Modified clostridium bacteria capable of producing propan-2-ol, and preparation and uses thereof
Patent Information
- Application Number
- EP2024722061
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-31
- Filing Date
- 2024-03-29
- Publication Date
- 2026-02-11
AI Technical Summary
Current methods for genetically modifying Clostridium bacteria to produce propan-2-ol and ethanol result in suboptimal C3/C2 ratios, limiting the efficiency of solvent production.
Inactivation of the hbd and bdhB genes combined with the expression of the adh gene from C. beijerinckii DSM 6423 in C. acetobutylicum, using CRISPR-Cas technology, to create strains like IFP 971 and IFP 970 that produce improved ratios of propan-2-ol and ethanol.
The modified strains achieve significantly enhanced C3/C2 ratios, increasing propan-2-ol production and optimizing solvent production, surpassing the efficiency of previous mutant strains.
Smart Images

Figure 000029 
Figure 00000028_0000
Abstract
Description
[0001]MODIFIED CLOSTRIDIUM BACTERIA PRODUCING PROPAN-2-OL, PREPARATION AND USES THEREOF The present invention relates to the genetic modification of bacteria of the genus Clostridium, typically solvent-producing bacteria of the genus Clostridium. The inventors describe in particular methods, tools and kits allowing the elimination or modification of sequence(s) coding for, or controlling the transcription of sequence(s) coding for, an enzyme with 3-hydroxybutyryl-CoA dehydrogenase (Hbd), an NADPH-dependent alcohol dehydrogenase (BdhB) and / or a pyruvate NADP ferredoxin oxidoreductase activity, or allowing the addition of a sequence coding for a secondary alcohol dehydrogenase (Adh). The genetically modified bacteria thus obtained are also described, as are their uses, in particular for producing propan-2-ol or a mixture comprising propan-2-ol and ethanol.TECHNOLOGICAL BACKGROUND Bacteria belonging to the genus Clostridium are Gram-positive, strict anaerobic bacilli capable of forming endospores and belonging to the phylum Firmicutes. This genus contains many species studied for their pathogenic nature or their industrial and medical interest. Clostridium species of industrial interest, non-pathogenic, are capable of producing compounds of interest such as acids and solvents from a wide variety of sugars and substrates ranging from glucose to cellulose. The growth of solvent-producing Clostridium bacteria (called "solventogenic" or "acidogenic") is said to be biphasic. Acids are produced during the acidogenesis phase, which corresponds to the exponential phase of growth.When cell growth ceases and the bacteria enter the stationary phase, they enter the solventogenesis phase, reassimilate the produced acids and transform them into solvents. Clostridium acetobutylicum is naturally capable of producing a mixture of ethanol, acetone and n-butanol during a fermentation called ABE (Figure 1). Some strains of Clostridium beijerinckii are also capable of reducing all or part of the acetone to propan-2-ol. This is the case of strain DSM 6423 which has in its genome a gene (adh) (Ismail AA et al., 1993) encoding a secondary alcohol dehydrogenase catalyzing the reduction of acetone to propan-2-ol. C. acetobutylicum is considered a model organism for the study of solventogenic microorganisms, due to the relatively high titers obtained during fermentations.Many genetic tools have been specifically developed to perform metabolic engineering to reorient metabolic pathways. In 2011, Lehmann and Lütke-Eversloh described the construction of a ∆hbd mutant that no longer produces butyrate or butanol as fermentation end products, due to the absence of an enzyme with 3-hydroxybutyryl-CoA dehydrogenase activity in this mutant. The resulting mutant produces mainly ethanol, as well as a small amount of acetone. In parallel, Collas et al, Dusséaux et al, Lee et al described the heterologous expression of the adh gene of C. beijerinckii DSM 6423 in C. acetobutylicum in order to obtain a microorganism producing a mixture of ethanol, propan-2-ol and n-butanol (Collas F. et al., 2012; Dusséaux S. et al., 2013; Lee J. et al., 2012).The inventors describe in the context of the present invention the combination of genetic modifications allowing the creation of a strain producing a mixture of ethanol and propan-2-ol, as well as genetic modifications and tools allowing, surprisingly, to advantageously improve the ratios (acetone + propan-2-ol) / ethanol (C3 / C2 ratio), compared to a simple mutant ∆hbd expressing the adh gene. SUMMARY OF THE INVENTION The inventors describe, in the context of the present invention, bacteria of the genus Clostridium, typically solvent-forming bacteria, in particular mutants of C. acetobutylicum no longer producing butanol or butyrate and producing propan-2-ol or a mixture comprising propan-2-ol and ethanol with a C3 / C2 ratio largely improved compared to the mutant ∆hbd described in the literature.The inventors describe in particular a genetically modified bacterium, belonging to the genus Clostridium, in particular a solvent-forming bacterium, whose hbd and bdhB genes have been inactivated. This genetically modified bacterium is a bacterium not expressing the products of the hbd and bdhB genes, in particular the products of the genes of sequences SEQ ID NO: 39 and SEQ ID NO: 36, or expressing non-functional versions of said products. These bacterial mutants are identified respectively in the present text as mutant Δhbd and mutant ΔbdhB. A particular bacterium described by the inventors in the present text further does not express the gene CA_C0764 of sequence SEQ ID NO: 37 or expresses a non-functional version thereof.The bacterium not expressing the products of the hbd and bdhB genes, or expressing non-functional versions of said products, can be advantageously used to obtain a bacterium not expressing in addition the CA_C0764 gene of sequence SEQ ID NO: 37 or expressing a non-functional version thereof.Particularly preferred genetically modified bacteria according to the invention correspond to the strain identified in the present description as IFP 971 as registered on February 17, 2023 under the deposit number LMG P-32995 with the BCCM-LMG collection (also identified in the present text as “Δhbd ΔbdhB::adh ΔCA_C0764”), and to the strain identified in the present description as IFP 970 as registered on February 17, 2023 under the deposit number LMG P-32994 with the BCCM-LMG collection (also identified in the present text as “Δhbd ΔbdhB::adh”), usable for preparing a strain equivalent to the strain IFP 971. The invention also relates to any bacteria derived, cloned, mutant or genetically modified version thereof.Another preferred genetically modified bacterium described by the inventors is the strain identified in the present description as IFP 969 as registered on February 17, 2023 under deposit number LMG P-32993 with the BCCM-LMG collection (also identified herein as “Δhbd”), usable for preparing strains equivalent to strains IFP 970 and IFP 971. The description also relates to any bacteria derived, cloned, mutant or genetically modified version thereof.The inventors further describe methods for producing a recombinant bacterium as described herein, in particular methods comprising the deletion or inactivation of the hbd and bdhB genes, and optionally furthermore of the CA_C0764 gene, so as to prevent or decrease the expression of functional corresponding proteins, preferably a method involving CRISPR-Cas technology, as well as the genetically modified bacteria obtainable by this method, of which the bacteria IFP 969, IFP 970 and IFP 971 are examples.They also describe the use of a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the products of the hbd and / or bdhB genes, and optionally in addition of the CA_C0764 gene, or expresses a non-functional version of the products of the hbd and bdhB genes, and optionally in addition of the CA_C0764 gene, such as the strain IFP 971, for preparing a genetically modified bacterium according to the invention not expressing the products of the hbd, bdhB and CA_C0764 genes, or expressing non-functional versions thereof.The inventors further describe the plasmids pGRNA-Δhbd of sequence SEQ ID NO: 31, pGRNA-ΔbdhB::adh of sequence SEQ ID NO: 33 and pGRNA-ΔCA_C0764 of sequence SEQ ID NO: 35, as well as the use of one, several or all of them for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium so as to improve its capacity for producing propan-2-ol or a mixture of propan-2-ol and ethanol. A method for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium, as well as the genetically modified bacterium of the genus Clostridium obtained using the method are also described. This method comprises a step of transforming the bacterium by introducing into said bacterium a plasmid selected from the plasmid pGRNA-Δhbd of sequence SEQ ID NO: 31, the plasmid pGRNA-ΔbdhB::adh of sequence SEQ ID NO: 33 and the plasmid pGRNA-ΔCA_C0764 of sequence SEQ ID NO: 35.The inventors further describe the use of a bacterium according to the invention to produce a bio-sourced molecule, for example a solvent, a biofuel or any (bio)chemical intermediate product, in particular propan-2-ol or a mixture of propan-2-ol and ethanol. Such bacteria can be advantageously used to produce a solvent or a mixture of solvents, in particular on an industrial scale. The invention also relates to a fermentation process involving the use of a genetically modified bacterium as described in the present text.The inventors finally describe kits, in particular a kit for transforming and preferably genetically modifying a bacterium belonging to the genus Clostridium, and a kit for producing a biosourced molecule, for example a solvent, a biofuel or any (bio)chemical intermediate product, using a bacterium belonging to the genus Clostridium, in particular propan-2-ol, or a mixture of propan-2-ol and ethanol, said kit comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the invention and ii) a preservation medium or a culture medium for said bacterium, in particular a suitable culture medium containing a sugar or a mixture of sugars, preferably a hexose and / or a pentose, even more preferably glucose and / or arabinose and / or xylose.DETAILED DESCRIPTION OF THE INVENTION Although used in industry for more than a century, knowledge of bacteria belonging to the genus Clostridium, in particular solvent-forming bacteria, remains very limited. The bacterium Clostridium acetobutylicum is today considered a model representative of solvent-forming Clostridia. Despite the difficulties, well known to those skilled in the art, encountered in genetically modifying bacteria belonging to the genus Clostridium, the inventors have succeeded, for the first time in the context of the present invention, in obtaining C. acetobutylicum bacteria capable of producing propan-2-ol (also identified in the present text as "isopropanol") or a mixture of propan-2-ol and ethanol with C3 / C2 ratios that are largely improved compared to the ratio that can be obtained using the Δhbd mutant known to those skilled in the art (described in 2011 by Lehmann and Lütke-Eversloh).In a preferred embodiment, these mutants no longer produce butanol or butyrate. The inventors have discovered and thus show for the first time that the joint inactivation of the hbd genes encoding an enzyme with 3-hydroxybutyryl-CoA dehydrogenase activity and bdhB encoding an NADPH-dependent alcohol dehydrogenase combined with the heterologous expression of the adh gene product of C. beijerinckii DSM 6423 in C. acetobutylicum makes it possible to obtain a strain not only capable of producing propan-2-ol but of producing it in substantially greater quantities than is possible with a mutant expressing the adh gene product of C. beijerinckii DSM 6423 in which only the hbd gene is inactivated, or in other words in which the bdhB gene product is still functionally expressed.The experimental part of the present description shows in fact that the quantity of propan-2-ol produced by the ∆hbd mutant containing the plasmid pFC002 (containing the adh gene of C. beijerinckii DSM 6423) is two times lower than the quantity of acetone produced by this same mutant containing the empty plasmid pEC500E. This indicates that the combination of the deletion of the hbd gene and the expression of the adh gene of C. beijerinckii DSM 6423 in C. acetobutylicum DSM 792 does not allow to obtain an efficient producer of propan-2-ol. An object described by the inventors thus relates to a genetically modified bacterium belonging to the genus Clostridium, in particular a species of Clostridium of industrial interest, in particular C. acetobutylicum, characterized in that i) it does not express the products of the hbd genes, preferably of sequence SEQ ID NO: 39 when the bacterium considered is C.acetobutylicum, and bdhB, preferably of sequence SEQ ID NO: 36 when the bacterium in question is C. acetobutylicum, or expresses non-functional versions thereof, and ii) it expresses the adh gene of C. beijerinckii of sequence SEQ ID NO: 38. In the context of the present invention, the term "hbd gene" refers in particular to the sequence SEQ ID NO: 39 (CA_C2708). The term "hbd gene" also refers to variants of said sequence SEQ ID NO: 39, in particular variants having sequence homology with said sequence SEQ ID NO: 39. In the context of the present invention, the term "bdhB gene" refers in particular to the sequence SEQ ID NO: 36 (CA_C3298) or a variant of said sequence, in particular a variant having sequence homology with said sequence SEQ ID NO: 36.In the context of the present invention, the term "CA_C0764 gene" refers in particular to the sequence SEQ ID NO: 37 or a variant of said sequence, in particular a variant having a sequence homology with said sequence SEQ ID NO: 37. A typical example of a variant according to the invention has a sequence homology with the sequence SEQ ID NO: 39, with SEQ ID NO: 36 or with the sequence SEQ ID NO: 37 of between 95% and 100%, and preferably between 96% and 100%. The sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37 and its variant are for example homologous to at least 95%, for example to at least 96%, to at least 97%, to at least 98%, or to at least 99%. According to a preferred embodiment, the sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37 and its variant have sequences that are at least 96%, at least 97%, or at least 98% homologous.The term "hbd gene" also refers to a sequence encoding a functional fragment or variant of the protein (enzyme) (S)-3-hydroxybutyryl-CoA dehydrogenase (Hbd), in particular a protein capable of / capable of exerting (S)-3-hydroxybutyryl-CoA dehydrogenase activity. In a particular embodiment, the term "hbd gene" also refers to a sequence encoding a functional fragment or variant of the Hbd protein, in particular a protein capable of / capable of exerting (S)-3-hydroxybutyryl-CoA dehydrogenase activity. The term "bdhB gene" also refers to a sequence encoding a functional fragment or variant of the protein (enzyme) NADPH-dependent Butanol dehydrogenase B (BdhB), in particular a protein capable of / capable of exerting NADPH-dependent alcohol dehydrogenase activity.In a particular embodiment, the term "bdhB gene" also refers to a sequence encoding a functional fragment or variant of the BdhB protein, in particular a protein capable of / capable of exerting an NADPH-dependent alcohol dehydrogenase activity. The term "CA_C0764 gene" also refers to a sequence encoding a functional fragment or variant of ferredoxin-NADP. + oxidoreductase (CAC0764). In a particular embodiment, the term "CA_C0764 gene" also refers to a sequence encoding a functional fragment or variant of the CAC0764 protein, in particular a protein capable of / capable of exerting a ferredoxin-NADP +oxidoreductase. The term "adh gene" also refers to a sequence encoding a functional fragment or variant of a NADP-dependent Isopropanol dehydrogenase (Adh) protein (enzyme), in particular a protein capable of / capable of exerting an enzymatic activity catalyzing the reduction of acetone to propan-2-ol. In a particular embodiment, the term "adh gene" also refers to a sequence encoding a functional fragment or variant of the Adh protein, in particular a protein capable of / capable of exerting an NADPH-dependent Isopropanol dehydrogenase activity.When this text refers to a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the products of the hbd, bdhB and / or CA_C0764 genes, or expresses non-functional versions thereof, the expression "non-functional version of the gene product" hbd, bdhB or CA_C0764 designates a protein, typically a protein identified in this text as "Hbd", "BdhB" or "CAC0764", which is non-functional, i.e., incapable of carrying out the function of the protein encoded by the wild-type version of the gene in question. By "bacteria of the genus Clostridium" is meant in particular the Clostridium species said to be of industrial interest, typically the solventogenic or acetogenic bacteria of the genus Clostridium. The expression "bacteria of the genus Clostridium" includes wild-type bacteria as well as strains derived from them, genetically modified for the purpose of improving their performance.By "Clostridium species of industrial interest" or "Clostridium bacteria of industrial interest" is meant species capable of producing, by fermentation, solvents such as ethanol, butanol, acetone or isopropanol and / or acids such as butyric acid, acetic acid or lactic acid, from sugars or oses, typically from sugars comprising 5 carbon atoms such as xylose, arabinose or fructose, from sugars comprising 6 carbon atoms such as glucose or mannose, from polysaccharides or polysaccharides such as cellulose or hemicellulose, and / or from any other source of carbon assimilable and usable by bacteria of the genus Clostridium (CO, CO2, and methanol for example).Examples of solvent-forming bacteria of interest are bacteria of the genus Clostridium producing acetone, butanol, ethanol and / or isopropanol (propan-2-ol), such as strains identified in the literature as “ABE strain” [strains carrying out fermentations allowing the production of acetone, butanol and ethanol], “IBE strain” [strains carrying out fermentations allowing the production of isopropanol (or propan-2-ol) by reduction of acetone, butanol and ethanol] and “AIBE strain” [strains carrying out fermentations allowing the production of acetone, isopropanol (or propan-2-ol), butanol and ethanol]. Solvent-forming bacteria of the genus Clostridium may be selected, for example, from, but not limited to, C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum and C.tyrobutyricum, preferably from C. acetobutylicum, C. beijerinckii, C. butyricum, C. tyrobutyricum and C. cellulolyticum, and even more preferably from C. acetobutylicum and C. beijerinckii. The acetogenic bacteria of interest are bacteria producing acids and / or solvents from CO2 and H2. Acetogenic bacteria of the genus Clostridium may be selected for example from C. aceticum, C. thermoaceticum, C. ljungdahlii, C. autoethanogenum, C. difficile, C. scatologenes and C. carboxidivorans. In a particular embodiment, the bacterium of the genus Clostridium concerned is an “ABE strain”, preferably the bacterium C. acetobutylicum, for example the strain DSM 792 (also designated strain ATCC 824 or LMG 5710) of C. acetobutylicum. In another particular embodiment, the bacterium of the genus Clostridium concerned is an “ABE strain”, preferably the bacterium C.beijerinckii, for example the strain NCIMB 8052 of C. beijerinckii. In another particular embodiment, the bacterium of the genus Clostridium concerned is an "IBE strain", preferably a subclade of C. beijerinckii selected from DSM 6423, LMG 7814, LMG 7815, NRRL B-593 and NCCB 27006. Thus, according to a preferred embodiment, the bacterium according to the invention belonging to the genus Clostridium is a Clostridium bacterium of industrial interest, in particular a solvent-forming bacterium, capable, in the wild state, of producing solvents and / or acids by fermentation from a carbon source, said carbon source being chosen for example from a sugar, CO, CO2, an alcohol, and an organic acid.In a particularly preferred embodiment, the carbon source is a sugar, in particular a sugar comprising 5 carbon atoms such as xylose or arabinose, a sugar comprising 6 carbon atoms such as glucose, fructose or mannose, or a polysaccharide or polysaccharide such as cellulose or hemicellulose. A particularly preferred bacterium belongs to the species C.acetobutylicum and, as explained above, does not express the products of the genes of sequence SEQ ID NO: 39 (CA_2708) (or a sequence at least 95% homologous, for example at least 96%, at least 97% or at least 98% thereof), of sequence SEQ ID NO: 36 (CA_3298) (or a sequence at least 95% homologous, for example at least 96%, at least 97% or at least 98% thereof), and preferably of sequence SEQ ID NO: 37 (CA_0764) (or a sequence at least 95% homologous, for example at least 96%, at least 97% or at least 98% thereof), or expresses non-functional versions of said expression products. This genetically modified bacterium further expresses the functional product of the adh gene of C. beijerinckii of SEQ ID NO: 38. The bacteria thus modified, particularly preferred, have the technical capabilities described above, i.e., they are capable of producing propan-2-ol (also identified in this text as “isopropanol”) or a mixture of propan-2-ol and ethanol. Some are capable of producing a mixture of propan-2-ol and ethanol with C3 / C2 ratios that are greatly improved compared to the ratio that can be obtained using the Δhbd mutant known to those skilled in the art (described in 2011 by Lehmann and Lütke-Eversloh). Such strains are characterized for the first time in the context of the present application. One of these strains was registered on February 17, 2023 under the deposit number LMG P-32995 in the BCCM-LMG collection (IFP 971, “Δhbd ΔbdhB::adh ΔCA_C0764”). In this strain, the hbd, bdhB and CA_C0764 genes were (jointly) inactivated. This strain also expresses the adh gene.The disclosure also relates to any bacterial derivative, clone, mutant or genetically modified version thereof, typically lacking the hbd, bdhB and CA_C0764 genes, or in which said genes have also been inactivated, and expressing a functional version of the adh gene product. A second strain was registered on February 17, 2023 under the deposit number LMG P-32994 with the BCCM-LMG collection (IFP 970, “Δhbd ΔbdhB::adh”). In this strain, the hbd and bdhB genes have been (jointly) inactivated. This strain further expresses the adh gene. The disclosure also relates to any bacterial derivative, clone, mutant or genetically modified version thereof, typically lacking the hbd and bdhB genes, or in which said genes have also been inactivated, and expressing a functional version of the adh gene product.A third strain was registered on February 17, 2023 under the deposit number LMG P-32993 with the BCCM-LMG collection (IFP 969, “Δhbd”). In this strain, the hbd gene has been inactivated. The description also relates to any bacteria derived, cloned, mutant or genetically modified version thereof, typically lacking the hbd gene, or in which said gene has also been inactivated. Another subject of the invention relates to the use of a bacterium according to the invention for producing propan-2-ol or a mixture comprising propan-2-ol and ethanol. In a particular embodiment, the bacterium according to the invention is for example capable of producing a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio greater than 0.10, for example 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18 or 0.19. In a particular preferred embodiment, the bacterium according to the invention is capable of producing a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio greater than or equal to 0.20 for example 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28 or 0.29, greater than or equal to 0.30 for example 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38 or 0.39, greater than or equal to 0.40 for example 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, or 0.49, greater than or equal to 0.50, for example 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, or 0.59, or greater than or equal to 0.60, for example 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, or 0.69, even more preferably greater than or equal to 0.70, for example 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, greater than or equal to 0.80, for example 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, or greater than or equal to 0.90, for example 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98 or 0.99.The genetically modified bacterium according to the invention can be advantageously used to produce a solvent, for example a biofuel, preferably propan-2-ol, or a mixture of solvents, for example a mixture of biofuels, preferably a mixture comprising propan-2-ol and ethanol, in particular on an industrial scale. The invention also relates to a fermentation process, typically an industrial process, involving the use of a bacterium according to the invention. Thanks to the present invention, the production of propan-2-ol is not only made possible but also greatly facilitated, as is that of a mixture comprising propan-2-ol and ethanol. The present invention offers a welcome solution which makes it possible to optimize the production of propan-2-ol, and to obtain a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio greater than 0.10.A genetically modified bacterium according to the invention can also be advantageously used to produce a bio-sourced molecule, for example a solvent, a biofuel or any (bio)chemical intermediate product, from a biomass or from a dedicated energy crop. In the context of the present invention, the term "bio-sourced molecule" means a molecule, of the alcohol or ketone type, the specificity of which is that the raw material used for its production must necessarily come from plant biomass, for example lignocellulosic biomass, and not from resources of fossil origin such as oil, coal or natural gas. These are, for example, alcohols resulting from the fermentation of sugary juices, in particular C5 (with 5 carbons) and / or C6 (with 6 carbons) carried out by "solventogenic" strains of the genus Clostridium.Examples of biosourced molecules that can be produced using the present invention are ethanol (usable as biofuel), or propan-2-ol, 1,3-butanediol and 2,3-butanediol. The invention also relates to a method for producing a recombinant bacterium according to the invention, comprising the deletion or inactivation of the hbd, bdhB and / or CA_C0764 genes so as to prevent or reduce the expression of functional Hbd and BdhB proteins, and preferably also of CA_C0764, and the transformation and genetic modification of the bacterium so as to enable it to express a functional Adh protein. The most effective known modification methods for obtaining genetically modified strains are based on homologous recombination events, which make it possible to modify the genome in a precise and stable manner.A particular production method according to the invention comprises a step of transforming the bacterium by introducing into said bacterium a nucleic acid of interest. For the purposes of the invention, the term "nucleic acid" means any natural, synthetic, semi-synthetic or recombinant DNA or RNA molecule, optionally chemically modified (i.e. comprising non-natural bases, modified nucleotides comprising, for example, a modified bond, modified bases and / or modified sugars), or optimized so that the codons of the transcripts synthesized from the coding sequences are the codons most frequently found in a bacterium of the genus Clostridium for use therein. In the case of the genus Clostridium, the optimized codons are typically codons rich in adenine ("A") and thymine ("T") bases.In the peptide sequences described in this document, the amino acids are represented by their one-letter code according to the following nomenclature: C: cysteine; D: aspartic acid; E: glutamic acid; F: phenylalanine; G: glycine; H: histidine; I: isoleucine; K: lysine; L: leucine; M: methionine; N: asparagine; P: proline; Q: glutamine; R: arginine; S: serine; T: threonine; V: valine; W: tryptophan and Y: tyrosine. In a particular embodiment described, the nucleic acid of interest comprises at least two complementary regions each of a target sequence, 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to said targeted region / portion / DNA sequence within the bacterial genome.These regions are capable of hybridizing to all or part of the complementary sequence of said region / portion / sequence, typically to a sequence as described above comprising at least 1 nucleotide, preferably at least 100 nucleotides, typically between 100 and 1000 nucleotides. The complementary regions of the target sequence present within the nucleic acid of interest can recognize, preferably target, the 5' and 3' flanking regions of the targeted sequence in a genetic modification tool known to those skilled in the art, typically any tool based on homologous recombination. In a particular preferred embodiment, a portion of the nucleic acid of interest further recognizes (at least partially binds), and preferably targets, i.e.recognizes and allows the cutting, in the genome of a Clostridium bacterium of interest, of at least one strand of i) a target sequence, ii) a sequence controlling the transcription of a target sequence, or iii) a sequence flanking a target sequence. The recognized sequence is also identified in this text as a “target sequence” or “targeted sequence”.In this same preferred particular embodiment, the nucleic acid of interest comprises at least one complementary region of the target sequence which is 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the targeted DNA region / portion / sequence within the bacterial genome and is capable of hybridizing to all or part of the complementary sequence of said region / portion / sequence, typically to a sequence comprising at least 5 nucleotides, preferably at least 5, 10, 14, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 15 and 30 nucleotides, preferably to a sequence comprising 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.The nucleic acid(s) of interest as described in the context of the present invention are capable of deleting said target sequence(s) from the genome of the bacterium or of modifying their expression, for example of modulating / regulating them, in particular of inhibiting them, preferably of modifying them so as to render said bacterium incapable of expressing one or more proteins, in particular one or more functional proteins, from said sequence(s). According to another aspect of the invention, the nucleic acid(s) of interest as described in the context of the present invention are capable of introducing a sequence of interest into the genome of the bacterium so as to render said bacterium capable of expressing one or more proteins, in particular one or more functional proteins, from said sequence(s).The “nucleic acids of interest”, typically expression cassettes or vectors, may be constructed by conventional techniques well known to those skilled in the art and may comprise one or more promoters, bacterial origins of replication (ORI sequences), termination sequences, selection genes, for example antibiotic resistance genes, and sequences (“flanked regions”) allowing the targeted insertion of the cassette or vector. ORI sequences of interest may for example be chosen from pIP404, pAMβ1, repH (origin of replication in C. acetobutylicum), ColE1 or rep (origin of replication in E. coli), or any other origin of replication allowing the maintenance of the vector, typically the plasmid, within a bacterial cell belonging to the genus Clostridium.Termination sequences of interest may be chosen, for example, from those of the adc, thl genes, the bcs operon, or any other terminator, well known to those skilled in the art, allowing the termination of transcription within a bacterial cell belonging to the genus Clostridium. Selection genes (resistance genes) of interest may be chosen from ermB, catP, bla, tetA, tetM, and / or any other gene for resistance to ampicillin, erythromycin, chloramphenicol, thiamphenicol, spectinomycin, tetracycline, or any other antibiotic, well known to those skilled in the art, which can be used to select bacteria of the genus Clostridium. The nucleic acid of interest may be a natural, synthetic RNA or produced by a recombinant technique.This nucleic acid of interest may be prepared by any method known to those skilled in the art such as, for example, chemical synthesis, in vivo transcription or amplification techniques. When the nucleic acid(s) of interest are introduced into the cell directly in the form of RNA molecules (mature or precursors), for example guide RNA (gRNA), these molecules may contain modified nucleotides or chemical modifications allowing them, for example, to increase their resistance to nucleases and thus increase their lifespan in the cell. They may in particular comprise at least one modified or unnatural nucleotide such as, for example, a nucleotide comprising a modified base, such as inosine, methyl-5-deoxycytidine, dimethylamino-5-deoxyuridine, deoxyuridine, diamino-2,6-purine, bromo-5-deoxyuridine or any other modified base allowing hybridization.The nucleic acids of interest used according to the invention can also be modified at the level of the internucleotide bond as are for example phosphorothioates, H-phosphonates or alkyl-phosphonates, or at the level of the skeleton as are for example alpha-oligonucleotides, 2'-O-alkyl riboses or PNA (Peptide Nucleic Acids) (Egholm et al., 1992). In the context of the present description, a particular example of a nucleic acid of interest, used to transform and / or genetically modify a bacterium of interest, is a DNA fragment i) recognizing a coding sequence, ii) controlling the transcription of a coding sequence, or iii) flanking a coding sequence, the enzyme Hbd (3-hydroxybutyryl-CoA dehydrogenase), the enzyme BdhB (NADPH-dependent alcohol dehydrogenase) or the pyruvate NADP ferredoxin oxidoreductase, or the protein Adh (secondary alcohol dehydrogenase).A nucleic acid of particular interest described by the inventors is for example a vector, preferably a plasmid, for example the plasmid pGRNA-Δhbd of sequence SEQ ID NO: 31, the plasmid pGRNA-ΔbdhB::adh of sequence SEQ ID NO: 33 or the plasmid pGRNA-ΔCA_C0764 of sequence SEQ ID NO: 35, described in the experimental part of the present description. The or one of the recognized sequences (target sequence(s)) is preferably one of the sequences SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37 corresponding to the hbd, bdhB and CA_C0764 genes respectively encoding the Hbd protein, the BdhB protein and the CAC0764 protein, or an amino acid sequence at least 70%, 75%, 80%, 85%, 90% or 95% identical to said protein, or a sequence comprising all or at least 95%, 96%, 97%, 98% or 99% of the sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37.In other words, the recognized sequence may be a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides of the sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37. According to another particular example, the target sequence may also be a sequence controlling the transcription of a coding sequence as described above, typically a promoter sequence, for example the promoter sequence of the “hbd” gene. (CA_C2708, SEQ ID NO: 39), that of the “bdhB” gene (CA_C3298, SEQ ID NO: 36) or that of the “CA_C0764” gene (SEQ ID NO: 37). The nucleic acid of interest then recognizes, and is therefore typically capable of binding to, a sequence controlling the transcription of a coding sequence as described above.According to another particular example, the target sequence may be a sequence flanking a coding sequence as described above, for example a sequence flanking the sequence SEQ ID NO: 39, SEQ ID NO: 36 or SEQ ID NO: 37, or a sequence at least 70% identical thereto. Such a flanking sequence typically comprises 1, 10 or 20 and 1000 nucleotides, for example between 1, 10 or 20 and 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, between 1, 10 or 20 and 100 nucleotides, between 1, 10 or 20 and 50 nucleotides, or between 1, 10 or 20 and 40 nucleotides, for example between 10 and 40 nucleotides, between 10 and 30 nucleotides, between 10 and 20 nucleotides, between 20 and 30 nucleotides, between 15 and 40 nucleotides, between 15 and 30 nucleotides or between 15 and 20 nucleotides.According to a particular aspect, the target sequence corresponds to the pair of sequences flanking such a coding sequence, each flanking sequence typically comprising at least 20 nucleotides, typically between 100 and 1000 nucleotides, preferably between 200 and 800 nucleotides.Preferably, the method according to the invention for producing a recombinant bacterium comprises transforming the bacterial cell using at least one nucleic acid of interest, for example one, two, three or four nucleic acids of interest as described above, said nucleic acid(s) of interest being capable i) of recognizing (and capable of binding at least in part) a coding sequence, controlling the transcription of a coding sequence, or flanking a coding sequence, the Hbd protein, ii) of recognizing (and capable of binding at least in part) a coding sequence, controlling the transcription of a coding sequence, or flanking a coding sequence, the BdhB protein, and preferably iii) of recognizing (and capable of binding at least in part) a coding sequence, controlling the transcription of a coding sequence, or flanking a coding sequence, the CAC0764 protein.The nucleic acid of interest as described in the context of the present invention is preferably capable of deleting said target sequence from the genome of the bacterium or of modifying its expression, for example of modulating / regulating it, in particular of inhibiting it, preferably of modifying it so as to render said bacterium incapable of expressing a protein (typically an Hbd, BdhB or CAC0764 protein), in particular a functional protein, from said sequence. In a particularly preferred embodiment, the nucleic acid of interest is capable of modifying the bacterium so as to render it incapable of expressing one and / or the other of the Hbd, BdhB or CAC0764 proteins. Another example of a nucleic acid of interest is the sequence coding for the Adh protein.According to a particular embodiment, the description relates more particularly to the use of the plasmid pGRNA-Δhbd of sequence SEQ ID NO: 31, of the plasmid pGRNA-ΔbdhB::adh of sequence SEQ ID NO: 33 and / or of the plasmid pGRNA-CA_C0764 of sequence SEQ ID NO: 35 to transform, and preferably genetically modify, a bacterium of the genus Clostridium so as to improve its capacity to produce propan-2-ol or a mixture of propan-2-ol and ethanol. It also relates to a method for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium, characterized in that it comprises a step of transforming the bacterium by introducing into said bacterium a plasmid as described in the present text, preferably a plasmid selected from the plasmid pGRNA-Δhbd of sequence SEQ ID NO: 31, the plasmid pGRNA-ΔbdhB::adh of sequence SEQ ID NO: 33 or the plasmid pGRNA-ΔCA_C0764 of sequence SEQ ID NO: 35.The description also relates to any genetically modified bacterium of the genus Clostridium obtained using such a method. The introduction into the bacterium of any nucleic acid of interest can be carried out by any method, direct or indirect, known to those skilled in the art, for example by transformation, conjugation, microinjection, transfection, electroporation, etc., preferably by electroporation (Mermelstein et al, 1993). Furthermore, these nucleic acids of interest (for example DNA fragments, RNA fragments, expression cassettes or expression vectors) can be integrated into the bacterial genome by techniques also well known to those skilled in the art.In a particular embodiment, the method for transforming, and preferably genetically modifying, a bacterium as described in the present text, comprises a step of transforming the bacterium by introducing into said bacterium a nucleic acid of interest according to the invention as described above and involves a genetic modification tool, for example a genetic modification tool selected from a CRISPR tool, an insertional mutagenesis tool, for example based on the use of type II introns (for example the Targetron® tool or the ClosTron® tool) and an allelic exchange tool (for example the ACE® tool). The method for transforming, and preferably further genetically modifying, a Clostridium bacterium may further comprise a step of obtaining, recovering, selecting or isolating the transformed bacterium, i.e. the bacterium exhibiting the desired recombination(s) / modification(s) / optimization(s).In a particular embodiment, the method according to the invention is based on the use of (implements) the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) technology / genetic tool, in particular the CRISPR-Cas (CRISPR-associated protein) genetic tool. The present invention can be implemented using a conventional CRISPR-Cas genetic tool using a single plasmid comprising a nuclease, a gRNA and a repair template as described by Wang et al. (2015). The person skilled in the art can easily define the sequence and structure of the gRNAs according to the chromosomal region or the mobile genetic element to be targeted using well-known techniques (see for example the article by DiCarlo et al., 2013).The inventors have further developed and described a genetic tool for modifying bacteria, suitable for bacteria of the genus Clostridium, usable in the context of the present invention, based on the use of two plasmids (see WO2017 / 064439, Wasels et al., 2017). In another embodiment, the method according to the invention is based on the use of an insertional mutagenesis tool, for example the use of type II introns, and for example implements the ClosTron® technology / genetic tool or the Targetron® genetic tool. Targetron® technology is based on the use of a reprogrammable group II intron (based on the Ll.ltrB intron of Lactococcus lactis), capable of integrating the bacterial genome rapidly at a desired locus (Chen et al., 2005, Wang et al., 2013), typically with the aim of inactivating a targeted gene.The mechanisms for recognizing the edited area and for inserting it into the genome by backsplicing are based on homology between the intron and the area on the one hand, and on the activity of a protein (LtrA) on the other. ClosTron® technology is based on a similar approach, supplemented by the addition of a selection marker in the intron sequence (Heap et al., 2007). This marker allows for the selection of the intron's integration into the genome, and therefore facilitates the production of the desired mutants. This genetic system also exploits type I introns. Indeed, the selection marker (called RAM for retrotransposition-activated marker) is interrupted by such a genetic element, which prevents its expression from the plasmid (a more precise description of the system: Zhong et al.). The splicing of this genetic element occurs before integration into the genome, which allows for the production of a chromosome with an active form of the resistance gene.An optimized version of the system includes FLP / FRT sites upstream and downstream of this gene, which allows the use of FRT recombinase to eliminate the resistance gene (Heap et al., 2010). In another embodiment, the method according to the invention is based on the use of an allelic exchange tool, and for example implements the ACE® technology / genetic tool. The ACE® technology is based on the use of an auxotrophic mutant (for uracil in C. acetobutylicum ATCC 824 by deletion of the pyrE gene, which also causes resistance to 5-fluoroorotic acid (5-FOA); Heap et al., 2012). The system uses the allelic exchange mechanism, well known to those skilled in the art. Following transformation with a pseudo-suicide vector (with very low copies), the integration of the latter into the bacterial chromosome by a first allelic exchange event can be verified using the resistance gene initially present on the plasmid.The integration step can be performed in two different ways, either within the pyrE locus or within another locus. In the case of integration at the pyrE locus, the pyrE gene is also placed on the plasmid, but without being expressed (no functional promoter). The second recombination restores a functional pyrE gene and can then be selected by auxotrophy (minimal medium, not containing uracil). Since the non-functional pyrE gene also has a selectable trait (sensitivity to 5-FOA), other integrations are then possible on the same model, successively alternating the state of pyrE between functional and non-functional. In the case of integration at another locus, a genomic area allowing expression of the counter-selection marker after recombination is targeted (typically, in an operon after another gene, preferably a highly expressed gene).This second recombination is then selected by auxotrophy (minimal medium not containing uracil). In the described embodiments based on the use of type II introns, and for example implementing the ClosTron® technology / genetic tool or the Targetron® genetic tool, or based on the use of an allelic exchange tool, and for example implementing the ACE® technology / genetic tool, the targeted sequence is typically one of the sequences described in the present text.The invention further relates to a kit for transforming and / or genetically modifying a bacterium of the genus Clostridium comprising at least one nucleic acid of interest as described in the present text (for example two or three nucleic acids of interest, typically a DNA fragment, each recognizing a target sequence) for transforming and preferably genetically modifying a bacterium of the genus Clostridium, and optionally one or more selection molecules.A particular kit comprises the essential elements for the operation of a CRISPR tool (typically at least one nucleic acid usable as gRNA, one nucleic acid usable as a repair template, at least one pair of primers, and an inducer allowing the expression of a nuclease, in particular a Cas9 or Cas12 type nuclease, for example MAD7), the essential elements for the operation of a tool based on the use of type II introns (typically at least one type II intron, at least one pair of primers and an inducer allowing the expression of a reverse transcriptase, for example type LtrA RT or Tel4c RT), or the essential elements for the operation of an allelic exchange tool (typically at least two nucleic acids usable as a homologous recombination template, and at least one pair of primers).The kits according to the invention may further comprise one or more consumables such as a preservation medium or a culture medium, at least one competent bacterium of the genus Clostridium (i.e. conditioned for transformation), or an explanatory leaflet. The invention typically relates to a kit for implementing a method of transformation and / or genetic modification described in the present text using a bacterium of the genus Clostridium. The invention relates in particular to the genetically modified bacterium belonging to the genus Clostridium having the essential characteristic i) of not expressing the products of the hbd and bdhB genes, and preferably CA_C0764, or of expressing non-functional versions thereof, and ii) of expressing the adh gene, as well as any bacteria derived, cloned, mutant or genetically modified version thereof, and their uses.The application also describes strain IFP 969 (“Δhbd”), registered on February 17, 2023 under deposit number LMG P-32993 with the BCCM-LMG collection, in which the hbd gene has been inactivated, as well as any derived bacteria, clones, mutants or genetically modified versions thereof, typically lacking the hbd gene, or in which said gene has also been inactivated preferably using CRISPR technology. The application also describes strain IFP 970 (“Δhbd ΔbdhB::adh”), registered on February 17, 2023 under deposit number LMG P-32994 with the BCCM-LMG collection, in which the hbd and bdhB genes have been inactivated and expressing the adh gene product, as well as any bacteria derived, cloned, mutant or genetically modified version thereof, typically lacking the hbd and bdhB genes, or in which said genes have also been inactivated, and expressing the adh gene product.It relates in particular to the use of a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the products of the hbd gene, or expresses a non-functional version of the products of the hbd gene, for example the strain IFP 969, registered on February 17, 2023 under the deposit number LMG P-32993 with the BCCM-LMG collection, to prepare a genetically modified bacterium according to the invention not expressing the products of the hbd and bdhB genes, or expressing non-functional versions thereof, and expressing the product of the adh gene.The application further describes strain IFP 971 (“Δhbd ΔbdhB::adh ΔCA_C0764”), registered on February 17, 2023 under deposit number LMG P-32995 with the BCCM-LMG collection, in which the hbd, bdhb and CA_C0764 genes have been inactivated and expressing the adh gene product, as well as any bacteria derived, cloned, mutant or genetically modified version thereof, typically lacking the hbd, bdhb and CA_C0764 genes, or in which said genes have also been inactivated, and expressing the adh gene product.It relates in particular to the use of a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the products of the hbd and bdhB genes, or expresses a non-functional version of the products of the hbd and bdhB genes, and expressing the product of the adh gene, for example the strain IFP 970, registered on February 17, 2023 under the deposit number LMG P-32994 with the BCCM-LMG collection, to prepare a genetically modified bacterium according to the invention not expressing the products of the hbd, bdhB and CA_C0764 genes, or expressing non-functional versions thereof, and expressing the product of the adh gene.The invention further relates to a kit for producing a bio-sourced molecule, for example a solvent, a biofuel or any (bio)chemical intermediate product, using a bacterium belonging to the genus Clostridium, comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the invention, for example IFP 969, IFP 970 or IFP 971, and ii) a medium, typically a preservation medium or a culture medium for said bacterium. The kit may further comprise an explanatory note. The preservation or culture medium for the genetically modified bacterium (belonging to the genus Clostridium) according to the invention present in the kit is preferably supplemented with a carbon source composed of glucose and / or at least one pentose, preferably i) glucose and / or ii) arabinose and / or i) xylose.This medium preferably comprises between 0.1 and 250 g / L, more preferably between 1 and 100 g / L, of said carbon source (composed of glucose and / or arabinose and / or xylose). The preservation or culture medium of the genetically modified bacterium is preferably an RCM type culture medium, more preferably a GAPES type culture medium, even more preferably a CGM type culture medium.The invention also relates to a particular kit for producing a solvent or a biofuel, or a mixture of solvents or biofuels, in particular propan-2-ol or a mixture comprising propan-2-ol and ethanol, using a bacterium belonging to the genus Clostridium, said kit comprising i) a bacterium (belonging to the genus Clostridium) genetically modified according to the invention, characterized in that it does not express the products of the hbd, bdhB and / or CA_C0764 genes, or expresses non-functional versions thereof, and ii) a culture medium, preferably an RCM-type culture medium, more preferably a GAPES-type culture medium, even more preferably a CGM-type culture medium, containing at least one carbon source, preferably glucose and / or arabinose and / or xylose.The invention further relates to the possible uses of the method or kit according to the invention for transforming and / or genetically modifying a bacterium of the genus Clostridium, typically a solvent-forming bacterium of the genus Clostridium, for example for generating improved variants of said bacterium. Finally, it relates to the possible uses of the method, the kit or a bacterium of the genus Clostridium transformed and preferably genetically modified according to the invention, in particular for enabling the production of bio-sourced molecules, for example solvent(s), biofuel(s) or (bio)chemical intermediate product(s), or mixtures thereof, typically on an industrial scale. The examples and figure below are intended to illustrate the invention more fully without limiting its scope.In particular, these examples present the obtaining and characterization of bacteria according to the invention, in which the inactivation of hbd, bdhB and / or CA_C0764 genes, and / or the insertion of the adh gene, is carried out according to a particular preferred embodiment using a CRISPR-Cas9 tool. Said genes can be inactivated, or introduced, according to other particular embodiments, well known to those skilled in the art, based for example on the inactivation, or the introduction, of gene by homologous recombination or by insertional mutagenesis, as explained above. FIGURE Figure 1 represents the central metabolism of C. acetobutylicum. C. acetobutylicum produces acetate, butyrate and possibly lactate during acidogenesis. During the solventogenesis phase, butyrate and acetate are reassimilated, and the carbon flow is redirected towards the production of acetone, ethanol and n-butanol.Ack, acetate kinase; Adc, acetoacetate decarboxylase; Adh, alcohol dehydrogenase; Ald, aldehyde dehydrogenase; Aldc, acetolactate decarboxylase; Als, acetolactate synthase; Bcd, butyryl-CoA dehydrogenase; Buk, butyrate kinase; CtfA-CtfB, butyrate-acetoacetate CoA-transferase (subunits A and B); Crt, crotonase; EtfA-EtfB, electron transfer flavoprotein (subunits α and β); Fnor, ferredoxin-NAD(P). +oxidoreductase; Hbd, 3-hydroxybutyryl-CoA dehydrogenase; HydA, hydrogenase; Ldh, lactate dehydrogenase; Pdc, pyruvate decarboxylase; Pfor, pyruvate ferredoxin oxidoreductase; Pta, phosphate acetyltransferase; Ptb, phosphate butyryltransferase; Thl, thiolase. EXAMPLES EXAMPLE No. 1: C. acetobutylicum strain producing a mixture of propan-2-ol and ethanol Materials and methods Culture conditions C. acetobutylicum DSM 792 (Deutsche Sammlung von Mikroorganismen und Zellkulturen, DSMZ) and C. beijerinckii DSM 6423 (DSMZ) were cultured at 34°C under anaerobic conditions (90% N2, 5% CO2, 5% N2) in 2YTG medium (tryptone 16 gL -1 , yeast extract 10 gL -1 , glucose 5 gL -1 , NaCl 4 gL -1 ). Escherichia coli NEB 10-beta (New England Biolabs, NEB) was grown at 37°C under aerobic conditions in LB medium (tryptone 10 gL -1 , yeast extract 5 gL -1 , NaCl 10 gL -1). Solid media were made by adding 15 gL -1 agarose to liquid media. If necessary, erythromycin (Em, 40 mg.L -1 ) and / or thiamphenicol (Tm, 15 mg.L -1 ) were used for C. acetobutylicum cultures. Similarly, chloramphenicol (12.5 mg.L -1 in liquid medium and 25 mg.L -1 in solid medium) and / or tetracycline (20 mg.L -1 ) were used for E. coli cultures. Nucleic acids and plasmid vectors The list of plasmids used is presented in Table 1 below. Table 1: Plasmids Characteristics a pEC500E (SEQ ID NO: 25) ermB, bla, ColE1, pAMB1 pFC002 (SEQ ID NO: 2) Derivative of pEC500E with insertion of the adh gene (Collas F. et al.) pCas9 acr(SEQ ID NO : 27) ermB, ColE1, pCB102, Pcm- tetO2 / 1-cas9, Pbgal-acrIIA4, tetR, bgaR (Wasels F. et al., 2020) pGRNAind (SEQ ID NO : 28) catP, ColE1, cas pIP4040 expression promoter (Ng Pcm-2tetO1) (Wasels F. et al., 2020) pAN2 (SEQ ID NO : 29) tetA, p15A ori, Φ3TI (Heap JT et al.) pGRNA-hbd (SEQ ID NO : 30) Derivative of pGRNAind, hbd targeting pGRNA-Δ SEQD NO : 31 pGRNA-hbd derivative, with Δhbd pGRNA-bdhB editing matrix (SEQ ID NO: 32) pGRNA derivative ind , targeting bdhB (Wasels F. et al., 2020) pGRNA-ΔbdhB::adh (SEQ ID NO : 33) Derivative of pGRNA-bdhB, with editing matrix ΔbdhB::adh pGRNA-C0764 (SEQ ID NO : 34) pGRNA ID NO : 33 ind , targeting CA_C0764 pGRNA-ΔCA_C0764 (SEQ ID NO : 35) Derived from pGRNA-bdhC, with editing matrix ΔCA_C0764 aermB, erythromycin resistance gene; catP, thiamphenicol and chloramphenicol resistance gene; tetA, tetracycline resistance gene; ColE1 and p15A ori, origins of replication in E. coli; pIP404, pAMB1 and pCB102, origins of replication in C. acetobutylicum. The engineered nucleic acids were purified using the QIAquick PCR Purification Kit (Qiagen), QIAprep Spin Miniprep Kit (Qiagen) and GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich). PCR amplifications were performed with Q5 High-Fidelity DNA Polymerase (NEB). The oligonucleotides used for plasmid construction are shown in Table 2 below. Table 2: Oligonucleotide Sequence (5'-3') P01 (SEQ ID NO: 1) TCATACTTGGAGCTAATCACCCAA P02 (SEQ ID NO: 2) AAACTTGGGTGATTAGCTCCAAGT P03 (SEQ ID NO: 3) ATGCATGTCGACCAAAATCCTTCTCTGTAAATTCATG P04 (SEQ ID NO: 4) GAAAAGGTATATTCAAAATAAGTTTACAAGAATCCCC P05 (SEQ ID NO: 5) ATTTTGAATATACCTTTTTCATTAAACAGACCTCC P06 (SEQID NO : 6) ATGCATGAATTACTGCAAATGTTTCTGATGATAAAATAG P07 : (SEQ ID NO : 7) ATTCGAGCTCGGTACCCGGGGATCCAAACTGTAGTAAACCCAAA AAGAAAGTTTC P08 (SEQ ID NO : 8) GTTATATTATA NOGTCCTA9PSGCCGQG AACCTTTCATTTTAACCCCTCCTGTTTAG P10 (SEQ ID NO : 10) CAAGCTTGCATGCCTGCAGGTCGACTAGCAAGCAATCTTAAG P11 (SEQ ID NO : 11) CCCGGTAGGTTTATAATAACTACTGCTTTAATGTAAGTC P12 (SEQAGTTTT AGGATTAACTTACTGCTTTAATGTAAGTC P13 (SEQ ID NO : 13) TCATATAGTTGGAGGAGGTCCAGC P14 (SEQ ID NO : 14) AAACGCTGGACCTCCTCCAACTAT P15 (SEQ ID NO : 15) AAAAAAGTCGACATGCATTCGATGTAATGTACTTCAGA P16 (SEQ) ID NO : AATTTAATTATTGTTATCCATAATAATTAATTAATCTCTCCTTTT P17 (SEQ ID NO : 17) TATGGATAACAATATAATTAATTTGAGTGAATTTGGA P18 (SEQ ID NO : 18) AAAAAAGGATCCCGCATTTATTAAGACATTATTTEdGACCSEQ Le 𝐶𝐸𝐸𝐶𝐶𝐶𝐶𝐶𝐶𝑔 (SEQ ID NO : 17) was constructed by cloning the hybridization product of oligonucleotides P01 and P02 into pGRNAind (SEQ ID NO: 28) using BsaI and T4 DNA ligase (NEB). The fragment obtained by knockdown PCRamplifications obtained from DSM 792 gDNA using oligonucleotide pairs P03-P04 and P05-P06 were cloned at the BamHI and SalI sites in pGRNA-hbd to obtain pGRNA-∆hbd (SEQ ID NO: 31). The fragment obtained by overlapping PCR of the amplifications obtained from DSM 792 gDNA using oligonucleotide pairs P07-P08 and P09-P10 and from DSM 6423 gDNA using oligonucleotide pair P11-P12 was cloned at the BamHI and SalI sites in pGRNA-bdhB (SEQ ID NO: 32) to obtain pGRNA-∆bdhB::adh (SEQ ID NO: 33). Plasmid pGRNA-CA_C0764 (SEQ ID NO: 34) was constructed by cloning the hybridization product of oligonucleotides P13 and P14 into pGRNAind. The fragment obtained by overlapping PCR of the amplifications obtained from DSM 792 gDNA using oligonucleotide pairs P15-P16 and P17-P18 was cloned at the BamHI and SalI sites in pGRNA-CA_C0764 to obtain pGRNA-∆CA_C0764 (SEQ ID NO: 1).ID NO: 35). Gene editing Plasmid constructs were introduced into C. acetobutylicum as described by Mermelstein LD et al.. Gene editing events were performed according to the protocol described by Wasels F. et al. (2020) and Wasels F. et al. (2017). Oligonucleotides used for confirmation of gene editing are shown in Table 3 below. Table 3: Locus Oligonucleotide Sequence (5'-3') hbd P19 (SEQ ID NO: 19) GTAATATTATAGCAGCTATTTTAAGTTTAC P20 (SEQ ID NO: 20) AAAGGTAAGGAAATGGCTGAG bdhB P21 (SEQ ID NO: 21) ACACATTGAAGGGAGCTTTT P22 (SEQ ID NO: 22) GGCAACAACATCAGGCCTTT CA_C0764 P25 (SEQ ID NO: 23) TGTTCATCGGTAACCTGTTCA P26 (SEQ ID NO: 24) ACGAAATGCCCAACTTGCAA The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, can make it possible to obtain mutants with equivalent genotypes, i.e. no longer expressing the products of the hbd genes, bdhB orCA_C0764, or expressing a non-functional version thereof. Fermentation The fermentation performances of the microorganisms described in this example were evaluated in batch. Precultures were carried out in an anaerobic chamber in a volume of 1 mL of CGM medium (KH2PO40.75 gL -1 , K2HPO40.75 gL -1 , MgSO4∙H2O 0.4 gL -1 , MnSO4∙H2O 0.01 gL -1 , FeSO4∙7H2O 0.01 gL -1 , NaCl 1.0 gL -1 , Asparagine 2.0 gL -1 , Yeast extract 5.0 gL -1 , (NH4)2SO42.0 gL -1 , Glucose 80 gL -1 ). After an 18-hour incubation, a volume of 500 µL of these precultures was used to inoculate 9.5 mL of CGM medium into flasks. Once crimped, the flasks were then incubated for 96 hours at 34°C, 100 rpm. At the end of fermentation, samples were centrifuged at 5000 g for 5 minutes, and the supernatants were diluted using an internal standard (final concentration of 0.5 gL-1 of n-propanol) and then filtered at 0.22 µm before being analyzed by chromatography. Solvent detection was carried out by gas chromatography on a PoraBOND-Q column (Agilent Technologies) with a flame ionization detector. Helium was used as the carrier gas at a flow rate of 1.6 mL.min -1, and the column heated from 50 to 250°C during a 30 min run. Acid detection was performed by high-performance liquid chromatography on an Aminex HPX-87H column (Biorad) coupled with a Spectra System RI-150 refractometer and a Waters 2487 dual λ UV detector set at 210 nm. The mobile phase consisted of a 0.1 M sulfuric acid solution, and the column temperature was set at 60°C. Unless otherwise stated, the results presented are the average of at least three independent runs. Results A Δhbd mutant was constructed in C. acetobutylicum strain DSM 792. The fermentation performances of this mutant compared to the wild-type strain are shown in Table 4 below. Table 4: Strains Solvents (gL -1 ) Ethanol Acetone Propan-2-ol n-Butanol Total DSM 792 1.1 ± 0.2 8.6 ± 0.8 0.1 ± 0.0 12.3 ± 0.7 22.1 ± 0.4 Δhbd 33.3 ± 1.3 2.9 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 36.3 ± 1.5 Acids (gL -1) Acetic acid Butyric acid Lactic acid Total DSM 792 1.6 ± 0.5 1.6 ± 0.5 0.0 ± 0.0 3.1 ± 1.0 Δhbd 0.7 ± 0.0 0.0 ± 0.0 0.5 ± 0.0 1.3 ± 0.0 As expected, this mutant is no longer capable of producing n-butanol or butyrate. It allows the production of significant quantities of ethanol, which becomes its predominant fermentation product. The quantity of acetone produced is reduced by more than 65% compared to the wild-type strain. In order to transform this mutant into a producer of propan-2-ol, the plasmid pFC002 (SEQ ID NO: 26) was introduced into this mutant. The fermentation performances of transformants of the wild-type strain and the Δhbd mutant containing the empty plasmid pEC500E (SEQ ID NO: 25) or the plasmid pFC002 (SEQ ID NO: 26) are presented in Table 5 below. Table 5: Strains Solvents (gL -1) Ethanol Acétone Propan-2-ol n-Butanol Total DSM 792 1,4 ± 0,0 7,2 ± 0,1 0,1 ± 0,0 13,9 ± 0,3 22,7 ± 0,4 pEC500E DSM 792 1,5 0,1 7,5 16,2 25,4 pFC002* Δhbd pEC500E 32,9 ± 0,5 4,4 ± 0,1 0,0 ± 0,0 0,0 ± 0,0 37,3 ± 0,4 Δhbd pFC002* 35,7 0,2 2,3 0,0 38,2 Acides (g.L -1) Acetic acid Butyric acid Lactic Total DSM 792 1.0 ± 0.1 1.3 ± 0.1 0.0 ± 0.0 2.3 ± 0.1 pEC500E DSM 792 1.5 2.5 0.0 4 pFC002* Δhbd pEC500E 0.5 ± 0.1 0.0 ± 0.0 0.0 ± 0.0 0.5 ± 0.1 Δhbd pFC002* 0.8 0.0 0.0 0.8 * DSM 792 clones pFC002 and Δhbd pFC002 were not tested in duplicate. Plasmid pFC002 (SEQ ID NO: 26) containing the adh gene from C. beijerinckii DSM 6423 allows the wild-type strain DSM 792 and the ∆hbd mutant to be transformed into producers of propan-2-ol. It should be noted that the quantity of propan-2-ol produced by the ∆hbd mutant containing the plasmid pFC002 is two times lower than the quantity of acetone produced by the same mutant containing the empty plasmid pEC500E. It therefore appears that the combination of the deletion of the hbd gene and the expression of the adh gene from C. beijerinckii DSM 6423 in C. acetobutylicum DSM 792 does not produce an efficient producer of propan-2-ol.In order to obtain a ∆hbd-derived mutant producing isopropanol in the absence of selection pressure, a Δhbd mutant ΔbdhB::adh was constructed. The bdhB gene (SEQ ID NO: 36) encodes a NADPH-dependent alcohol dehydrogenase. The fermentation performances of this mutant are presented in Table 6 below. Table 6: Strains Solvents (gL -1 ) Ratio Propan- Ethanol Acetone Propan-2-ol Total2-ol / EthanolΔhbd 33.3 ± 1.3 2.9 ± 0.2 0.0 ± 0.0 36.3 ± 1.5 0.00 Δhbd pFC002* 35.7 0.2 2.3 38.2 0.06 Δhbd 27.9 ± 1.7 0.1 ± 0.0 7.2 ± 0.5 35.2 ± 2.2 0.26 ΔbdhB::adh Acids (gL -1) Acetic acid Butyric acid Lactic Total Δhbd 0.7 ± 0.0 0.0 ± 0.0 0.5 ± 0.0 1.3 ± 0.0 Δhbd pFC002* 0.8 0.0 0.0 0.8 Δhbd 0.8 ± 0.1 0.0 ± 0.0 1.2 ± 0.2 2.0 ± 0.3 ΔbdhB::adh * The Δhbd pFC002 clone was not tested in duplicate. Surprisingly, this modification improves the propan-2-ol / ethanol ratio compared to the Δhbd mutant containing plasmid pFC002, which is multiplied by a factor of 4. Other modifications were considered to further improve the C3 ratio (acetone + propan-2-ol) / C2 (ethanol). In particular, the fermentation performances of a mutant derived from Δhbd ΔbdhB::adh, in which the gene CA_C0764 (SEQ ID NO: 37) encoding a pyruvate NADP ferredoxin oxidoreductase is deleted, are presented in Table 7. Table 7: Strains Solvents (gL -1<h2 style=";text-align:left;direction:ltr">) Ratio C3 / C2 Ethanol Acétone Propan-2-ol Total Δhbd 33,3 ± 1,3 2,9 ± 0,2 0,0 ± 0,0 36,3 ± 1,5 0,09 Δhbd 27,9 ± 1,7 0,1 ± 0,0 7,2 ± 0,5 35,2 ± 2,2 0.26 ΔbdhB::adh Δhbd 17.9 ± 0.6 4.3 ± 0.1 9.7 ± 0.2 32.0 ± 0.9 0.78 ΔbdhB::adh ΔCA_C0764 Acides (gL<h2 style=";text-align:left;direction:ltr"> -1) Acetic Ac. Butyric Ac. Lactic Total Δhbd 0.7 ± 0.0 0.0 ± 0.0 0.5 ± 0.0 1.3 ± 0.0 Δhbd 0.8 ± 0.1 0.0 ± 0.0 1.2 ± 0.2 2.0 ± 0.3 ΔbdhB ::adh Δhbd 1.3 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 1.3 ± ,0.2 ΔbdhB ::adh ΔCA_C0764 The C3 (acetone + propan-2-ol) / C2 (ethanol) ratio is improved by a factor of 3 in the Δhbd mutant ΔbdhB::adh ΔCA_C0764 compared to the Δhbd mutant ΔbdhB::adh and by a factor of 9 compared to the Δhbd mutant. Furthermore, this mutant produces a greater quantity of propan-2-ol than the DSM 792 strain containing the plasmid pFC002 (Table 6). Conclusions The results presented in this example describe the production of C. acetobutylicum mutants that no longer produce butanol or butyrate and produce a propan-2-ol / ethanol mixture with an advantageous C3 / C2 ratio, largely improved compared to the ∆hbd mutant described in the literature. REFERENCES - Collas F, Kuit W, Clément B, Marchal R, López-Contreras AM, Monot F.2012.Simultaneous production of isopropanol, butanol, ethanol and 2,3-butanediol by Clostridium acetobutylicum ATCC 824 engineered strains. AMB Expr 2:45. doi:10.1186 / 2191-0855-2-45. - Dusséaux S, Croux C, Soucaille P, Meynial-Salles I. 2013. Metabolic engineering of Clostridium acetobutylicum ATCC 824 for the high-yield production of a biofuel composed of an isopropanol / butanol / ethanol mixture. Metabolic Engineering 18:1–8. doi:10.1016 / j.ymben.2013.03.003. - Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. 2007. The ClosTron: a universal gene knock-out system for the genus Clostridium. Journal of Microbiological Methods 70:452–464. doi:10.1016 / j.mimet.2007.05.021. - Ismaiel AA, Zhu CX, Colby GD, Chen JS.1993. Purification and characterization of a primary-secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii. J Bacteriol 175:5097–5105. doi:10.1128 / jb.175.16.5097-5105.1993.- Lee J, Jang Y-S, Choi SJ, Im JA, Song H, Cho JH, Seung DY, Papoutsakis ET, Bennett GN, Lee SY. 2012. Metabolic engineering of Clostridium acetobutylicum ATCC 824 for isopropanol-butanol-ethanol fermentation. Applied and Environmental Microbiology 78:1416–1423. doi:10.1128 / AEM.06382-11. - Lehmann D, Lütke-Eversloh T. 2011. Switching Clostridium acetobutylicum to an ethanol producer by disruption of the butyrate / butanol fermentative pathway. Metabolic Engineering 13:464–473. doi:10.1016 / j.ymben.2011.04.006. - Mermelstein LD, Papoutsakis ET. 1993. In vivo methylation in Escherichia coli by the Bacillus subtilis phage phi 3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Applied and Environmental Microbiology 59:1077–1081. doi:10.1128 / aem.59.4.1077-1081.1993 - Wasels F, Jean-Marie J, Collas F, López-Contreras AM, Lopes Ferreira N.2017.A two-plasmid inducible CRISPR / Cas9 genome editing tool for Clostridium acetobutylicum. Journal of Microbiological Methods 140:5–11. doi:10.1016 / j.mimet.2017.06.010. - Wasels F, Chartier G, Hocq R, Lopes Ferreira N. 2020. A CRISPR / Anti-CRISPR Genome Editing Approach Underlines the Synergy of Butanol Dehydrogenases in Clostridium acetobutylicum DSM 792. Applied and Environmental Microbiology 86. doi:10.1128 / AEM.00408-20.
Claims
CLAIMS 1. Genetically modified bacterium belonging to the genus Clostridium, characterized in that i) it does not express the products of the hbd genes of sequence SEQ ID NO: 39 and bdhB of sequence SEQ ID NO: 36, or expresses non-functional versions thereof, and ii) it expresses the adh gene of C. beijerinckii of sequence SEQ ID NO:
38.
2. Bacterium according to claim 1, characterized in that the bacterium does not express the CA_C0764 gene of sequence SEQ ID NO:
37.
3. Bacterium according to claim 1 or 2, characterized in that the bacterium is a solventogenic bacterium, preferably C. acetobutylicum.
4. Bacteria according to claim 3, characterized in that the bacterium is the IFP970 strain registered on February 17, 2023 under the number LMG P-32994 with the BCCM-LMG collection, or a genetically modified version thereof producing a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio higher than that of a Δhbd strain. 5.Bacterium according to claim 3, characterized in that the bacterium is the strain IFP971 registered on February 17, 2023 under the number LMG P-32995 with the BCCM-LMG collection or a genetically modified version thereof producing a C3 (acetone + propan-2-ol) / C2 (ethanol) ratio higher than that of a Δhbd strain.
6. Use of a bacterium according to claim 1 to obtain a bacterium according to claim 2.
7. Use of the genetically modified bacterium according to one of claims 1 to 5, to produce propan-2-ol or a mixture comprising propan-2-ol and ethanol, preferably on an industrial scale.
8. Fermentation process involving the use of a bacterium as described in any one of claims 1 to 5. 9.Kit for producing propan-2-ol, or a mixture of propan-2-ol and ethanol, using a bacterium belonging to the genus Clostridium, comprising a genetically modified bacterium belonging to the genus Clostridium according to any one of claims 1 to 5 and a medium for preserving or culturing said bacterium.