Liposomal compositions of archexin
Patent Information
- Application Number
- EP2024781600
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-31
- Filing Date
- 2024-03-21
- Publication Date
- 2026-02-11
AI Technical Summary
The existing antisense oligonucleotide Archexin faces challenges due to poor membrane permeability and in vivo stability, as well as a demanding administration regimen, limiting its effectiveness in cancer treatment.
The development of lipid nanoparticle compositions that encapsulate Archexin, comprising specific ratios of cationic, ionizable, neutral, and PEGylated lipids, which enhance intracellular delivery and circulation time, allowing for improved cancer treatment methods.
The lipid nanoparticle encapsulation significantly enhances the delivery and stability of Archexin, leading to effective inhibition of tumor growth, prevention of cancer metastasis, and angiogenesis, and induction of cytotoxicity in cancer cells.
Smart Images

Figure IMGF000050_0001 
Figure IMGF000056_0001 
Figure IMGF000090_0001
Abstract
Description
[0001] Attorney Docket No.11650-003WO1 LIPOSOMAL COMPOSITIONS OF ARCHEXIN CROSS-REFERENCE TO RELATED APPLICATION This application claims priority to and the benefit of U.S. Provisional Application No.63 / 493,576, filed on March 31, 2023, the content of which is hereby incorporated in its entirety. REFERENCE TO SEQUENCE LISTING The Sequence Listing submitted March 21, 2024, as a text filed named “11650- 003PV1_2023_03_30_Sequence_Listing” created March 30, 2023, and having a file size of 2,566 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5). BACKGROUND AKT-1 (Archexin), a protein product of akt-1 proto-oncogene, plays a role in cancer progression by promoting cell proliferation and inhibiting apoptosis of cancer cells (see Revathidevi S, et al., Semin Cancer Biol.2019;59:80-91; and Uko NE, et al., Curr Top Med Chem.2020;20(10):883-900). Archexin is a fully phosphorothioated 20-mer antisense oligonucleotide, which can specifically bind to AKT-1 mRNA resulting in RNase H-based AKT-1 downregulation. Archexin inhibits AKT-1 mRNA translation and inhibits tumor growth. However, due to its poor membrane permeability and in vivo stability, and further demanding administration regimen of 14-day continuous infusion, Archexin was limited by the challenges inherent to antisense oligonucleotides. There is a need to enhance the intracellular delivery and circulation time of oligonucleotides such as Archexin. The compositions and methods disclosed herein address these and other needs. SUMMARY Described herein are pharmaceutical compositions including a lipid nanoparticle encapsulating an active agent. The lipid nanoparticle can include 2.5 mol% to 15 mol% one or more cationic lipids; 30 mol% to 50 mol% one or more ionizable lipids; 30 mol% to 65 mol% one or more neutral lipids; and 2.5 mol% to 15 mol% one or more PEGylated lipids. In some embodiments, the active agent can include RX- 0201, 5′ gctgcatuatctccttggcg 3′, SEQ. ID. NO.1. Also described herein are methods for treating cancer, preventing cancer, preventing cancer metastasis, preventing cancer recurrence or preventing angiogenesis. These methods can include administering a pharmaceutical composition described herein to a subject in need thereof. Attorney Docket No.11650-003WO1 Also described herein are methods of inducing cytotoxicity in a cancer cell. These methods can include contacting the cell with a pharmaceutical composition described herein. Also described herein are methods of producing a population of lipid nanoparticles encapsulating an active agent. The method can include (a) combining one or more ethanolic solutions comprising a mixture of lipids with an aqueous solution and acidifying to induce formation of a population of empty lipid nanoparticles; (b) contacting the population of empty lipid nanoparticles with an aqueous solution comprising the active agent, thereby encapsulating the active agent in the population of empty lipid nanoparticles to produce the population of lipid nanoparticles encapsulating the active agent; and (c) subjecting the population of lipid nanoparticles encapsulating the active agent to tangential flow filtration to replace buffer and remove residual ethanol. In some embodiments, the mixture of lipids comprises 2.5 mol% to 15 mol% one or more cationic lipids; 30 mol% to 50 mol% one or more ionizable lipids; 30 mol% to 65 mol% one or more neutral lipids; and 2.5 mol% to 15 mol% one or more PEGylated lipids. BRIEF DESCRIPTION OF THE FIGURES Figures 1A-1B show graphs of the effects of WGI-0301 on tumor growth (Fig.1A) and survival (Fig.1B) in Hepa1-6 syngeneic hepatocellular carcinoma model. Figures 2A-2B are graphs of branch point number versus concentration (Fig.2A) and capillary length versus concentration (Fig.2B). Figures 3A-3C shows images of anti-angiogenesis effect of WGI-0301 alone and in therapy combinations (0.1% DMSO and WGI-0301 (Fig.3A), 2 µM Sorafenib and WGI-0301 (Fig.3B), and 5 µM Lenvatinib and WGI-0301 (Fig.3C)). Figure 4 shows a flow chart of the manufacturing process of the lipid nanoparticles described herein. Figure 5 shows the effects of test articles on mice body weight in Hepa 1-6 model. Figure 6 shows the effects of test articles on mice body weight change in Hepa 1-6 model. Figure 7 shows the effects of test articles on tumor volume in Hepa 1-6 model. Figure 8 shows the survival curves of test articles in Hepa 1-6 model. Figure 9 shows a diagram of command voltage program for hERG testing using manual patch- clamp. Figure 10 shows free acid of Archexin: concentration response curve. Attorney Docket No.11650-003WO1 Figure 11 shows body weight changes after administering test articles to female Balb / c nude mice bearing Hep3B-luc tumor cell. Data points represent group mean body weight. Error bars represent standard error of the mean (SEM). Figure 12 shows percentage of body weight (BW) change after administering test articles to female Balb / c nude mice bearing Hep3B-luc tumor cell. BW change was calculated based on animal weight on PG-D0. Data points represent percent group mean change in BW. Error bars represent standard error of the mean (SEM). Figure 13 shows body weight change of female Balb / c nude mice bearing the Hep 3B-luc model. Figure 14 shows bioluminescence trace of female Balb / c node mice bearing Hep3B-luc model. Figure 15 shows survival curve of WGI-0301 and Lenvatinib monotherapy or combination in the treatment of human hepatocellular cancer Hep3B-luc orthotopic model in the female Balb / c nude mice. Figure 16 shows survival curve of WGI-0301 Sorafenib monotherapy or combination in the treatment of human hepatocellular cancer Hep3B-luc orthotopic model in the female Balb / c nude mice. Figure 17 shows survival curve of WGI-0301 and Cabozantinib monotherapy or combination in the treatment of human hepatocellular cancer Hep3B-luc orthotopic model in the female Balb / c nude mice. Figure 18 shows a table with images of bioluminescence results. DETAILED DESCRIPTION Before the present methods and systems are disclosed and described, it is to be understood that the methods and systems are not limited to specific synthetic methods, specific components, or to particular compositions. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in this specification and the following claims, the terms “comprise” (as well as forms, derivatives, or variations thereof, such as “comprising” and “comprises”) and “include” (as well as forms, derivatives, or variations thereof, such as “including” and “includes”) are inclusive (i.e., open-ended) and do not exclude additional elements or steps. For example, the terms "comprise" and / or "comprising," when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. Other than where noted, all numbers expressing quantities of ingredients, reaction conditions, geometries, dimensions, and so forth used in the specification and claims are to be understood at the very least, and not as an Attorney Docket No.11650-003WO1 attempt to limit the application of the doctrine of equivalents to the scope of the claims, to be construed in light of the number of significant digits and ordinary rounding approaches. Accordingly, these terms are intended to not only cover the recited element(s) or step(s), but may also include other elements or steps not expressly recited. Furthermore, as used herein, the use of the terms “a”, “an”, and “the” when used in conjunction with an element may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” Therefore, an element preceded by “a” or “an” does not, without more constraints, preclude the existence of additional identical elements. Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. By “about” is meant within 5% of the value, e.g., within 4, 3, 2, or 1% of the value. When such a range is expressed, another aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. A range may be construed to include the start and the end of the range. For example, a range of 10% to 20% (i.e., range of 10%-20%) can includes 10% and also includes 20%, and includes percentages in between 10% and 20%, unless explicitly stated otherwise herein. As used herein, the terms "may," "optionally," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient. It is understood that when combinations, subsets, groups, etc. of elements are disclosed (e.g., combinations of components in a composition, or combinations of steps in a method), that while specific reference of each of the various individual and collective combinations and permutations of these elements may not be explicitly disclosed, each is specifically contemplated and described herein. “Administration" to a subject includes any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, transcutaneous, transdermal, intra-joint, intra-arteriole, intradermal, intraventricular, intralesional, intranasal, rectal, Attorney Docket No.11650-003WO1 vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like. "Concurrent administration", "administration in combination", "simultaneous administration" or "administered simultaneously" as used herein, means that the compounds are administered at the same point in time or essentially immediately following one another. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time. "Systemic administration" refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject's body (e.g. greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, "local administration" refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration but are undetectable or detectable at negligible amounts in distal parts of the subject's body. Administration includes self-administration and the administration by another. As used herein, the term “controlled-release” or “controlled-release drug delivery” or “extended release” refers to release or administration of a drug from a given dosage form in a controlled fashion in order to achieve the desired pharmacokinetic profile in vivo. An aspect of “controlled” drug delivery is the ability to manipulate the formulation and / or dosage form in order to establish the desired kinetics of drug release. As used here, the terms “beneficial agent” and “active agent” are used interchangeably herein to refer to a chemical compound or composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, i.e., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, i.e., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, and the like. When the terms “beneficial agent” or “active agent” are used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, Attorney Docket No.11650-003WO1 pharmacologically active salts, esters, amides, prodrugs, conjugates, active metabolites, isomers, fragments, analogs, etc. “Therapeutic agent” refers to any composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “therapeutic agent” is used, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc. A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant. "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels. “Inactivate”, “inactivating” and “inactivation” means to decrease or eliminate an activity, response, condition, disease, or other biological parameter due to a chemical (covalent bond formation) between the ligand and a its biological target. By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic (e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the Attorney Docket No.11650-003WO1 standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control. As used herein, the terms “treating” or “treatment” of a subject includes the administration of a drug to a subject with the purpose of preventing, curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing or affecting a disease or disorder, or a symptom of a disease or disorder. The terms “treating” and “treatment” can also refer to reduction in severity and / or frequency of symptoms, elimination of symptoms and / or underlying cause, prevention of the occurrence of symptoms and / or their underlying cause, and improvement or remediation of damage. By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed. For example, the terms “prevent” or “suppress” can refer to a treatment that forestalls or slows the onset of a disease or condition or reduced the severity of the disease or condition. Thus, if a treatment can treat a disease in a subject having symptoms of the disease, it can also prevent or suppress that disease in a subject who has yet to suffer some or all of the symptoms. As used herein, the term “preventing” a disorder or unwanted physiological event in a subject refers specifically to the prevention of the occurrence of symptoms and / or their underlying cause, wherein the subject may or may not exhibit heightened susceptibility to the disorder or event. By the term “effective amount” of a therapeutic agent is meant a nontoxic but sufficient amount of a beneficial agent to provide the desired effect. The amount of beneficial agent that is “effective” will vary from subject to subject, depending on the age and general condition of the subject, the particular beneficial agent or agents, and the like. Thus, it is not always possible to specify an exact “effective amount”. However, an appropriate “effective’ amount in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of a beneficial can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. Attorney Docket No.11650-003WO1 An “effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. As used herein, a “therapeutically effective amount” of a therapeutic agent refers to an amount that is effective to achieve a desired therapeutic result, and a “prophylactically effective amount” of a therapeutic agent refers to an amount that is effective to prevent an unwanted physiological condition. Therapeutically effective and prophylactically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term “therapeutically effective amount” can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the drug and / or drug formulation to be administered (e.g., the potency of the therapeutic agent (drug), the concentration of drug in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. As used herein, the term “pharmaceutically acceptable” component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing any significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When the term “pharmaceutically acceptable” is used to refer to an excipient, it is generally implied that the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration. Also, as used herein, the term “pharmacologically active” (or simply “active”), as in a “pharmacologically active” derivative or analog, can refer to a derivative or analog (e.g., a salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) having the same type of pharmacological activity as the parent compound and approximately equivalent in degree. A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative." As used herein, by a “subject” is meant an individual. Thus, the “subject” can include domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), Attorney Docket No.11650-003WO1 laboratory animals (e.g., mouse, rabbit, rat, guinea pig, goats, sheep, pigs, dogs, cats, etc.), and birds (e.g., chickens, turkeys, songbirds, etc.). “Subject” can also include a mammal, such as a primate or a human. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician. Administration of the therapeutic agents can be carried out at dosages and for periods of time effective for treatment of a subject. In some embodiments, the subject is a human. The term “nucleic acid” as used herein means a polymer composed of nucleotides, e.g. deoxyribonucleotides or ribonucleotides. The terms “ribonucleic acid” and “RNA” as used herein mean a polymer composed of ribonucleotides. The terms “deoxyribonucleic acid” and “DNA” as used herein mean a polymer composed of deoxyribonucleotides. The term “oligonucleotide” denotes single- or double-stranded nucleotide multimers of from about 2 to up to about 100 nucleotides in length. Suitable oligonucleotides may be prepared by the phosphoramidite method described by Beaucage and Carruthers, Tetrahedron Lett., 22:1859-1862 (1981), or by the triester method according to Matteucci, et al., J. Am. Chem. Soc., 103:3185 (1981), both incorporated herein by reference, or by other chemical methods using either a commercial automated oligonucleotide synthesizer or VLSIPS™ technology. When oligonucleotides are referred to as “double-stranded,” it is understood by those of skill in the art that a pair of oligonucleotides exist in a hydrogen-bonded, helical array typically associated with, for example, DNA. In addition to the 100% complementary form of double-stranded oligonucleotides, the term “double-stranded,” as used herein is also meant to refer to those forms which include such structural features as bulges and loops, described more fully in such biochemistry texts as Stryer, Biochemistry, Third Ed., (1988), incorporated herein by reference for all purposes. The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%, 98%, 99% or higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment Attorney Docket No.11650-003WO1 and visual inspection (see, e.g., NCBI web site or the like). Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 10 amino acids or 20 nucleotides in length, or more preferably over a region that is 10-50 amino acids or 20-50 nucleotides in length. As used herein, percent (%) amino acid sequence identity is defined as the percentage of amino acids in a candidate sequence that are identical to the amino acids in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods. For sequence comparisons, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res.25:3389-3402, and Altschul et al. (1990) J. Mol. Biol.215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1990) J. Mol. Biol.215:403-410). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for Attorney Docket No.11650-003WO1 nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) or 10, M=5, N=−4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=−4, and a comparison of both strands. The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01. The term "nucleobase" refers to the part of a nucleotide that bears the Watson / Crick base- pairing functionality. The most common naturally-occurring nucleobases, adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T) bear the hydrogen-bonding functionality that binds one nucleic acid strand to another in a sequence specific manner. An antisense compound is a tool that can be used to introduce modifications into the nucleic acids found in living cells. The term “antisense” refers to the notion that nucleic acids “encode” proteins. That is, the sequence of nucleotides found in a given nucleic acid determines, among other things, what protein will be produced. A “sense” sequence for a full gene will yield a normal protein in the usual amount, in response to a given stimulus. A “sense” oligonucleotide will hybridize with a normal gene sequence, and will not affect the amount of, or properties of, the protein. A “nonsense” sequence will not yield a product, or may yield a non-functional product. For example, if a “nonsense” codon or oligomer is inserted into a gene, a truncated, non-functional protein may result. An “antisense” oligonucleotide will hybridize with a normal gene, but will yield a protein altered with respect to its Attorney Docket No.11650-003WO1 structure, or amount. It has been found that antisense oligomers, that is antisense compounds that are relatively short, can be easily inserted into cells, where they alter gene function. Antisense compounds are commonly used as research reagents for the exploration of gene function because they are able to alter gene expression with exquisite specificity, and may be used to elucidate the function of particular genes. Antisense compounds can be used, for example, to distinguish between functions of various members of a biological pathway. Antisense oligonucleotides can be used to selectively block disease-causing genes, thereby inhibiting production of disease-associated proteins. Some antisense oligonucleotides have been safely and effectively administered to humans, and numerous clinical trials are presently underway. It is thus possible that oligonucleotides can be used to treat cells, tissues, and animals, especially humans. In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a nucleic acid target and increased stability in the presence of nucleobases. The compositions and methods described herein employ oligomeric nucleotide compounds, particularly antisense oligonucleotides, which are targeted to a portion of a nucleic acid encoding Akt-1, and which modulate the expression of Akt-1. The oligonucleotide compounds are designed to specifically hybridize with one or more nucleic acids encoding Akt-1. To target an antisense compound to a particular gene means to identify the nucleic acid sequence of interest, and select one or more sites within the nucleic acid sequence to be modified. Once the target site has been identified, an oligonucleotide is chosen which is sufficiently complementary to the target site so that it will hybridize specifically to the site, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect. As used herein, the phrase “nucleic acid encoding Akt-1” encompasses DNA encoding Akt-1, RNA (including pre-mRNA) transcribed from such DNA, and also cDNA derived from such RNA. The specific hybridization of an antisense oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. The functions of DNA to be interfered with include replication and transcription. The functions of RNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, Attorney Docket No.11650-003WO1 splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA. The overall effect of such interference with target nucleic acid function is modulation of the expression, or production of, a protein. In the context of the present invention, “modulation” means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. In the context of this invention, “to hybridize” means to hydrogen bond, which may be via Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. While antisense oligonucleotides are a preferred form of antisense compound, the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below. The antisense compounds in accordance with this invention preferably comprise from about 10 to about 30 nucleobases. Particularly preferred are antisense oligonucleotides comprising about 20 nucleobases (i.e. about 20 linked nucleosides). As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines Attorney Docket No.11650-003WO1 and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage. Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′–5′ linkages, 2′–5′ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′–5′ to 5′–3′ or 2′–5′ to 5′–2′. Various salts, mixed salts and free acid forms are also included. Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Attorney Docket No.11650-003WO1 In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with new groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH2—NH—O—CH2—, —CH2—N(CH3)—O—CH2— [known as a methylene (methylimino) or MMI backbone], —CH2—O— N(CH3)—CH2—, —CH2—N(CH3)—N(CH3)—CH2— and —O—N(CH3)—CH2—CH2— [wherein the native phosphodiester backbone is represented as —O—P—O—CH2—]. Also preferred are oligonucleotides having morpholino backbone structures. Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2′ position: OH; F; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; O—, S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly preferred are O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2′ position: C1to C10lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy (2′- O—CH2CH2OCH3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486–504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2′- dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2group, also known as 2′-DMAOE, as described in examples hereinbelow. Other preferred modifications include 2′-methoxy (2′-O—CH3), 2′-aminopropoxy (2′- OCH2CH2CH2NH2) and 2′-fluoro (2′-F). Similar modifications may also be made at other positions on the Attorney Docket No.11650-003WO1 oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8- azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6–1.2° C. and are presently preferred base substitutions, even more particularly when combined with 2′-O- methoxyethyl sugar modifications. Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl- ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl- oxycholesterol moiety. It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also includes antisense compounds which are chimeric compounds. “Chimeric” antisense compounds or “chimeras,” in the Attorney Docket No.11650-003WO1 context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art. Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and / or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. The antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules. The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and / or absorption. The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically Attorney Docket No.11650-003WO1 acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. The term “prodrug” indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and / or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives. The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligonucleotides, preferred examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine. Compositions Described herein are pharmaceutical compositions including a lipid nanoparticle encapsulating an active agent. In some embodiments, the active agent can include RX-0201, 5′ gctgcatgatctccttggcg 3′, SEQ. ID. NO.1. RX-0201, is targeted to a site in the coding region of the Akt-1 gene having the following sequence: 5′ cgccaaggagatcatgcagc 3′ at site 1,478 of Akt-1 gene (Genebank # BC000479) (Seq. Id. No. 2). The sequence for the backbone of RX-0201 is complementary to this site. Archexin (RX-0201) is described in U.S. Patent No.7,122,527, which is hereby incorporated by reference in its entirety. In some embodiments, the compound is an antisense oligonucleotide. In some embodiments, the antisense oligonucleotide has at least one modified internucleoside linkage that is a phosphorothioate linkage. Suitable cationic lipids can include, but are not limited to, DOTMA: [1-(2,3-sioleyloxy)propyl)]- N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DODAP, DOSPA (2,3-dioleyloxy-N-[2-(spermine carboxamido)ethyl]-N,N-dimethyl-1-propanaminium Attorney Docket No.11650-003WO1 trifluoroacetate), DORIE (N-[1-(2,3-dioleyloxypropyl)]-N,N-dimethyl-N-hydroxyethylammonium bromide), DODAB, DOIC, DMEPC, DOGS: Dioctadecylamidoglicylspermin, DIMRI: Dimyristooxypropyl dimethyl hydroxyethyl ammonium bromide, DOTAP: dioleoyloxy-3-(trimethylammonio)propane, DC-6- 14: O,O-ditetradecanoyl-N-.alpha.-trimethylammonioacetyl)diethanolamine chloride, CLIP 1: rac-[(2,3- dioctadecyloxypropyl)(2-hydroxyethyl)]-dimethylammonium chloride, CLIP6: rac-[2(2,3- dihexadecyloxypropyloxymethyloxy)ethyl]-trimethylammonium, CLIP9: rac-[2(2,3- dihexadecyloxypropyloxysuccinyloxy)ethyl]-trimethylammonium, oligofectamine, lipids described in U.S. Patent No.5,049,386, N-[1-(2,3-dioleyloxypropyl)]-N,N-dimethyl-N-hydroxyethylammonium bromide (DORIE), 2,3-dioleyloxy-N-[2-(spermine carboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), and the like as disclosed in International Publication Nos. WO91 / 16024 and WO97 / 019675; and (3R,4R)-3,4-bis((Z)-Hexadec-9-enyloxy)-1-methylpyrrolidine, and N-Methyl-N,N- bis(2-((Z)-octadec-6- enyloxy)ethyl)amine and the like as disclosed in International Publication No. WO2011 / 13636, or any combination thereof. In some embodiments, the lipid nanoparticle can include 2.5 mol% to 15 mol% one or more cationic lipids. In some embodiments, the one or more cationic lipids can be present in the lipid nanoparticle in an amount of at least 2.5 mol%, (e.g., at least 5 mol%, at least 7.5 mol%, at least 10 mol%, or at least 12.5 mol%). In some embodiments, the one or more cationic lipids can be present in the lipid nanoparticle in an amount of 15 mol% or less, (e.g., 12.5 mol% or less, 10 mol% or less, 7.5 mol% or less, or 5 mol% or less). The one or more cationic lipids can be present in the lipid nanoparticle in an amount ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the one or more cationic lipids can be present in the lipid nanoparticle in an amount of from 2.5 mol% to 15 mol% (e.g., from 2.5 mol% to 12.5 mol%, from 2.5 mol% to 10 mol%, from 2.5 mol% to 7.5 mol%, from 2.5 mol% to 5 mol%, from 5 mol% to 15 mol%, from 5 mol% to 12.5 mol%, from 5 mol% to 10 mol%, or from 5 mol% to 7.5 mol%). Suitable neutral lipids can include, but are not limited to, dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylethanolamine (DOPE), 1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC), palmitoyloleoylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC), distearoylphosphatidylcholine (DSPC), cholesterol, or any combination thereof. In some embodiments, the one or more neutral lipids can include cholesterol, DOPE, DOPC, or a combination thereof. In some Attorney Docket No.11650-003WO1 embodiments, the one or more neutral lipids can include (1) cholesterol; and (2) DOPE, DOPC, or a combination thereof. In some embodiments, the lipid nanoparticle can include 30 mol% to 65 mol% one or more neutral lipids. In some embodiments, the one or more neutral lipids are present in the lipid nanoparticle in an amount of at least 30 mol%, (e.g., at least 35 mol%, at least 40 mol%, at least 45 mol%, at least 50 mol%, at least 55 mol%, or at least 60 mol%). In some embodiments, the one or more neutral lipids are present in the lipid nanoparticle in an amount of 65 mol% or less, (e.g., 60 mol% or less, 55 mol% or less, 50 mol% or less, 45 mol% or less, 40 mol% or less, or 35 mol% or less). The one or more neutral lipids can be present in the lipid nanoparticle in an amount ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the one or more neutral lipids are present in the lipid nanoparticle in an amount of from 30 mol% to 65 mol%, (e.g., from 35 mol% to 60 mol %, from 40 mol% to 55 mol %, or from 45 mol% to 50 mol %). Suitable PEGylated lipids can include, but are not limited to, a PEG-ditetradecylacetamide, a PEG-myristoyl diglyceride, a PEG-diacylglycerol, a PEG dialkyloxypropyl, a PEG-phospholipid, a PEG- ceramide, PEG-DMG, PEG-DSPE, or any combinations thereof. In some embodiments, the one or more PEGylated lipids comprise 1,2-dimyristoyl-sn-glycerol (DMG-PEG). In some embodiments, the lipid nanoparticle can include 2.5 mol% to 15 mol% one or more PEGylated lipids. In some embodiments, the one or more PEGylated lipids can be present in the lipid nanoparticle in an amount of at least 2.5 mol%, (e.g, at least 5 mol%, at least 7.5 mol%, at least 10 mol%, or at least 12.5 mol%). In some embodiments, the one or more PEGylated lipids can be present in the lipid nanoparticle in an amount of 15 mol% or less, (e.g., 12.5 mol% or less, 10 mol% or less, 7.5 mol% or less, or 5 mol% or less). The one or more PEGylated lipids can be present in the lipid nanoparticle in an amount ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the one or more PEGylated lipids can be present in the lipid nanoparticle in an amount of from 2.5 mol% to 15 mol%, (e.g., from 2.5 mol% to 10 mol%, from 2.5 mol% to 7.5 mol%, from 2.5 mol% to 5 mol%, from 5 mol% to 15 mol%, from 5 mol% to 10 mol%, from 5 mol% to 7.5 mol%, from 7.5 mol% to 10 mol%, from 7.5 mol% to 15 mol%, from 7.5 mol% to 12.5 mol%, from 10 mol% to 12.5 mol%, from 10 mol% to 15 mol%, or from 12.5 mol% to 15 mol%). Attorney Docket No.11650-003WO1 Suitable ionizable lipids can include, but are not limited to, N,N-dimethyl-2,3- dioleyloxypropylamine (DODMA), [(4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), 9-heptadecanyl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102), DLin-MC3-DMA, DLin-KC2-DMA, DLinDMA and the like as disclosed in International Publication No. WO2005 / 121348, DLin-K-DMA and the like as disclosed in International Publication No. WO2009 / 086558, 1-(2,3-bis(((9Z,12Z)-octadeca-9,12-dien-1-yl)oxy)propyl)pyrrolidine (A066), or any combination thereof. In some embodiments, the one or more ionizable lipids comprise N,N-dimethyl- 2,3-dioleyloxypropylamine (DODMA). In some embodiments, the lipid nanoparticle can include 30 mol% to 50 mol% one or more ionizable lipids. In some embodiments, the one or more ionizable lipids can be present in the lipid nanoparticle in an amount of at least 30 mol%, (e.g., at least 35 mol%, at least 40 mol%, or at least 45 mol%). In some embodiments, the one or more ionizable lipids can be present in the lipid nanoparticle in an amount of 50 mol% or less, (e.g., 45 mol% or less, 40 mol% or less, or 35 mol% or less). The one or more ionizable lipids can be present in the lipid nanoparticle in an amount ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the one or more ionizable lipids can be present in the lipid nanoparticle in an amount of from 30 mol% to 50 mol%, (e.g, from 30 mol% to 45 mol%, from 30 mol% to 40 mol%, from 30 mol% to 35 mol%, from 35 mol% to 50 mol%, from 35 mol% to 45 mol%, from 35 mol% to 40 mol%, from 40 mol% to 50 mol%, from 40 mol% to 45 mol%, or from 45 mol% to 50 mol%). In some embodiments, the lipid nanoparticle comprises DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG. In some embodiments, the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG can be present at a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:25:20:10, 5:40:27.5:20:7.5, or 5:40:30:20:5. In some embodiments, the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG can be present at a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:27.5:20:7.5. In some embodiments, the lipid nanoparticle and the active agent can be present at a weight ratio of lipid nanoparticle to active agent of from 5:1 to 20:1, from 7.5:1 to 15:1, from 7.5:1 to 10:1, from 7.5:1 to 12:1, from 10:1 to 12:1, from 10:1 to 15:1, or from 12:1 to 15:1. In some embodiments, the lipid nanoparticle and the active agent are present at a weight ratio of lipid nanoparticle to active agent of 15:1, 12:1, 10:1, or 7.5:1. Attorney Docket No.11650-003WO1 In some embodiments, the composition can include a population of the lipid nanoparticles having an average particle size, as determined by dynamic light scattering, of at least 50 nm, (e.g., at least 60 nm, at least 70 nm, at least 75 nm, or at least 65 nm). In some embodiments, the composition can include a population of the lipid nanoparticles having an average particle size, as determined by dynamic light scattering, of 80 nm or less, (e.g., 75 nm or less, 70 nm or less, 65 nm or less, or 60 nm or less). The composition can include a population of the lipid nanoparticles having an average particle size, as determined by dynamic light scattering, ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the composition can include a population of the lipid nanoparticles having an average particle size, as determined by dynamic light scattering, of from 50 nm to 80 nm, (e.g., from 50 nm to 70 nm, from 50 nm to 60 nm, from 55 nm to 70 nm, from 55 nm to 65 nm, from 55 nm to 60 nm, from 60 nm to 80 nm, from 55 nm to 75nm, from 60 nm to 75 nm, from 60 nm to 70 nm, from 60 nm to 65 nm, from 65 nm to 80 nm, from 65 nm to 70 nm, from 70 nm to 75 nm, from 70 nm to 80 nm, or from 75 nm to 80 nm). In some embodiments, the population of the lipid nanoparticles can have an average particle size, as determined by dynamic light scattering, of about 55 nm. In some embodiments, the composition can include a population of the lipid nanoparticles having an average zeta potential of at least -0.6 mV (e.g, at least -0.1 mV, at least 0.5 mV, at least 1 mV, at least 1.5 mV, or at least 2 mV). In some embodiments, the composition can include a population of the lipid nanoparticles having an average zeta potential of 2.5 mV or less, (e.g., 2 mV or less, 1.5 mV or less, 1 mV or less, 0.5 mV or less, 0.1 mV or less, or -0.1 mV or less). The composition can include a population of the lipid nanoparticles having an average zeta potential ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the composition can include a population of the lipid nanoparticles having an average zeta potential of from -0.6 mV to 2.5 mV, (e.g., -0.6 mV to 2 mV, - 0.6 mV to 1.5 mV, -0.6 mV to 1 mV, -0.6 mV to 0.5 mV, -0.6 mV to -0.1 mV, -0.1 mV to 2.5 mV, -0.1 mV to 2 mV, -0.1 mV to 1.5 mV, -0.1 mV to 1 mV, -0.1 mV to 0.5 mV, 0.5 mV to 2 mV, 0.5 mV to 1.5 mV, 0.5 mV to 1 mV, 1 mV to 2 mV, 1 mV to 1.5 mV, 1.5 mV to 2 mV, 1.5 mV to 2.5 mV, or 2 mV to 2.5 mV). In some embodiments, the population of the lipid nanoparticles can have an average zeta potential of -5.5 mV. Attorney Docket No.11650-003WO1 In some embodiments, the composition can include a population of the lipid nanoparticles having a polydispersity index (PDI) of at least 0.15, (e.g., at least 0.2, at least 0.25, at least 0.3, at least 0.35, at least 0.4, or at least 0.45). In some embodiments, the composition can include a population of the lipid nanoparticles having a polydispersity index (PDI) of 0.5 or less, (e.g., 0.45 or less, 0.4 or less, 0.35 or less, 0.3 or less, 0.25 or less, 0.2 or less, or 0.15 or less). The composition can include a population of the lipid nanoparticles having a polydispersity index (PDI) ranging from any of the minimum values described above to any of the maximum values described above. For example, in some embodiments, the composition can include a population of the lipid nanoparticles having a polydispersity index (PDI) of from 0.15 to 0.5, (e.g., from 0.15 to 0.4, from 0.15 to 0.3, from 0.15 to 0.2, from 0.2 to 0.3, from 0.2 to 0.5, from 0.2 to 0.4, from 0.2 to 0.3, from 0.3 to 0.4, from 0.3 to 0.5, or from 0.4 to 0.5). In some embodiments, the lipid nanoparticles are dispersed in a pharmaceutically acceptable carrier. "Pharmaceutically acceptable carrier" (sometimes referred to as a "carrier") means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein. “Excipients” include any and all solvents, diluents or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. General considerations in formulation and / or manufacture can be found, for example, in Remington's Pharmaceutical Sciences, Sixteenth Edition, E. W. Martin (Mack Publishing Co., Easton, Pa., 1980), and Remington: The Science and Practice of Pharmacy, 21st Edition (Lippincott Williams & Wilkins, 2005). Exemplary excipients include, but are not limited to, any non-toxic, inert solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. Some examples of materials which can serve as excipients include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium Attorney Docket No.11650-003WO1 carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil; safflower oil; sesame oil; olive oil; corn oil and soybean oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; detergents such as Tween 80; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; and phosphate buffer solutions, as well as other non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the composition, according to the judgment of the formulator. As would be appreciated by one of skill in this art, the excipients may be chosen based on what the composition is useful for. For example, with a pharmaceutical composition, the choice of the excipient will depend on the route of administration, the agent being delivered, time course of delivery of the agent, etc., and can be administered to humans and / or to animals, orally, rectally, parenterally, intracisternally, intravaginally, intranasally, intraperitoneally, topically (as by powders, creams, ointments, or drops), buccally, or as an oral or nasal spray. In some embodiments, the active compounds disclosed herein are administered topically. Exemplary diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, etc., and combinations thereof. Exemplary granulating and / or dispersing agents include potato starch, corn starch, tapioca starch, sodium starch glycolate, clays, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, cation-exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethyl cellulose, cross- linked sodium carboxymethyl cellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds, etc., and combinations thereof. Exemplary surface active agents and / or emulsifiers include natural emulsifiers (e.g. acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g. bentonite [aluminum silicate] and Veegum [magnesium aluminum silicate]), long chain amino acid derivatives, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol Attorney Docket No.11650-003WO1 distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g. carboxy polymethylene, polyacrylic acid, acrylic acid polymer, and carboxy vinyl polymer), carrageenan, cellulosic derivatives (e.g. carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxyethylene sorbitan monolaurate [Tween 20], polyoxyethylene sorbitan [Tween 60], polyoxyethylene sorbitan monooleate [Tween 80], sorbitan monopalmitate [Span 40], sorbitan monostearate [Span 60], sorbitan tristearate [Span 65], glyceryl monooleate, sorbitan monooleate [Span 80]), polyoxyethylene esters (e.g. polyoxyethylene monostearate [Myrj 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and Solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g. Cremophor), polyoxyethylene ethers, (e.g. polyoxyethylene lauryl ether [Brij 30]), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, Pluronic F 68, Poloxamer 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, etc. and / or combinations thereof. Exemplary binding agents include starch (e.g. cornstarch and starch paste), gelatin, sugars (e.g. sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol, etc.), natural and synthetic gums (e.g. acacia, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, mucilage of isapol husks, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl- pyrrolidone), magnesium aluminum silicate (Veegum), and larch arabogalactan), alginates, polyethylene oxide, polyethylene glycol, inorganic calcium salts, silicic acid, polymethacrylates, waxes, water, alcohol, etc., and / or combinations thereof. Exemplary preservatives include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives. Exemplary antioxidants include alpha tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite. Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA) and salts and hydrates thereof (e.g., sodium edetate, disodium edetate, trisodium edetate, calcium disodium edetate, dipotassium edetate, and the like), citric acid and salts and hydrates thereof (e.g., citric acid monohydrate), fumaric acid and salts and hydrates thereof, malic acid and salts and hydrates thereof, phosphoric acid and salts and hydrates thereof, and tartaric acid and salts and hydrates thereof. Attorney Docket No.11650-003WO1 Exemplary antimicrobial preservatives include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal. Exemplary antifungal preservatives include butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid. Exemplary alcohol preservatives include ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and phenylethyl alcohol. Exemplary acidic preservatives include vitamin A, vitamin C, vitamin E, beta- carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid. Other preservatives include tocopherol, tocopherol acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisol (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus, Phenonip, methylparaben, Germall 115, Germaben II, Neolone, Kathon, and Euxyl. In certain embodiments, the preservative is an anti-oxidant. In other embodiments, the preservative is a chelating agent. Exemplary buffering agents include citrate buffer solutions, acetate buffer solutions, phosphate buffer solutions, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen- free water, isotonic saline, Ringer's solution, ethyl alcohol, etc., and combinations thereof. Exemplary lubricating agents include magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behanate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, etc., and combinations thereof. Attorney Docket No.11650-003WO1 Exemplary natural oils include almond, apricot kernel, avocado, babassu, bergamot, black current seed, borage, cade, chamomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cotton seed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd, grape seed, hazel nut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litsea cubeba, macademia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange, orange roughy, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood, sasquana, savoury, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut, and wheat germ oils. Exemplary synthetic oils include, but are not limited to, butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and combinations thereof. Liquid compositions include emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compound, the liquid composition may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. Injectable compositions, for example, injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be an injectable solution, suspension, or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents for pharmaceutical or cosmetic compositions that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. Any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables. In certain embodiments, the particles are suspended in a carrier fluid comprising 1% (w / v) sodium carboxymethyl cellulose and 0.1% (v / v) Tween 80. The injectable composition can be sterilized, for example, by filtration through a bacteria-retaining filter, or by Attorney Docket No.11650-003WO1 incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. Solid compositions include capsules, tablets, pills, powders, and granules. In such solid compositions, the particles are mixed with at least one excipient and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar- agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets, and pills, the dosage form may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. Tablets, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. Solid compositions of a similar type may also be employed as fillers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. Compositions for topical or transdermal administration include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The active compound is admixed with an excipient and any needed preservatives or buffers as may be required. The ointments, pastes, creams, and gels may contain, in addition to the active compound, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, and zinc oxide, or mixtures thereof. Attorney Docket No.11650-003WO1 Powders and sprays can contain, in addition to the active compound, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates, and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants such as chlorofluorohydrocarbons. Transdermal patches have the added advantage of providing controlled delivery of a compound to the body. Such dosage forms can be made by dissolving or dispensing the nanoparticles in a proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the particles in a polymer matrix or gel. Method of Use Described herein are also methods for treating cancer, preventing cancer, preventing cancer metastasis, preventing cancer recurrence or preventing angiogenesis. In some embodiments, the methods can include administering to a subject in need thereof the pharmaceutical composition described herein. In some embodiments, the cancer can be hepatocellular carcinoma. The compositions as used in the methods described herein can be administered by any suitable method and technique presently or prospectively known to those skilled in the art. For example, the active components described herein can be formulated in a physiologically- or pharmaceutically- acceptable form and administered by any suitable route known in the art including, for example, oral and parenteral routes of administering. As used herein, the term “parenteral” includes subcutaneous, intradermal, intravenous, intramuscular, intraperitoneal, and intrasternal administration, such as by injection. The active agent may be administered by any route. In some embodiments, the active ingredient is administered via a variety of routes, including oral, intravenous, intramuscular, intra- arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and / or drops), mucosal, nasal, bucal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and / or inhalation; and / or as an oral spray, nasal spray, and / or aerosol. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the active ingredient (e.g., its stability in the environment of the gastrointestinal tract), the condition of the subject (e.g., whether the subject is able to tolerate oral administration), etc. Administration of the active components of their compositions can be a single administration, or at continuous and distinct intervals as can be readily determined by a person skilled in the art. In certain embodiments, it may be desirable to provide continuous delivery of one or more compounds to a patient in need thereof. For intravenous or intraarterial routes, this can be Attorney Docket No.11650-003WO1 accomplished using drip systems, such as by intravenous administration. For topical applications, repeated application can be done or a patch can be used to provide continuous administration of the compounds over an extended period of time. The active ingredient may be administered in such amounts, time, and route deemed necessary in order to achieve the desired result. The exact amount of the active ingredient will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the infection, the particular active ingredient, its mode of administration, its mode of activity, and the like. The active ingredient, whether the active compound itself, or the active compound in combination with an agent, is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the active ingredient will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the active ingredient employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific active ingredient employed; the duration of the treatment; drugs used in combination or coincidental with the specific active ingredient employed; and like factors well known in the medical arts. The exact amount of an active ingredient required to achieve a therapeutically or prophylactically effective amount will vary from subject to subject, depending on species, age, and general condition of a subject, severity of the side effects or disorder, identity of the particular compound(s), mode of administration, and the like. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult. Useful dosages of the compositions disclosed herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art. The dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms or disorder are affected. The dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician Attorney Docket No.11650-003WO1 in the event of any counterindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. In some embodiments, the compositions described herein can be administered in conjunction with additional active agent or therapy. Active Agents As used herein, a “active agent” refers to therapeutic agents, diagnostic agents, or prophylactic agents. As discussed herein, the therapeutic agents can be released from the disclosed compounds, compositions, and systems in a biologically active form. It is further understood, that as used herein, the terms “therapeutic agents” refers to one or more therapeutic agents, active ingredients, or substances that can be used to treat a medical condition. Therapeutic agent includes any synthetic or naturally occurring biologically active compound or composition of matter which, when administered to an organism (human or nonhuman animal), induces a desired pharmacologic, immunogenic, and / or physiologic effect by local and / or systemic action. The term therefore encompasses those compounds or chemicals traditionally regarded as drugs, vaccines, and biopharmaceuticals including molecules such as proteins, peptides, hormones, nucleic acids, gene constructs and the like. Examples of therapeutic agents are described in well-known literature references such as the Merck Index (14th edition), the Physicians' Desk Reference (64th edition), and The Pharmacological Basis of Therapeutics (12th edition), and they include, without limitation, medicaments; vitamins and minerals such as essential amino acids, calcium, iron, potassium, zinc, vitamin B12, and the like; substances used for the treatment, prevention, diagnosis, cure or mitigation of a disease or illness; substances that affect the structure or function of the body, or pro-drugs, which become biologically active or more active after they have been placed in a physiological environment. For example, the term “therapeutic agent” includes compounds or compositions for use in all of the major therapeutic areas including, but not limited to, adjuvants; an antimicrobial agents (including antibiotics, antiviral agents, antiparasitic, and anti-fungal agents), anti-inflammatory agents (including steroids and non-steroidal anti-inflammatory agents), anti-coagulant agents, ophthalmic agents, gastrointestinal drugs, antiplatelet agents, and antiseptic agents, steroidal agent, anti-neoplastic agent, anti-cancer agent, antigen, antibody, birth control agent, progestational agent, anti-cholinergic, nutritional agent, analgesics and analgesic combinations such as acetaminophen, acetylsalicylic acid, and the like; anesthetics such as lidocaine, xylocaine, and the like, anorexics such as dexadrine, phendimetrazine tartrate, and the like; anti-epileptics, local and general anesthetics, hypnotics, sedatives, antipsychotic agents, neuroleptic agents, antidepressants such as isocarboxazid, amoxapine, Attorney Docket No.11650-003WO1 and the like; anxiolytics, antagonists, neuron blocking agents, anticholinergic and cholinomimetic agents, antimuscarinic and muscarinic agents, antiparkinsonian agents, anti-Alzheimer's agents, antiadrenergics, antiarrhythmics, antihypertensive agents, hormones such as insulin, progestins, estrogens, corticoids, glucocorticoids, androgens, and the like;, and nutrients, antiarthritics such as methylprednisolone, ibuprofen, and the like; antiasthmatics such as terbutaline sulfate, theophylline, ephedrine, and the like; anticonvulsants such as phenyloin sodium, diazepam, and the like; antiallergenics, antihistamines such as diphenhydramine HCl, chlorpheniramine maleate, and the like; antinauseants, antineoplastics, antipruritics, antipyretics; antispasmodics such as belladonna alkaloids, dicyclomine hydrochloride, and the like; cardiovascular agents such as prazosin HCl, nitroglycerin, propranolol HCl, hydralazine HCl, pancrelipase, succinic acid dehydrogenase, and the like; vasoactive agent, cardiovascular preparations (including calcium channel blockers, beta-blockers, beta-agonists and antiarrythmics), antihypertensives, diuretics such as furosemide, spironolactone, and the like; vasodilators; central nervous system stimulants; cough and cold preparations; decongestants; diagnostics; bone growth stimulants and bone resorption inhibitors; muscle relaxants; psychostimulants; sedatives; tranquilizers such as thorazine, diazepam, chlorpromazine HCl, reserpine, chlordiazepoxide HCl, and the like; antiulcer drugs such as rantidine HCl, cimetidine HCl, and the like; anti-asthmatic agents, anti-diarrheals, anti-obesity agents, anti-thrombotic agents, anti-tussive agents, anti-uricemic agents, anti-anginal agents, appetite suppressants, expectorants, hyperglycemic agents, hypoglycemic agents, thyroid and anti-thyroid agents, tissue growth agents, uterine relaxants, immunomodulator, including, for example, cytokines, interleukins, interferon, colony stimulating factor, tumor necrosis factor, and the like; immunosuppressants such as rapamycin, tacrolimus, and the like; immunological agent; antigens, factors, growth factors, amino acids, peptides and proteins and fragments thereof (whether naturally occurring, chemically synthesized or recombinantly produced) such as LHRH, somatostatin, calcitonin, growth hormone, glucagon-like peptides, growth releasing factor, angiotensin, FSH, EGF, bone morphogenic protein (BMP), erythopoeitin (EPO), interferon, interleukin, collagen, fibrinogen, insulin, Factor VIII, Factor IX, Enbrel®, Rituxam®, Herceptin®, alpha-glucosidase, Cerazyme / Ceredose®, vasopressin, ACTH, human serum albumin, gamma globulin, structural proteins, blood product proteins, complex proteins, antigens or antigenic polypeptides, enzymes, antibodies, monoclonal antibodies, and the like; and nucleic acid molecules (polymeric forms of two or more nucleotides, polynucleotides, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) including both double- and single-stranded molecules, gene constructs, expression vectors, antisense molecules and the like), small molecules (e.g., doxorubicin) and other biologically active macromolecules such as, for Attorney Docket No.11650-003WO1 example, proteins and enzymes. The agent may be a biologically active agent used in medical, including veterinary, applications and in agriculture, such as with plants, as well as other areas. In certain embodiments of the present disclosure, the agent to be delivered may be a mixture of active agents. Representative examples of antibiotics include amikacin, amoxicillin, ampicillin, atovaquone, azithromycin, aztreonam, bacitracin, carbenicillin, cefadroxil, cefazolin, cefdinir, cefditoren, cefepime, cefiderocol, cefoperazone, cefotetan, cefoxitin, cefotaxime, cefpodoxime, cefprozil, ceftaroline, ceftazidime, ceftibuten, ceftizoxime, ceftriaxone, chloramphenicol, colistimethate, cefuroxime, cephalexin, cephradine, cilastatin, cinoxacin, ciprofloxacin, clarithromycin, clindamycin, dalbavancin, dalfopristin, daptomycin, demeclocycline, dicloxacillin, doripenem, doxycycline, eravacycline, ertapenem, erythromycin, fidaxomicin, fosfomycin, gatifloxacin, gemifloxacin, gentamicin, imipenem, lefamulin, lincomycin, linezolid, lomefloxacin, loracarbef, meropenem, metronidazole, minocycline, moxifloxacin, nafcillin, nalidixic acid, neomycin, norfloxacin, ofloxacin, omadacycline, oritavancin, oxacillin, oxytetracycline, paromomycin, penicillin, pentamidine, piperacillin, plazomicin, quinupristin, rifaximin, sarecycline, secnidazole, sparfloxacin, spectinomycin, sulfamethoxazole, sulfisoxazole, tedizolid, telavancin, telithromycin, ticarcillin, tigecycline, tobramycin, trimethoprim, trovafloxacin, and vancomycin. Representative examples of antiviral agents include, but are not limited to, abacavir, acyclovir, adefovir, amantadine, amprenavir, atazanavir, balavir, baloxavir marboxil, boceprevir, cidofovir, cobicistat, daclatasvir, darunavir, delavirdine, didanosine, docasanol, dolutegravir, doravirine, ecoliever, edoxudine, efavirenz, elvitegravir, emtricitabine, enfuvirtide, entecavir, etravirine, famciclovir, fomivirsen, fosamprenavir, forscarnet, fosnonet, famciclovir, favipravir, fomivirsen, foscavir, ganciclovir, ibacitabine, idoxuridine, indinavir, inosine, inosine pranobex, interferon type I, interferon type II, interferon type III, lamivudine, letermovir, letermovir, lopinavir, loviride, maraviroc, methisazone, moroxydine, nelfinavir, nevirapine, nitazoxanide, oseltamivir, peginterferon alfa-2a, peginterferon alfa- 2b, penciclovir, peramivir, pleconaril, podophyllotoxin, pyramidine, raltegravir, remdesevir, ribavirin, rilpivirine, rimantadine, rintatolimod, molnupiravir, ritonavir, saquinavir, simeprevir, sofosbuvir, stavudine, tarabivirin, telaprevir, telbivudine, tenofovir alafenamide, tenofovir disoproxil, tenofovir, tipranavir, trifluridine, trizivir, tromantadine, umifenovir, valaciclovir, valganciclovir, vidarabine, zalcitabine, zanamivir, and zidovudine. Representative examples of anticoagulant agents include, but are not limited to, heparin, warfarin, rivaroxaban, dabigatran, apixaban, edoxaban, enoxaparin, and fondaparinux. Attorney Docket No.11650-003WO1 Representative examples of antiplatelet agents include, but are not limited to, clopidogrel, ticagrelor, prasugrel, dipyridamole, dipyridamole / aspirin, ticlopidine, and eptifibatide. Representative examples of antifungal agents include, but are not limited to, voriconazole, itraconazole, posaconazole, fluconazole, ketoconazole, clotrimazole, isavuconazonium, miconazole, caspofungin, anidulafungin, micafungin, griseofulvin, terbinafine, flucytosine, terbinafine, nystatin, and amphotericin b. Representative examples of steroidal anti-inflammatory agents include, but are not limited to, hydrocortisone, dexamethasone, prednisolone, prednisone, triamcinolone, methylprednisolone, budesonide, betamethasone, cortisone, and deflazacort. Representative examples of non-steroidal anti- inflammatory drugs include ibuprofen, naproxen, ketoprofen, tolmetin, etodolac, fenoprofen, flurbiprofen, diclofenac, piroxicam, indomethacin, sulindax, meloxicam, nabumetone, oxaprozin, mefenamic acid, and diflunisal. Other examples of active agents include chloroquine, hydrochloroquine, Pyridoxal phosphate, Vitamin D, and Vitamin C. Representative examples of anticytokine or immunomodulatory agents, but are not limited to, tocilizumab, sarilumab, bevacizumab, fingolimod, imiquimod, and eculizumab. Representative examples of contraceptives include, but are not limited to, progestins, estrogens, or any combination thereof. For example, suitable progestins include, but are not limited to, natural and synthetic compounds having progestational activity, such as, for example, progesterone, chlormadinone acetate, norethindrone, cyproterone acetate, norethindrone acetate, desogestrel, levonorgestrel, drospirenone, trimegestone, norgestrel, norgestimate, norelgestromin, etonogestrel, gestodene, and other natural and / or synthetic gestagens. For example suitable estrogens include, but are not limited to, natural and synthetic compounds having estrogenic activity, such as, for example, estradiol (17β-estradiol), 17α-estradiol, estriol, estrone, and their esters, such as the acetate, sulfate, valerate or benzoate esters of these compounds, including, for example, estradiol 17β-cypionate, estradiol 17- propionate, estradiol 3-benzoate, and piperazine estrone sulfate; ethinyl estradiol; conjugated estrogens (natural and synthetic); mestranol; agonistic anti-estrogens; and selective estrogen receptor modulators. Other examples of contraceptives include gonodotropin releasing hormone (GnRh) or anologs thereof such as deslorelin, avorelin, leuprolide, triptorelin, nafarelin, goserelin, buserelin, and fertirelin. The term “steroid” refers to compounds belonging to or related to the following illustrative families of compounds: corticosteroids, mineralicosteroids, and sex steroids (including, for example, Attorney Docket No.11650-003WO1 potentially androgenic or estrogenic or anti-androgenic and anti- estrogenic molecules). Included among these are, for example, prednisone, prednisolone, methyl-prednisolone, triamcinolone, fluocinolone, aldosterone, spironolactone, danazol (otherwise known as OPTINA), and others. In some embodiments, the therapeutic agent may comprise a steroid. Exemplary cancer drugs or anti-cancer agents can include, but are not limited to, antimetabolite anti- cancer agents and antimitotic anti-cancer agents, and combinations thereof. Various antimetabolite and antimitotic anti-cancer agents, including single such agents or combinations of such agents, may be employed in the methods and compositions described herein. Antimetabolic anti-cancer agents typically structurally resemble natural metabolites, which are involved in normal metabolic processes of cancer cells such as the synthesis of nucleic acids and proteins. The antimetabolites, however, differ enough from the natural metabolites such that they interfere with the metabolic processes of cancer cells. In the cell, antimetabolites are mistaken for the metabolites they resemble, and are processed by the cell in a manner analogous to the normal compounds. The presence of the “decoy” metabolites prevents the cells from carrying out vital functions and the cells are unable to grow and survive. For example, antimetabolites may exert cytotoxic activity by substituting these fraudulent nucleotides into cellular DNA, thereby disrupting cellular division, or by inhibition of critical cellular enzymes, which prevents replication of DNA. In one aspect, therefore, the antimetabolite anti-cancer agent is a nucleotide or a nucleotide analog. In certain aspects, for example, the antimetabolite agent may comprise purine (e.g., guanine or adenosine) or analogs thereof, or pyrimidine (cytidine or thymidine) or analogs thereof, with or without an attached sugar moiety. Suitable antimetabolite anti-cancer agents for use in the present disclosure may be generally classified according to the metabolic process they affect, and can include, but are not limited to, analogues and derivatives of folic acid, pyrimidines, purines, and cytidine. Thus, in one aspect, the antimetabolite agent(s) is selected from the group consisting of cytidine analogs, folic acid analogs, purine analogs, pyrimidine analogs, and combinations thereof. In one particular aspect, for example, the antimetabolite agent is a cytidine analog. According to this aspect, for example, the cytidine analog may be selected from the group consisting of cytarabine (cytosine arabinodside), azacitidine (5-azacytidine), and salts, analogs, and derivatives thereof. In another particular aspect, for example, the antimetabolite agent is a folic acid analog. Folic acid analogs or antifolates generally function by inhibiting dihydrofolate reductase (DHFR), an enzyme involved in the formation of nucleotides; when this enzyme is blocked, nucleotides are not formed, Attorney Docket No.11650-003WO1 disrupting DNA replication and cell division. According to certain aspects, for example, the folic acid analog may be selected from the group consisting of denopterin, methotrexate (amethopterin), pemetrexed, pteropterin, raltitrexed, trimetrexate, and salts, analogs, and derivatives thereof. In another particular aspect, for example, the antimetabolite agent is a purine analog. Purine- based antimetabolite agents function by inhibiting DNA synthesis, for example, by interfering with the production of purine containing nucleotides, adenine and guanine which halts DNA synthesis and thereby cell division. Purine analogs can also be incorporated into the DNA molecule itself during DNA synthesis, which can interfere with cell division. According to certain aspects, for example, the purine analog may be selected from the group consisting of acyclovir, allopurinol, 2-aminoadenosine, arabinosyl adenine (ara-A), azacitidine, azathiprine, 8-aza-adenosine, 8-fluoro-adenosine, 8-methoxy- adenosine, 8-oxo-adenosine, cladribine, deoxycoformycin, fludarabine, gancylovir, 8-aza-guanosine, 8- fluoro-guanosine, 8- methoxy-guanosine, 8-oxo-guanosine, guanosine diphosphate, guanosine diphosphate-beta- L-2-aminofucose, guanosine diphosphate-D-arabinose, guanosine diphosphate-2- fluorofucose, guanosine diphosphate fucose, mercaptopurine (6-MP), pentostatin, thiamiprine, thioguanine (6-TG), and salts, analogs, and derivatives thereof. In yet another particular aspect, for example, the antimetabolite agent is a pyrimidine analog. Similar to the purine analogs discussed above, pyrimidine-based antimetabolite agents block the synthesis of pyrimidine-containing nucleotides (cytosine and thymine in DNA; cytosine and uracil in RNA). By acting as “decoys,” the pyrimidine-based compounds can prevent the production of nucleotides, and / or can be incorporated into a growing DNA chain and lead to its termination. According to certain aspects, for example, the pyrimidine analog may be selected from the group consisting of ancitabine, azacitidine, 6-azauridine, bromouracil (e.g., 5-bromouracil), capecitabine, carmofur, chlorouracil (e.g.5-chlorouracil), cytarabine (cytosine arabinoside), cytosine, dideoxyuridine, 3′-azido-3′- deoxythymidine, 3′- dideoxycytidin-2′-ene, 3′-deoxy-3′-deoxythymidin-2′-ene, dihydrouracil, doxifluridine, enocitabine, floxuridine, 5-fluorocytosine, 2-fluorodeoxycytidine, 3-fluoro-3′- deoxythymidine, fluorouracil (e.g., 5-fluorouracil (also known as 5-FU), gemcitabine, 5-methylcytosine, 5- propynylcytosine, 5-propynylthymine, 5-propynyluracil, thymine, uracil, uridine, and salts, analogs, and derivatives thereof. In one aspect, the pyrimidine analog is other than 5- fluorouracil. In another aspect, the pyrimidine analog is gemcitabine or a salt thereof. In certain aspects, the antimetabolite agent is selected from the group consisting of 5- fluorouracil, capecitabine, 6-mercaptopurine, methotrexate, gemcitabine, cytarabine, fludarabine, pemetrexed, and salts, analogs, derivatives, and combinations thereof. In other aspects, the Attorney Docket No.11650-003WO1 antimetabolite agent is selected from the group consisting of capecitabine, 6- mercaptopurine, methotrexate, gemcitabine, cytarabine, fludarabine, pemetrexed, and salts, analogs, derivatives, and combinations thereof. In one particular aspect, the antimetabolite agent is other than 5-fluorouracil. In a particularly preferred aspect, the antimetabolite agent is gemcitabine or a salt or thereof (e.g., gemcitabine HCl (Gemzar®)). Other antimetabolite anti-cancer agents may be selected from, but are not limited to, the group consisting of acanthifolic acid, aminothiadiazole, brequinar sodium, Ciba-Geigy CGP-30694, cyclopentyl cytosine, cytarabine phosphate stearate, cytarabine conjugates, Lilly DATHF, Merrel Dow DDFC, dezaguanine, dideoxycytidine, dideoxyguanosine, didox, Yoshitomi DMDC, Wellcome EHNA, Merck & Co. EX-015, fazarabine, fludarabine phosphate, N-(2′-furanidyl)-5-fluorouracil, Daiichi Seiyaku FO-152, 5- FU-fibrinogen, isopropyl pyrrolizine, Lilly LY-188011; Lilly LY-264618, methobenzaprim, Wellcome MZPES, norspermidine, NCI NSC-127716, NCI NSC-264880, NCI NSC-39661, NCI NSC-612567, Warner- Lambert PALA, pentostatin, piritrexim, plicamycin, Asahi Chemical PL-AC, Takeda TAC-788, tiazofurin, Erbamont TIF, tyrosine kinase inhibitors, Taiho UFT and uricytin, among others. In one aspect, the antimitotic agent is a microtubule inhibitor or a microtubule stabilizer. In general, microtubule stabilizers, such as taxanes and epothilones, bind to the interior surface of the beta-microtubule chain and enhance microtubule assembly by promoting the nucleation and elongation phases of the polymerization reaction and by reducing the critical tubulin subunit concentration required for microtubules to assemble. Unlike mictrotubule inhibitors, such as the vinca alkaloids, which prevent microtubule assembly, the microtubule stabilizers, such as taxanes, decrease the lag time and dramatically shift the dynamic equilibrium between tubulin dimers and microtubule polymers towards polymerization. In one aspect, therefore, the microtubule stabilizer is a taxane or an epothilone. In another aspect, the microtubule inhibitor is a vinca alkaloid. In some embodiments, the therapeutic agent may comprise a taxane or derivative or analog thereof. The taxane may be a naturally derived compound or a related form, or may be a chemically synthesized compound or a derivative thereof, with antineoplastic properties. The taxanes are a family of terpenes, including, but not limited to paclitaxel (Taxol®) and docetaxel (Taxotere®), which are derived primarily from the Pacific yew tree, Taxus brevifolia, and which have activity against certain tumors, particularly breast and ovarian tumors. In one aspect, the taxane is docetaxel or paclitaxel. Paclitaxel is a preferred taxane and is considered an antimitotic agent that promotes the assembly of microtubules from tubulin dimers and stabilizes microtubules by preventing depolymerization. This Attorney Docket No.11650-003WO1 stability results in the inhibition of the normal dynamic reorganization of the microtubule network that is essential for vital interphase and mitotic cellular functions. Also included are a variety of known taxane derivatives, including both hydrophilic derivatives, and hydrophobic derivatives. Taxane derivatives include, but are not limited to, galactose and mannose derivatives described in International Patent Application No. WO 99 / 18113; piperazino and other derivatives described in WO 99 / 14209; taxane derivatives described in WO 99 / 09021, WO 98 / 22451, and U.S. Pat. No.5,869,680; 6-thio derivatives described in WO 98 / 28288; sulfenamide derivatives described in U.S. Pat. No.5,821,263; deoxygenated paclitaxel compounds such as those described in U.S. Pat. No.5,440,056; and taxol derivatives described in U.S. Pat. No.5,415,869. As noted above, it further includes prodrugs of paclitaxel including, but not limited to, those described in WO 98 / 58927; WO 98 / 13059; and U.S. Pat. No.5,824,701. The taxane may also be a taxane conjugate such as, for example, paclitaxel-PEG, paclitaxel-dextran, paclitaxel-xylose, docetaxel-PEG, docetaxel- dextran, docetaxel- xylose, and the like. Other derivatives are mentioned in “Synthesis and Anticancer Activity of Taxol Derivatives,” D. G. I. Kingston et al., Studies in Organic Chemistry, vol.26, entitled “New Trends in Natural Products Chemistry” (1986), Atta-ur-Rabman, P. W. le Quesne, Eds. (Elsevier, Amsterdam 1986), among other references. Each of these references is hereby incorporated by reference herein in its entirety. Various taxanes may be readily prepared utilizing techniques known to those skilled in the art (see also WO 94 / 07882, WO 94 / 07881, WO 94 / 07880, WO 94 / 07876, WO 93 / 23555, WO 93 / 10076; U.S. Pat. Nos.5,294,637; 5,283,253; 5,279,949; 5,274,137; 5,202,448; 5,200,534; 5,229,529; and EP 590,267) (each of which is hereby incorporated by reference herein in its entirety), or obtained from a variety of commercial sources, including for example, Sigma-Aldrich Co., St. Louis, Mo. Alternatively, the antimitotic agent can be a microtubule inhibitor; in one preferred aspect, the microtubule inhibitor is a vinca alkaloid. In general, the vinca alkaloids are mitotic spindle poisons. The vinca alkaloid agents act during mitosis when chromosomes are split and begin to migrate along the tubules of the mitosis spindle towards one of its poles, prior to cell separation. Under the action of these spindle poisons, the spindle becomes disorganized by the dispersion of chromosomes during mitosis, affecting cellular reproduction. According to certain aspects, for example, the vinca alkaloid is selected from the group consisting of vinblastine, vincristine, vindesine, vinorelbine, and salts, analogs, and derivatives thereof. The antimitotic agent can also be an epothilone. In general, members of the epothilone class of compounds stabilize microtubule function according to mechanisms similar to those of the taxanes. Attorney Docket No.11650-003WO1 Epothilones can also cause cell cycle arrest at the G2-M transition phase, leading to cytotoxicity and eventually apoptosis. Suitable epithiolones include epothilone A, epothilone B, epothilone C, epothilone D, epothilone E, and epothilone F, and salts, analogs, and derivatives thereof. One particular epothilone analog is an epothilone B analog, ixabepilone (Ixempra™). In certain aspects, the antimitotic anti-cancer agent is selected from the group consisting of taxanes, epothilones, vinca alkaloids, and salts and combinations thereof. Thus, for example, in one aspect the antimitotic agent is a taxane. More preferably in this aspect the antimitotic agent is paclitaxel or docetaxel, still more preferably paclitaxel. In another aspect, the antimitotic agent is an epothilone (e.g., an epothilone B analog). In another aspect, the antimitotic agent is a vinca alkaloid. Examples of cancer drugs that may be used in the present disclosure include, but are not limited to: thalidomide; platinum coordination complexes such as cisplatin (cis-DDP), oxaliplatin and carboplatin; anthracenediones such as mitoxantrone; substituted ureas such as hydroxyurea; methylhydrazine derivatives such as procarbazine (N- methylhydrazine, MIH); adrenocortical suppressants such as mitotane (o,p′-DDD) and aminoglutethimide; RXR agonists such as bexarotene; and tyrosine kinase inhibitors such as sunitimib, imatinib, axitinib, dasatinib, erlotinib, nilotinib, and pazopanib. Examples of additional cancer drugs include alkylating agents, antimetabolites, natural products, hormones and antagonists, and miscellaneous agents. Alternate names are indicated in parentheses. Examples of alkylating agents include nitrogen mustards such as mechlorethamine, cyclophosphainide, ifosfamide, melphalan sarcolysin) and chlorambucil; ethylenimines and methylmelamines such as hexamethylmelamine and thiotepa; alkyl sulfonates such as busulfan; nitrosoureas such as carmustine (BCNU), semustine (methyl-CCNU), lomustine (CCNU) and streptozocin (streptozotocin); DNA synthesis antagonists such as estramustine phosphate; and triazines such as dacarbazine (DTIC, dimethyl-triazenoimidazolecarboxamide) and temozolomide. Examples of antimetabolites include folic acid analogs such as methotrexate (amethopterin); pyrimidine analogs such as fluorouracin (5-fluorouracil, 5-FU, SFU), floxuridine (fluorodeoxyuridine, FUdR), cytarabine (cytosine arabinoside) and gemcitabine; purine analogs such as mercaptopurine (6-mercaptopurine, 6-MP), thioguanine (6-thioguanine, TG) and pentostatin (2′-deoxycoformycin, deoxycoformycin), cladribine and fludarabine; and topoisomerase inhibitors such as amsacrine. Examples of natural products include vinca alkaloids such as vinblastine (VLB) and vincristine; taxanes such as paclitaxel, protein bound paclitaxel (Abraxane) and docetaxel (Taxotere); epipodophyllotoxins such as etoposide and teniposide; camptothecins such as topotecan and irinotecan; antibiotics such as dactinomycin (actinomycin D), daunorubicin (daunomycin, rubidomycin), doxorubicin, histrelin, bleomycin, mitomycin (mitomycin C), Attorney Docket No.11650-003WO1 idarubicin, epirubicin; enzymes such as L-asparaginase; and biological response modifiers such as interferon alpha and interlelukin 2. Examples of hormones and antagonists include luteinising releasing hormone agonists such as buserelin; adrenocorticosteroids such as prednisone and related preparations; progestins such as hydroxyprogesterone caproate, rnedroxyprogesterone acetate and megestrol acetate; estrogens such as diethylstilbestrol and ethinyl estradiol and related preparations; estrogen antagonists such as tamoxifen and anastrozole; androgens such as testosterone propionate and fluoxymesterone and related preparations; androgen antagonists such as flutamide and bicalutamide; and gonadotropin-releasing hormone analogs such as leuprolide. Alternate names and trade-names of these and additional examples of cancer drugs, and their methods of use including dosing and administration regimens, will be known to a person versed in the art. In some aspects, the anti-cancer agent may comprise a chemotherapeutic agent. Suitable chemotherapeutic agents include, but are not limited to, alkylating agents, antibiotic agents, antimetabolic agents, hormonal agents, plant-derived agents and their synthetic derivatives, anti- angiogenic agents, differentiation inducing agents, cell growth arrest inducing agents, apoptosis inducing agents, cytotoxic agents, agents affecting cell bioenergetics i.e., affecting cellular ATP levels and molecules / activities regulating these levels, biologic agents, e.g., monoclonal antibodies, kinase inhibitors and inhibitors of growth factors and their receptors, gene therapy agents, cell therapy, e.g., stem cells, or any combination thereof. According to these aspects, the chemotherapeutic agent is selected from the group consisting of cyclophosphamide, chlorambucil, melphalan, mechlorethamine, ifosfamide, busulfan, lomustine, streptozocin, temozolomide, dacarbazine, cisplatin, carboplatin, oxaliplatin, procarbazine, uramustine, methotrexate, pemetrexed, fludarabine, cytarabine, fluorouracil, floxuridine, gemcitabine, capecitabine, vinblastine, vincristine, vinorelbine, etoposide, paclitaxel, docetaxel, doxorubicin, daunorubicin, epirubicin, idarubicin, mitoxantrone, bleomycin, mitomycin, hydroxyurea, topotecan, irinotecan, amsacrine, teniposide, erlotinib hydrochloride and combinations thereof. Each possibility represents a separate aspect of the invention. According to certain aspects, the therapeutic agent may comprise a biologic drug, particularly an antibody. According to some aspects, the antibody is selected from the group consisting of cetuximab, anti-CD24 antibody, panitumumab and bevacizumab. Growth factors useful as therapeutic agents include, but are not limited to, transforming growth factor-α (“TGF-α”), transforming growth factors (“TGF-β”), platelet-derived growth factors (“PDGF”), fibroblast growth factors (“FGF”), including FGF acidic isoforms 1 and 2, FGF basic form 2 and FGF 4, 8, 9 Attorney Docket No.11650-003WO1 and 10, nerve growth factors (“NGF”) including NGF 2.5s, NGF 7.0s and beta NGF and neurotrophins, brain derived neurotrophic factor, cartilage derived factor, bone growth factors (BGF), basic fibroblast growth factor, insulin-like growth factor (IGF), vascular endothelial growth factor (VEGF), granulocyte colony stimulating factor (G-CSF), insulin like growth factor (IGF) I and II, hepatocyte growth factor, glial neurotrophic growth factor (GDNF), stem cell factor (SCF), keratinocyte growth factor (KGF), transforming growth factors (TGF), including TGFs alpha, beta, beta1, beta2, beta3, skeletal growth factor, bone matrix derived growth factors, and bone derived growth factors and mixtures thereof. Vascular endothelial growth factor (VEGF) inhibitors useful as therapeutic agents include, but are not limited to, sunitinib, pazopanib, sorafenib, tivozanib, cabozantinib, bevacizumab, aflibercept, ranibizumab, dasatinib, and nilotinib. Cytokines useful as therapeutic agents include, but are not limited to, cardiotrophin, stromal cell derived factor, macrophage derived chemokine (MDC), melanoma growth stimulatory activity (MGSA), macrophage inflammatory proteins 1 alpha (MIP-1alpha), 2, 3 alpha, 3 beta, 4 and 5, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, TNF-α, and TNF-β. Immunoglobulins useful in the present disclosure include, but are not limited to, IgG, IgA, IgM, IgD, IgE, and mixtures thereof. Some preferred growth factors include VEGF (vascular endothelial growth factor), NGFs (nerve growth factors), PDGF-AA, PDGF-BB, PDGF-AB, FGFb, FGFa, and BGF. Other molecules useful as therapeutic agents include but are not limited to growth hormones, leptin, leukemia inhibitory factor (LIF), tumor necrosis factor alpha and beta, endostatin, thrombospondin, osteogenic protein-1, bone morphogenetic proteins 2 and 7, osteonectin, somatomedin-like peptide, osteocalcin, , interferon alpha, interferon alpha A, interferon beta, interferon gamma, interferon 1 alpha, and interleukins 2, 3, 4, 56, 7, 8, 9, 10, 11, 12,13, 15, 16, 17 and 18. Diagnostic agents include gases; metals; commercially available imaging agents used in positron emissions tomography (PET), computer assisted tomography (CAT), single photon emission computerized tomography, x-ray, fluoroscopy, and magnetic resonance imaging (MRI); and contrast agents. Examples of suitable materials for use as contrast agents in MRI include gadolinium chelates, as well as iron, magnesium, manganese, copper, and chromium. Examples of materials useful for CAT and x-ray imaging include iodine-based materials. Therapeutic and prophylactic agents include, but are not limited to, antibiotics, nutritional supplements, and vaccines. Vaccines may comprise isolated proteins or peptides, inactivated organisms and viruses, dead organisms and viruses, genetically altered organisms or viruses, cell extracts, and RNA encoding at least one antigenic polypeptide or an immunogenic fragment thereof (e.g., an immunogenic Attorney Docket No.11650-003WO1 fragment capable of inducing an immune response to the antigenic polypeptide). Therapeutic and prophylactic agents may be combined with interleukins, interferon, cytokines, and adjuvants such as cholera toxin, alum, Freund's adjuvant, etc. Prophylactic agents can include infection agents such as antigens of such bacterial organisms as Streptococccus pneumoniae, Haemophilus influenzae, Staphylococcus aureus, Streptococcus pyrogenes, Corynebacterium diphtheriae, Listeria monocytogenes, Bacillus anthracis, Clostridium tetani, Clostridium botulinum, Clostridium perfringens, Neisseria meningitidis, Neisseria gonorrhoeae, Streptococcus mutans, Pseudomonas aeruginosa, Salmonella typhi, Haemophilus parainfluenzae, Bordetella pertussis, Francisella tularensis, Yersinia pestis, Vibrio cholerae, Legionella pneumophila, Mycobacterium tuberculosis, Mycobacterium leprae, Treponema pallidum, Leptospirosis interrogans, Borrelia burgdorferi, Camphylobacter jejuni, and the like; antigens of such viruses as human Metapneumovirus (hMPV), human parainfluenza viruses (hPIV) types 1, 2, and 3 (hPIV1, hPIV2 and hPIV3, respectively), respiratory syncytial virus (RSV), measles virus (MeV), coronaviruses (e.g., MERS-CoV, SARS-CoV, SARS-CoV2, HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-NL, HCoV-NH, HCoV-HKU1), poxviruses (e.g., smallpox, monkeypox), influenza A and B, HIV, varicella-zoster, herpes simplex 1 and 2, cytomegalovirus, Epstein-Barr virus, rotavirus, rhinovirus, adenovirus, papillomavirus, poliovirus, mumps, rabies, rubella, coxsackieviruses, equine encephalitis, Japanese encephalitis, yellow fever, Rift Valley fever, hepatitis A, B, C, D, and E virus, and the like; antigens of fungal, protozoan, and parasitic organisms such as Cryptococcus neoformans, Histoplasma capsulatum, Candida albicans, Candida tropicalis, Nocardia asteroides, Rickettsia ricketsii, Rickettsia typhi, Mycoplasma pneumoniae, Chlamydial psittaci, Chlamydial trachomatis, Plasmodium falciparum, Trypanosoma brucei, Entamoeba histolytica, Toxoplasma gondii, Trichomonas vaginalis, Schistosoma mansoni, and the like. These antigens may be in the form of whole killed organisms, peptides, proteins, glycoproteins, carbohydrates, or combinations thereof. Also described herein are methods of inducing cytotoxicity in a cancer cell including contacting the cell with a pharmaceutical composition described herein. Also described herein are methods of producing a population of lipid nanoparticles encapsulating an active agent, the method comprising (a) combining one or more ethanolic solutions comprising a mixture of lipids with an aqueous solution and acidifying to induce formation of a population of empty lipid nanoparticles; (b) contacting the population of empty lipid nanoparticles with an aqueous solution comprising the active agent, thereby encapsulating the active agent in the population of empty lipid nanoparticles to produce the population of lipid nanoparticles encapsulating the active agent; and (c) subjecting the population of lipid nanoparticles encapsulating the active agent to tangential flow Attorney Docket No.11650-003WO1 filtration to replace buffer and remove residual ethanol. In some embodiments, the mixture of lipids or lipid nanoparticle comprises 2.5 mol% to 15 mol% one or more cationic lipids; 30 mol% to 50 mol% one or more ionizable lipids; 30 mol% to 65 mol% one or more neutral lipids; and 2.5 mol% to 15 mol% one or more PEGylated lipids. In some embodiments, the active agent comprises RX-0201, 5′ gctgcatgatctccttggcg 3′, SEQ. ID. NO.1. In some embodiments, the RX-0201 is an antisense oligonucleotide. In some embodiments, the RX-0201 has at least one modified internucleoside linkage that is a phosphorothioate linkage. In some embodiments, the lipid nanoparticles comprise DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG. In some embodiments, the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG in the lipid nanoparticles are present at a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:25:20:10, a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:27.5:20:7.5, or a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:30:20:5. In some embodiments, the lipid nanoparticle and the active agent are present at a weight ratio of lipid nanoparticle to active agent of from 5:1 to 20:1, from 7.5:1 to 15:1, from 7.5:1 to 10:1, from 7.5:1 to 12:1, from 10:1 to 12:1, from 10:1 to 15:1, or from 12:1 to 15:1. In some embodiemnts, the population of the lipid nanoparticles has an average particle size, as determined by dynamic light scattering, of from 50 nm to 80 nm, from 55 nm to 75nm, or from 55 nm to 60 nm. In some embodiments, the population of the lipid nanoparticles has an average zeta potential of from -06 mV to 2.5 mV. In some embodiments, the population of the lipid nanoparticles has a polydispersity index (PDI) of from 0.15 to 0.5, from 0.15 to 0.4, from 0.15 to 0.3, from 0.15 to 0.2, from 0.2 to 0.3, from 0.2 to 0.5, from 0.2 to 0.4, from 0.2 to 0.3, from 0.3 to 0.4, from 0.3 to 0.5, or from 0.4 to 0.5. EXAMPLES The following examples are for the purpose of illustration of the invention only and are not intended to limit the scope of the present invention in any manner whatsoever. Example 1: The anti-tumor and anti-angiogenesis efficacy of a lipid nanoparticle suspension of an AKT-1 anti-sense oligonucleotide AKT-1 plays a critical role in cancer progression by promoting cell proliferation and inhibiting apoptosis (see Revathidevi S, et al., Semin Cancer Biol.2019;59:80-91; and Uko NE, et al., Curr Top Med Chem.2020;20(10):883-900). Inhibition of AKT has been shown to inhibit tumor growth and angiogenesis (see Nitulescu GM, et al., Int J Oncol.2016;48(3):869-85). Archexin is a fully phosphorothioated 20-mer antisense oligonucleotide, which can specifically bind to AKT-1 mRNA Attorney Docket No.11650-003WO1 resulting in RNase H-based AKT-1 downregulation. WGI-0301 is a proprietary lipid nanoparticle (LNP) formulation of Archexin designed for enhanced delivery. A phase I clinical study has recently been initiated for WGI-0301 in solid tumors. Anti-tumor efficacy of WGI-0301 was studied in vivo in a Hepa1-6 syngeneic murine tumor model for hepatocellular carcinoma (HCC). The mice were injected i.v. with vehicle control or WGI-0301 at 8 mg / kg once weekly for 4 doses (n=8). Tumor size and body weight changes were monitored daily. In addition, the anti-angiogenesis activity of WGI-0301 was investigated in vitro using human umbilical vein endothelial cells (HUVEC) (see DeCicco-Skinner KL, et al., J Vis Exp.2014 Sep 1;(91):e51312; and Arnaoutova I, et al., Nat Protoc.2010;5(4):628-35). In the study, combination of WGI-0301 with Lenvatinib or Sorafenib were investigated to determine possible synergism. Three experimental groups were set up, including WGI-0301(0, 0.2, 2 and 20 μM), WGI-0301+ 2 μM Sorafenib, and WGI-0301+ 5 μM Lenvatinib. The cells were plated at 1.5 × 104per well. The cells were treated with 50% Matrigel and then cultured in the 24 well plate in triplicates and were incubated for an additional 6 hours. The in vivo study demonstrated anti-tumor efficacy of WGI-0301 in the Hepa1-6 model. The tumor growth inhibition % (TGI) for WGI-0301 was 46.16%, and the medium survival time (MST) of the treatment group was 55 days, which was significantly different from that of the control group (37 days). There was no severe adverse event observed in the course of the study. In the in vitro anti-angiogenesis study, WGI-0301 alone or in combination with 2 μM Sorafenib and 5 μM Lenvatinib exhibited dose- dependent inhibition of angiogenesis. Compared with the control group, 20 μM WGI-0301 either alone or in combination with 2 μM Sorafenib and 5 μM Lenvatinib showed significantly inhibitory effect on angiogenesis. The 2 μM WGI-0301 in combination with 5 μM Lenvatinib also showed a significant inhibition effect on angiogenesis. Results are shown in Figures 1A-3C. The dose-dependent inhibitory effect of WGI-0301 on angiogenesis was observed both as a monotherapy and in combination with other agents, particularly with 5 μM Lenvatinib, indicating that angiogenesis inhibition may be a crucial mechanism of its antitumor activity. Furthermore, the combination therapy of WGI-0301 and Lenvatinib demonstrated high effectiveness. The study results showed that WGI-0301 had significant anti-tumor and anti-angiogenic efficacy in the Hepa1-6 syngeneic murine tumor model for HCC. Moreover, combining WGI-0301 with Sorafenib or Lenvatinib resulted in even greater anti-angiogenic activity compared to WGI-0301 monotherapy. These findings suggest that WGI-0301, as a selective AKT-1 inhibitor. Example 2: WGI-0301 lipid nanoparticles Attorney Docket No.11650-003WO1 The drug substance is the antisense oligonucleotide, Archexin (RX-0201), developed by Rexahn Pharmaceuticals (Rockville, MD). The drug product WGI-0301 is manufactured as a lyophilized powder. After both preclinical studies and clinical trials, RX-0201 was found to have promising antitumor activity and tolerability. RX-0201 also achieved early success in Phase II trials for renal cell carcinoma and pancreatic cancers. Due to its poor membrane permeability and in vivo stability, and further demanding administration regimen of 14-day continuous infusion, RX-0201 was limited by the challenges inherent to antisense oligonucleotides. To further improve the in vivo delivery of RX-0201 and its therapeutic performance, Zhejiang Haichang Biotech Co., Ltd. (HCBio) has developed RX-0201 as a lipid nanoparticle (LNP) suspension formulation (WGI-0301). As a LNP formulation, WGI-0301 uses a combination of quaternary and tertiary lipoamines for pH sensitive delivery along with other neutral and stabilizing lipids. WGI-0301 is proposed as a promising therapeutic candidate for hepatocellular carcinoma. A detailed listing of components for clinical batch is provided in following tables. Table 1 Composition of WGI-0301 Amount per Vial Component Components Concentration Function Quality d e e e e e e F F F F F F F 1. DOTAP as the cationic lipid and the full chemical name is 1,2-dioleoyl-3-trimethylammonium- propane. 2. DODMA as the ionizable lipid and the full chemical name is 1,2-dioleyloxy-3-dimethylamino-propane. 3. DOPC as the neutral lipid and the full chemical name is 1,2-dioleoyl-sn-glycero-3-phosphocholine. 4. DMG-PEG2000 as the PEGylated lipid and the full chemical name is 1,2-Dimyristoyl-rac-glycero-3- methylpolyoxyethylene 2000. Attorney Docket No.11650-003WO1 5. Sucrose, Ammonium chloride, Acetic acid, Sodium hydroxide and Ethanol will be removed during process preparation. LNPs are suspended in a solution of 0.9% sodium chloride. Since aqueous form of RX-0201 cannot be stored stably at 2–8°C, the long-term storage recommendation for WGI-0301 is set at -20°C, with thawing before use. WGI-0301 is provided as a 6.573 mg Free Acid of Archexin (which is equivalent to 7.0 mg Archexin / RX-0201) per 7 mL to fulfill clinical need. Based on the established experience of HCBio, different formulations were developed and studied. These formulations were investigated based on the CQAs and efficacies to screen the appropriate formulation and formulation process. Table 2. WGI-0301 Critical Quality Attributes (CQAs) Quality Attributes Target CQA Justification . e . e Attorney Docket No.11650-003WO1 Quality Attributes Target CQA Justification e s, ly s. e t , Attorney Docket No.11650-003WO1 Quality Attributes Target CQA Justification , A d ct ill t C e e, y Attorney Docket No.11650-003WO1 Quality Attributes Target CQA Justification o sk ll rc exn ( - ) - - Q . , armacoogca ass: Phosphorothioate oligonucleotide, 20 nucleotides in length, Molecular Formula: C194H247N70O103P19S19Na19. Physiochemical properties: RX-0201 is a white lyophilized powder. It does not have special scent; it is hygroscopic and easily soluble in water. It is unstable at high temperatures and sensitive to light and oxidative conditions. The aqueous solution degrades under prolonged storage at 4°C. The stability of aqueous solution is highly dependent on pH; RX-0201 degrades faster in lower pH conditions. Chemical Structure: was investigated and evaluated by combining the experimental data of the influencing factors of the drug product. Excipient selection (1) cationic lipids and ionizable lipids Permanently ionized lipids (e.g., lipids bearing quaternary ammonium moieties) and conditionally ionizable lipids (e.g., lipids bearing tertiary amine moieties) have been widely used in LNP formulation for the delivery of nucleic acid drugs. Attorney Docket No.11650-003WO1 Quaternary cationic lipids, such as DOTAP-Cl, carry a permanent positive charge with the cationic property remained unchanged in different pH conditions. The quaternary cationic lipids are widely used in the formulation of LNP delivery systems for gene delivery. It has a high charge density to help condense the large nucleic acid drugs into nanosized stable complexes. While its positive charge can also interact with blood components and result in possible toxicity. On the other hand, ionizable lipids, such as DODMA, are mostly uncharged under neutral pH and become positively charged only under acidic conditions. When incorporate DODMA into the LNP formulation, after endocytosis of LNPs, DODMA becomes charged and subsequently promotes the escape of encapsulated gene materials loaded in the LNPs under the low pH condition of late endosome or lysosome. This design leverages the advantages of high charge density afforded by quaternary lipoamines (DOTAP-Cl) and the pH responsiveness of conditionally ionizable tertiary lipoamines (DODMA) to achieve the optimal balance of charge and endosomal escape for oligonucleotide delivery. DOTAP-Cl also contributes to the structural stability of LNPs under physiological pH conditions: permanently positively charged DOTAP-Cl better interacts with the negative charged oligonucleotides, resulting in nanoparticles with a relatively smaller particle size compared to the nanoparticles only containing tertiary lipoamines. With the acidic conditions like late endosome or lysosome, the ionization of DODMA promotes the electrostatic interaction between cationic lipids and the endosomal anionic membrane, leading to exocytosis and promoting the escape of oligonucleotide into the cytoplasm. In this study, commercially available DOTAP-Cl and DODMA were selected as cationic lipids for WGI-0301 product formulation. (2) PEGylated lipid and neutral lipids PEGylated lipids are widely used in nanoparticle delivery systems. Cationic lipids interact non- specifically with charged components in the serum through electrostatic interaction and may be recognized and eliminated by the mononuclear phagocytic system easily. PEGylated lipids can confer stealth properties to LNPs, reduce non-specific interactions with negatively charged serum components, and suppress the drug uptake by the reticuloendothelial system (RES), thereby prolonging the half-life of the drug in the plasma. Moreover, PEGylated lipids are able to enhance formulation stability by reducing interaction with nucleases and improving overall colloidal stability. However, the presence of a PEG layer can sterically hinder the interaction between LNPs and cell membranes, result in reduced cell uptake and inhibited interaction of LNPs with the endosomal and lysosomal membranes. Thus, while PEGylated lipids are necessary to improve the formulation stability and circulating time in blood, they need to be rapidly released from LNPs after the nanoparticles reach Attorney Docket No.11650-003WO1 the target organ to increase the cellular internalization and facilitate the endosomal escape. Therefore, the timely release of PEGylated lipids from LNPs is critical. Many studies showed that the duration that PEGylated lipids attached to the LNP were determined by the length of the fatty acid chain of PEGylated lipids. Longer chain PEGylated lipids (e.g. PEG-C20) cannot be easily released from the LNPs due to the stronger intermolecular forces, resulting in LNPs with greater stability and circulation time. While shorter chain PEGylated lipids (e.g. PEG-C8) can be easily removed from the nanoparticles. The length of PEGylated lipid chain is independent from the LNP’s ability to accumulate at the tumor site. It is also reported that PEGylated lipids have a strong immune response. The clearance rate of LNPs with longer fatty acid chains (e.g., PEG-DSPE, PEG-s-DSG) was faster compared to the ones with shorter fatty acid chains (e.g., PEG-s-DMG or PEG-CerC14). According to the principles of the LNP delivery, three different designs of LNP formulation were prepared. Formulation 1: DOTAP-Cl, DODMA, DOPC, cholesterol, and DMG-PEG 2000; Formulation 2: DOTAP-Cl, DODMA, DSPC, cholesterol, and DMG-PEG 2000; Formulation 3: DOTAP-Cl, DODMA, DOPC, cholesterol, and DSPE-PEG 2000. Particle size of API loaded LNPs was used as a formulation screening criterium. The design of the different formulations is shown in the table below. Table 3. Design of LNP formulations Formulation Formulation 1 Formulation 2 Formulation 3 composition Molar acd caton, sucrose as an Osmoarty reguator, NaO as a p reguator, an ydrous et ano as a pd solubilizer, and water for injection as solvent. The amount of the aforementioned components is the same in three formulations, so they will not be discussed in this report. Table 4. Formulation screening of LNP formulations. Results of Different Molar Ratios Attorney Docket No.11650-003WO1 Appearance White translucent White translucent White translucent suspension suspension suspension 47.53 nm, formulation 3 has a particle size of 67.19 nm, and formulation 2 has the largest particle size of 123.1 nm and the largest PDI value of 0.807. API loaded LNPs of smaller particle sizes (<100 nm) are more likely to enter the target tissues such as tumors than particles of larger sizes. DMG-PEG2000 with PEG-C14 tends to loosen the PEG layer that shields the positive charge faster than the ones with longer fatty acid chain. They have the largest amount of accumulation in organs with reticuloendothelial system, especially the liver. WGI-0301 is intended to be developed as a potential treatment for hepatocellular carcinoma, so DMG-PEG 2000 was selected as the PEGylated lipid. Neutral lipids such as DOPC and DOPE are used as bilayer forming lipids for LNPs due to their low cytotoxicity and immunogenicity. The biophysical property of neutral lipids such as DOPC, DOPE, are not related to pH but limits the ability of LNPs to load and deliver negatively charged oligonucleotide drugs. Based on the formulation screening results above, DOPC was chosen as the neutral lipid for our LNP formulation. Cholesterol is a neutral lipid used as a regulator of membrane fluidity, which plays a role in lipid self-assembly and stabilization of LNPs. Selection of excipients based on the route of administration 1,2-dioleoyl-3-trimethylammonium-propane chloride (DOTAP-Cl), 1,2-dioleyloxy-3- dimethylamino-propane (DODMA), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), cholesterol (CHOL), 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene 2000 (DMG-PEG 2000), sucrose, ammonium chloride, glacial acetic acid, sodium hydroxide, and sodium chloride are used for the manufacturing of the clinical batch of WGI-0301. DOTAP-Cl and DODMA provide positive charge balance to interact with anionic oligonucleotides. DOPC is used as a bilayer forming lipid. Cholesterol is a lipid regulator of membrane fluidity, which increases membrane rigidity and provides stabilization. DMG-PEG 2000 is selected as a lipid to reduce the off-target uptake and immunogenicity and promote the circulation time. Sucrose and sodium Attorney Docket No.11650-003WO1 chloride are osmolarity regulators. Ammonium chloride and glacial acetic acid are lipid acidifiers used to protonate DODMA. NaOH is used to adjust pH. Formulation This design leverages the advantages of high charge density afforded by cationic quaternary lipoamines (DOTAP-Cl) and the pH responsiveness of conditionally ionizable tertiary lipoamines (DODMA) to achieve the optimal balance of charge and endosomal escape for oligonucleotide delivery. DOTAP-Cl also contributes to the structural stability of LNPs under physiological pH conditions: permanently positively charged DOTAP-Cl better interacts with the negative charged oligonucleotides, resulting in nanoparticles with a relatively smaller particle size compared to the nanoparticles only containing tertiary lipoamines. DOPC is used as a bilayer forming lipid. Cholesterol is a lipid regulator of membrane fluidity, which increases membrane rigidity and provides stabilization. DMG-PEG 2000 is selected as a lipid to reduce the off-target uptake and immunogenicity and promote the circulation time. Sucrose plays a role as an Osmolarity regulator. Ammonium chloride and glacial acetic acid were used as lipid acidifiers to protonate DODMA to interact with the API under low pH conditions. After formation of an electrostatic complex, pH is elevated to physiological pH with NaOH as a pH modifier. The buffer system is then replaced with 0.9% NaCl solution by tangential flow filtration. Determination of lipid molar ratio Several different formulations were screened to determine the optimal ratio of lipid components. The molar ratios of the formulations are as follows: Formulation 1: DOTAP / DODMA / DOPC / Cholesterol / DMG-PEG = 5 / 40 / 27.5 / 20 / 7.5; Formulation 2: DOTAP / DODMA / DOPC / Cholesterol / DMG-PEG = 5 / 40 / 25 / 20 / 10; Formulation 3: DOTAP / DODMA / DOPC / Cholesterol / DMG-PEG = 5 / 40 / 30 / 20 / 5. The particle size and zeta potential of LNPs were examined. The molar ratios of lipid were confirmed by HPLC-ELSD. The formulation designs can be found in the table below: Table 5 LNP formulations design Formulation composition Formulation 1 Formulation 2 Formulation 3 Attorney Docket No.11650-003WO1 Note: The formulation also includes the use of ammonium chloride and glacial acetic acid as lipid acidifiers, sucrose as osmolarity regulator, NaOH as pH regulator, anhydrous ethanol, and water for injection as the solvent. The amount of each component is the same in three formulations and they are not discussed in this section of the report. Table 6 Physicochemical characteristics of different LNP formulations Results of Different Molar Ratios Formulation composition Formulation 1 Formulation 2 Formulation 3 e resu s s ow a e ormua on w a oes ero - w h the molar ratio of 5 / 40 / 27.5 / 20 / 7.5 had the smallest particle size and PDI, with a particle size of 47.53 nm and a PDI of 0.234. LNPs with small particle sizes are more likely to penetrate porous target tissues such as tumors. Therefore, the optimal lipid molar ratio is set as 5 / 40 / 27.5 / 20 / 7.5. Confirmation of the lipid ratio Based on the lipids and molar ratio selected in the previous studies, four formulations with different lipid:drug ratio were designed. The CQAs of the formulations and the efficacy of the pharmacological animal experiments were investigated as the selection criteria. The composition of formulations and the results of the analysis can be found in the table below: Table 7. Design of formulations with different LNP:API ratios. Formulation No. Formulation 1 Formulation 2 Formulation 3 Formulation 4 Attorney Docket No.11650-003WO1 Sucrose 10 g 10 g 10 g 10 g NaOH q.s. q.s. q.s. q.s. a t discussed in detail here. Table 8. Physicochemical characteristics of formulations with different LNP:API ratios. Results of Different Lipid:Drug Ratios Batch No. 19111301 19111302 19111303 19111304 Formulation No. The results showed that the particle size was the smallest when the lipid:drug (w / w) ratio was 7.5:1. LNPs with small particle sizes are more likely to enter porous target tissues such as tumors. Therefore, the optimal lipid:drug (w / w) ratio is set as 7.5:1. Pharmacological efficacy study: WGI-0301 (RX-0301 as the formerly used name), composed with different lipid:drug (w / w) ratios, were given at 8 mg / kg (the dose level of 8 mg / kg indicated that of Archexin, which is equivalent to 7.5 mg / kg Free Acid of Archexin) to evaluate the anti-tumor effect in syngeneic Hepa1-6 model with C57BL / 6 mice. Statistical Analysis of Tumor Growth Inhibition Attorney Docket No.11650-003WO1 Table 9 Anti-tumor effect on Hepa1-6 syngeneic mouse model 3 Group Treatment Description Tumor Size (mm ) TGI T / C on day 34 (%) (%) P value p y Group 01 Group 02 Group 03 Group 04 Group 05 Group 06 Group 07 Group 01 After 34 days of dosing (QW x 4 weeks), the mean tumor volume (MTV) of the negative control was 2045.44 mm3. The MTV of WGI-0301 control group (15:1; excluding RX-0201) (8mg / kg) was 1417.07 mm3, TGI (%) was 31%, and the difference was not statistically significant compared to the negative control group (p=0.300). RX-0201 (8mg / kg) control group’s MTV was 1676.36 mm3, TGI (%) was 18%, and the difference was not statistically significant compared to the negative control group (p=0.419). The MTV of the WGI-0301 (15:1) (8mg / kg) treatment group was 1500.58 mm3, TGI(%) was 27%, and the difference was not statistically significant compared with the negative control group (p=0.300). WGI- 0301 (12:1) (8mg / kg) treatment group’s MTV was 1027.11 mm3,TGI(%) was 50%, and the difference was statistically significant compared with the negative control group (p=0.041). The MTV of the WGI-0301 (10:1) (8mg / kg) treatment group was 1260.48 mm3, TGI(%) was 38%, and the difference was not statistically significant compared to the negative control group (p=0.156). The MTV of the WGI-0301 (7.5:1) (8mg / kg) treatment group was 545.46 mm3, TGI(%) was 73%, and the difference was significantly different compared to the negative control group (p=0.007). The results showed that WGI-0301 (12:1) Attorney Docket No.11650-003WO1 and WGI-0301 (7.5:1) had significant anti-tumor effects on the syngeneic Hepa1-6 model in C57BL / 6 mice. Survival Analysis Table 11. Survival Analysis of Each Group. Medium 95% Increased Groups Treatment Survival Days Confidence life span p Value 1 7 9 3 5 2 a e . omparatve nayss (p aue) o t e urvva me o ac wo roups. Group 01 Group 02 Group 03 Group 04 Group 05 Group 06 Group 07 Group 01 Group 02 0.271 Group 03 0.947 0.135 Group 04 0.959 0.153 0.239 Group 05 0.433 0.236 0.065 0.056 Group 06 0.185 0.631 0.185 0.140 0.223 Group 07 0.042 0.282 0.004 0.002 0.018 0.570 From the survival analysis results, the MSTs of WGI-0301 (15:1), WGI-0301 (12:1), and WGI- 0301(10:1) are not significantly different than that of RX-0201 control group. WGI-0301 (7.5:1) has a significantly higher survival time compared to the RX-0201 control, WGI-0301 (15:1), and WGI-0301 (12:1) groups. To summarize, the lipid:drug ratio selected in this study was 7.5:1. Manufacturing process This product is an injectable suspension, the preparation process includes API solution preparation, empty LNPs preparation, drug loading, pH titration, tangential flow filtration, sterile filtration, filling, capping and sealing, packaging, and freezing. The ethanol dilution method is used to prepare LNPs. Ethanolic lipid solutions containing cationic lipids (DOTAP-Cl, DODMA), bilayer forming lipids (DOPC), PEGylated lipids (DMG-PEG 2000), and cholesterol are combined and acidified to around pH 4.0. Then the empty LNPs and oligonucleotide aqueous solutions are mixed rapidly to prepare the Attorney Docket No.11650-003WO1 LNPs at a 1:1 (v / v) lipid:drug ratio, which also brings the pH value to a physiological range. Tangential flow filtration is used to replace buffer and remove ethanol to stabilize the LNP. And high-throughput and controllable microfluidic technology is used to obtain high-quality, nanosized, stable LNPs. The advantage of microfluidic technology in the preparation of LNPs is that the prepared LNPs have higher encapsulation efficiency and smaller particle size, which enables the rapid production of LNPs, from laboratory scale to GMP production scale. The microfluidic technology is an in-line, continuous process for the preparation of LNPs. One advantage of this technology is that there was no change in formulation composition and proportion, equipment, or process parameters from laboratory scale to lab scale, to pilot scale, and to GMP production scale. In addition, there was no obvious change in the key quality parameters of the drug product, which indicates the stability of the process. The manufacturing process of empty LNPs used for nonclinical studies is similar to that of WGI-0301 except using 20% sucrose solution to replace the API solution. Figure 4 shows a diagram of the manufacturing process. Solution Preparation Preparation of 50 mM ammonium chloride / 50 mM glacial acetic acid solution: weigh 18.72 g glacial acetic acid, dissolve with appropriate amount of water for injection, mix and ultrafiltrate by an ultrafiltration membrane to remove bacterial endotoxin. Preparation of 20% (w / v) sucrose solution: weigh 1600 g sucrose, dissolve with appropriate amount of water for injection, mix and ultrafiltrate by an ultrafiltration membrane to remove bacterial endotoxin. Preparation of API solution (RX-0201 in 0.9% sucrose): weigh 10.50 g RX-0201 and 5698 g of 20% sucrose solution from step #1.2, mix and obtain 1.88 mg / mL Free Acid of Archexin (API solution). Preparation of 0.9%(w / w) sodium chloride solution: weigh 450 g of solidum chloride, dissolve with appropriate amount of water for injection, mix and ultrafiltrate by an ultrafiltration membrane to remove bacterial endotoxin. Preparation of 1 M sodium hydroxide (NaOH) solution: weigh 20.0 g sodium hydroxide, dissolve with appropriate amount of water for injection. Preparation of lipids solution: weigh 3.84 g DOTAP-Cl, 27.21 g DODMA, 23.72 g DOPC, 8.50 g cholesterol, and 20.74 g DMG-PEG 2000 (molar ratio = 5: 40: 27.5: 20: 7.5), dissolve the lipids with 798.50 g anhydrous ethanol, mix with a magnetic stirrer in a 40 ℃ water bath, and filter the lipids solution with a 0.45 μm PVDF syringe filter. Preparation of Empty Lipid Nanoparticles Attorney Docket No.11650-003WO1 Connect of an SY03 syringe pump system pipeline flush the tubes connected to the SY03 syringe pump system with 0.1 M sodium hydroxide solution. Connect the inlet ends of pumps #1 and #2 to water for injection. Flush the SY03 syringe pump system with water for injection until the pH is neutral. Evacuate water for injection; turn off the SY03 syringe pump system. Set the water bath temperature of the heated magnetic stirrer (DF-101T; #1) to 40℃. With magnetic stirring, pre-heat 4200 g (4.2 L) ammonium chloride / glacial acetic acid solution in a 5 L screw-top reagent bottle to 40℃ (acceptable temperature range: 38–42℃). Set the water bath temperature of the heated magnetic stirrer (DF-101T; #2) to 40℃. With magnetic stirring, pre-heat 846.21 g (1.05 L) filtered lipid solution in a 1 L screw-top reagent bottle to 40℃ (acceptable temperature range: 38–42℃). Set the water bath temperature of the heated magnetic stirrer (DF-101T; #3) to 40℃. With magnetic stirring, pre-warm a 5 L screw-top reagent bottle in the water bath. Connect the inlet end of pump #1 to the pre-heated 40℃ ammonium chloride / glacial acetic acid solution; connect the inlet end of pump #2 to the pre-heated 40℃ lipid solution. Place the head of the stainless-steel needle (16 G; 1.19 mm; 300mm) in the pre-heated 5 L screw-top reagent bottle in the 40℃-water bath. Turn on the SY03 syringe pump system to prepare the empty lipid nanoparticles. Use the pre-warmed 5 L screw-top reagent bottle to receive the empty lipid nanoparticle solution. After preparing the empty lipid nanoparticles, keep stirring the empty lipid nanoparticles solution at 40°C for 15 minutes. Preparation of WGI-0301 lipid nanoparticles Set the water bath temperature of the heated magnetic stirrer (DF-101T; #2) to 40℃. With magnetic stirring, pre-heat 5.25 L RX-0201 solution (in a 5 L screw-top reagent bottle) to 40 ℃ (acceptable temperature range: 38–42℃). With magnetic stirring, transfer the 5 L screw-top reagent bottle that contains the blank lipid nanoparticle solution from the #3 stirrer (DF-101T; #3) to the #2 stirrer (DF-101T; #2). Set the water bath temperature of the heated magnetic stirrer (DF-101T; #3) to 40℃. With magnetic stirring, pre-warm a 10 L empty screw-top reagent bottle in the 40℃-water bath. Connect the SY03 injection pump system pipelines. Connect the inlet of pump #1 to the preheated (40℃) RX-0201 solution; connect the inlet of pump #2 to the preheated (40℃) empty lipid nanoparticle solution. Connect the two tail ends of bifurcated extension to the outlet of two 25 mL-syringes, respectively; connect the head of bifurcated extension to a stainless-steel syringe. Place the head of the stainless-steel syringe (16 G; 1.19 mm; 510 mm) into the pre-warmed 10 L screw-top reagent bottle. Turn on the SY03 syringe pump system to prepare WGI-0301 lipid nanoparticles. Use the pre-warmed 10 L screw-top reagent bottle to receive WGI-0301 lipid nanoparticle solution. After the preparation, keep stirring the WGI-0301 lipid nanoparticle solution at 40°C for 15 minutes. Attorney Docket No.11650-003WO1 Place the crude WGI-0301 solution in a cool water bath to cool down the solution to room temperature (15–25℃). With a magnetic stirrer, add 1M sodium hydroxide (NaOH) solution for pH titration for WGI-0301 solution until the pH reaches 7.0–7.4. Set up a tangential flow filtration (TFF) system. Pretreat the new hollow fiber column filter: rinse with water first, then repeatedly rinse with a 0.2 M NaOH solution for 60 min. After that, rinse with sterile water for injection until the pH of the flushed water becomes neutral. Use a pretreated hollow fiber column filter as a tangential flow filtration device and use a 0.9% NaCl solution as the tangential flow replacement solution to change the suspending medium of WGI-0301 to 0.9% NaCl solution. Conduct tangential flow filtration until 25000 g 0.9% NaCl solution is consumed, and then pump supplemented 0.9% NaCl solution into the hollow fiber column filter to flush out the residue WGI-0301 solution inside the column into a 10 L screw-top reagent bottle. Sample and test the assay of the WGI- 0301 solution. Dilute the crude WGI-0301 solution with 0.9% sodium chloride solution to obtain the final WGI- 0301 solution with desired API concentration. Filter the WGI-0301 solution into the Merck Millipore sterile bag through two 0.22 μm PVDF sterilized filters. Heat sterilization under 121 ℃ for 30 min. Clean the vials using wash machine and sterilize the vials through a tunnel drying oven (330±15℃, ≤55 vials / min). Fill the WGI-0301 into 10 mL medium borosilicate glass vials in the RABS under laminar flow, purge the filled vails with nitrogen and then perform stoppering. Screening of lipid concentration In the process optimization of empty LNP preparation, total lipid concentrations of 150 mg / mL, 75 mg / mL, and 37.5 mg / mL were tested. SY03 syringe pump system was used to prepare Empty LNPs as well as API loaded LNPs at a lipid:drug ratio (w / w) of 7.5:1. This was followed by pH titration using 1M NaOH solution to physiological pH. The appropriate lipid concentration was screened by particle size distribution as the criterion for acceptance. The experimental design and results are listed in the table below. Table 13. In Process Optimization of Empty LNP Preparation. Process Batch No. Attorney Docket No.11650-003WO1 Needle size (G; inner diameter; length) 16 G; 1.19 mm; 300 mm 4 9 6 eren p concen ra ons ( mg m , mg m , . mg m ) were use o screen e effect of lipid concentration on particle size distribution and PDI during the empty LNP, drug loading, and pH titration steps. The test results showed that the particle size of empty LNPs decreased with decreasing lipid concentration, and when the lipid concentration was 150 mg / mL, the particle size at the drug loading and titration step were reduced due to greater electrostatic interaction. However, when the lipid concentration was 75 mg / mL and 37.5 mg / mL, the particle size increased after the drug loading and titration steps, especially for the 37.5 mg / mL lipid concentration group, where the particle size increased from 35.87 nm to 65.28 nm, showing its instability. Summarily, when the lipid concentration was 75 mg / mL, the final particle size was the smallest and most stable. Therefore, the lipid concentration was selected to be 75 mg / mL. Screening of the concentration of ammonium chloride / glacial acetic acid for lipid acidification In the process of optimizing empty LNP preparation, ammonium chloride / glacial acetic acid solutions of 25 mM / 25 mM, 50 mM / 50 mM, and 100 mM / 100 mM were investigated. The SY03 syringe pump system was used to prepare empty LNPs as well as API loaded LNPs at a lipid:drug ratio (w / w) of 7.5:1. This was followed pH titration by 1M NaOH solution to physiological pH. The appropriate lipid concentration was screened by particle size distribution as the criterion for acceptance. The experimental design and results are shown in the table below. Table 14. Screening of Buffer Concentration for Lipid Acidification. Attorney Docket No.11650-003WO1 Process Batch No. steps Process parameters 20051501 20051502 20051503 9 8 The pKa of the cationic lipid DODMA is 6 to 7. The lipid becomes fully ionized under acid pH. After acidifying the lipid solution with ammonium chloride / glacial acetic acid of 25mM / 25mM, 50mM / 50mM, 100mM / 100mM, respectively, empty LNPs were formed; their pH values were 4.556, 4.197, 3.814, respectively. It is known from the literature that DODMA best associates with oligonucleotide when it is completely ionized. At pH 4.556, DODMA is insufficiently ionized, while at pH 4.197 and pH 3.814, DODMA is completely ionized. The particle size distribution results show that when the ammonium chloride / glacial acetic acid solution is 50mM / 50mM, the particle size is much smaller than with 25mM / 25mM and 100mM / 100mM. The small LNPs are more likely to enter target tissues such as tumors, so 50mM / 50mM Ammonium chloride / glacial acetic acid was selected as the ammonium chloride / glacial acetic acid solution concentration. Screening of organic-aqueous phase ratio In the optimization process of empty LNP preparation, the following ratios of lipid solution (organic phase) and ammonium chloride / glacial acetic acid solution (aqueous phase) were selected: 1:8, 1:4, 1:2. The empty LNPs were prepared using a SY03 syringe pump system. The particle size distribution Attorney Docket No.11650-003WO1 was used as the criterion to screen the appropriate organic-aqueous phase ratio (v / v). The experimental design and results are shown in the table below: Table 14 Screening of Organic-aqueous Phase Ratio for LNP Preparation Process Batch No. steps 20051506 20051507 20051508 The experimental results show that when the organic-aqueous phase ratio is 1:8 (particle size: 45.11 nm) or 1:4 (particle size: 44.80 nm), the particle size is much smaller than when the organic- aqueous phase ratio is 1:2 (particle size: 58.49 nm). However, when the organic-aqueous phase ratio is 1:8 and its PDI is 0.392, it is much larger than the PDI of 0.251 when the organic-aqueous phase ratio is 1:4, indicating that the particle size distribution is more uniformly distributed when the organic-aqueous phase ratio is 1:4. Therefore, 1:4 was selected as the empty LNP organic-aqueous ratio (v / v). Screening of needle inner diameter In the process optimization of empty LNPs, a SY03 syringe pump system is used to prepare empty LNPs. When lipid solution and acidifying solutions pass through a T-connector at a certain flow rate (flow rates are 40 and 160 mL / min, respectively) through a microfluidic channel of a certain size, under laminar flow, the lipid solution and acidifying solution can be fully dispersed rapidly and completely. Needle sizes tested include 14G (internal diameter 1.60 mm; length 300 mm), 16G (internal diameter 1.19 mm; length 300 mm), and 18G (internal diameter 0.84 mm; length 300 mm). The particle size distribution was used as the criterion for selection. The experimental design and results are shown in the table below. Attorney Docket No.11650-003WO1 Table 15. Screening of Needle Inner Diameter. Process Batch No. steps Process parameters 20051801 20051802 20051803 0 e resuts s ow t at w en t e neede spec caton s 6G, t e partce sze o empty N s s t e smallest. When the needle is 18G, due to the narrow inner diameter, it creates high-shear fluid pressure. Therefore, the needle selected was selected as16G (inner diameter of 1.19 mm; length of 300 mm) for empty LNP preparation. Screening of syringe pump system for lipid solution and ammonium chloride / glacial acetic acid solution In the process optimization of empty LNP preparation, the SY03 syringe pump system is used to prepare empty LNPs. When different lipid solutions and acidic solutions pass through the T-connector, at a certain flow rate through a certain size microfluidic channel under laminar flow, the lipid solution and acidifying solution can be fully dispersed rapidly and completely. With a stainless-steel syringe needle (16G; internal diameter 1.19 mm; length 300 mm) as a mixing and dispersion microfluidic channel, the syringe pump speed combinations of lipid solution and acidifying solution were set at 40 & 160 mL / min, 20 & 80 mL / min, and 10 & 40mL / min, respectively. The suitable the syringe pump speed combinations of lipid solution and acidifying solution was selected with particle size distribution as the criterion. The experimental design and results are shown in the table below. Table 16. Screening of Syringe Pump System. Process Batch No. 20051802 20051804 20051805 Attorney Docket No.11650-003WO1 Process parameters Lipid concentration 75 mg / mL e maxmum ow ra e o e syrnge pump sys em s m mn. sng e p solution / acidifying solution ratio (v / v) (i.e., the flow rate ratio) of 1:4, the syringe pump speed combinations of lipid solution and acidifying solution were set to 40 & 160 mL / min, 20 & 80 mL / min, and 10:40 mL / min. The results show that when the syringe pump speed combination was 40 & 160 mL / min, the particle size of the empty LNPs formed was the smallest (particle size of 34.24 nm) and the preparation time was also the shortest. Therefore, 40 & 160 mL / min was selected as the syringe pump speed combination of lipid solution and acidifying solution for empty LNP preparation. Screening of needle specifications In the process of drug loading optimization, the SY03 syringe pump system was used to prepare empty LNPs. The empty LNPs and API solution were combined by a T-connector, at a certain flow rate combination (40 and 160 mL / min) through a certain sized microfluidic channel under laminar flow, which allowed for rapid and complete mixing. Needle sizes tested include 14G (internal diameter 1.60mm; length 300 mm), 16G (internal diameter 1.19mm; length 300 mm), and 18G (internal diameter 0.84mm; length 300 mm). The particle size distribution was used as the criterion for selection. The experimental design and results are shown in the table below. Table 17. Screening of Needle Specifications. Process Batch No. 20052701-2A 20052701-2B 20052701-2C Attorney Docket No.11650-003WO1 API solution concentration 1.88 mg / mL 1.88 mg / mL 1.88 mg / mL Needle size (G; inner diameter; 14G; 1.60 mm; 16G; 1.19 mm; 18G; 0.84 mm; n al e e The results showed that when using needles with different diameters, there was no significant difference in particle size distribution for drug loading. When the needle was 16G, the particle size of the loaded LNP was the smallest, 42.10 nm. When the needle was 18G, due to the small internal diameter, it caused high internal pressure, which may lead to leakage of the solenoid valve of the syringe pump. Therefore, the selection of needle diameter was 16G for drug loading via microfluidic method. Screening of syringe pump system of empty LNPs and API solutions In the process of drug loading optimization, the SY03 syringe pump system was used to prepare API loaded LNPs. The empty LNPs and API solution were combined by a T-connector, at a certain flow rate combination (40 & 160 mL / min) through a microfluidic channel of a certain size under laminar flow, which allowed for rapid and complete mixing. A 16G needle was equipped to determine the effect of varying syringe pump speed combination of empty LNPs and API solutions: 160 &160 mL / min, 80 & 80 mL / min, and 40 & 40 mL / min. The appropriate syringe pump speed combination was determined using particle size as the criterion. The experimental design and results are shown in the table below. Table 18. Screening of Syringe Pump System of Empty LNPs and API Solutions. Attorney Docket No.11650-003WO1 Process Batch No. steps Process parameters 20052701-2D 20052701-2B 20052701-2E n y g p p y . that the particle size distribution of WGI-0301, which was prepared with different injection speed combination of empty LNP and API solution, was not significantly different. When the syringe pump speed combination was 160 & 160mL / min, the processing time was the shortest; for WGI-0301 prepared by microfluidic technology, a shorter processing time is preferred. Therefore, 160 & 60mL / min was selected as the syringe pump speed combination of empty LNP and API solutions. Screening of incubation temperature and incubation time Microfluidic continuous mixing technology is used to prepare empty LNPs and to load API into empty LNPs. For both preparations, the solutions are maintained at the same temperature. API solution (RX-0201 in sucrose solution), empty LNPs, and API loaded LNPs were investigated at different incubation temperatures (25°C, 40°C, and 55°C) and for different incubation times. RX-0201 is easy to dissolve in sucrose solution at room temperature with stirring. With continuous microfluidic processing, API solution may be exposed to high temperature for a prolonged period. At high temperature, RX-0201 is unstable and impurities may increase. Small quantities of API were dissolved, and the Assay value and impurities were evaluated under different temperature conditions. The experimental design and inspection results are as follows. Table 19. API Stability under Different Temperature. Sample information RX-0201 Related Substances (%) Assay value Attorney Docket No.11650-003WO1 API solution at 25°C for 6 h 7.34 2.864 5.754 1.94 API solution at 25°C for 12 h 7.34 2.844 5.740 1.96 ° . Acid of Archexin, which is the API solution (RX-0201 is soluble in 20% sucrose solution and the dissolution time is very short, so no investigation is necessary). Then the API solution was incubated 25°C, 40°C, and 55°C, respectively, for 12 h to investigate the stability. The results showed that impurity increased along with time at different temperatures and impurities increased with temperature. However, it is important to note that the Assay value did not change significantly. Using the SY03 syringe pump system, the previously selected processing parameters were used to prepare empty LNPs and API loaded LNPs. Setting the preparation / incubation temperatures of empty LNPs at 25°C, 40°C, and 55°C respectively, the effects of different incubation times (15 min, 30 min, 1 h, 3 h, 6 h, 9 h, 12 h, and 24 h) on the particle size distribution, encapsulation efficacy, LPC and impurities of the empty LNPs were investigated. Setting the preparation / incubation temperatures of empty LNPs at 25°C, 40°C, and 55°C respectively, the effects of different incubation times (15 min, 30 min, 1 h, 3 h, 6 h, 9 h, 12 h, and 24 h) on the particle size distribution, encapsulation efficacy, LPC, and impurities of the API loaded LNPs were investigated. The experimental design and results are as follows. Table 20. Experimental Design to Screen the Incubation Temperature and Incubation Time. Process Batch No. 20051901 20051902 20051903 Attorney Docket No.11650-003WO1 Screening incubation time 15 min, 30 min, 1 h, 3 h, 6 h, 9 h, 12 h, and 24 h 4
[0002] Attorney Docket No.11650-003WO1 Table 21 Different Incubation Time Comparisons of Empty LNPs at 25°C, 40°C, and 55°C Particle LPC Particle LPC Particle LPC CQA size PDI content size PDI content size PDI content L) e esu s s owe a w e e cu a o e pe a u e was , e pa ce s e o e pty LNPs decreased slowly with the increasing incubation time (from 48.47 nm to 39.35 nm), PDI decreased with the incubation time slowly (from 0.483 to 0.265), and LPC content increased with incubation time (from 0.013 mg / mL to 0.023 mg / mL). When the incubation temperature was 40°C, the particle size of empty LNPs increased slowly with the incubation time (from 37.23 nm to 46.46 nm), the PDI decreased slowly with the incubation time (from 0.340 to 0.233), and LPC content remained unchanged at 12 h, but increased at 24 h. When the incubation temperature was 55°C, the particle size of the empty LNPs within 12 h increased slowly corresponding to increased incubation time (from 41.54 nm to 49.75 nm), but suddenly decreased to 41.54 nm at 24 h, indicating that the empty LNPs may be damaged or broken at 24 h.
[0003] Attorney Docket No.11650-003WO1 Table 22. Comparison of Different Incubation Times of Drug-Loaded LNP at 25°C, 40°C, and 55°C. Test Item Particl Maximum Temp. e Encapsulation LPC content Total size (nm) PDI efficiency (mg / mL) single impurity * The results showed that when the incubation temperature was 25°C, the particle size after drug loading increased from 48.47 nm to 59.66 nm, and the particle size of the API loaded-carrying LNPs decreased slightly with the incubation time. When incubation temperature was 40°C, particle size increased from 37.23 nm to 48.24 nm, with no further significant change in particle size as incubation time increased. When incubation temperature was 55°C, the particle size after API loading increased from 41.54 nm to 58.12 nm, with no significant change in particle size as incubation time increased. Both particle size and PDI change were minimal when the preparation / incubation temperature was 40°C. At different temperatures, there was no significant change in the encapsulation efficiency and LPC content for LNPs incubated for 24 h. At different temperatures, the largest single and total impurities increased with incubation time, and the impurities increased rapidly at higher temperatures. Attorney Docket No.11650-003WO1 RX-0201 sucrose solution (API solution), empty LNPs, and API loaded LNPs were incubated at different temperatures (25°C, 40°C, and 55°C) and particle size distribution, assay value, impurities, LPC content, and encapsulation efficiency were evaluated. Empty LNPs were determined to be prepared at 40°C, with incubation time of 15 min. Tangential flow filtration replacement solution A Spectrum hollow fiber membrane column (mPES; 100Ka 115 cm2) is used as the TFF device with 0.9% NaCl solution and pH 7.4 PBS solution as the TFF replacement solution. These two TFF replacement solution were investigated to understand their effect on the drug product. The results of the experiment are shown in the table below. Table 23. Screening of TFF Replacement Solution. Batch No. 20051902-3 20051902-4A 20051902-3-4B 6 cycles of TFF using 6 cycles of TFF using FF Attorney Docket No.11650-003WO1 Drug loaded LNPs with physiological pH were buffer exchanged with different buffer systems (0.9% NaCl solution or pH 7.4 PBS solution) using TFF. The results showed that there was no significant difference in the particle size distribution, assay value, encapsulation efficiency, lipids, LPC content, impurities, or residual solvent (ethanol) in different buffer systems. The results of the freeze-thaw experiment showed no significant change in particle size distribution. However, the data of animal experiments (Batch No.19111301 / 02 / 03 / 04, TFF using pH 7.4 PBS buffer) show that when pH 7.4 PBS solution was used as the final buffer system, some toxicity was observed. Moreover, literatures also show that pH 7.4 PBS solution administered intravenously has certain toxicity. Therefore, 0.9% NaCl solution was selected as the buffer solution. Confirmation of TFF cycles With a hollow fiber membrane column (mPES; 100Ka 115cm2) as the TFF module and 0.9% NaCl solution as the replacement buffer, TFF was conducted up to eight cycles. Particle size distribution and residual solvent (ethanol) were used as the selection criteria. The results of the experiment are shown in the table below. Table 24. Confirmation of TFF Cycles. Batch No. 20052001 Residual solvents The results show that as the number of TFF cycles increases, the particle size and PDI do not change significantly. While the residual ethanol amount reduced in line with the increased number of TFF cycles. The residual ethanol in the draft quality standards was set at <0.25%. At least four TFF buffer replacement cycles are necessary to reach the quality standard for ethanol removal. The number of TFF buffer replacement cycles was set as six. Selection of membrane filter materials Attorney Docket No.11650-003WO1 API loaded LNPs were sterilized with Millipore Durapore® 0.22 µm PVDF syringe filters and Millipore Express® 0.22µm PES syringe filter, respectively, to examine the effects of different filter materials on sterile filtration. Table 25. Selection of Membrane Filter Materials. Sample Before sterilization Sterile filtration: PVDF Sterile filtration: membrane PES membrane The results showed that there was no significant change in particle size distribution, assay value, encapsulation efficiency, LPC content, or impurities after sterile filtration with a PVDF or PES membrane. The lipid contents of LNPs filtered by PVDF membrane or PES membrane were almost identical, and there was no significant difference between the retention and adsorption of lipids by different material membranes. Therefore, for the sterile filtration process, the choice of PVDF membrane or PES membrane are appropriate because there is no significant impact on chemical or physical properties of the LNPs. The investigational product is stored under -20℃ and allow to warm to room temperature prior to administration. In-use stability studies were conducted on the pilot batches to evaluate the compatibility between the packaging components and the drug product. WGI-0301 products were thawed at 5℃±3℃ and kept at room temperature for 2h.0.9% sodium chloride injection was used to dilute the drug product to the concentration of 0.019 mg / mL, 0.19 mg / mL, 0.47 mg / mL and 0.70 mg / mL and diluted solutions were injected into PVC sterile bags. Sampling and testing were performed at 0 h, 1.5 h and 6 h and the results are summarized in the following tables. Attorney Docket No.11650-003WO1 The in-use stability and compatibility data shows that the Di(90) value of the sample solution at 0.019 mg / mL changed significantly. Particle sizes of the sample solution at 0.019 mg / mL and 0.19 mg / mL of batch QT-SY2020022 increased to 55 nm and 53 nm, respectively. There is no significant difference in the other specifications, which indicates the packaging components are compatible with the drug product. In addition, the results of accelerated and long-term stability studies also indicate the packaging components are compatible with the drug product when stored under -20℃. Example 3: In Vivo Efficacy of WGI-0301 in the Liver Cancer Mice Model The AKT pathway is an important therapeutic target for cancer drug discovery as it functions as the main point for transducing extracellular and intracellular oncogenic signals. Moreover, alternations of the AKT pathway have been found in a wide range of cancers (Cheng, J. Q., et al., Oncogene, 24(50), 7482-7492 (2005)). Archexin (also named RX-0201) is a fully phosphorothioated 20-mer oligonucleotide complementary to Akt1 mRNA. Archexin is able to specifically target the mRNA sequence of Akt-1 where it causes inhibition of translation and downstream pathway activity of Akt-1 mRNA (Bellacosa, A., et al., Adv Cancer Res, 94, 29-86 (2005), Liang, J., et al., J. M.,Cell Cycle, 2(4), 339-345 (2003), Staal, S. P. Proc Natl Acad Sci U S A, 84(14), 5034-5037 (1987), Staal, S. P., et al. Proc Natl Acad Sci U S A, 74(7), 3065- 3067 (1977), Testa, J. R., et al. Proc Natl Acad Sci U S A, 98(20), 10983-10985 (2001), and Yoon, H., et al., J Cell Biochem, 108(4), 832-838 (2009).). Archexin (RX-0201) was developed for the treatment of cancers under IND 69763. In vitro pharmacology studies have demonstrated that the inhibition of Akt-1 mRNA by Archexin is sequence-specific. The Akt-1 mRNA levels and AKT-1 protein expression in human tumor cells of brain, breast, cervix, liver, lung, ovary, prostate, and stomach, as well as melanoma, were significantly reduced following treatment with Archexin. In addition, these studies demonstrated that Archexin suppressed cell proliferation of these human cancer cells. The growth inhibition by Archexin appeared to be dose-dependent and the concentration causing 50% inhibition (IC50) of cell growth ranged from 2 nM to 50 nM in these human cancer cells. Three clinical trials of Archexin were conducted under IND 69763: one Phase I monotherapy trial and two Phase II combination therapy trials. In the Phase I single agent, dose escalation study of formulated Archexin, doses ranging from 6 to 315 mg / m2 / day were administered to 17 subjects with advanced solid tumors continuously for at least 14 days. The maximum tolerated dose of single agent administration of formulated Archexin was 250 mg / m2 / day, equivalent to 6.76 mg / kg / day. WGI-0301 is a lipid nanoparticle formulation of Archexin. Nonclinical studies carried out to support the development of WGI-0301 include primary pharmacology studies demonstrating tumor Attorney Docket No.11650-003WO1 inhibition efficacy of WGI-0301 in the liver cancer mice model in vivo, as well as to study the survival prolongation effect. Safety pharmacology studies were conducted to investigate any untoward pharmacologic actions of WGI-0301 on the central and peripheral nervous system, the cardiovascular system, and the respiratory system. The in vivo pharmacokinetics and tissue distribution studies, as well as in vitro stability study in plasma, were investigated to characterize the distribution and metabolic stability of WGI-0301 in the toxicology test species, and toxicological evaluations were performed which included the toxicokinetics analysis of WGI-0301. To assess the nonclinical safety of WGI-0301, acute toxicity studies were conducted in Sprague- Dawley rats and Beagle dogs to determine the maximum tolerated doses in these two species. Repeated dose toxicities were studied in rats and dogs following once weekly 1-h intravenous administration for 29 days (4 weeks and 5 doses in total) followed by a 28-day recovery period. Other studies have been performed to assess the potential immunotoxicity in dogs and in vitro hemolysis potential of WGI-0301. WGI-0301 is a reformulated lipid nanoparticle suspension of Archexin. Due to the tissue distribution profile of lipid nanoparticle, liver is the main target of WGI-0301. In the pharmacodynamics study, mice liver cancer models were selected to study the efficacy of WGI-0301. In an in vivo Hepa1-6 liver cancer mice model study (Study No. E4275-T1906), following intravenous treatment with WGI-0301 or Archexin at 8 mg / kg once weekly for 4 doses, WGI-0301 showed a better tumour inhibition efficacy and significant longer survival time than Archexin. The tumour growth inhibition% of WGI-0301 was 46.16%, while that of Archexin at the same dosing regimen was 3.32%, as compared to the vehicle control group. The medium survival time of the vehicle control, Archexin-treated, and WGI-0301-treated groups were 37, 41, and 55 days, respectively; the difference between the vehicle control group and WGI-0301-treated group was significant (p=0.042). The lipid nanoparticle formulation of Archexin, WGI-0301, is expected to achieve promising antitumor and / or survival prolongation effects with a lower dosing frequency and less amount of Archexin. Antitumor growth efficacy and survival prolongation of WGI-0301 at a lower dose level, 8 mg / kg (0.65 mg / kg HED), in the liver cancer mice model were demonstrated. In addition, no test article-related effect on neurobehavioral changes was noted in rats, and no test-article related changes in qualitative and quantitative electrocardiogram evaluation, blood pressure, heart rate, and respiratory parameters, neurological examination parameters were founded. The in vitro hERG assay showed little inhibitory effect at concentrations of up to 274.1 µM Free Acid of Archexin. Pharmacokinetics Studies Attorney Docket No.11650-003WO1 The nonclinical pharmacokinetics of WGI-0301 were generally similar across the primary species (Sprague-Dawley rat and Beagle dog) used for pharmacokinetic and toxicological evaluation. In each species that were administered a single dose of WGI-0301, plasma half-time (T1 / 2) increased as dose level increased, and the systemic exposure (AUC0-last and Cmax) of Free Acid of Archexin increased proportionally as the dose increased generally, with the exception of AUC0-last in female dogs. In the once weekly intravenous infusion regimen for 3 weeks, accumulation effect in Cmax in male rats was noted, no accumulation effects were noted in dogs. The tissue distribution study in rats showed that WGI-0301 tended to enter liver, kidney, and spleen rapidly from blood after dosing, and stayed in the liver for up to 7 days. Toxicity Studies In the acute toxicity studies with WGI-0301, the lethal dose and MTD in rats were 12 mg / kg and 6 mg / kg, respectively, and the MTD in dogs was 9 mg / kg, a maximal feasible dose. In the 4-week toxicology study in dogs, following intravenous treatment with WGI-0301 at up to 5 mg / kg once weekly for 4 weeks (5 doses in total), there were no treatment-related adverse effects. The NOAEL and HNSTD of WGI-0301 in dogs were 5 mg / kg / dose, which is equivalent to 2.77 mg / kg HED. In the 4-week toxicology study in rats, following intravenous treatment with WGI-0301 at 2, 4, or 6 mg / kg once weekly for 4 weeks (5 dose in total), there were no treatment-related adverse effects on morbidity / mortality, clinical signs, body weight, food consumption, ophthalmic examinations, coagulation, and urinalyses. Example 4: First in Human, Open-Label, Dose-Escalation Study to Evaluate the Safety, Tolerability, and Pharmacokinetics of WGI-0301, a Lipid Nanoparticle Suspension of Akt-1 Antisense Oligonucleotide, in Patients with Advanced Solid Tumors Cancer plays as a leading role in causing death and an important barrier to increase life expectancy across the world. According to the modelling results from the World Health Organization (WHO) in 2019, cancer is the first or second leading cause of death before the age of 70 years in 112 of 183 countries and ranks third or fourth in a further 23 countries. In 2020, an estimated 19.3 million new cancer cases (18.1 million excluding nonmelanoma skin cancer) and almost 10.0 million cancer deaths (9.9 million excluding nonmelanoma skin cancer) occurred worldwide[1]. To date, available therapeutic approaches to cancer include surgery, chemotherapy, hormone therapy, immunotherapy, and radiation. Each of these therapies has their limitation, such as intolerable toxicities, insufficient efficacy, or not well accessible for the public. Therefore, the need of safe and effective therapies is always increasing. The Akt (also called protein kinase B or PKB) gene family consists of 3 widely expressed, closely related proto-oncogenes known as Akt-1, Akt-2, and Akt-3, respectively. Once activated, Akt protein Attorney Docket No.11650-003WO1 products can phosphorylate a range of proteins and thereby control several cellular processes (Staal, 1987)[2]. In cancer cells, overexpression of constitutively activated Akt-1 gene promotes cellular transformation by two distinct mechanisms. Strong evidence demonstrates that Akt-1 protein plays a very important role in cancer progression process by stimulating cell proliferation and inhibiting apoptosis. Akt-1 appears to promote proliferation under conditions in which cells should normally be growth arrested. Akt-1 also prevents apoptosis by inhibiting virtually all cell-death inducing molecules. These mechanisms enable Akt-1 to promote the survival of tumor cells under conditions in which those cells should die. In addition, strong evidence is showing that overexpression of p-Akt may contribute to the development and progression of malignancies (e.g., prostate (Van de Sande, T et al., 2005)[3], breast (Stal et al, 2003)[4], ovarian (Kurose et al., 2001)[5], endometrial (Uegaki et al., 2005)[6], squamous cell (Massarelli et al., 2005)[7], and renal (Rathmell et al., 2005) cancers)[8]and have a negative impact on prognosis. High anti-phosphorlation specific Akt immunostaining was significantly associated with poor cancer specific survival rate and metastases in renal cell carcinoma (Horiguchi et al., 2003)[9]. Increases in both cytoplasmic and nuclear p-Akt levels were independent prognostic factors for reduced renal cancer subject survival (Hager et al, 2009)
[0010] . Successful regulation of Akt-1 activity will be an effective way to control the survival of cancer cells. Therefore, Akt-1 may be an attractive drug target for the treatment of cancer. The potential of antisense oligonucleotides in gene silencing was discovered around 40 years ago, which resulted in increasing interest in chemistry, mechanism of action, and metabolic pathways aspects. Currently, one of the approaches to regulating Akt-1 is to use antisense oligonucleotides to modify and regulate the mRNA that controls the expression and production of Akt-1. Archexin is a 20-mer oligonucleotide, the API of WGI-0301, that is complementary to Akt-1 mRNA. Archexin had been tested in several in vitro and in vivo models and the results of these studies have demonstrated that Archexin is a selective and specific antitumor agent. In vitro studies have demonstrated that Archexin specifically inhibits the proliferation of human cancer cells of the brain, breast, cervix, colon, kidney, liver, lung, ovary, pancreas, prostate, skin, and stomach by inhibiting the mRNA and protein expression of Akt. In vivo studies have also shown that Archexin significantly inhibits the growth of tumor mass in human prostate and brain cancer cells of nude mice and increases the survival of human kidney or pancreatic cancer cells in nude mice cancer models. Archexin also exhibits tolerability and safety in three clinical studies conducted in cancer patients previously. The most commonly reported adverse event (AE) was fatigue (70.6%). Of them, Attorney Docket No.11650-003WO1 29.4% was reported as mild fatigue, 23.5% as moderate fatigue, and 17.6% as severe fatigue. Besides, mild or moderate nausea, anorexia, and arthralgia were the second most reported AEs. In two Phase II studies of Archexin, combination therapy with gemcitabine or everolimus have been tested against metastatic pancreatic cancer and renal cell carcinoma, respectively. However, none of the primary objective has been met due to lack of efficacy or premature termination of the study. Despite the early termination, it is believed that the short duration of naked Archexin is the main reason of ineffectiveness. To further investigate, WGI-0301 was designed to improve the in vivo delivery of drug substance Archexin and its therapeutic performance. WGI-0301 is formulated as a lipid nanoparticle suspension formulation of Archexin using a combination of quaternary and tertiary lipoamines for pH sensitive delivery along with other neutral and stabilizing lipids. Permanently ionized and conditionally ionizable lipids have been widely used in LNP formulation for the delivery of nucleic acid drugs. WGI-0301 product used quaternary cationic lipids, DOTAP-Cl, which carries a permanent positive charge regardless of the pH conditions, to help condense the large nucleic acid drugs into nanosized stable complexes. The LNP formulation also includes DODMA as ionizable lipid, which is mostly uncharged under at neutral pH and becomes cationized only under in acidic conditions. When incorporate DODMA into the LNP formulation, after endocytosis of LNPs, DODMA becomes charged and subsequently promotes the escape of LNP-encapsulated nucleic acids gene materials loaded in the LNPs under in the low pH condition, such as of late endosome or lysosome. LNP formulation of Archexin can also take advantage of the well documented enhanced permeation and retention (EPR) effect and a cleavable PEG coating which reduces mononuclear phagocyte system (MPS) uptake, and so that Archexin can accumulate preferentially within the tumor site, limiting off-target exposure. In addition, the in vivo animal studies of WGI-0301 showed that WGI-0301 enhanced the efficacy and altered the tissue distribution profile in the liver, making liver cancer a very promising target. Further investigation has been planned after the proposed first in human study. WGI-0301 will be evaluated in patients with advanced solid tumors. Pre-clinical Studies Drug Product WGI-0301 WGI-0301 is a lipid nanoparticle suspension of Archexin. Reformulation of Archexin enhanced its efficacy in liver cancer mice models. In an in vivo liver cancer mice model study, the tumor growth inhibition of 8 mg / mL, i.v., QW*4 weeks WGI-0301 was 46.16%, which is much higher than that of Archexin at the same dose, 3.32%. Attorney Docket No.11650-003WO1 Single Dose and 3-week Once Weekly Doses In rats and dogs, animals were administered single 1-h IV infusion of WGI-0301 and once weekly doses for 3 weeks. In rats, the dose levels of the single dosing were 2, 4, and 6 mg / kg, and that of the weekly dosing was 4 mg / kg. In dogs, the dose levels of the single dosing were 0.75, 1.5, and 3. mg / kg, and that of the weekly dosing was 3. mg / kg. Clinical Studies Define the safety and tolerability of WGI-0301 in patients with advanced solid tumors by determining the dose-limiting toxicities (DLT), the maximum tolerated dose (MTD), and / or the recommended Phase 2 Dose (RP2D). Determine the pharmacokinetic (PK) profile of WGI-0301 and free Archexin (if measurable) in patients with advanced solid tumors. Assess preliminary tumor response in patients with advanced solid tumors treated with WGI-0301. Investigate potential biomarkers and the relationship to clinical response by biochemical and / or genetic analysis of blood and / or tumor samples. (Akt-1 mRNA, pAkt -1, pGSK-3β, pPRAS40, PTEN). Determine immunogenicity (anti-WGI-0301, anti-PEG) and its impact on PK, PD, and clinical responses if applicable. Product, Dosage and Route of Administration WGI-0301 is a lipid nanoparticle preparation of Archexin®for the treatment of advanced solid tumors. WGI-0301 will be administered weekly by intravenous infusion over 1 hour at a starting dose of 0.1 mg / kg for 4 consecutive weeks (a cycle). Treatment cycles will continue unless disease progression, unacceptable toxicity, or a clinical observation meeting any withdrawal criteria is noted. A subject that has a Dose Limiting Toxicity (DLT) will be removed and other subjects in the same cohort will receive precedent cohort dose. Please refer to Pharmacy Manual for more investigational products handling and administration details. Method A ‘3+3’ design will be deployed to determine dose limiting toxicities (DLT), maximum tolerated dose (MTD) / the Recommended Phase 2 dose (RP2D). Three to six patients per treatment cohort will be assigned to receive weekly 1-h IV infusion of WGI-0301 for 4 weeks (1 cycle) at a starting dose of 0.1 mg / kg. All relevant safety data will be reviewed and adjudicated 28 days following the cycle’s start date. All toxicities will be considered related to WGI-0301 if they cannot be definitively explained by underlying disease, intercurrent illness or concomitant medications; Treatment cycles will continue unless disease progression, unacceptable toxicity, or a clinical observation meeting any withdrawal criteria is noted. The 3 + 3 design will be conducted as follows. Three patients will be enrolled to a cohort initially, if a Attorney Docket No.11650-003WO1 patient experiences a DLT 3 additional patients will be enrolled. When more than 1 DLT occurs in ≤ 6 patients in a dosing cohort, dose escalation will be stopped, and this dose level will be identified as the non-tolerated dose. In that case, MTD could be either defined as the preceding lower dose or a between the non-tolerated dose and the preceding lower dose which may require more precise exploration to define the appropriate MTD. Dose Escalation Schedule Dose escalation in this study will follow the Modified Fibonacci schedule. Prior to escalation to the next higher dose level, safety data from all patients at the precedent dose level will be reviewed by Safety Monitoring Committee. Table 26. Escalation Schedule. Dose Level 1 0.1 mg / kg / weekly D L l 2 03 / k / kl Table 27. Escalation Method. Observed Safety Outcomes Action Dose Selection, Dosing Interval and Escalation Schedule The starting dose is 0.1 mg / kg IV infusion over 1 hour weekly, 4 weeks as a cycle. The treatment cycles will continue unless disease progression, unacceptable toxicity, or a clinical observation meeting any withdrawal criteria is noted. This dose selection is supported by the toxicology and pharmacokinetic studies in rats and dogs. The weekly dosing interval in the proposed clinical study is the same as that investigated in the studies of repeated-dose toxicology in rats and dogs. Dose escalation in this study follows the Modified Fibonacci schedule. The exposure of the dose level 5, 1.3 mg / kg / weekly of WGI-0301, is covered within the safety margin, obtained from the repeated-dose toxicology in rats. Dose escalation will continue Attorney Docket No.11650-003WO1 with caution to 1.75 mg / kg to establish the maximum-tolerated dose (MTD) if feasible. The exposure of the proposed maximum dose is covered within the safety margin obtained from the repeated-dose study in dogs. Based on the collected AEs, intensive clinical monitoring will be implemented. Please note that both 1.3 and 1.75 mg / kg / weekly dose of WGI-0301 satisfies the requirement of endotoxin under the USP <85> recommendation of 5 EU / kg in one hour; the endotoxin level of the drug products for the clinical trials has been retested and the results is < 2.5 mg / kg. The total study duration will be approximately 16 months. The number of treatment cycles is not fixed in this study. Subjects who continue to derive clinical benefit from the study treatment in the absence of withdrawal of consent, PD, or unacceptable toxicity may continue the study treatment. Patients may withdraw their consent at any time. The Primary Investigator may discontinue therapy at any time for the best interest of subjects. Specific criteria for the discontinuation of a patient’s participation are outlined. A DLT is defined as any treatment-emergent adverse event (TEAE) not attributable to disease or disease-related processes that occurs during the DLT evaluation period (Day 1 to Day 28) according to National Cancer Institute Common Terminology Criteria for Adverse Event (NCI-CTCAE) version 5.0. Study Participants Approximately 24 subjects, depending on the number of cohorts explored. Subjects must meet all the following criteria to participate in this study: Subject with measurable disease based on RECIST 1.1. Advanced, histologically or cytologically confirmed solid tumors who have progressed from current therapy or who have relapsed after prior therapy and are not candidates for potentially curative therapy. Pathologically confirmed solid tumors. Patients with advanced solid tumors (unresectable or metastatic) who failed standard therapy (disease progression or intolerance). Capable of understanding the written informed consent, provides signed, dated, and witnessed written informed consent, and agrees to comply with study protocol. Age 18 years or older at first screening / examination visit. Eastern Cooperative Oncology Group (ECOG) performance status of 0 to 2, measured within 72 hours of 1sttreatment. Adequate hematological function [absolute neutrophil count (ANC) ≥ 1.5 × 109 / L], [Platelets ≥ 100 × 109L], [Hemoglobin ≥ 9 g / dL], and [Serum albumin ≥ 2.8 g / dL]. Adequate renal function [calculated estimate glomerular filtration rate eGFR of ≥ 50mL / min] using the CKD-EPI Creatinine Equation (2021). Adequate hepatic function [total bilirubin ≤ 1.5 x UNL; AST (aspartate transaminase) or ALT (alanine transaminase) ≤ 3 x UNL or ≤ 5 x UNL if due to liver involvement by tumor. Negative pregnancy test for women of child-bearing potential (WOCBP) and males need to agree to use a highly effective method of contraception if not surgically sterile prior to study entry, while on drug, Attorney Docket No.11650-003WO1 and for 3 months' time after the last dose. Please refer to Appendix 1 for acceptable effective contraceptive methods. Subject who has predicted life expectancy of at least 12 weeks. Subjects meet one or more of the criteria below will be excluded: Lactating, pregnant, or intending to be pregnant. Received anti-cancer therapy or other investigational drugs within 4 weeks prior to the 1st dose of study drug. Patient in use of sensitive substrates of major cytochrome P450 enzymes and transporters based on FDA Drug Development and Drug Interactions, Table of Substrates, Inhibitors, and Inducers, or strong inducers of transporter, P-gp, including apalutamide, carbamazepine, enzalutamide, mitotane, phenytoin, rifampin, St. John’s wort. Patient in use of strong inhibitors of transporters based on based on FDA Drug Development and Drug Interactions, Table of Substrates, Inhibitors, and Inducers All acute toxic effect of any prior antitumor therapy not resolved to Grade 1 before the start of study therapy (with the exception of alopecia [G 1 or 2 permitted], neurotoxicity [Grade ≤ 2 permitted], or selected lab parameters [Grade < 2 permitted with exceptions noted below]. Has evidence of another malignancy not in remission or history of such a malignancy within the last 3 years (except for treated basal or squamous cell carcinoma of the skin, or in situ cancer of the cervix). Concomitant malignancies except carcinoma in situ, basal or squamous cell skin carcinoma; low grade prostate cancer treated with prostatectomy more than 5 years ago; early-stage melanoma treated with complete surgical excision more than 5 years ago; carcinoma in situ of cervix treated with cone procedure more than 8 years ago. Has primary brain cancer or symptomatic central nervous system (CNS) metastases, except where metastases are stable over a three-month period. Has unstable bleeding disorder or currently under non-established course of anticoagulant therapy (except for the use of heparinized saline to maintain the patency of central venous catheters). Has a medical history of symptomatic CHF (New York Heart Association [NYHA] classes II-IV) or serious cardiac arrhythmia requiring treatment. Has a medical history of myocardial infarction or unstable angina within 6 months before registration. Has a QTcF prolongation > 470 ms based on a 12-lead ECG in triplicate, or other abnormalities that in the opinion of the Investigator increase the risk of participating in the study. Has higher or equal to Grade 3 hypertension (≥ 160 / 100 mmHg) or ≤ 80 / 50 mmHg; has heart rate (HR) ≥ 100 beats per minute (bpm), or ≤ 45 bpm, confirmed by a repeat assessment. Has evidence of electrolyte imbalance such as hypokalemia, hypocalcemia, and hypomagnesaemia of NCI-CTCAE Grade ≥ 2 (symptomatic, intervention indicated). Major surgery besides tumor resection, within 4 weeks prior to screening. Has uncontrolled diabetes mellitus, neurologic or psychiatric condition, an ongoing systemic (including opportunistic) clinically significant infections or any other significant or unstable concurrent Attorney Docket No.11650-003WO1 medical illness that may increase the risk of study participants determined by Investigator. Has a known history of human immunodeficiency virus. References [1] Sung, H., Ferlay, J., Siegel, R. L., Laversanne, M., Soerjomataram, I., Jemal, A., & Bray, F. (2021). Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA: A Cancer Journal for Clinicians, 71(3), 209–249. [2] taal, S. P. (1987). Molecular cloning of the akt oncogene and its human homologues AKT1 and AKT2: amplification of AKT1 in a primary human gastric adenocarcinoma. Proc Natl Acad Sci U S A, 84(14), 5034-5037. [3] van de Sande, T., Roskams, T., Lerut, E., Joniau, S., van Poppel, H., Verhoeven, G., & Swinnen, J. V. (2005). High-level expression of fatty acid synthase in human prostate cancer tissues is linked to activation and nuclear localization of Akt / PKB. The Journal of Pathology, 206(2), 214–219. [4] Stål, O., Pérez-Tenorio, G., ÅKerberg, L., Olsson, B., Nordenskjöld, B., Skoog, L., & Rutqvist, L. E. (2003). Akt kinases in breast cancer and the results of adjuvant therapy. Breast Cancer Research, 5(2). [5] Kurose, K., Zhou, X. P., Araki, T., Cannistra, S. A., Maher, E. R., & Eng, C. (2001). Frequent Loss of PTEN Expression Is Linked to Elevated Phosphorylated Akt Levels, but Not Associated with p27 and Cyclin D1 Expression, in Primary Epithelial Ovarian Carcinomas. The American Journal of Pathology, 158(6), 2097–2106. [6] Uegaki, K., Kanamori, Y., Kigawa, J., Kawaguchi, W., Kaneko, R., Naniwa, J., Takahashi, M., Shimada, M., Oishi, T., Itamochi, H., & Terakawa, N. (2005). PTEN-positive and phosphorylated-Akt- negative expression is a predictor of survival for patients with advanced endometrial carcinoma. Oncology Reports. Published. [7] Massarelli, E., Liu, D. D., Lee, J. J., El-Naggar, A. K., lo Muzio, L., Staibano, S., de Placido, S., Myers, J. N., & Papadimitrakopoulou, V. A. (2005). Akt activation correlates with adverse outcome in tongue cancer. Cancer, 104(11), 2430–2436. [8] Rathmell, W. K., Wright, T. M., & Rini, B. I. (2005). Molecularly targeted therapy in renal cell carcinoma. Expert Review of Anticancer Therapy, 5(6), 1031–1040. https: / / doi.org / 10.1586 / 14737140.5.6.1031 [9] HORIGUCHI, A., OYA, M., UCHIDA, A., MARUMO, K., & MURAI, M. (2003). Elevated Akt Activation and Its Impact on Clinicopathological Features of Renal Cell Carcinoma. The Journal of Urology, 710–713. Attorney Docket No.11650-003WO1
[0010] Hager, G. L., McNally, J. G., & Misteli, T. (2009). Transcription Dynamics. Molecular Cell, 35(6), 741–753.
[0011] Kilanowska, A., & Studzińska, S. (2020). In vivoandin vitrostudies of antisense oligonucleotides – a review. RSC Advances, 10(57), 34501–34516. Example 5: In Vivo Efficacy Study of Test Articles in the Treatment of Subcutaneous Hepa 1-6 Murine Liver Cancer Model in Female C57BL / 6 Mice The objective of this study is to evaluate the in vivo therapeutic efficacy of test articles in the treatment of subcutaneous Hepa 1-6 murine liver cancer model in female C57BL / 6 mice. Materials: Female Mus musculus C57BL / 6. The mice were 7-8 weeks old. Mice were housed at a density of up to 5 mice per cage at a temperature of 20-26 °C, humidity of 40-70%, 12 hours of light and 12 hours dark, on a standard rodent chow diet, irradiated, ad libitum, and 0.2 µm filtered, reverse osmosis (RO) water, autoclaved. Mice were monitored daily cage side observations, and weekly clinical observations. Hepa 1-6 tumor cells were maintained in vitro with 10% fetal bovine serum in DMEM medium at 37°C in an atmosphere of 5% CO2. The tumor cells in an exponential growth phase were harvested and counted for tumor inoculation. Each mousewas inoculated subcutaneously at the right front flank region with Hepa 1-6 tumor cells (5 x 106) in 0.1 mL of PBS for tumor development. Experimental Treatment for Hepa 1-6 model study is shown in Table 28 below. Table 28. Treatment for Hepa 1-6 Model Study. Dose Level Dosing Dosing Dosing G Mi T t t / k S l ti V l ROA F & records. Change was under the approval of sponsor. Attorney Docket No.11650-003WO1 The randomization started when the mean tumor size reached approximately 81 mm3. A total of 48 mice were enrolled in the study and allocated into 6 groups shown in Table 4, with 8 mice per group. Randomization was performed based on "Matched distribution" method (Study Director TM software, version 3.1.399.19). The date of randomization was denoted as Day O. After tumor inoculation, the animals were checked daily for morbidity and mortality. During routine monitoring, the animals were checked for any effects of tumor growth and treatments on behavior such as mobility, food and water consumption, body weight gain / loss (body weights were measured twice per week after randomization), eye / hair matting, and any other abnormalities. Mortality and observed clinical signs were recorded for individual animals in detail. Tumor volumes were measured twice per week after randomization in two dimensions using a caliper, and the volume was expressed in mm3 using the formula: V = (L x W x W) / 2, where Vis tumor volume, L is tumor length (the longest tumor dimension) and W is tumor width (the longest tumor dimension perpendicular to L). Dosing as well as tumor and body weight measurements were conducted in a Laminar Flow Cabinet. The body weights and tumor volumes were measured by using Study Director™ software (version 3.1.399.19). Drug Formulation Adjust dosing volume for body weight (dosing volume= 10 µL / g) Dose Items Level Cone Pre aration Ph sical Attorney Docket No.11650-003WO1 Diluted 2ml lmg / mL RX0201(12:l) with 0.5ml Solution RX-0201(12:1) 10% sucrose to make 2.5ml 0.8mg / mL The treatment was initiated on the same day of randomization per study design (Table 4). Dosing of this Hepa 1-6 model study started from Day 0 through Day 21. All mice would be fed with Dietgel Recovery if>l0% mean BWL is observed in the therapeutic groups. To deter cannibalization, any animal exhibiting an ulcerated or necrotic tumor was separated immediately and singly housed and monitored daily before the animal was euthanized or until tumor regression was complete. Mouse with tumor ulceration of approximately 25% or greater on the surface of the tumor was euthanized. To compare tumor volumes of different groups at a pre-specified day, Bartlett's test was first used to check the assumption of homogeneity of variance across all groups. When the p-value of Bartlett's test is0.05, one-way ANOVA was ran to test the overall equality of means across all groups. If the p-value of the one-way ANOVA is <0.05, post hoc testing was further performed by running Tukey's HSD (honest significant difference) tests for all pairwise comparisons, and Dunnett's tests for comparing each treatment group with the vehicle group. When the p-value of Bartlett's test was <0.05, the Kruskal- Wallis test was ran to test the overall equality of medians among all groups. If the p-value of the Kruskal- Wallis test was <0.05, hoc testing was further performed post by running Conover's non-parametric test for all pairwise comparisons or for comparing each treatment group with the vehicle group, both with single-step p-value adjustment. All statistical analyses were done in R-a language and environment for statistical computing and graphics (version 3.3.1). All tests were two-sided unless otherwise specified, and p-values of <0.05 were regarded as statistically significant. For survival analysis, the survival time was analyzed by the Kaplan-Meier method. The survival time was defined as the time from the day of randomization until animal death or ethical endpoint. For each group, the median survival time (MST) and the increase in life-span (ILS) were calculated. The Kaplan-Meier curves were also constructed for each group and the log-rank test was used to compare survival curves between groups. Results Attorney Docket No.11650-003WO1 The results of body weights and body weight changes at different time points are shown in Figures 5 and 6, respectively. In this study, although most of the mice showed slight or medium body weight loss after the treatment, they could recover gradually during the dosing interval. G4-118 mouse was sacrificed and GS- 197 mouse was found dead on Day 9. The maximum mean body weight loss in Negative control, Empty LNP, RX-0201 (8 mg / kg), RX-0301(15:1) (8 mg / kg), RX-0301(12:1) (8 mg / kg), RX-0301(10:1) (8 mg / kg) and RX-0301(7.5:1) (8 mg / kg) (dosing started from Day 0) treated groups was respectively none, - 13.91% (on Day 2), none, -13.39% (on Day 2), -16.13% (on Day 3), -13.37% (on Day 2) and-10.71% (on Day 2). The mean tumor growth curves at different time points are shown in Figure 7. The tumor growth inhibition of test articles in the treatment of subcutaneous Hepa 1-6 human liver cancer model in female C57BL / 6 mice is summarized in Table 29 below. Table 29. Antitumor Activity of Test Articles in Hepa 1-6 Model. Tumor Size (mm3) TIC(%) on TGI(%) p Group Treatment Description on Day 30 Day30 on Day 30 valueb 1 Negative control, 10 µL / g, i.v., 1470.17±254.64 QW 2 Empty LNP, 0 mg / kg, i.v., QW 1079.62±247.35 73.44 26.56 0.874 RX-0201, 8mg / kg, i.v., QW 1421.44±122.38 96.68 3.32 1 3 4 RX-0301(15:1), 8mg / kg, i.v., QW 1059.51±186.08 72.07 27.93 0.858 5 RX-0301(12:1), 8mg / kg, i.v., QW 854.64±70.77 58.13 41.87 0.522 RX-0301(10:1), 8mg / kg, i.v., QW 910.15±181.46 61.91 38.09 0.582 6 7 RX-0301(7.5:1), 8mg / kg, i.v., QW 791.55±369.62 53.84 46.16 0.0561 Note: a. Mean± SEM; b. compared with group 1 tumor volume on Day 30. The detailed statistical analysis for multiple comparison on Day 30 is shown below. Attorney Docket No.11650-003WO1 In this study, the mean tumor size of the negative control mice reached 1470.17 mm3on Day 30 post randomization. Empty LNP administered at 0 mg / kg, QW, produced slight anti-tumor efficacy against Hepa 1-6 model, with a TGI value of 26.56% on Day 30, however no statistically significant difference (P>0.05) was observed compared with control group. RX-0201 administered at 8 mg / kg, QW, produced slight anti-tumor efficacy against Hepa 1-6 model, with a TGI value of 3.32% on Day 30, however no statistically significant difference (P>0.05) was observed compared with control group. Attorney Docket No.11650-003WO1 RX-0301(15:1) administered at 8 mg / kg, QW, produced slight anti-tumor efficacy against Hepa 1- 6 model, with a TGI value of 27.93% on Day 30, however no statistically significant difference (P>0.05) was observed compared with control group. RX-0301(12:1) administered at 8 mg / kg, QW, produced slight anti-tumor efficacy against Hepa 1- 6 model, with a TGI value of 41.87% on Day 30, however no statistically significant difference (P>0.05) was observed compared with control group. RX-0301(10:1) administered at 8 mg / kg, QW, produced slight anti-tumor efficacy against Hepa 1- 6 model, with a TGI value of 38.09% on Day 30, however no statistically significant difference (P>0.05) was observed compared with control group. RX-0301(7.5:1) administered at 8 mg / kg, QW, produced slight anti-tumor efficacy against Hepa 1- 6 model, with a TGI value of 46.16% on Day 30, however no statistically significant difference (P>0.05) was observed compared with control group. Survival Analysis Survival time was assessed by time to tumor volume reaching 3000 mm3,the data were analyzed using Kaplan-Meier survival curves and shown in Table 30 and Figure 8. Table 30. Survival Analysis of Test Articles in Hepa 1-6 Model. Group Treatment Description MST (days) ILS (%) p value Ne ative control 10 L / iv 37 The detailed statistical survival analysis for multiple comparisons is shown below: Attorney Docket No.11650-003WO1 In this study, the also investigated. Mice whose tumor volume exceeded 3000 mm3were euthanized. RX-0301(7.5:1) showed significant efficacy in prolonging the survival time of Hepa 1-6 tumor-bearing mice while other test articles did not. The tolerability and efficacy of test articles in subcutaneous Hepa 1-6 liver cancer model in female C57BL / 6 mice were investigated in this study. In summary, Hepa 1-6 tumor-bearing mice were well tolerated during the 4-week dosing phase with the designed dosing regimens. The tumor volume statistical analysis was conducted based on the data on Day 30 when all the animals were alive or did not meet the exclusion criteria of exceeding 3000 mm3tumorvolume. The TGI¾ of EmptyLNP, RX-0201 (8 mg / kg), RX-0301(15:1) (8 mg / kg), RX-0301(12:1) (8 mg / kg), and RX-0301(10:1) (8 mg / kg), and RX-0301 (7.5:1) (8 mg / kg) groups were 26.56%, 3.32%, 27.93%, 41.87%, 38.09%, and 46.16% on Day 30 compared to vehicle control, respectively. There were no significant differences between the treated groups and the vehicle control group. The experiment was terminated on Day 56 to study the survival prolongation effects of the test articles. RX-0301 (7.5:1) (8 mg / kg) group showed significant efficacy in prolonging the survival time compared to the vehicle control group and RX-020 I-treated group in Hepa 1-6 tumor-bearing mice. Attorney Docket No.11650-003WO1 Example 6: Free acid of archexin: effects on electric current passing through cloned herg potassium channels stably expressed in human embryonic kidney (hek293) cells using manual patch-clamp technique The objective of this study was to evaluate the in vitro concentration-response relationship of the effect of Free Acid of Archexin on the electric current passing through hERG (human ether a-go-go- related gene) potassium channels (a surrogate for IKr, the rapidly activating, delayed rectifier cardiac potassium current) stably expressed in a HEK293 cell line using manual patch clamp technique. Free Acid of Archexin is the active pharmaceutical ingredient; the concentration of test article in this report indicates the concentration of Free Acid of Archexin. Free Acid of Archexin was soluble in extracellular solution (ECS) at concentrations up to 300 µM without precipitate by visual check. The pH value of ECS containing the highest concentration of Free Acid of Archexin was 6.9, which was within the target range of 6.5 to 7.8. No pH adjustment was required in the treatment medium. A dose range-finding assay was performed first to support the dose selection for the definitive assay. The definitive hERG assay was used to determine the ICso of Free Acid of Archexin. ECS was chosen as the solvent based on the solubility of Free Acid of Archexin. In the dose range-finding assay, 3, 30, and 300 µM of Free Acid of Archexin working solutions were prepared. No precipitate was observed by visual check at any concentration. Three concentrations at 3, 30, and 300 µM with duplicate cells for each concentration were used to evaluate the effects of Free Acid of Archexin on hERG current. Free Acid of Archexin inhibited hERG current by 5.99%, 6.63%, and 11.69% at 3, 30, and 300 µM, respectively. Therefore, the concentrations selected for the definitive hERG assay were 10, 30, 100, and 300 µM with the determined concentrations in the postperfusion solutions at 9.591, 26.85, 105.6, and 274.1 µM, respectively. In definitive hERG assay, the working solutions thereof were analyzed. The measured concentration of the samples for concentration verifications were within 82% to 104% of the nominal values, and the measured concentration of the samples for homogeneity were within 98% to 102% of the nominal values. RSD ( relative standard deviation) values were within the acceptance criteria. No Free Acid of Archexin was detected in the vehicle / negative control working solution. In the current study, hERG currents were stable for at least 15 min in the negative control. Inhibition of positive control, terfenadine at 100 nM, on the hERG current was 78.84%, which was within the historical positive control data range. The seal criteria, current amplitude, and leak criteria met the pre-defined ranges. All these data demonstrated the validity of this assay. Attorney Docket No.11650-003WO1 In the definitive hERG assay, three replicate cells were used for each concentration of Free Acid of Archexin; no precipitate was observed in any concentration. Under the conditions of this study, the ICso value for the inhibitory effect of Free Acid of Archexin on hERG potassium current was not determined and no inhibitory effect of Free Acid of Archexin on hERG potassium current was observed at concentrations of postperfusion solutions up to 274.1 µM. The objective of this study was to evaluate the in vitro concentration-response relationship of the effect of Free Acid of Archexin on the electric current passing through hERG (human ether-a-go-go- related gene) potassium channels (a surrogate for IKr, the rapidly activating, delayed rectifier cardiac potassium current) stably expressed in a HEK293 cell line using manual patch-clamp technique. Materials and Methods Rationale for Selection of Ion Channel and Expression System The cardiac hERG potassium channel is responsible for a rapid delayed rectifier current (IKr) in human ventricles. Inhibition of IKr is the most common mechanism of the increase in ventricular action potential duration evoked by non cardiac drug. The increased action potential duration causes prolongation of the QT interval in the electrocardiogram that is associated with a dangerous ventricular arrhythmia, torsade de pointes. Therefore, testing the interaction of a compound with the hERG potassium channel in heterologous expression systems is recommended by the International Conference on Harmonisation (ICH) as one of the non-clinical testing methods for assessing the potential of a test compound for prolonging the QT interval. In this study, hERG channels were stably expressed in Human Embryonic Kidney (HEK293) cells. The Human Embryonic Kidney cell line, HEK293-hERG was employed in this assay. HEK293-hERG cells were obtained from Sophion Biosciences BPS Biosciences (San Diego, CA), subcultured and frozen in WuXi AppTec (Suzhou) Co., Ltd. The cell stocks were stored in liquid nitrogen. Every batch of the cell stocks was tested and determined to be free from mycoplasma contamination. Cells were not used after the 20th passage. Medium and Cell Culture Condition Complete medium was MEM medium, supplemented with 10% fetal bovine serum, 1% non- essential amino acids, 1 mM Na pyruvate, 400 µg / mL Geneticin@ selective antibiotic (G418), and 1% Penicillin / Streptomycin. Recovery medium was MEM medium with 10% fetal bovine serum, 1% non- essential amino acids, and 1 mM Na pyruvate. HEK293-hERG cells were cultured in a humidified incubator of5% CO2 (4% to 8%) in air at 37°C (±2°C). Attorney Docket No.11650-003WO1 The cells were recovered with recovery medium and subcultured in complete medium. The culture medium was switched to recovery medium in the last subculture before patch-clamp experiment. Solubility and pH Tests Test article was soluble in ECS at concentrations up to 300 µM. The pH of the ECS containing the highest soluble concentration was 6.9 in the pH test, which was within the range of 6.5 to 7.8. Dose Range-finding Assay In the dose range-finding assay, three concentrations of test article working solutions at 3, 30, and 300 µM. A visual check for precipitation was performed before testing. Three concentrations at 3, 30, and 300 µM were tested to evaluate the effect on hERG current, and two replicate cells for each concentration were tested. Preparation of Target Cells Exponentially growing HEK293-hERG cells was collected and suspended in ECS for use. Manual Patch-clamp Setup The hERG current was recorded at physiological temperature (33°C - 37°C) using whole-cell patch-clamp techniques. Output signals from the patch clamp amplifier were digitized and low-pass filtered at 2.9 KHz. The recording was controlled with Patchmaster Pro software. The recording chamber with cells seeded was mounted on an inverted microscope stage. A cell in the recording chamber was randomly picked up for testing. The cell was continuously perfused from the perfusion system. A micropipette filled with ICS was used as recording electrode in the manual patch-clamp study. The micropipette was prepared on the day of the patch clamp experiment using glass capillaries (BF150- 117-10, SUTTER INSTRUMENT USA). The pipette resistance (Rp) was within 2 to 5 MO with ICS filled. The cells were voltage clamped at a holding potential of -80 mV. The hERG current was activated by depolarizing at +60 mV for 850 ms, after which the current was taken back to -50 mV for 1275 ms to remove the inactivation and to observe the deactivating tail current; the peak tail current was measured and collected for data analysis. Finally, the voltage was decreased to the holding potential (-80 mV). This command voltage protocol was repeated every 15 s continuously during the test article application. See Figure 9. During the initial recording period with vehicle control working solution, the peak tail current amplitude was monitored until it was stable for at least 10 sweeps. The average peak tail current Attorney Docket No.11650-003WO1 amplitude of the last 5 sweeps during the monitored period was used as current amplitude for vehicle control working solution (initial current). Then test article perfusion was started with the low concentration and continued until the peak tail current amplitude was again stable for at least 10 sweeps and the duration was at least 5 minutes. Then a higher concentration of test article working solution was applied. The averaged peak tail current amplitude of last 5 sweeps of each concentration was taken as the peak tail current amplitude of the concentration for data analysis. Definitive hERG Assay In the definitive hERG assay, four concentrations of test article working solutions at 10, 30, 100, and 300 µM were tested based on the results of dose range-finding assay. A visual check for precipitation was conducted before testing. Three replicate cells for each concentration were tested. Preparation of target cells were performed as described in the dose range finding assay. Manual patch- clamp setup was performed as described in the dose range finding assay. The positive and negative controls were evaluated in the definitive assay. Negative Control Group The negative control was conducted in a separate group of cells (three cells) to evaluate the current stability (run-down or run-up) during at least 15 min recording period. The average peak tail current amplitude of the last five sweeps of every 5 min was used to evaluate current run-down or run- up. All the values were normalized to that of first 5 min and were presented as percentages. Less than 15% current during run-down or run-up measurement period was considered acceptable. Positive Control Terfenadine was used as the positive control article to evaluate the validity of the test system. The final working solution of positive control article at 100 nM was prepared for this study. The positive control was tested with 3 cells. The inhibition ratio for the positive control should be comparable with the historical positive control data range, to ensure the consistent responsiveness of the test system. Quality Control for Manual Patch-clamp Data Acceptance Seal criteria: When acquiring whole-cell configuration, a holding potential (e.g., -80 mV) was applied while membrane parameters were collected (Cm, Rm and Rs). A "good" whole-cell recording is generally defined as: series resistance (Rs) was less than 10 MΩ; membrane resistance (Rm) was greater than 500 MΩ, and membrane capacitance (Cm) was less than 100 pF. Attorney Docket No.11650-003WO1 Current amplitude criteria: The peak current amplitude must be between 400 pA and 5000 pA before the test article / positive control application; otherwise the cell was discarded. Leak criteria: At -80 mV holding potential, the absolute leak current value must be less than 200 pA. The amplitude of current was adjusted with leak current at -80 mV. The sweeps that absolute leak current value was greater than 200 pA was not used in data analysis. Data In each cell, the percent inhibition values for each test article / positive control concentration were calculated according to the formula: (1 - peak current amplitude with test article / positive control working solution perfusion / peak current amplitude with vehicle control working solution perfusion (initial current)) x100%. The percent inhibition values from all recorded cells were averaged. The final ICso value for test article was determined from the Concentration-Response curve with Hill fitting in Origin software. y= the average of percent inhibition values from all recording cells; where Vmax=100%; x= the test article postperfusion working solution concentration; n= Hill coefficient; and k= the concentration of test article at 50% inhibition. Data was presented as mean ± SEM. Data was presented as mean ± SEM. where SD is x = average (numberl, number2... ); n = Acceptance Criteria CV of the peak tail current amplitude of vehicle control for the last 10 continuous sweeps during the monitored period is less than 10% to rule out initial run down or run up. Attorney Docket No.11650-003WO1 The stable current amplitude is defined as the CV of peak current amplitudes in 10 continuous sweeps that is less than 10% or less than 30% if the average current amplitude of the 10 sweeps is less than 200 pA. If an average of percent inhibition value is less than 70%, the Standard Deviation (SD) of percent inhibition values from different recorded cells must be less than 15%. If the average of percent inhibition value is over 70%, the SD of percent inhibition values from different recorded cells must be less than 10%. Results Solubility and pH Tests Test article was soluble in ECS at concentrations up to 300 µM, no precipitate was observed at any concentration by visual check. The pH value for the ECS containing 300 µM of test article was 6.9 in the pH test, which was within the acceptable range of 6.5 to 7.8. Therefore, no pH adjustment was required in the treatment medium. Working and Postperfusion Solutions Analyses In the definitive hERG assay: The Free Acid of Archexin concentration in the vehicle / negative control working solution was below the Limit of Quantificationx Dilution Factor, which demonstrated the absence of Free Acid of Archexin in the vehicle / negative control working solution. The concentrations of Free Acid of Archexin in the working solutions at 10, 30, 100, and 300 µM were verified by concentration analysis (all were within 82% to 104% of nominal concentrations), confirming that the test article working solutions were accurately prepared. The homogeneities of Free Acid of Archexin in the working solutions at 10 and 300 µM were verified by homogeneity analysis (all were within 98% to 102% of nominal concentrations, and the RSD of top, middle, and bottom samples were all within 1% to 2% for both formulations), suggesting that the test article working solutions were homogeneous. The actual concentrations of postperfusion solutions were 9.591, 26.85, 105.6, and 274.1 in corresponding to the working solutions at concentrations of 10, 30, 100, and 300 µM, respectively. Dose Range-finding Assay In the dose range-finding assay, three concentrations at 3, 30, and 300 µM were tested to evaluate the effect of Free Acid of Archexin on hERG current, and two replicate cells for each concentration were tested. The results of hERG current inhibition are provided in Table 31. Mean current inhibitions of 5.99%, 6.63%, and 11.69% were observed at 3, 30, and 300 µM, respectively. Table 31. Free Acid of Archexin: hERG Current Inhibition in the Dose Range-finding Assay. Attorney Docket No.11650-003WO1 The Definitive Assay Based on the results of dose range-finding assay, the concentrations of test article working solutions selected for the definitive hERG assay were 10, 30, 100, and 300 µM. The hERG current inhibition data for the negative control are presented in Table 32; the hERG current inhibition data for the positive control are presented in Table 33. The concentration-response curve of Free Acid of Archexin is shown in Figure 10; and the hERG current inhibition data for Free Acid of Archexin are presented in Table 34. Table 32. hERG Current Stability of Negative Control in the Definitive hERG Assay. Table 33. Terfenadine: hERG Current Inhibition in the Definitive hERG Assay. Attorney Docket No.11650-003WO1 Negative Control The negative control was tested in a separate group of cells (three cells) to evaluate the current stability (run-down or run-up) during at least 15 min recording period. The results indicated that no significant current run-down or run-up was observed during the recording period. Positive Control (Terfenadine) Attorney Docket No.11650-003WO1 Three replicate cells for the positive control, terfenadine at 100 nM, were tested. No precipitate was observed at any concentration. Inhibition of 100 nM terfenadine on the hERG current was 78.84%, which was within the historical positive control data range and demonstrated the validity of this assay. Free Acid of Archexin Three replicate cells for each concentration of Free Acid of Archexin were tested. No precipitate was observed at any concentration. The ICsovalue of Free Acid of Archexin on hERG current was greater than 274.1 µM based on the actual concentrations of postperfusion solutions. Conclusion In the current study, hERG currents were stable for at least 15 min in the negative control. The inhibition of 100 nM terfenadine on hERG current was 78.84%, which was within the historical positive control data range. The seal criteria, current amplitude, and leak criteria met the pre-defined ranges, demonstrating the validity of this assay. Under the conditions of this study, the ICso value of Free Acid of Archexin on hERG current inhibition was greater than 274.1 µM based on the actual concentrations of postperfusion solutions. Example 7: WGI-0301 plus Sorafenib Advanced HCC Indication Hepatocellular carcinoma (HCC) is the most common type of liver cancer in adults in the United States. It is a primary malignancy of the liver and occurs in ~90% of patients with cirrhosis, with 5-yr survival rates remaining low (22% overall; 3.5% for those with metastatic disease). The prominent risk factors for HCC include chronic infection with hepatitis B or C virus, alcoholic liver disease and non- alcoholic fatty liver disease or non-alcoholic steatohepatitis [1]. As of January 1, 2020, there were 102,997 (<0.1 % of population) people alive with liver and intrahepatic bile duct cancer in the US. And the death rates from liver and intrahepatic bile duct cancer between 2016-2020 was 6.6 per 100,000 population. In 2023, the estimated number of new cases is 41,210 and the estimated deaths is 29,380 [2]. There are several factors that limit therapeutic efficacy, including reduced liver function, and the chemotherapy- refractory nature of the tumor, and the high-rate expression of drug resistance genes [3]. Meanwhile, HCC is a highly vascular tumor in which angiogenesis plays a major role in tumor growth and metastasis [4]. The proposed clinical use of WGI-0301 is to treat advanced HCC as a second line treatment for patients who failed frontline immunotherapies (IOs) in combination with Tyrosine Kinase Inhibitor (TKI), Attorney Docket No.11650-003WO1 Sorafenib. Immunotherapy or immunotherapy combinations with better efficacy data has gradually taken over the crown of first line Advanced HCC setting in recent years. However, these patients who receive IO or IO combination therapy may ultimately fail or become intolerant to the frontline therapies, and there is limited, strong clinical evidence based sequential and beyond therapy options for such patients. At the point of current submission, this investigation has been granted Orphan Drug Designation by the FDA on September 20th, 2023. Combination use of WGI-0301 plus Sorafenib The study is to determine the MTD of WGI-0301 when combined with Sorafenib for advanced HCC and to assess the safety and efficacy of WGI-0301 in combination with Sorafenib for the treatment of advanced unresectable HCC in adults who have previously received PD-1 / PD-L1 immune checkpoint inhibitor. The study rationale for evaluating combination of WGI-0301 and Sorafenib as compared with Sorafenib alone in patients with advanced HCC is as follows: Treatment of advanced HCC who have previously received PD-1 / PD-L1 immune checkpoint inhibitor remains a high-unmet medical need. Systemic treatment plays an important role in the treatment of advanced HCC. The previous standard first-line systemic treatments for advanced HCC were only Sorafenib and Lenvatinib. However, the rapid evolution of immunotherapy and molecular targeted therapy has changed the systemic treatment strategies for advanced HCC. The second-line systemic treatments include Regorafenib, Cabozantinib, and Ramucirumab. All the current options were approved for the patients who were previously treated with Sorafenib. The treatment landscape for advanced HCC following disease progression or toxicity after first-line therapy is different from before. The combination of Atezolizumab withBevacizumab (Atezo-Bev) is currently the first choice first-line treatment, as it confers a superior survival benefit compared to Sorafenib[5]. There are few data to guide the selection of second-line therapy in patients who progress on first-line IO therapy. For patients who have previously received PD- 1 / PD-L1 immune checkpoint inhibitor, and sufficiently preserved liver function, the best way to sequence the available systemic treatment options has not been established. Therefore, an ongoing high-unmet medical need remains for patients with advanced HCC who progressed on immunotherapy or did not tolerate immunotherapy agents. Sorafenib is an important therapeutic advance as a single agent in advanced HCC. Sorafenib has a well-studied safety profile and excellent patient access with many years of clinical use. It is the first systemic treatment that has shown overall survival (OS) benefit over placebo in Attorney Docket No.11650-003WO1 HCC patients validated through randomized controlled trial [6]. For more than a decade, it was used in the treatment of advanced HCC globally. However, the combination of Atezo-Bev or Durvalumab- Tremelimumab exhibited superior OS outcomes over Sorafenib [5,7]. Sorafenib becomes an alternative option of first- line therapy for patients with contraindication or limited access to Atezo-Bev or Durvalumab-Tremelimumab, or empirical use as second-line therapy after IO treatment. As is shown in some retrospective studies with small sample size, Sorafenib can potentially provide moderate survival benefits over placebo in patients with advanced HCC after disease progression on Atezo-Bev [8]. Aside from empirical use, there is no established role of Sorafenib-combinations regimens as second-line therapy in patients who progress on first-line IO therapy. The Combination of WGI-0301 and Sorafenib has shown potential synergistic anti-tumor activity in HCC. WGI-0301 has the potential to enhance Sorafenib’s anti-tumor effect through various mechanisms of action (MoA). Synergistic effects have been observed with the co- administration of WGI-0301 and Sorafenib in preclinical models, resulting in enhanced inhibition of angiogenesis and augmentation of tumor growth suppression. This combination therapy has garnered attention due to the absence of significant cytochrome P450 enzyme interaction by WGI-0301, suggesting a reduced likelihood of pharmacokinetic drug-drug interactions with concurrent Sorafenib treatment. Preliminary assessments posit the safety and efficacy of the WGI-0301 and Sorafenib combination, a promising candidate for advanced HCC treatment, particularly in patients who have developed resistance to PD- 1 / PD-L1 inhibitors. The ongoing investigations into this combination therapy may offer a new horizon for HCC management, marking a significant stride in the quest for more effective cancer therapeutics. The Combination of WGI-0301 and Sorafenib may provide mechanisms to overcome Sorafenib resistance Sorafenib remains a cornerstone treatment in HCC that is supported by robust evidence and clinical experience. Unfortunately, the development of drug resistance to Sorafenib is becoming increasingly common through compensatory activation of the PI3K / AKT pathway. Resistance is a complex phenomenon involving multiple mechanisms, including activation of signaling pathways such as phosphatidylinositol 3-kinase (PI3K) / AKT / mammalian target of rapamycin (mTOR). Sorafenib can activate the PI3K / AKT pathway, and the potential compensation mechanism presented by the PI3K / AKT pathway can cause Sorafenib resistance in HCC patients [9]. Current preclinical and clinical evidence suggests that inhibitors of the PI3K / AKT / mTOR pathway could have utility in combination with other anticancer therapies to circumvent resistance by cancer cells
[0010] . Dual Attorney Docket No.11650-003WO1 blockade with an AKT-1 inhibitor might prevent or delay the development of resistance. Therefore, there is also an opportunity to explore whether a different combination of treatment can overcome Sorafenib resistance and improve response among HCC patients, and WGI-0301 with Sorafenib as a combination treatment strategy is worth further investigation. Indication Combination of WGI-0301 and Sorafenib will be studied in patients with advanced HCC who have previously received PD-1 / PD-L1 immune checkpoint inhibitor therapy. General Approach This study will investigate if the combination of WGI-0301 with Sorafenib can improve the clinical outcome for patients with advanced HCC in the second line setting. It follows a two-stage design, consisting of a Dose Escalation Stage (Stage 1: advanced HCC patients) and a Dose Expansion Stage (Stage 2: advanced HCC patients who have received up to one line of immunotherapy). Stage 1 will use “Traditional 3 + 3” study design to explore the MTD / RP2D of WGI-0301 when combined with Sorafenib, and to evaluate the PK, PD, safety, tolerability and preliminary efficacy of the combination therapy for advanced HCC. The starting dose of WGI-0301 is 0.6 mg / kg / week with 400 mg Sorafenib PO, BID. During Stage 1, three dose levels of WGI-0301, 0.6, 1.0 and 1.3 mg / kg / week, combined with Sorafenib are planned. Once MTD / RP2D of WGI-0301 is determined from Stage 1 by Safety Monitoring Committee (SMC), Stage 2 will start once. In Stage 2, patients will be treated with combination of different WGI-0301 dose levels and standard dose Sorafenib or standard dose Sorafenib alone in a 2:2:1 ratio to evaluate the safety and efficacy in patients with advanced HCC who have previously received up to one line of PD-1 / PD- L1 immune checkpoint inhibitor or combination in the first line setting. Stage 1 and Stage 2 will be conducted in both the US and China. The US sites will start Stage 1 once approved by FDA regardless of China segment status. Study will be conducted in a competing enrollment manner when more than 1 site is activated. Kinds of Clinical Trials to be Conducted in the First Year Following Submission An open-label phase 2 study of WGI-0301 plus Sorafenib in patients with advanced HCC as second line therapy will be conducted in the U.S. and China. The US sites will start Stage 1 once approved by FDA regardless of China segment status. Study will be conducted in a competing enrollment manner when more than 1 site is activated. Stage 2 will start once the MTD / RP2D of WGI- 0301 in combination with Sorafenib is determined from Stage 1 by SMC. Estimated Number of Patients Attorney Docket No.11650-003WO1 Approximately 9 to 18 subjects will be enrolled in Stage 1, and approximately 50 subjects will be enrolled in Stage 2. Risks A total of 11 patients with advanced solid tumors were enrolled in the currently ongoing WGI- 0301 monotherapy phase 1 clinical study (WGI0301P1U, NCT05267899) as of October 30, 2023. The dose escalation is ongoing without any findings of DLT up to 0.6 mg / kg / week dose level. The most frequently observed AEs (≥ 20% patients) in the WGI-0301 monotherapy clinical trials (WGI0301P1U) were dehydration, anemia, infusion-related reaction, and hyperglycemia, regardless of causality. No Grade 3 or above treatment related adverse events (TRAE) or treatment related serious adverse events identified to date. Subsequent clinical trial data will continue to be collected and closely monitored to establish the safety profile of the WGI-0301. Infusion Reactions For infusion reactions, it is critical for clinical staff to recognize and differentiate against anaphylactic reactions. While both reactions may have overlapping features, anaphylaxis involves respiratory compromise (like wheezing, difficulty breathing, or cyanosis), reduced blood pressure, or end- organ dysfunction, which are not typically seen with standard infusion reactions. As of October 30, 2023, there are 3 out of 11 (27.3%) subjects in the safety analysis dataset developed mild to moderate infusion reaction without any pre-treatments. For events related to WGI-0301, class adverse events of LNP infusion product that may occur during or shortly after the administration of an LNP-containing therapy based on severity of symptoms, absence of respiratory function loss, respond to treatment (steroids and antihistamines) was lean towards. The exact cause of infusion reactions to LNP products is not always clear, but it is thought that they may result from the body’s immune response to the LNP itself or the payload delivered by the LNP. The components of the LNP formulation, such as the lipid mixture, may also play a role in these reactions. To minimize chances of developing such events, prophylaxis regimen was proposed containing corticosteroids, antihistamines, with or without nonsteroidal anti- inflammatory drugs, which has been utilizing during phase I study recommended by SMC committee. A serum tryptase test will also be implemented to help excluding anaphylaxis. However, the site should remain alert on differentiating anaphylaxis and infusion reactions with emergency medications and equipment on hand. Liver Toxicity For liver toxicity, clinically significant liver function tests (LFTs) elevation has not been captured during Phase I study as of 30Oct2023. In addition, the incidence of severe drug-induced liver injury, defined Attorney Docket No.11650-003WO1 as elevated transaminase levels above 20 times the upper limit of normal or transaminase elevations with significant clinical sequelae (for example, elevated INR, ascites, fatal, or transplantation), was two of 3,357 patients (0.06%) in a global Sorafenib monotherapy database. However, to treat advanced HCC patients with WGI-0301 and Sorafenib, it is vital to maintain a careful balance between therapeutic efficacy and hepatotoxic potentials, even with Child-Pugh Liver Function Class A patients. Hence, the study will implement frequent LFTs to capture any early signals with clinical evaluation. Once elevated LFT identified, investigators should address any significant elevations in liver enzymes or bilirubin levels by interrupting treatment or reducing the dose promptly as outlined in section 6.2 of study protocol. Immunogenicity There are no known antibodies forming or immunological reactions in response to administration of oligonucleotides. In Phase 1 and 2 clinical trials of Archexin, immunogenic activity was not detected in patients. However, WGI-0301 is the LNP encapsulated version of Archexin, the immunogenicity of encapsulated API and Lipid Nanoparticle itself are planned to be tested during the study. The assay used to measure binding and neutralizing antibodies is under development. Once validated, collected samples will be tested for immunogenicity in the proposed study. Immune Related Adverse Events For immune related adverse events (irAEs), special attention was implemented in the FIH study of WGI-0301 including halt rules and management plan. However, no immune related adverse events nor cytokine release syndrome have been reported up to date. Due to the complex nature of the dose relationship, as the immune system’s response to therapy is not always predictable, careful monitoring of all patients’ receiving immunotherapy is critical, regardless of the dose. Dose adjustments, treatment pauses, or discontinuation, along with the use of corticosteroids or other immunosuppressants, are common strategies to manage irAEs when they occur. Hyperglycemia For hyperglycemia, reports have been noticed across other cancer therapeutics targeting the PI3K / AKT pathway. This pathway plays a crucial role in controlling insulin sensitivity and glucose metabolism
[0011] . As a result, hyperglycemia is one of the most common on-target adverse effects of PI3K / AKT inhibitors. The management of this side effect is vital, ADA guideline or other local guideline should be followed based on current experience and consensus for such treatment induced hyperglycemia. Other or Sorafenib related risks Attorney Docket No.11650-003WO1 For other potential risks of the combination like gastrointestinal reactions, abdominal pains, fatigue or other non-specific adverse events, all efforts should be made to collect, report, and manage. For risks outlined in label of Sorafenib, the most common side effects observed in at least 20% of patients which were considered related to Sorafenib include fatigue, weight loss, rash / desquamation, hand-foot skin reaction, alopecia, diarrhea, anorexia, nausea, and abdominal pain. For additional risks associated with patients taking sorafenib, please refer to the sorafenib prescribing information. References 1. Asafo-Agyei, Kwabena O. “Hepatocellular Carcinoma.” StatPearls - NCBI Bookshelf, 12 Feb. 2023. 2. SEER*Explorer Application. seer.cancer.gov / statistics- network / explorer / application.html?site=35&data_type=5&graph_type=12&compareBy=sex &chk_sex_1=1&chk_sex_3=3&chk_sex_2=2&series=9&race=1&age_range=1&prev_durati on=1&advopt_precision=1&hdn_view=1&advopt_show_apc=on&advopt_display=2. 3. Marin, Jose J. G., et al. “Molecular Bases of Drug Resistance in Hepatocellular Carcinoma.” Cancers, vol.12, no.6, MDPI, June 2020, p.1663. 4. Yang, Zhen, and Ronnie T. P. Poon. “Vascular Changes in Hepatocellular Carcinoma.” Anatomical Record-advances in Integrative Anatomy and Evolutionary Biology, vol.291, no.6, Wiley, June 2008, pp.721–34. 5. Finn RS, Qin S, Ikeda M, et al. Atezolizumab plus Bevacizumab in Unresectable Hepatocellular Carcinoma. N Engl J Med.2020 May 14.382(20):1894-1905. 6. Llovet JM, Ricci S, Mazzaferro V, et al. SHARP Investigators Study Group. Sorafenib in advanced hepatocellular carcinoma. N Engl J Med.2008 Jul 24.359(4):378-90. 7. Abou-Alfa GK, Chan SL, Kudo M et al. Phase 3 randomized, open-label, multicenter study of Tremelimumab (T) and Durvalumab (D) as first-line therapy in patients (pts) with unresectable hepatocellular carcinoma (uHCC): HIMALAYA. J Clin Oncol 2022.40(4Suppl.):379. 8. Yoo C, Kim JH, Ryu MH et al. Clinical Outcomes with Multikinase Inhibitors after Progression on First-Line Atezolizumab plus Bevacizumab in Patients with Advanced Hepatocellular Carcinoma: A Multinational Multicenter Retrospective Study. Liver Cancer.2021 Apr;10(2):107-114.[6] Neeraj Agarwal, Sumanta K. Pal, Richard C, et al. Results of a phase II study to evaluate the safety and efficacy of RX-0201 in combination with everolimus in subjects with metastatic renal cell carcinoma (mRCC). J Clinical Oncol 37:646–646. 9. Manning BD, Toker A. AKT / PKB Signaling: Navigating the Network. Cell.2017 Apr Attorney Docket No.11650-003WO1 20;169(3):381-405. 10. Fruman DA, Chiu H, Hopkins BD, et al. The PI3K Pathway in Human Disease. Cell.2017 Aug 10;170(4):605-635. 11. Huang X, Liu G, Guo J, et al. The PI3K / AKT pathway in obesity and type 2 diabetes. Int J Biol Sci.2018 Aug 6;14(11):1483-1496. doi: 10.7150 / ijbs.27173. 12. Qin, Shukui, et al. “Pembrolizumab Versus Placebo as Second-Line Therapy in Patients From Asia With Advanced Hepatocellular Carcinoma: A Randomized, Double-Blind, Phase III Trial.” Journal of Clinical Oncology, vol.41, no.7, American Society of Clinical Oncology, Mar.2023, pp. 1434–43. 13. “American Cancer Society | Cancer Facts and Statistics.” https: / / cancerstatisticscenter.cancer.org / data-analysis / 91Q4dqjU 14. “American Cancer Society | Cancer Facts and Statistics.” https: / / cancerstatisticscenter.cancer.org / data-analysis / dw1qthUo Example 8: In Vivo efficacy evaluation of WGI-0301 combined with Tyrosine Kinase Inhibitors (TKIs) (Lenvatinib or Sorafenib or Cabozantinib) in the treatment of human hepatocellular cancer Hep3B-luc orthotopic model in the female Balb / c nude mice Archexin is a fully phosphorothioated 20-mer antisense oligonucleotide, complementary to AKT- 1 mRNA, which leads to the inhibition of translation and the downstream pathway activities of AKT-1 mRNA. WGl-0301 is a proprietary lipid nanoparticle formulation (QTsomeTM) of Archexin designed to enhance delivery. A phase I clinical study of WGl-0301 as monotherapy in patients with advanced solid tumors is currently ongoing in the U.S. Given the limited efficacy of TKIs compared to immunotherapy and growing incidence resistance, WGl- 0301 combined with TKls may augment the therapeutic response to TKls by enhancing angiogenic blockade, inhibiting AKT-1 , and overcome resistance. An efficacy study of WGI-0301 was conducted in combination with Lenvatinib, sorafenib, or cabozantinib in the treatment of human hepatocellular cancer Hep3B-luciferase orthotopic model in the female Balb / c nude mice. Sixty-four female Balb / c nude mice were randomly divided into groups {8 mice in each group), including a vehicle control. The mice were given WGI-0301 or Lenvatinib, sorafenib, or cabozantinib or WGI-0301 in combination with lenvatinib / sorafenib / cabozantinib for 28 days. WGI-0301 was administered at a dose of 8 mg / kg once a week intravenously for 4 times, and lenvatinib / sorafenib / cabozantinib were given by oral at doses of 10 mg / kg, 20 mg / kg, and 20 mg / kg daily respectively for 28 days. Body weight was monitored twice a week. Whole body fluorescent Attorney Docket No.11650-003WO1 imaging was performed twice a week, and tumor load was measured using bioluminescence. Treatment was suspended from day 29 to day 70 for survival observation after drug discontinuation. Table 35. Groups and Treatment Information. Dosing Dosing Dosing Group N a Treatment b DoseSurvival (mg / kg)Volume Route ScheduledOe(µL / g)cbservation was formulated in cremophor EL: (95%) ethanol = 1:1 (v / v) and WGI-0301 was formulated in saline. Vehicle in group 1 was saline. c. Dosing volume: adjust dosing volume based on body weight 10 µL / g. d. Grouping was performed on PG-D0, treatment was started from PG-D1. Dosing schedule of Lenvatinib, Sorafenib and Cabozantinib were QD, dosing schedule of Vehicle and WGI-0301 were QW.e.Treatment was suspended from PG-D29 to PG-D70 for survival observation, the body weight was measured twice a week, and bioluminescence was measured once a week. Experimental Methods Cell Culture The Hep3B-luc (from Wuxi) tumor cells were maintained in vitro in EMEM medium supplemented with 10% fetal bovine serum and 1% Antibiotic-Antimycotic at 37ºC in an atmosphere of 5% CO2in air. The tumor cells were routinely subcultured twice weekly. The cells growing in an exponential growth phase were harvested and counted for tumor inoculation. Tumor Inoculation Each mouse was inoculated on left lobe of liver with the tumor cells (3 x 106) in 0.02 mL of DPBS mixed with Matrigel (Volume Ratio=1:1) for tumor development. On the Day 4 after cell inoculation, when tumors reached an average bioluminescence of 3.85 x 107photons / second, they were randomized and dosed the day after grouping with 8 mice per group. The animal randomization was designated as PG-D0, the first day of dosing was designated as PG-D1. The animals were assigned into groups using an Excel-based randomization software performing stratified randomization based upon their Attorney Docket No.11650-003WO1 bioluminescence value. Each group consisted of 8 tumor-bearing mice. The test articles were administrated to the mice according to the predetermined regimen as shown in the experimental design table (Table 35). Vehicle Solvent and Testing Article Formulation Preparation Table 36. Formulation of Articles. c Concentration Compounds Preparation(mg / mL)Storageh a.The stock solution of Lenvatinib, Sorafenib and Cabozantinib were stored at -20 C. b. The diluent of Lenvatinib and Cabozantinib were kept at 4°C and used up within 3 days after preparation. Sorafenib and WGI-0301 were freshly prepared just before use. c. Treatment was started on PG-D1. Observations Attorney Docket No.11650-003WO1 The protocol and any amendment(s) or procedures involving the care and use of animals in this study were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of WuXi AppTec prior to conduct. During the study, the care and use of animals were conducted in accordance with the regulations of the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC). After inoculation, the animals were checked daily for morbidity and mortality. At the time of routine monitoring, the animals were checked for any effects of tumor growth and treatments on normal behavior such as mobility, food and water consumption, body weight gain / loss, eye / hair matting and any other abnormal effect. Death and observed clinical signs were recorded on the basis of the numbers of animals within each subset. Tumor Measurements and the Endpoints The surgically inoculated mice were weighed and intraperitoneally administered luciferin at a dose of 150 mg / kg. Ten minutes after the luciferin injection, the animals were pre-anesthetized with the mixture gas of oxygen and isoflurane. When the animals were in a complete anesthetic state, the mice were moved into the imaging chamber for bioluminescence measurements with an IVIS (Lumina III) imaging system. The major endpoint was to see if the tumor bioluminescence growth can be delayed, decreased, or vanished, and another major endpoint was to observe the survival period of the mice after treatment, such as the death of a single mouse or the mouse reaching the requirement of euthanasia. Tumor bioluminescence metastasis can be prevented or the mice can be cured. The body weight was measured twice weekly. The bioluminescence value of the whole animal body, including primary and metastatic tumors, was measured and recorded twice per week during treatment. The survival period was observed after treatment, and the bioluminescence values of the animals were measured once a week. When the animal's health has deteriorated, dying (the animal has obvious weight loss, the weight loss of more than 20%), being unable to eat or drink normally, or has difficulty in moving, paralyzed, etc., veterinary notice need be filled. Animals were euthanized with CO2 immediately if necessary after the veterinarian evaluation. RTB was calculated for each mouse using the formula: RTB = Bt / B0, Bt was the tumor bioluminescence value of the mice on a given day, B0 was the tumor bioluminescence value of the mice on the day of grouping. The T / C value (in percent) is an indicator of antitumor effectiveness; T / C (%) was calculated for each group using the formula: T / C% = TRTB / CRTBx 100, TRTBwas the average RTB of a treatment group on a given day, CRTBwas the average RTB of the vehicle control group on the same given day with treatment group. Attorney Docket No.11650-003WO1 TGI is calculated for each group using the formula: TGI (%) = [1-(Ti-T0) / (C1-C0)] ×100; Tiis the average tumor bioluminescence value of a treatment group on a given day, T0is the average tumor bioluminescence value of the treatment group on the first day of treatment, Ci is the average tumor bioluminescence value of the vehicle control group on the same day with Ti, and C0 is the average tumor bioluminescence value of the vehicle group on the first day of treatment. Mean survival time (Days) of each group was calculated based on the survival time of the animals within, increased life span was analyzed according to the mean survival time in treatment groups and vehicle group. Statistical Analysis Summary statistics, including mean and the standard error of the mean (SEM), are provided for the bioluminescence of each group at each time point. Statistical analysis was performed to evaluate the differences between groups based on bioluminescence on PG-D24. Comparisons between two groups were carried out with t-test. Used Dunnett's multiple comparisons test for one-way ANOVA to compare among groups. The data were analyzed using SPSS and GraphPad Prism 9. p<0.05 was considered to be statistically significant. Results The results showed that the combination group (WGI-0301 with Lenvatinib, sorafenib, or cabozantinib) had better anti-tumor effect (TGI: 66.05%, 86.81%, 75.89%) than the lenvatinib / sorafenib / cabozantinib group (TGI: 50.84%, 55.68%, 47.84%). The fluorescence signal intensity of the combination group (56.74*108, 22.28*108, 40.40*108photons / s) was slightly lower than that of the lenvatinib / sorafenib / cabozantinib group (81.97*108, 73.95*108, 86.96*108photons / s). The median survival time (MST) for the combination group was 55.5, 58.0, and 53.5 days, which was slightly higher than the lenvatinib / sorafenib / cabozantinib group (46.0, 55.5, 51.5 days). Based on limited safety endpoints (mortality, clinical symptoms, and body weight) and compared to the lenvatinib / sorafenib / cabozantinib monotherapy group, there was no substantial increase in toxicity in the mice treated with the combination of WGI-0301 with lenvatinib 8+10 mg / kg, WGI-0301 with sorafenib 8+20 mg / kg, and WGI-0301 with cabozantinib 8+20 mg / kg. No severe adverse reactions were observed in the combination group. The combination of WGI-0301 with lenvatinib / sorafenib / cabozantinib showed superior anti- tumor efficacy compared to the currently used lenvatinib / sorafenib / cabozantinib in clinical practice. The combination of WGI·0301 with TKls demonstrated superior anti-tumor efficacy over TKI monotherapy in the absence of substantial increase in toxicity. Attorney Docket No.11650-003WO1 Results are shown in Figures 11-18 and Table 35-42. Mortality, Clinical Observation and Body Weight Gain or Loss Animal body weight was monitored regularly as an indirect measurement of toxicity. During the treatment, the mouse #8-3 in group 4 (Sorafenib, 20 mg / kg, p.o., QD x 4W) exhibited body weight loss over 15% on PG-D24, it was provided with diet gel from PG-D25 to PG-D27 to maintain its bodyweight. The mouse #1-1 in group 1 (Vehicle, i.v., QW x 4W) was found died at PG-D27, according to the veterinary autopsy, the cause of death was likely related to deteriorating health status caused by huge tumor. In the Vehicle group, 3 mice showed enlarged abdomen at 17 days after administration, and the liver protruded in situ. Abdominal distension and hepatic protrusions were observed from 6 mice, 1 mouse, and 1 mouse in WGI-0301, Lenvatinib, and Cabozantinib groups at 21, 21, and 24 days after administration, respectively. No obvious abnormality was observed in other administration groups during treatment. The details of clinical observation are showed as Table 37. The body weight (BW) and BW change curves of Hep3B-luc model efficacy study are showed in Figure 11 and Figure 12. Table 37. Clinical symptoms. Clinical Observation GroupAnimalIDFindin Clini l S m t m ............... Attorney Docket No.11650-003WO1 Lenvatinib, 5-1 PG-D35 Abdominal dilatation, bulge in situ of liver, died on D49. mg / kg p.o., QD x 4W 5-2 PG-D42 Abdominal dilatation, bulge in situ of liver, euthanized on D54. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Attorney Docket No.11650-003WO1 14-4 -- Survival WGI-0301 + 15-1 PG-D56 Abdominal dilatation, bulge in situ of liver, euthanized on D56. C b z ntinib . . . . . Tumor Bioluminescene curve after female Balb / c nude mice with Hep3B-luc tumors dosed test articles is showed in Figure 14. Bioluminescence Intensity Mean bioluminescence value over time in female Balb / c nude mice bearing human hepatocellular cancer cell Hep3B-luc is shown in Table 38 and Table 39. Table 38. Bioluminescence value over time during treatment in mice (x108 photon / s). Bioluminescence value (x108photon / s)aGroup Treatment 0b3 7 10 14 17 21 24 28cVehi0.39± 0.87± 4.35± 9.46± 30.48± 59.39± 115.07± 166.36± 144.20 1cle,i.v., QW x 4W0.05 0.15 0.93 2.11 5.31 8.87 17.15 27.90 ±26.27 WGI-0301, 2 8 mg / kg, i.v., 0.39± 0.80± 3.71± 8.34± 22.80± 52.63± 101.94± 161.59± 153.21 QW x 4W 0.05 0.11 0.87 2.33 2.81 10.39 15.50 29.49 ±22.29 Lenvatinib, 0.39± 0.70± 3.94± 9.59± 23.98± 32.18± 48.30±9 81.97±1 110.41 3 10 mg / kg p.o., 0.06 0.11 0.84 0.99 3.21 4.56 .96 6.66 ±25.11 QD x 4W Sorafenib, 4 20 mg / kg p.o., 0.39± 1.14± 4.47± 13.17 26.42± 42.27± 62.10±2 73.95±2 84.01± QD x 4W 0.06 0.19 0.79 ±2.98 7.01 13.48 2.06 7.27 31.76 Cabozantinib, 0.38± 1.05± 5.05± 13.67 27.66± 47.12± 73.63±2 86.96±2 122.26 5 20 mg / kg p.o., 0.05 0.23 1.27 ±3.32 6.32 11.46 1.18 1.81 ±33.21 QD x 4W WGI-0301 + Lenvatinib, 8 mg / kg + 10 0.39± 0.95± 3.53± 8.58± 18.41± 27.17± 41.96±7 56.74±1 76.45± 6 mg / kg, 0.06 0.12 0.43 1.15 3.89 4.87 .70 0.71 16.88 i.v., + p.o., (QW + QD) x 4W 0.38± 1.05± 2.39± 4.44± 10.10± 13.34± 20.86±6 22.28±9. 24.39± 7WGI-0301 +Sorafenib,0.05 0.18 0.41 0.75 2.76 4.13 .68 27 10.08 Attorney Docket No.11650-003WO1 8 mg / kg + 20 mg / kg, i.v., + p.o., (QW + QD) x 4W WGI-0301 + Cabozantinib, 8 8 mg / kg + 20 0.38± 0.76± 3.85± 8.17± 15.23± 19.02± 30.70±6 40.40±9. 36.38± mg / kg, 0.06 0.11 0.72 1.65 3.13 3.36 .34 27 11.26 i.v., + p.o., (QW + QD) x 4W a. Data are shown as Mean ± SEM. b. Days after grouping. c. Bioluminescence data after PG-D24 were incomplete due to animal death. Table 39. Bioluminescence value over time during survival observation post treatment in mice (x108 photon / s). Bioluminescence value (x108photon / s)aGroup Treatment 35b42 49 56 63 8 8 mg / kg+ 20 mg / kg, 53.56±13.76 160.03±32.04 178.55±45.65 177.39±45.78 177.39±45.78 i.v., + p.o., (QW+ QD) x 4W a. Data are shown as Mean ± SEM. b. Days after grouping and bioluminescence data during survival observation. Tumor Growth Inhibition Analysis Attorney Docket No.11650-003WO1 Tumor growth inhibition of test articles in the treatment of female Balb / c nude mice bearing human hepatocellular cancer Hep3B-luc was calculated based on bioluminescence measured on PG-D24. The data is shown in Table 40 and Table 41. Table 40. Tumor Growth Inhibition Analysis (Calculated based on the bioluminescence data obtained on PG-D24). Bioluminescence valuep cGroup Treatment (x108photon / s)T / Cb(%) TGIb(%)value a WGI-0301 + Sorafenib, 8 mg / kg + 20 mg / kg, 7 i.v., + p.o., (QW + QD) x 22.28±9.27 12.75 86.81 * 4W WGI-0301 + Cabozantinib, 8 8 mg / kg + 20 mg / kg, 40.40±9.27 23.52 75.89 * i.v., + p.o., (QW + QD) x 4W a. Data is shown as Mean ± SEM. The data analysis was based on the bioluminescence of PG-D24 instead of PG-D28 because the bioluminescence data of PG-D28 was incomplete due to animal death. b. Tumor Growth Inhibition (TGI) was calculated using the formula: TGI (%) = [1-(T24-T0) / (C24-C0)] ×100, where T24= mean bioluminescence value at the PG-D24 of treatment group, C24= mean bioluminescence value at the PG-D24 of control group. Antitumor activity (T / C) was calculated using the formula: T / C% = TRTB / CRTB x 100, where TRTB = mean RTB at the PG-D24 of treatment group, CRTB = mean RTB at the PG-D24 of control group. c. A one-way ANOVA with SPSS was performed to compare the bioluminescence value among vehicle group and treatment groups. ns: no significance, * indicates p<0.05. Table 41. Tumor Growth Inhibition Analysis (Calculated based on the bioluminescence data obtained on PG-D24). Bioluminescence tment value pa b cGroup Trea p p (x108photon / s) value value value (PG-D24)a Attorney Docket No.11650-003WO1 4Sorafenib,20 mg / kg p.o., QD x 4W73.95±27.27 -- -- --5 Cabozantinib, 20 mg / kg p.o., QD x 4W86.96±21.81 -- -- --WGI-0301 + Lenvatinib, 6 8 mg / kg + 10 mg / kg, 56.74±10.71 ns -- -- i.v., + p.o., (QW + QD) x4W WGI-0301 + Sorafenib, 7 8 mg / kg + 20 mg / kg, 22.28±9.27 -- ns -- i.v., + p.o., (QW + QD) x 4W WGI-0301 + Cabozantinib, 8 8 mg / kg + 20 mg / kg, 40.40±9.27 -- -- ns i.v., + p.o., (QW + QD) x 4W a. Independent-Samples T Test with SPSS was performed to compare the bioluminescence value between group 3 and group 6. ns: no significance. b. Independent-Samples T Test using SPSS was performed to compare the bioluminescence value between group 4 and group 7. ns: no significance.c.Independent-Samples T Test using SPSS was performed to compare the bioluminescence value between group 5 and group 8. ns: no significance. Survival Animals with deteriorating health status due to excessive tumor size or severe bodyweight loss were euthanized according to the IACUC protocol. The survival time of the animals was observed for 42 days. The mean survival time of animals in vehicle group was 37.63 days. The mean survival time of the animals from Group 2 (WGI-0301, 8 mg / kg), Group 3 (Lenvatinib, 10 mg / kg), Group 4 (Sorafenib, 20 mg / kg), Group 5 (Cabozantinib, 20 mg / kg), Group 6 (WGI-0301+Lenvatinib, 8+10 mg / kg), Group 7 (WGI- 0301+Sorafenib, 8+20 mg / kg) and Group 8 (WGI-0301+Cabozantinib, 8+20 mg / kg) were 35.88, 47.00, 53.25, 52.25, 53.00, 58.88 and 53.75 days respectively. The mean survival rates of each treatment group were 95.35%, 124.90%, 141.51%, 138.85%, 140.85%, 156.47% and 142.84% respectively. The median survival time of vehicle group was 35 days. The median survival time of the animals from Group 2 (WGI- 0301, 8 mg / kg), Group 3 (Lenvatinib, 10 mg / kg), Group 4 (Sorafenib, 20 mg / kg), Group 5 (Cabozantinib, 20 mg / kg), Group 6 (WGI-0301+Lenvatinib, 8+10 mg / kg), Group 7 (WGI-0301+Sorafenib, 8+20 mg / kg) and Group 8 (WGI-0301+Cabozantinib, 8+20 mg / kg) were 35.5, 46.0, 55.5, 51.5, 55.5, 58.0 and 53.5 days respectively. The Kaplan-Meier survival curves for animals in each group is shown in Figure 15, 16 and 17. The result of survival time analysis is shown in Table 42. Table 42. Survival Time analysis. Meanamean survival Treatmentrates (%)b Median c p Attorney Docket No.11650-003WO1 Vehicle, i.v., QW x 4W37.63±3.74 -- 35.00 -- Cabozantinib, 20 mg / kg p.o., QD x 4W52.25±3.03 138.85 51.50 nsWGI-0301 + Lenvatinib 8 mg / kg + 10 mg / kg, 53.00±1.72 140.85 55.50 ** i.v., + p.o., (QW + QD) x4W WGI-0301 + Sorafenib 8 mg / kg + 20 mg / kg, 58.88±3.49 156.47 58.00 ** i.v., + p.o., (QW + QD) x 4W WGI-0301 + Cabozantinib 8 mg / kg + 20 mg / kg, 53.75±2.80 142.84 53.50 * i.v., + p.o., (QW + QD) x 4W a. Mean Survival Time ± SEM. b. The mean survival rates (%) was calculated by dividing the mean survival time of the drug administration group by the mean survival time of the control group. c. Median and p value were calculated based on survival time by survival analysis with GraphPad Prism 9 compared with the vehicle group, respectively. **: p<0.01, *: p<0.05, ns: no significance. Results Summary and Discussion In this study, the therapeutic efficacy of WGI-0301 combined with Lenvatinib, Sorafenib or Cabozantinib in the treatment of human hepatocellular cancer Hep3B-luc orthotopic model in the female Balb / c nude mice was investigated. Animal body weight was monitored regularly as an indirect measurement of toxicity. Body weight and body weight changes after administration of test articles are shown in Figure 11 and Figure 12. The mouse #1-1 in the vehicle group was found dead on the 27th day of administration. After veterinary autopsy evaluation, it may be related to the decline in physical fitness caused by tumor overload. The mice treated with Lenvatinib, 10 mg / kg and Sorafenib, 20 mg / kg (monotherapy or combination) showed slight bodyweight loss during treatment. Endpoint data based on mortality, clinical symptoms, and body weight showed no substantial increase in toxicity in mice treated with the combination of WGI-0301 + Lenvatinib, 8+10 mg / kg, WGI-0301 + Sorafenib, 8+20 mg / kg and WGI-0301 + Cabozantinib, 8+20 mg / kg compared to the Lenvatinib / Sorafenib / Cabozantinib monotherapy group. Both T / C and TGI were the indicators of antitumor effectiveness, the data on PG-D24 are shown in Table 40 and Table 41. Compared with vehicle group (Bioluminescence=166.36x108photon / s), WGI- Attorney Docket No.11650-003WO1 0301+Sorafenib, 8+20 mg / kg and WGI-0301+Cabozantinib, 8+20 mg / kg, exhibited significant anti-tumor activity with mean Bioluminescence of 22.28x108photon / s (T / C=12.75%, TGI=86.81%, p=0.014) and 40.40x108photon / s (T / C= 23.52%, TGI= 75.89%, p=0.030), while WGI-0301, 8 mg / kg, Lenvatinib, 10 mg / kg, Sorafenib, 20 mg / kg, Cabozantinib, 20 mg / kg and WGI-0301+Lenvatinib 8+10 mg / kg showed minor tumor inhibitory effects with mean Bioluminescence of 161.59x108photon / s (T / C= 98.53%, TGI= 2.87%, p= 1.000), 81.97 x 108photon / s (T / C= 51.36%, TGI= 50.84%, p= 0.249), 73.95x108photon / s (T / C= 33.80%, TGI= 55.68%, p= 0.327), 86.96x108photon / s (T / C= 46.38%, TGI= 47.84%, p= 0.392) and 56.74x108photon / s (T / C= 33.59%, TGI= 66.05%, p= 0.064). Based on the T / C and TGI data, the combined treatment groups WGI-0301 + Lenvatinib, 8+10 mg / kg (TGI= 66.05%), WGI-0301 + Sorafenib, 8+20 mg / kg (TGI= 86.81%), and WGI-0301 + Cabozantinib, 8+20 mg / kg (TGI= 75.89%) had better antitumor effects than monotherapy groups Lenvatinib 10 mg / kg (TGI= 50.84%), Sorafenib, 20 mg / kg (TGI= 55.68%), and Cabozantinib, 20 mg / kg (TGI= 47.84%), respectively. The survival time of the animals was observed for 42 days after 28-days treatment completion. The animals were died or euthanized in accordance to the IACUC protocol due to obvious weight loss or deterioration of health status. The mean and median survival time of animals in vehicle group was 37.63 days and 35 days, respectively. The mean and median survival time of the animals from WGI-0301, 8 mg / kg, Lenvatinib, 10 mg / kg, Sorafenib, 20 mg / kg, Cabozantinib, 20 mg / kg, WGI-0301 + Lenvatinib, 8+10 mg / kg, WGI-0301 + Sorafenib, 8+20 mg / kg and WGI-0301 + Cabozantinib, 8+20 mg / kg were 35.88 and 35.50, 47.00 and 46.00, 53.25 and 55.50, 52.25 and 51.50, 53.00 and 55.50, 58.88 and 58.00, 53.75 and 53.50 days, respectively. Compared with vehicle group, Sorafenib, 20 mg / kg, WGI-0301+Lenvatinib, 8+10 mg / kg, WGI-0301+Sorafenib, 8+20 mg / kg and WGI-0301+Cabozantinib, 8+20 mg / kg could significantly prolong the survival time of mice bearing the Hep3B-luc orthotopic tumor model. Compared with the monotherapy, the combined treatment showed a little more survival time of mice. In conclusion, the mice treated with WGI-0301 combined with Sorafenib, 8+20 mg / kg, and WGI- 0301 combined with Cabozantinib, 8+20 mg / kg, showed a significant anti-tumor effect on Hep3B-luc orthotopic tumor-bearing mice, and can prolong the survival time of mice. Sorafenib, 20 mg / kg and WGI-0301+Lenvatinib, 8+10 mg / kg showed minor tumor inhibitory effects and can prolong the survival time of mice as well. In the absence of substantial increase in toxicity, WGI-0301 combined with Lenvatinib / Sorafenib / Cabozantinib has a better inhibitory effect on tumor growth in Hep3B-luc orthotopic tumor-bearing mice compared with the monotherapy, and it can better prolong the survival of mice. Attorney Docket No.11650-003WO1 The compositions and methods of the appended claims are not limited in scope by the specific compositions and methods described herein, which are intended as illustrations of a few aspects of the claims and any compositions and methods that are functionally equivalent are intended to fall within the scope of the claims. Various modifications of the compositions and methods in addition to those shown and described herein are intended to fall within the scope of the appended claims. Further, while only certain representative compositions and method steps disclosed herein are specifically described, other combinations of the compositions and method steps also are intended to fall within the scope of the appended claims, even if not specifically recited. Thus, a combination of steps, elements, components, or constituents may be explicitly mentioned herein or less, however, other combinations of steps, elements, components, and constituents are included, even though not explicitly stated. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments of the invention and are also disclosed. Other than in the examples, or where otherwise noted, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood at the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, to be construed in light of the number of significant digits and ordinary rounding approaches
Claims
Attorney Docket No. 11650-003WO1 CLAIMS What is claimed is:
1. A pharmaceutical composition comprising a lipid nanoparticle encapsulating an active agent, the lipid nanoparticle comprising: 2.5 mol% to 15 mol% one or more cationic lipids; 30 mol% to 50 mol% one or more ionizable lipids; 30 mol% to 65 mol% one or more neutral lipids; and 2.5 mol% to 15 mol% one or more PEGylated lipids.
2. The composition of claim 1, wherein the active agent comprises RX-0201, 5′ gctgcatgatctccttggcg 3′, SEQ. ID. NO.
1.
3. The composition of claim 2, wherein RX-0201 is an antisense oligonucleotide.
4. The composition of any one of claims 2-3, wherein the RX-0201 has at least one modified internucleoside linkage that is a phosphorothioate linkage.
5. The composition of any one of claims 1-4, wherein the one or more cationic lipids are present in the lipid nanoparticle in an amount of from 2.5 mol% to 12.5 mol%, or from 2.5 mol% to 10 mol%.
6. The composition of any one of claims 1-5, wherein the one or more cationic lipids comprise DOTMA: [1-(2,3-sioleyloxy)propyl)]-N,N,N-trimethylammonium chloride, DMRIE, di-C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DODAP, DOSPA (2,3-dioleyloxy-N-[2-(spermine carboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate), DORIE (N-[1-(2,3- dioleyloxypropyl)]-N,N-dimethyl-N-hydroxyethylammonium bromide), DODAB, DOIC, DMEPC, DOGS: Dioctadecylamidoglicylspermin, DIMRI: Dimyristooxypropyl dimethyl hydroxyethyl ammonium bromide, DOTAP: dioleoyloxy-3-(trimethylammonio)propane, DC-6-14: O,O-ditetradecanoyl-N-.alpha.- trimethylammonioacetyl)diethanolamine chloride, CLIP 1: rac-[(2,3-dioctadecyloxypropyl)(2- hydroxyethyl)]-dimethylammonium chloride, CLIP6: rac-[2(2,3- dihexadecyloxypropyloxymethyloxy)ethyl]-trimethylammonium, CLIP9: rac-[2(2,3- dihexadecyloxypropyloxysuccinyloxy)ethyl]-trimethylammonium, oligofectamine, lipids described in U.S.Attorney Docket No. 11650-003WO1 Patent No.5,049,386, N-[1-(2,3-dioleyloxypropyl)]-N,N-dimethyl-N-hydroxyethylammonium bromide (DORIE), 2,3-dioleyloxy-N-[2-(spermine carboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), and the like as disclosed in International Publication Nos. WO91 / 16024 and WO97 / 019675; and (3R,4R)-3,4-bis((Z)-Hexadec-9-enyloxy)-1-methylpyrrolidine, and N-Methyl-N,N- bis(2-((Z)-octadec-6- enyloxy)ethyl)amine and the like as disclosed in International Publication No. WO2011 / 13636, or any combination thereof.
7. The composition of any of claims 1-6, wherein the one or more neutral lipids are present in the lipid nanoparticle in an amount of from 40 mol% to 55 mol %.
8. The composition of any one of claims 1-7, wherein the one or more neutral lipids comprise dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylethanolamine (DOPE), 1,2-Dioleoyl-sn- glycero-3-phosphocholine (DOPC), palmitoyloleoylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC), distearoylphosphatidylcholine (DSPC), cholesterol, or any combination thereof.
9. The composition of any one of claims 1-8, wherein the one or more neutral lipids comprise cholesterol.
10. The composition of any one of claims 1-9, wherein the one or more PEGylated lipids are present in the lipid nanoparticle in an amount of from 2.5 mol% to 10 mol%, or from 5 mol% to 10 mol%.
11. The composition of any one of claims 1-10, wherein the one or more PEGylated lipids comprise a PEG-ditetradecylacetamide, a PEG-myristoyl diglyceride, a PEG-diacylglycerol, a PEG dialkyloxypropyl, a PEG-phospholipid, a PEG-ceramide, PEG-DMG, PEG-DSPE, or any combinations thereof.
12. The composition of any one of claims 1-11, wherein the one or more PEGylated lipids comprise 1,2-dimyristoyl-sn-glycerol (DMG-PEG).
13. The composition of any one of claims 1-12, wherein the one or more ionizable lipids are present in the lipid nanoparticle in an amount of from 35 mol% to 45 mol%.Attorney Docket No. 11650-003WO1 14. The composition of any one of claims 1-13, wherein the one or more ionizable lipids comprise N,N-dimethyl-2,3-dioleyloxypropylamine (DODMA), [(4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl)bis(2- hexyldecanoate) (ALC-0315), 9-heptadecanyl 8-{(2-hydroxyethyl)[6-oxo-6- (undecyloxy)hexyl]amino}octanoate (SM-102), DLin-MC3-DMA, DLin-KC2-DMA, DLinDMA and the like as disclosed in International Publication No. WO2005 / 121348, DLin-K-DMA and the like as disclosed in International Publication No. WO2009 / 086558, 1-(2,3-bis(((9Z,12Z)-octadeca-9,12-dien-1- yl)oxy)propyl)pyrrolidine (A066), or any combination thereof.
15. The composition of any one of claims 1-14, wherein the one or more ionizable lipids comprise N,N-dimethyl-2,3-dioleyloxypropylamine (DODMA).
16. The composition of any one of claims 1-15, wherein the lipid nanoparticle comprises DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG.
17. The composition of claim 16, wherein the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG are present at a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:25:20:
10.
18. The composition of claim 16, wherein the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG are present at a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:27.5:20:7.
5.
19. The composition of claim 16, wherein the DOTAP, DODMA, DOPC, cholesterol, and DMG-PEG are present at a molar ratio of DOTAP:DODMA:DOPC:cholesterol:DMG-PEG of 5:40:30:20:
5.
20. The composition of any of claims 1-19, wherein the lipid nanoparticle and the active agent are present at a weight ratio of lipid nanoparticle to active agent of from 5:1 to 20:1, from 7.5:1 to 15:1, from 7.5:1 to 10:1, from 7.5:1 to 12:1, from 10:1 to 12:1, from 10:1 to 15:1, or from 12:1 to 15:
1.
21. The composition of any one of claims 1-20, wherein the lipid nanoparticle and the active agent are present at a weight ratio of lipid nanoparticle to active agent of 15:1, 12:1, 10:1, or 7.5:
1.
22. The composition of any one of claims 1-21, wherein the composition comprises a population of the lipid nanoparticles, and wherein the population of the lipid nanoparticles has an average particleAttorney Docket No. 11650-003WO1 size, as determined by dynamic light scattering, of from 50 nm to 80 nm, from 55 nm to 75nm, or from 55 nm to 60 nm.
23. The composition of any one of claims 1-22, wherein the composition comprises a population of the lipid nanoparticles, and wherein the population of the lipid nanoparticles has an average particle size, as determined by dynamic light scattering, of about 55 nm.
24. The composition of any one of claims 1-23, wherein the composition comprises a population of the lipid nanoparticles, and wherein the population of the lipid nanoparticles has an average zeta potential of from -06 mV to 2.5 mV.
25. The composition of any one of claims 1-24, wherein the composition comprises a population of the lipid nanoparticles, and wherein the population of the lipid nanoparticles has an average zeta potential of -5.5 mV.
26. The composition of any one of claims 1-25, wherein the composition comprises a population of the lipid nanoparticles, and wherein the population of the lipid nanoparticles has a polydispersity index (PDI) of from 0.15 to 0.5, from 0.15 to 0.4, from 0.15 to 0.3, from 0.15 to 0.2, from 0.2 to 0.3, from 0.2 to 0.5, from 0.2 to 0.4, from 0.2 to 0.3, from 0.3 to 0.4, from 0.3 to 0.5, or from 0.4 to 0.
5.
27. The composition of any of claims 1-26, wherein the lipid nanoparticles are dispersed in a pharmaceutically acceptable carrier.
28. A method for treating cancer, preventing cancer, preventing cancer metastasis, preventing cancer recurrence or preventing angiogenesis, the method comprising administering to a subject in need thereof the pharmaceutical composition of any one of claims 1-27.
29. The method of claim 28, wherein the subject is a human.
30. The method of any one of claims 28-29, wherein the cancer is hepatocellular carcinoma.Attorney Docket No. 11650-003WO1 31. The method of any one of claims 28-30, wherein administration comprises oral, topical, transcutaneous, transdermal, intra-joint, intra-arteriole, intradermal, intraventricular, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, intracranial injections or infusion techniques.
32. The method of any of claims 28-31, wherein the composition is co-administered with an additional active agent or therapy.
33. The method of claim 32, wherein the additional active agent or therapy comprises radiotherapy, a chemotherapeutic agent, an immunomodulating agent, an antigen, or any combination thereof.
34. The method of any of claims 28-33, wherein the composition is co-administered with a tyrosine kinase inhibitor.
35. The method of any of claims 28-34, wherein the composition is co-administered with a vascular endothelial growth factor (VEGF) inhibitor.
36. The method of any one of claims 28-35, wherein the composition is co-administered with sorafenib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; cabozantinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; or any combination thereof to the subject.
37. The method of any one of claims 28-35, wherein the composition is co-administered with sorafenib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; and lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof to the subject.
38. The method of any one of claims 28-35, wherein the composition is co-administered with sorafenib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; and cabozantinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof to the subject.Attorney Docket No. 11650-003WO1 39. The method of any one of claims 28-35, wherein the composition is co-administered with lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; and cabozantinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof to the subject.
40. The method of any one of claims 28-35, wherein the composition is co-administered with sorafenib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof to the subject.
41. The method of any one of claims 28-35, wherein the composition is co-administered with lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof to the subject.
42. The method of any one of claims 28-35, wherein the composition is co-administered with cabozantinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof to the subject.
43. The method of any one of claims 28-35, wherein the composition is co-administered with sorafenib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; lenvatinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof; and cabozantinib, or a pharmaceutically acceptable salt, prodrug, or derivative thereof to the subject.
44. A method of inducing cytotoxicity in a cancer cell in a subject comprising contacting the cell with the pharmaceutical composition of any one of claims 1-27.
45. A method of producing a population of lipid nanoparticles encapsulating an active agent, the method comprising (a) combining one or more ethanolic solutions comprising a mixture of lipids with an aqueous solution and acidifying to induce formation of a population of empty lipid nanoparticles; (b) contacting the population of empty lipid nanoparticles with an aqueous solution comprising the active agent, thereby encapsulating the active agent in the population of empty lipid nanoparticles to produce the population of lipid nanoparticles encapsulating the active agent; and (c) subjecting the population of lipid nanoparticles encapsulating the active agent to tangential flow filtration to replace buffer and remove residual ethanol;Attorney Docket No. 11650-003WO1 wherein the mixture of lipids comprises 2.5 mol% to 15 mol% one or more cationic lipids; 30 mol% to 50 mol% one or more ionizable lipids; 30 mol% to 65 mol% one or more neutral lipids; and 2.5 mol% to 15 mol% one or more PEGylated lipids.