Process for the modification of genome structure and gene expression in wheat

Abstract

A method of modifying the genome structure and / or gene expression of wheat by crossing a parental wheat (P♀) with a transgenic barley (X XH+H) containing at least one transgenic barley chromosome (XH+), wherein the following steps are carried out: (i) barley genome is transformed with a pre-designed gene construct that can affect the wheat genome and / or its expression, (ii) the resulting wheat (F1) × wheat × at least one transgenic barley chromosome containing transitional hybrids (F1♀) are selected and bred, (iii) the wheat × at least one transgenic barley chromosome -containing transitional hybrids (F1♀) are backcrossed with a wheat (♂), (iv) and a new generation is produced by selfing the selected backcrosses (BC1), (v) from this new generation, a wheat (BC1S1) is selected which is the product of the process and is free from any chromosomal aberrations and altered in genome structure and / or gene expression.

Description

[0001] Process for the modification of genome structure and gene expression in wheat

[0002] The invention relates to a non-transgenesis -inducing process in the wheat genome that modifies genome structure and / or gene expression, which is more efficient than similar non-transgenesis-inducing processes used in wheat so far. The process is a genetic technique that involves a change in the genetic material and / or gene expression of wheat that would not occur in nature without human intervention.

[0003] To modify the genetic material and / or gene expression of wheat, the barley genome is transformed with a pre-designed gene construct that can manipulate the wheat genome and / or its expression, and then wheat egg cell fertilization with the transgenic barley pollen is combined with a demethylation chemical treatment to produce a transient wheat x barley hybrid plant in which proteins and / or RNAs encoded by the transgene carry out the modification of the wheat genome. The change in the genetic material of wheat and / or in the expression of its genes may be temporary and may be passed on to subsequent generations depending on the transgene carried by the barley. The new trait of the plant is created by the transgene present in the barley, and in the absence of a transgene no beneficial trait would develop.

[0004] State of the art

[0005] Modification of genome structure and / or gene expression is usually achieved by the intracellular expression or artificial insertion of an executive protein and / or RNA molecule. In many cases, modification of genetic material in this way confers an economic advantage to the organism. This group includes various gene- editing techniques (CRISPR / Cas, TALEN, ZFN, meganucleases) that can be used to impart food, health, or other economically important traits to plants. Unlike previous transgenic techniques, these traits do not necessarily require the insertion of foreign gene sequences, but create new phenotypes through induced gene mutations, similar to other freely available but random mutation techniques (irradiation, chemical treatment, etc.). A major advantage of gene editing over previously used mutation techniques is the high degree of specificity of creating the desired gene mutation, provided by a programmed RNA molecule and / or protein. Based on the state-of-the-art, the most efficient method for carrying out gene-specific mutagenesis is to temporarily insert the gene of the gene-editing protein and, if applicable, an RNA molecule into the genome and then remove them in subsequent generations after the gene mutations have been created. However, temporary transgenesis involving the target genome may raise concerns on the user side due to the currently controversial perception of GMOs (Genetically Modified Organisms), including plants. At the same time, transgenesis has technological difficulties, as the transformability of most plant species / cultivars is limited. In view of the above, it is feasible to produce transgenic wheat by gene editing and then transgene segregation. The problem is that few wheat cultivars can be well transformed and there is a risk of persistence of small gene fragments that are difficult to trace and that have been incorporated during transgenesis.

[0006] For these reasons, procedures have been developed that do not require transgenesis of the target genome. Examples include the biolistic (gene bombardment) or chemically induced delivery of gene-editing proteins and / or RNA into embryogenic cells and subsequent plant regeneration from these cells. However, in the absence of selection, these techniques are labour intensive and, due to the limited lifetime of the gene- editing protein in the cells, their efficiency is very low and the process is not well suited for industrial application.

[0007] International Publication Document No. WO / 2018 / 102816, which is the closest technical solution to the present invention describes a new method of gene editing. It does not involve the introduction of a transgene into the target genome, does not require good transformability of the target genome, and at the same time, a genome with a transgene and the target genome only temporarily coexist in the cell so that both gene editing and transgene removal can be performed without any doubt.

[0008] The process involves pollinating a plant to be modified with pollen from a known haploid induction line containing a transgene suitable for plant gene editing. The genome of the resulting haploid progeny is modified by the function of the transgene transferred by the crossing, while the gene-editing transgene is eliminated along with the chromosomes of the haploid inducer line. In practice, the genetic material is only altered for the first few cell divisions, as the gene sequence producing gene -editing proteins on the chromosomes of the haploid-inducing line is continuously eliminated during cell divisions. Preferred embodiments of the technique include modification of the wheat genome. However, the technique is actually of little or no use for modifying the genome of hexapioid wheat, since there are three pairs of homeologous subgenomes (A, B, and D) in wheat, and usually all three homeologous gene sequences need to be modified to achieve a particular trait, which is very inefficient in a process where the transgene is only present for a few cell divisions. In many cases, moreover, the gene to be modified is located in a heterochromatic region during embryonic development, which, because of its methylation, is not accessible to the proteins encoded by the transgene until the time of elimination. Other wheat genes (e.g. gliadin storage protein genes) are present in the wheat genome in high copy numbers (>100), which would also require very high efficiency or longer time to modify. International Publication Document No. WO / 2018 / 102816 mentions the distant crossing of wheat with transgenic barley as a preferred embodiment. After crossing wheat and transgenic barley, the F1 progeny plants can be divided into two sets: A) a group of plants without a barley chromosome (early chromosome elimination), which are considered haploid (In) compared to the original wheat with 2n genome, since they contain only the maternal genome; B) a group of plants with at least one barley chromosome, which are partial or complete wheat x barley hybrid plants. The solution according to International Publication Document No. WO / 2018 / 102816 focuses only on set A) and aims to achieve the transgene-free status by the early elimination of paternal chromosomes, which in turn is not preferred to wheat gene modification due to the relatively short duration of the transgene. This embodiment of the cited patent is not well feasible for all wheat cultivars, since the proportion of transgene- free haploid F1 individuals in wheat x barley crosses is, with few exceptions, relatively low. Thus, compared to other distant crosses (e.g. wheat x maize), wheat x barley crosses can be considered as hybridization rather than haploid induction.

[0009] Given the shortcomings identified, we aimed to develop a method that is more efficient than the state-of- the-art methods for modifying the genome structure and / or gene expression in wheat, while ensuring a transgene-free outcome.

[0010] The discovery according to the invention

[0011] It is known from the state of the art that hybridization occurs in distant crosses of wheat x barley to a technologically useful extent. It is recognized that the presence of transgene -containing barley chromosomes in hybrids over longer periods and at different stages of the life cycle provides the opportunity to modify the genome structure and / or gene expression in wheat compared to haploid induction techniques, which is favorable to the use of genetic engineering tools to modify wheat genome structure and / or gene expression. Genetic engineering tools are defined as protein families and gRNA families that allow modification of genome structure and / or gene expression. Without limitation, such tools are CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-Associated Protein), TALENs (Transcription Activator-Like Effector Nucleases), ZFNs (Zinc Finger Nucleases), meganucleases, RNA interference constructs (artificial microRNA, inverted repeat), enzymes affecting DNA methylation (methylases, demethylases). Genetic engineering is defined as those techniques that facilitate the application of the above tools. Without limitation, such methods are: biolistic or agrobacterial transgenesis; direct cellular delivery of RNAs, RNPs (RiboNucleoProtein), or proteins; and viral delivery (VIGE, Virus Induced Genome Editing).

[0012] In the present specification, the term "crossbreeding" is used in a sense different from the essentially biological process of creating conventionally bred plant cultivars: in the embodiments of the present invention, "crossbreeding" includes, inter alia, pollination between distant species (genetically and reproductively unrelated) and a chemical treatment for demethylation. Distant interspecific fertilization is characterized by the partial or total loss of genetic material from one (often paternal) parent during the development of the offspring. This process is fundamentally different from controlled crosses in breeding for cultivar development, which, on the contrary, aim at combining the genetic material of both parents and passing it on in a stable way to the progeny. On the other hand, demethylation chemistry can compensate with great efficiency for the phenomenon, which often occurs when pollinating distant species, that the genetic material from the parents of the opposite species is incompatible, which prevents the methylation pattern of the genes from being passed on to the progeny: the endosperm does not develop, and its lack does not allow the embryo to grow and develop. This defect is corrected by the demethylation chemistry treatment by resetting the methylation pattern, resulting in larger and more developed hybrid embryos. Accordingly, in wheat x barley 'crosses', the efficient production of hybrid embryos is also ensured by chemical treatment with a demethylation agent. (Note that, unlike in intercultivar crosses, the progeny that are produced after pollination between distant species are inherently non-viable because they lack endosperm, or nutritive tissue, to provide the nutrients necessary for natural germination. Therefore, embryos that are undeveloped and doomed to die must always be dissected out of the grains at an early stage and then grown in vitro on artificial media to provide these missing nutrients.) It is also known from the state of the art that wheat x barley hybrids can be backcrossed with wheat to produce wheat with a 2n genome and no barley chromosome. Related to this is our further finding that, with the appropriate sequence of steps known from the state-of-the-art in our process, after modifying the genome structure and / or gene expression in the hybrids, the progeny plants can be made transgene-free with 2n genome by backcrossing and self-fertilization. Thus, the product of the process meets all the state- of-the-art requirements for the assessment of GMOs imposed on gene-editing technologies.

[0013] In International Publication Document No. WO / 2018 / 102816, barley is used as a haploid-inducing crop in wheat, but we use the more likely hybridization phenomenon that typically occurs. In our approach, we, therefore, retain for further crossing those hybrids that still contain transgene -bearing barley chromosomes and are more likely to have the desired changes in genome structure and / or gene expression. In the F1 progeny resulting from a wheat x transgenic barley cross, the barley chromosomes may segregate during meiosis, so that after backcrossing the F1 progeny with wheat some individuals of the BC1 (Back Cross 1) generation no longer contain the barley chromosomes. The individuals without the barley chromosomes can be selected using known state-of-the-art methods. The members of the BC1 generation generated by backcrossing, selected using known methods, are heterozygous for each induced gene mutation. However, members of the BC1S1 (BC1 Self 1) generation generated by selfing BC1 plants may be selected as homozygous for the desired gene altered in genome structure and / or gene expression and no longer containing the marker chromosome.

[0014] It is also important to note that the genetic stocks of barley and wheat are so different that the possibility of gene transfer by recombination in the transitional hybrids, and thus the appearance of a transgenic wheat chromosome on the barley chromosome, is virtually eliminated.

[0015] The objective of the invention

[0016] With this objective in mind, our invention is therefore a method to modify the genome structure and / or gene expression with high efficiency using a transgenic barley genome containing at least one transgenic barley chromosome.

[0017] The objectives of the invention may be achieved by the process described in claim 1, the preferred embodiments of which are set out in the sub-claims.

[0018] Brief description of the invention

[0019] 1 A process for modifying the genome structure and / or gene expression of wheat by crossing a parental wheat (P♀) with a transgenic barley (XH+XH) containing at least one transgenic barley chromosome (XH+), wherein the following steps are carried out:

[0020] (i) transforming the barley genome with a pre-designed gene construct that can manipulate the wheat genome and / or its expression,

[0021] (ii) fertilizing wheat egg cells with the transgenic barley pollen, the wheat is then subjected to a demethylation treatment to induce partial development of the endosperm and more efficient development of the embryos, and the embryos are grown on artificial media under in vitro conditions; (iii) the resulting cross progeny (F1) wheat x transitional hybrids (F1♀) containing at least one transgenic barley chromosome are selected and grown,

[0022] (iv) then, the wheat x transitional hybrids (F1♀) containing at least one transgenic barley chromosome are backcrossed with a wheat ( ♂),

[0023] (v) and then a new generation is produced by self-fertilization from the selected individuals (BC1) resulting from backcrossing,

[0024] (vi) from which a new generation of wheat (BC1S1) is selected, which is the product of the process, free of the barley chromosomes, modified in genome structure and / or gene expression.

[0025] 2. The process according to Point 1, wherein the backcrossed wheat ( ♂) and the parental wheat (P♀) are of the same cultivar.

[0026] 3. The process according to any one of Points 1 and 2, wherein the wheat used in the backcrossing ( ♂) and the parent wheat (P♀) arc of different cultivars.

[0027] 4. The process according to any one of Points 1 to 3, wherein a chemical demethylation treatment is applied during the crossing.

[0028] 5. The process according to any one of Points 1 to 4, wherein the transgene of the transgenic cargo chromosome (XH+) used is a gene-editing tool.

[0029] 6. The process according to Point 5, wherein said gene-editing tool is selected from the gene techniques of CRISPR / Cas, TALENs, ZFNs, RNA interference constructs, a derivative, or a combination thereof.

[0030] 7. The process according to any one of Points 1 to 3, wherein the transgene of the transgenic barley chromosome (XH+) used modifies the methylation pattern of the wheat.

[0031] 8. The process according to Point 7, wherein the methylation pattern modifying transgene is an RNA interference construct that silences the Metl and / or Cmt3 genes.

[0032] 9. The process according to any one of Points 1 to 8, wherein the transgenic barley chromosome (XH+) used comprises a reporter gene.

[0033] 10. The process according to Point 9, wherein the reporter gene is one or a combination of GFP, YFP, DsRed, and Ruby.

[0034] 11. The process according to any one of Points 1 to 10, wherein the growing is carried out by in vitro micropropagation. 12. The process of Point 11, wherein the explant in the in vitro micropropagation is an immature embryo or immature ear.

[0035] Description of the figures

[0036] Our findings are presented in detail with reference to the attached drawings, where

[0037] - Figure 1 shows the steps of our procedure.

[0038] - Figure 2 shows the application of our process for gene editing.

[0039] - Figure 3 shows the application of our process for temporarily modifying gene expression.

[0040] - Figure 4 illustrates an application of our technique to modify the genome structure and / or gene expression of wheat that hybridizes poorly with barley.

[0041] - Figure 5 shows a process to modify the process of meiotic recombination between two wheat cultivars.

[0042] - Figure 6 shows the chromosome composition of the F1 (wheat x barley) generation by multiplex PCR (MPCR). (A) Genome-specific MPCR products A, (B) Genome-specific MPCR products B, (C) Genome- specific MPCR products D, (D) Genome -specific MPCR products H (red asterisk, Cas9-positive plants; red arrow, Cas9 amplicon of size 445 base pairs), (E) Template DNA used to identify individual chromosome-specific MPCR product amplicons. M - 100 bp Plus DNA layer; 1-37 - F1 hybrid plants; M1

[0043] - M1 wheat; GP - 'Golden Promise' bailey; dw - distilled water.

[0044] - Figure 7 shows an analysis of wheat mlo gene mutations in the F1 generation by PCR / RE (238 bp Tamlo PCR product digested with Cac8I restriction enzyme). M - 100 bp Plus DNA layer; 1-37 - F1 hybrid plants (red arrow, mutant plants); w - wild type M1 wheat, digested PCR product; - wild type M1 wheat, undigested PCR product; dw - distilled water.

[0045] - Figure 8 shows chromosome composition analysis of BC1 generation subgenomes by multiplex PCR. M - 100 bp Plus DNA ladder; 1-17 - BC1 plants (red asterisk, Cas9-positive plants; red arrow, 445 base pair size Cas9 amplicon); GP - ‘Golden Promise' barley; Ml - Ml wheat.

[0046] - Figure 9 shows an analysis of wheat mlo gene mutations in the BC1 generation by PCR / RE (Tamlo PCR products digested with Cac8I restriction enzyme at 238 base pairs). M · 100 bp Plus DNA layer; 1-17

[0047] - BC1 plants (red arrow, mutant plant); w - wild type Ml wheat, digested PCR product; - wild type M1 wheat, undigested PCR product.

[0048] - Figure 10 shows in vitro plants from F1 embryos showing wheat mlo gene mutations (A) and barley genome chromosome composition (B). M - 100 bp Plus DNA layer; 1-20 - in vitro propagated plants (red arrow, mutant plant); - wild type M1 wheat, undigested PCR product; w - wild type M1 wheat, digested PCR product; dw - distilled water; M1 - M1 wheat; GP - ‘Golden Promise' barley.

[0049] - Figure 11 shows an analysis of wheat mlo gene mutations by PCR / RE in in vitro propagated progeny from immature cassava of an F1 plant (Figure 5-figure supplement 7). M - 100 bp Plus DNA ladder; 1-24 - in vitro propagated plants; w - wild type M1 wheat, digested PCR product; - wild type Ml wheat, undigested PCR product.

[0050] - Figure 12 shows a schematic drawing of the pHUER_Tamlosg2 vector (SEQ ID NO: 01) used for the Agrobacterium-mediated transformation of immature barley embryos to create targeted mutations in wheat Tamlo genes.

[0051] The meaning of the reference symbols used in the description and figures is as follows:

[0052] P - Generation Parent

[0053] F1 - First (filial) generation of progeny

[0054] BC1 - First backcrossed generation

[0055] BC1 S1 - First self-fertilized generation from the backcrossed generation

[0056] Xx- At least one chromosome from any subgenome of hexapioid wheat

[0057] Xx- At least one chromosome from any subgenome of hexapioid wheat with altered genome structure

[0058] - Barley transgenic chromosome (text: XH+)

[0059] - Barley non-transgenic chromosome (text: XH)

[0060] Xx* - Hexapioid wheat with at least one chromosome from any subgenome

[0061] Xx*x - One chromosome derived from recombination of homologous chromosomes from any subgenome of another wheat and a hexapioid wheat

[0062] Xxx* - Hexapioid common wheat and another chromosome resulting from recombination of homologous chromosomes from either subgenome of another wheat

[0063] P♀ - Parental wheat

[0064] F1♀ - Wheat x transitional hybrid containing at least one transgenic barley chromosome

[0065] ♂ - Wheat used for backcrossing

[0066] Figure 1 shows the steps of our process. Already after crossing wheat with transgenic barley (step 2), genome editing and / or gene expression modification can be achieved. However, changes in the genome structure and / or gene expression of wheat with a 2n genome, homozygous for the desired gene, generated during the procedure, can also occur in any of the subsequent steps of the procedure, in which the wheat genome and transgenic barley chromosomes are present in cells together, which is of particular importance in influencing the recombination process, where the effect of the transgene is particularly relevant during the formation of gametes of the BC1 generation. The process steps are as follows:

[0067] Step 1: Transforming barley with a system that modifies the structure and / or expression of the wheat genome.

[0068] The process can involve the use of any transgene that modifies the genome structure and / or gene expression of wheat in transgenic barley. The transgene is always selected according to the genomic structure and / or gene expression modification objective from among the procedures known in the state of the art. Hereafter, the transgene selected according to the purpose will be abbreviated as transgene GOI, or Gene of Interest, for better differentiation. Genome-modifying transgenes by type of GOI may be, but are not limited to, CRISPR / Cas, TALEN, meganucleases or ZFN. Gene -expression-altering transgenes may be, but are not limited to, RNA interference constructs (artificial microRNA, inverted repeat), methylases, demethylases, and modifying factors. A transgenic barley carrying a transgenic GOI can be produced by state-of-the-art methods. In the process, it is advantageous to use a linked reporter gene (e.g. GFP, YFP, DsRed, Ruby, etc.) in addition to the transgenic GOI selected for the purpose of identifying transgenic barley chromosomes. Without limitation, transgenic barley may be produced by biolysis or Agrobacterium- mediated gene transfer.

[0069] Step 2: Crosses between parental wheat and transgenic barley containing at least one transgenic barley chromosome

[0070] In this step, barley (Hordettm vulgare L.) is crossed with wheat (Triticum aestivum L.) using barley as a stamen. Following crossing, a chemical demethylation treatment is applied to the wheat plant to promote more efficient endosperm and embryo development following distant crossing.

[0071] Step 3: Selection and breeding of transitional hybrids containing at least one transgenic wheat x barley chromosome

[0072] Selection can be done, for example, by using a reporter gene linked to the transgenic GOI selected for the purpose using a procedure known in the state of the art when transgenic barley was generated, or by any other procedure to determine the karyotype or genotype. The F1 generation is raised in vitro on artificial media by embryo rescue. Since the efficiency of egg cell fertilization with a distant species is lower than with natural pollination with the same species, and the low number of embryos that develop is also variable in the number of wheat carrying transgenic GOI, or with modified genome structure and / or gene expression, the system can be made more efficient by micropropagating the immature embryo or immature cotyledon of the established F1 hybrid embryo or the immature cotyledon of the F1 hybrid plant raised by in vitro culture of a hybrid carrying the desired modification(s) in wheat chromosomes and barley chromosome(s) carrying the transgenic GOI. Through in vitro breeding, we can backcross more plants with wheat, which will increase the yield of BC1 plants in the next step.

[0073] Step 4: Backcrossing of hybrids containing at least one transgenic wheat x one transgenic barley chromosome with wheat

[0074] To repeatedly produce a wheat plant containing 2n wheat genomes from the F1 hybrid plant selected in step 3, selected wheat x transgenic barley hybrids of the F1 hybrid are crossed with wheat using an arbitrary procedure known in the state-of-the-art.

[0075] One preferred embodiment of our method is backcrossing with the parental wheat, where the hybrid selected in the previous step is crossed with the parent wheat plant.

[0076] Another advantageous embodiment of our procedure is to cross the hybrid selected in the previous step with a so-called noble wheat, which is different from the parental wheat, does not hybridize well with barley, but is otherwise more important from an economic point of view. The resulting BC1 hybrid will either contain the transgenic barley chromosome or not. In a hybrid that also contains the transgenic barley chromosome, the genome and / or gene expression of the economically more important wheat may be altered. According to another preferred embodiment of our method, the transgenic GOI comprises a methylase / demethylase enzyme or a methylase / demethylase silencing construct, so that recombination can be extended to naturally recombinable or non-recombinable regions of the genome by modifying methylation in two different wheat cultivars during backcrossing.

[0077] Step 5: Self-fertilisation of the backcrossed generation

[0078] Self-fertilisation occurs naturally on its own. To prevent fertilization by foreign pollen, the ear is insulated, so the only way to fertilize is by self-fertilization. Self-fertilization, including isolation, can be achieved by any method or means known in the state-of-the-art.

[0079] Step 6: Product selection of wheat free of transgenic commodity chromosomes, modified in genome structure and / or gene expression

[0080] From the generation generated by self-fertilization in the previous step, we use any method we like to test the karyotype of the plants, i.e. which chromosomes of which genomes are present, using state-of-the-art techniques. Such a method may be genome in situ hybridization (GISH), or a PCR-based chromosome marker system, or any other method known in the state of the art. On the other hand, we investigate the occurrence of modifications in genome structure and / or gene expression. In the case of a change in genome structure and / or gene expression, the change affects at least one gene. The change can be verified by PCR / RE (PCR / restriction enzyme), T7 endonuclease assay of the target sequence, possibly Cas9 / guide RNA (RNP) in vitro cleavage, qPCR, RNAseq procedures, or sequencing. This can be used to determine whether a mutant sequence other than the original genome sequence is present at the target sequence locus and whether it is heterozygous or homozygous.

[0081] The products of the process can become the starting materials for plant breeding processes. Processes that involve editing and / or modifying the expression of a gene or genes result in a stable product that is homozygous for the gene or genes in question and can be used for plant breeding. However, hybrids containing recombination induced in regions of rare recombination, where the aim is to increase genetic variability and create new combinations, will in most cases necessarily be produced in a form that is mixed homozygous and heterozygous for each gene and, as such, will be suitable inputs for a plant breeding process.

[0082] Figure 2 shows the application of our method to genome editing. In the figure, only at least one affected chromosome is shown from both the wheat and barley genomes. In the parental generation P, we cross aP♀ wheat of genotype X XXXwith transgenic barley of genotype X XH+Hthat contains at least one transgenic chromosome (hereafter: XH+to denote transgenic barley chromosome), which transgene is capable of modifying the structure and / or gene expression of the target genome on chromosome XX, where XXis at least one chromosome of subgenomes A, B, D.

[0083] From the transitional hybrids of the first F1 progeny generation resulting from crosses, we select, using state-of-the-art methods, those F1♀ hybrids of genotype X'XXH+in which at least one chromosome of the wheat A, B, and D subgenomes has been modified by hybridization and transgene expression on the XH chromosome, and at least one X'Xgene-edited wheat chromosome has been created. The resulting hybrid contains at least one X'Xgene-edited chromosome.

[0084] Subsequently, the F1 generation containing at least one X'Xchromosome will be backcrossed with wheat ♂ of genotype XXXXto produce the first backcrossed BC1 generation, which will again contain hexapioid (2n) wheat genomes and be heterozygous for the gene being gene-edited.

[0085] The BC1S1 self-fertilized generation, which can be generated by self-fertilization from individuals of the BC1 generation X'XXXand X'XX XXH+, can be selected from the X'XX'Xindividuals that are homozygous for at least one gene and no longer contain a price chromosome.

[0086] Figure 3 shows the application of our procedure to temporarily modify gene expression. The GOI of transgenic barley transgene XH+XHcontaining at least one transgenic barley chromosome used in the parental generation P allows for the temporary modification of gene expression in P wheat of genotype XXXX. From the F1 first progeny generation XXXH+genotypic transient hybrids resulting from the cross, those in which the expression of the desired gene is modified by hybridization and the transgene expressed on the XH+transgenic barley chromosome, resulting in the appearance of the N protein and / or RNA in the cell, are selected using known methods. The selection method can be implemented based on phenotypic traits due to temporary changes in gene expression.

[0087] Subsequently, the F1 generation of the selected XXXH+F1♀ transitional hybrid will be backcrossed with the XXXXwheat genotype to produce the first backcrossed generation BC1, which will again contain hexapioid (2n) wheat genomes, within which they will either contain the XH+barley chromosome, i.e. they are XXXXXH+wheat x barley hybrids, or if the XH+barley chromosome has already segregated during meiosis, the individual will be at most a partial wheat x barley hybrid, or if it does not contain a barley chromosome, it will not be a hybrid, i.e. XXXXwheat.

[0088] The members of the BC1S1 self-fertilized generation, which can be generated by self-fertilization from any individual of the BC1 generation, can be selected from those wheat XXXXindividuals that no longer contain the barley chromosome.

[0089] Figure 4 illustrates an application of our process to modify the genomic structure and / or gene expression of a (♂ noble wheat of genotype Xx*Xx*that is intrinsically poorly hybridizable with barley. In the figure, only at least one affected chromosome from both the wheat genome and the barley genome is shown. Figure 4 is a sub-figure of Figure 2, in which the genome structure and / or gene expression of wheat of Xx*Xx*genotype containing at least one transgenic barley chromosome, which hybridizes poorly with transgenic barley containing at least one transgenic barley chromosome but is important for economic reasons, is modified by backcrossing BC1, when similarly to Figure 2, XXXH++genotype F1♀ transitional hybrids of the F1 generation generated from XXXXgenotype parental wheat P and XXXH+type transgenic barley containing at least one transgenic barley chromosome are selected, and then from the XXXH+genotype F1♀ transitional hybrid containing at least transgenic barley chromosome and Xx*Xx*genotype wheat hybrids are generated by backcrossing.

[0090] Of the resulting BC1 hybrids, the hybrid XXXX*XH+containing the transgenic XH+chromosome is of interest to us because the transgene can also modify the structure and / or gene expression of the chromosomes in the common wheat so that after the self-fertilization step, the modified homozygous form of the X’x*X’x*wheat is also produced, which can be selected from the BC1S1 generation using state-of- the-art techniques.

[0091] Figure 5 shows a process to modify the process of meiotic recombination between two wheat cultivars.

[0092] Figure 5 is a subset of Figure 3, where the gene modified in expression (expression) affects the methylation of DNA. In hybrids of the F1 generation containing the F1♀ transgenic barley chromosome, enzymes affecting M methylation are already present due to the transgene function. Influencing methylation in the BC1 generation will be important during gamete formation since recombination between the F1♀ transitional hybrid Xx of genotype XXXH+from the F1 generation and the Xx*Xx*chromosomes from the wheat genotype Xx* will occur at this stage if the presence of the transgenic XH+chromosome ensures the production of enzymes affecting M methylation and thus the modification of the methylation pattern of the chromosomes. After self-fertilization, recombinant wheat x wheat hybrids Xx*xXxx*without any barley chromosomes are selected.

[0093] Description of the techniques used in the invention

[0094] SEQ ID:01

[0095] Sequence Examples

[0096] Example 1: A barley plant was transformed using the pHUERTamlosg2 CRISPR / Cas9 vector (SEQ ID NO:01, 12. Figure 12), in which the transfer DNA (T-DNA) contained a wheat gene (Tamlo) specific guide RNA, a constitutively driven (maize ubiquitin promoter) Cas9 gene, a constitutively driven (CaMV 35S promoter) DsRed reporter gene and a hygromycin phosphotransferase (hptH) gene. We used a guide RNA (target sequence: 5’- GCGGCACAAGAACGCGCTGG, PAM: CGG -3’) with an efficiency of 17%, i.e. very low, according to the guide RNA designer CRISPR-Cereal (http: / / crispr.hzau.edu.cn / CRISPR- Cereal / ). The target sequence also contains a restriction enzyme (Cac8I) recognition site, which facilitates the detection of mutations using PCR / restriction enzyme (PCR / RE). The construct was generated based on a previously described protocol (Xing, Hui-Li, et al., BMC Plant Biology, 14: 1-12, 2014) using Golden Gate Assembly with Tamlo_sg2_guide_F (SEQ ID NO:02) and Tamlo_sg2_guide_R (SEQ ID NO:03) oligonucleotides. The barley cultivar transgenically modified with the construct is Hordeum vulgare 'Golden Promise'. The barley transformation was generated using a previously described method (Bartlett, Joanne G., et al., Plant Methods 4: 1-12, 2008).

[0097] Wheat (Triticum aestivum 'LM1') was crossed with T3 individuals of transgenic barley containing at least one transgenic barley chromosome (which did not show segregation for the presence of the transgene) using a method known from the literature (Polgari, David et al., Plant Cell Reports 38:767-775, 2019), where the porter was transgenic barley containing at least one transgenic barley chromosome. A total of 37 plants were regenerated in vitro by embryo rescue. To reactivate the epigenetically inactivated genes, plants were treated with a cytosine analog (5-azacytidine, Sigma-Aldrich) carrying nitrogen substitution at carbon atom 5 (Vieira et al., Genome, 33.5: 707-712, 1990; Haaf, Thomas Pharmacology & Therapeutics, 65.1: 19-46, 1995). 5-azacytidine dissolved in DMSO (5 pM - 5 mM) was injected into the last internode cavity below the ear. Treated ears were injected with 1 mL of 100 mg / L 2,4-D solution 1 day after pollination to induce elongation of maternal tissues. Immature embryos were removed from the pollinated inflorescences 14 days after fertilization and the developing hybrid embryos were excised after surface sterilization. A multiplex PCR-based chromosome-specific marker system (Ali et al., Plant Methods, 20.1 (2024): 37) was used to determine the karyotype of the hybrids (Figure 1). In five cases, the hybrid plants did not contain any barley chromosomes, 15 plants contained the entire set of barley chromosomes, and 17 plants contained 1-6 barley chromosomes in a random distribution. All three Tamlo homeoallelic universal primer pairs (SEQ ID NO:04, 05) were used to amplify the guide RNA target sequence from DNA extracted from the leaves of 37 F1 plants, and the resulting amplicons were subjected to Cac8I restriction enzyme digestion (Figure 2), whereby amplicons containing mutations cannot be cleaved by the Cac8I restriction enzyme because the mutations generated by CRISPR / Cas9 are located in the restriction enzyme recognition site. In mutant individuals, we therefore expected to see a product of the same size as the uncleaved amplicon after cleavage. In none of the individuals without barley chromosomes was a Tamlo gene mutation in the CRISPR / Cas9 guide RNA target sequence detectable by PCR / RE. Only -54% of the hybrid individuals containing the CRISPR / Cas9 transgene had target gene mutations as determined by PCR / RE. F1 hybrids were inoculated with wheat (Triticum aestivum L.MP). In this experiment, 17 BC1 plants were grown, 12% of which did not contain any barley chromosomes according to the multiplex PCR-based marker system (Figure 3), and the remaining 88% contained barley chromosomes in a random distribution. Individuals containing the CRISPR / Cas9 transgene were present in 18% of the BC1 generation based on Cas9-specific PCR (Figure 3, H-plex) using the Cas9_det_F and Cas9_det_R oligos (SEQ ID NO:06, 07). In the PCR / RE experiment for Tamlo mutation (Figure 4), no mutation was found in the CRISPR / Cas9 target sequence among BC1 individuals without barley chromosomes, only among individuals with barley chromosomes. Self-fertilization of mutant individuals is the state of the art to create a homozygous mutant for the desired gene.

[0098] Example 2: In the above example, 18% of the BC1 generation still had the CRISPR / Cas9 transgene present on a chromosome and 33% also contained a mutation. Therefore, in these plants, the CRISPR / Cas9 system expressing the transgene carried by the barley chromosomes also induces additional mutations in the paternal wheat genome used in the BC1 cross. Then, as in Example 1, individuals of the BC1S1 selffertilized generation can be identified by PCR / RE in which the Tamlo gene mutations were in homozygous form.

[0099] Example 3: In the first example, F1 plants were produced by in vitro growth of an embryo expressing the DsRed reporter gene not by rooting, but by callus induction using a method known from the literature (Bartlett, Joanne G., et al., Plant Methods 4.1: 1-12, 2008). Mutation analysis of the 20 in vitro propagated F1 plant clones obtained by PCR / RE (Figure 5 / A) revealed that one of the plants was highly mutated, as confirmed by DNA sequencing data. No Tamlo allele in subgenomes B and D, but a T nucleotide insertion in the guide RNA target sequence (SEQ ID NO: 8) was found in subgenome A. We also examined the presence of barley chromosomes in the plant (Figure 5 / B), where we found that barley chromosome 6 was missing. The immature ear of this plant (—1-1.5 cm in length) was placed on callus induction medium in vitro. Mutation analysis of the resulting 24 in vitro propagated F1 plant clones by PCR / RE (Figure 6) showed that they exhibited the same PCR / RE pattern as the propagated plant. Then, as in Example 1 , these plants can be backcrossed with wild-type wheat and barley chromosomes and transgene-less Tamlo mutants on the maternal genome can be selected in the BC1 generation to self-pollinate to produce homozygous Tamlo mutant wheat plants, or the plants of Example 2. As in example 2, individuals containing CRISPR / Cas9 transgenic barley chromosomes can be selected in the BC1 generation, which can result in further mutations in the paternal Tamlo gene. Then, as in Example 1 , individuals in the self-fertilized BC1S1 generation can be identified by PCR / RE as having homozygous Tamlo gene mutations.

[0100] Example 4: Modification of the meiotic recombination process between two wheat cultivars

[0101] In breeding a new cereal cultivar, the diversity of combinations of beneficial parental traits determines the success of selecting the desired offspring. Parts of the parental genomes are exchanged during meiotic recombination early in meiosis. The process of meiotic recombination is highly regulated in time, space, and number. Meiotic recombination starts with a large number of DNA double-strand breaks, which are physically observed on chromosomes in the form of so-called chiasmata before the first cell division of meiosis. In cereals, however, only a fraction of DNA double-strand breaks lead to recombination, the remaining breaks disappearing during the error correction mechanism. Another limiting factor is that the resulting chromosomal crossing over occurs mainly in regions of the chromosome away from the centromere, so that new combinations are rarely formed in genomic regions close to the centromere. By modifying the processes that regulate the formation of chromosome crossovers, plant materials can be created in which recombination can be extended to previously inaccessible genomic regions. In the model plant Arabidopsis thaliana, non-functional mutations of the enzymes DNA methyltransferase (MET1) and DNA chromomethylase (CMT3), which are involved in silencing gene function, were used to demonstrate that recombination hotspots in the genome can be relocated. In plants mutant for the metl gene, the number of chromosomal crossovers close to the centromere increased, while the number of those further away decreased. Similarly, the number of recombination events near centromeres increased in cmt3 gene mutants (Yelina, N.E. et al., Genes & Development 29:2183-2202, 2015; Yelina, N.E., et al., PLoS Genetics 8.8:el002844, 2012; Underwood, C.J. et al., Genome Research 28:519-531, 2018).

[0102] In wheat, the recombination process can also be modified by silencing analog genes, allowing the development of genetic materials with combinations of beneficial agronomic traits previously unavailable. Our method can also be used to implement the mechanism described above in wheat. In the procedure, the barley transgenic GOI is an inducible, either tissue-specific or constitutively promoter-driven gene silencing construct (e.g., artificial miRNA, inverted-repeat, Casl3 nuclease, dCas9-SunTag) and a constitutively driven reporter gene construct linked to it. The gene silencing construct is generated by silencing a wheat metl or cmt3 or other gene with a similar function and then pollinating the transgenic barley containing at least one transgenic barley chromosome onto a wheat parent plant. F1 embryos containing the transgenic GOI are raised and backcrossed with another wheat. In the resulting BC1 generation, plants containing transgenic chromosomes are selected using the reporter gene. By operating the gene silencing construct in the meiosis that occurs before the BC1 generation self-fertilizes, we induce chromosome crossovers in regions where they would have a low probability of occurring naturally. In the next generation (BC1S1), wheat progeny that no longer contains the reporter gene and the marker system based on PCR are selected for the reporter gene and the marker system.

[0103] Our method is therefore suitable for modifying the genome structure and / or gene expression of wheat with a hexapioid genome in a temporary or heritable manner, and then, following the modification, producing homozygous individuals for the specific genes of the target genome, without leaving either the transgenic or other barley chromosomes in the plant. The technique is also suitable for the application of gene-editing techniques in wheat that were not feasible or difficult to implement due to the specificity of wheat. The technique can also be used to change a particular gene or genes, resulting in a homozygous individual for that gene or genes. The process can also be used to recombine two different wheats, resulting in a heterozygous individual with a mixture of the two wheat traits within chromosomes. The products of the process are generally used as the raw materials for wheat plant breeding processes.

Claims

What is claimed is1. A method for modifying the genome structure and / or gene expression of wheat by crossing a parental wheat (P♀) with a transgenic barley (X XH+H) containing at least one transgenic barley chromosome (XH+), characterized by the following steps:(i) transforming the barley genome with a pre-designed gene construct that can manipulate the wheat genome and / or its expression,(ii) fertilizing wheat egg cells with the transgenic barley pollen, the wheat is then subjected to a demethylation treatment to induce partial development of the endosperm and more efficient development of the embryos, and growing the embryos on artificial media under in vitro conditions;(iii) selecting and breeding the resulting cross-generation (F1) wheat x transitional hybrids (F1♀) containing at least one transgenic barley chromosome,(iv) backcrossing transitional hybrids (F1♀) containing at least one transgenic wheat x barley chromosome with a wheat ( ♂) .(v) and then producing a new generation by self-fertilization from the selected individuals (BC1) resulting from backcrossing,(vi) from which a new generation of wheat (BC1S1) is selected, which is the product of the process, free of the barley chromosomes and modified in genome structure and / or gene expression.

2. The process according to Claim 1, characterized in that the backcrossed wheat ( ♂) and the parental wheat (P♀) are of the same cultivar.

3. The process according to any one of Claims 1 and 2, characterized in that a wheat cultivar ( ♂) different from the parental wheat (P♀) is used for backcrossing.

4. The process according to any one of Claims 1 to 3, characterized in that the crossing involves a chemical demethylation treatment.

5. The process according to any one of Claims 1 to 4, characterized in that the transgene of the transgenic barley chromosome (XH+) used is a gene-editing tool.

6. The process according to Claim 5, characterized in that said gene-editing tool is a genetic engineering tool, a derivative or combination thereof selected from the group of CRISPR / Cas, TALENs, ZFNs, RNA interference constructs.

7. The process according to any one of Claims 1-3, characterized in that the transgene of the transgenic barley chromosome (XH+) used alters the methylation pattern of the wheat.

8. The process according to Claim 7, characterized in that the methylation pattern modifying transgene is an RNA interference construct that silences the Met1 and / or Cmt3 genes.

9. The process according to any one of Claims 1 to 8, characterized in that one of the transgenic barley chromosomes (XH+) used is a reporter gene.

10. The process according to Claim 9, characterized in that one of GFP, YFP, DsRed, Ruby, or a combination thereof is used as the reporter gene.

11. The process according to any one of Claims 1 to 10, characterized in that the growing is carried out by in vitro micropropagation.

12. The process according to Claim 11, characterized in that in the in vitro micropropagation the explant is an immature embryo or immature ear.

Images