic acid molecule comprising:- a transcriptional unit comprising:- a promoter for driving expression of the hLPLS447Xor the polypeptide having at least 80% sequence identity thereto, the promoter comprising the sequence of any one of SEQ ID NOs: 13 to 16 or a sequence having at least 80% sequence identity thereto,- a coding nucleic acid molecule that encodes the hLPLS447Xor the polypeptide having at least 80% sequence identity thereto, and- a polyadenylation signal, wherein the recombinant nucleic acid molecule optionally comprises a truncated woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) comprising the sequence of SEQ ID NO: 19 or a fragment of the sequence of SEQ ID NO: 18, which is positioned downstream with respect to the coding nucleic acid molecule.
2. The recombinant nucleic acid molecule of claim 1 , which is for expressing the hLPLS447X, wherein the hLPLS447Xcomprises the sequence of SEQ ID NO: 3.
3. The recombinant nucleic acid molecule of claim 1 or 2, wherein the promoter comprises the sequence of any one of SEQ ID NOs: 13 to 16.
4. The recombinant nucleic acid molecule of any one of claims 1 to 3, wherein the polyadenylation signal is:- a bovine growth hormone (bGH) polyadenylation signal (hGH polyA) comprising the sequence of SEQ ID NO: 20 or a sequence having at least 80% sequence identity thereto,- a human growth hormone (hGH) polyadenylation signal (hGH polyA) comprising the sequence of SEQ ID NO: 21 or a sequence having at least 80% sequence identity thereto, or- a human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22 or a sequence having at least 80% sequence identity thereto.
5. The recombinant nucleic acid molecule of claim 4, wherein the polyadenylation signal is the human growth hormone (hGH) polyadenylation signal (hGH polyA) comprising the sequence of SEQ ID NO: 21.
6. The recombinant nucleic acid molecule of any one of claims 1 to 5, wherein the coding nucleic acid molecule comprises the sequence of any one of SEQ ID NOs: 4, and 6 to 9; or a sequence having at least 80% sequence identity thereto.
7. The recombinant nucleic acid molecule of any one of claims 1 to 6, wherein the coding nucleic acid molecule comprises the sequence of any one of SEQ ID NOs: 4, and 6 to 9.
8. The recombinant nucleic acid molecule of any one of claims 1 to 7, wherein the transcriptional unit is flanked by 5' and 3' inverted terminal repeats (ITRs).
9. The recombinant nucleic acid molecule of claim 8, wherein the 5' and 3' ITRs are from an adeno-associated virus and comprise, respectively, the sequences of SEQ ID NOs: 10 and 11 , or ITR sequences having at least 80% sequence identity thereto.
10. The recombinant nucleic acid molecule of claim 9, wherein the 5' and 3' ITRs comprise, respectively, the sequences of SEQ ID NOs: 10 and 11.
11. The recombinant nucleic acid molecule of any one of claims 1 to 10, wherein the truncated WPRE is present in the recombinant nucleic acid molecule.
12. The recombinant nucleic acid molecule of claim 11, which comprises SEQ ID NO: 33 (from pVR59) or a sequence having at least 80% sequence identity thereto.
13. The recombinant nucleic acid molecule of claim 11, which comprises SEQ ID NO: 33 (from pVR59).
14. The recombinant nucleic acid molecule of any one of claims 1 to 10, which does not comprise the WPRE or the truncated WPRE.
15. The recombinant nucleic acid molecule of claim 14, which comprises SEQ ID NO: 35 (from pVR80) or a sequence having at least 80% sequence identity thereto.
16. The recombinant nucleic acid molecule of claim 14, which comprises SEQ ID NO: 35 (from pVR80).
17. The nucleic acid molecule of any one of claims 1 to 14, wherein the polyadenylation signal is the human p-globin polyadenylation signal comprising the sequence of SEQ ID NO: 22.
18. The recombinant nucleic acid molecule of claim 14 or 17, which comprises SEQ ID NO: 37 (from pNC201) or a sequence having at least 80% sequence identity thereto.
19. The recombinant nucleic acid molecule of claim 14 or 17, which comprises SEQ ID NO:37 (from pNC201).
20. The recombinant nucleic acid molecule of claim 14 or 17, which comprises SEQ ID NO:38 (from pNC182) or a sequence having at least 80% sequence identity thereto.
21. The recombinant nucleic acid molecule of claim 14 or 17, which comprises SEQ ID NO: 38 (from pNC182).
22. The recombinant nucleic acid molecule of any one of claims 1 to 21 , which is a single stranded DNA (ssDNA) molecule, a double stranded DNA (dsDNA) molecule, a single stranded RNA (ssRNA) molecule, or a double stranded RNA (dsRNA) molecule.
23. The recombinant nucleic acid molecule of any one of claims 1 to 21 , which is a single stranded DNA (ssDNA) molecule.
24. A vector comprising the recombinant nucleic acid molecule as defined in any one of claims 1 to 21.
25. The vector of claim 24, which is a plasmid vector.
26. The vector of claim 25, wherein the plasmid vector is an adeno-associated virus (AAV) transfer plasmid.
27. A recombinant host cell comprising the nucleic acid molecule as defined in any one of claims 1 to 23 or the vector of any one of claims 24 to 26.
28. A recombinant viral particle comprising the recombinant nucleic acid molecule as defined in any one of claims 1 to 23.
29. A recombinant AAV viral particle (rAAV) comprising the nucleic acid molecule as defined in claim 23.
30. The rAAV of claim 29, which is of adeno-associated virus serotype 8 (AAV8).
31. The rAAV of claim 29, which is of adeno-associated virus serotype 1 (AAV1).
32. A method of delivering the recombinant nucleic acid molecule as defined in any one of claims 1 to 23 to a cell comprising contacting the cell with the recombinant viral particle as defined in claim 28.
33. A method of delivering the recombinant nucleic acid molecule as defined in any one of claims 1 to 23 to a cell comprising contacting the cell with the rAAV as defined in any one of claims 29 to 31.
34. A method of treating plasma lipidemia comprising administering to a subject the rAAV as defined in any one of claims 29 to 31.
35. A method of treating lipoprotein lipase deficiency in a subject comprising administering to a subject the rAAV as defined in any one of claims 29 to 31.
36. The method of claim 34 or 35, wherein the step of administering is intramuscular (IM) administration, intravenous (IV) administration, or subcutaneous (SQ) administration.
37. The method of claim 36, wherein the step of administering is the IM administration.
38. The method of claim 37, wherein the rAAV is of the AAV8 serotype and is about ten times as efficacious as the same amount of Glybera™.
39. The method of claim 36, wherein the step of administering is the IV administration.
40. The method of claim 39, wherein the rAAV is of the AAV8 serotype and is about one hundred times as efficacious as the same amount of Glybera™.
41. A use, for delivering the recombinant nucleic acid molecule as defined in any one of claims 1 to 23 to a cell, of the recombinant viral particle as defined in claim 28.
42. A use, for delivering the recombinant nucleic acid molecule as defined in any one of claims 1 to 23 to a cell, of the rAAV as defined in any one of claims 29 to 31 .
43. A use, for treatment of plasma lipidemia, of the rAAV as defined in any one of claims 29 to 31.
44. A use, for treatment of lipoprotein lipase deficiency in a subject, of the rAAV as defined in any one of claims 29 to 31.
45. The use of claim 43 or 44, wherein the rAAV is for intramuscular (IM), intravenous (IV), or subcutaneous (SQ) use.
46. The use of claim 45, wherein the rAAV is for the IM use.
47. The use of claim 46, wherein the rAAV is of the AAV8 serotype and is about ten times as efficacious as the same amount of Glybera™.
48. The use of claim 45, wherein the rAAV is or IV use.
49. The use of claim 48, wherein the rAAV is of the AAV8 serotype and is about one hundred times as efficacious as the same amount of Glybera™.
50. The rAAV as defined in any one of claims 29 to 31 for use in treatment of plasma lipidemia in a subject.
51. The rAAV as defined in any one of claims 29 to 31 for use in treatment of lipoprotein lipase deficiency in a subject.
52. The rAAV for use of claim 50 or 51 , wherein the rAAV is for intramuscular (IM), intravenous (IV), or subcutaneous (SQ) use.
53. The rAAV for use of claim 52, which is for the IM use.
54. The rAAV for use of claim 53, wherein the rAAV is of the AAV8 serotype and is about ten times as efficacious as the same amount of Glybera™.
55. The rAAV for use of claim 52, which is for the IV use.
56. The rAAV for use of claim 55, wherein the rAAV is of the AAV8 serotype and is about one hundred times as efficacious as the same amount of Glybera™.
57. A method of producing recombinant AAV viral particles (rAAVs) comprising:- transfecting cells with:- a transfer plasmid comprising the recombinant nucleic acid molecule as defined in any one of claims 1 to 22, wherein the cells express AAV components required for packaging the recombinant nucleic acid molecule into rAAV particles;- culturing the cells to produce the rAAVs, and- isolating the rAAVs.
58. The method of claim 57, wherein the cells express AAV rep and cap proteins, AAV E2 and E4A proteins and AAV virus-associated (VA) RNAs.
59. The method of claim 57, further comprising transfecting or co-transfecting the cells with:- a plasmid encoding AAV rep and cap proteins, and- a helper plasmid encoding an AAV E2 and E4A proteins and AAV virus- associated (VA) RNAs.
60. The method of any one of claims 57 to 59, wherein the rAAVs are of adeno-associated virus serotype 8.
61. The method of any one of claims 57 to 59, wherein the rAAVs are of adeno-associated virus serotype 1.
62. The method of any one of claims 57 to 61 , which is an in vitro method.