Modified clostridium bacteria, genetic editing tool for the psol plasmid of clostridium bacteria and uses thereof
Patent Information
- Application Number
- EP2024722062
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-31
- Filing Date
- 2024-03-29
- Publication Date
- 2026-02-11
AI Technical Summary
Genetic editing of Clostridium bacteria, particularly solventogenic species like Clostridium acetobutylicum, is challenging due to low transformation efficiencies and low frequencies of homologous recombination, limiting the modification of the pSOL megaplasmid, which is essential for solvent production.
A CRISPR-Cas9 tool is used to make the pSOL megaplasmid essential for bacterial survival by deleting or inactivating genes like hbd, allowing for precise and efficient genetic modifications, and subsequent reintroduction of deleted genes to achieve desired biofuel production capabilities.
This approach enables precise and efficient modification of the pSOL megaplasmid, improving biofuel production by making the pSOL megaplasmid essential for bacterial survival, allowing for sequential modifications without integrating resistance markers, and restoring functionality as needed.
Smart Images

Figure FR2024050415_03102024_PF_FP_ABST
Abstract
Description
[0001]MODIFIED CLOSTRIDIUM BACTERIA, TOOL FOR GENETIC EDITING OF THE PSOL PLASMID OF CLOSTRIDIUM BACTERIA, AND USES The present invention relates to the genetic modification of bacteria of the genus Clostridium, typically solvent-forming bacteria of the genus Clostridium, and the possible use of a genetic editing tool suitable for modifying the pSOL megaplasmid within said bacteria. It further relates to methods, tools and kits for the elimination, modification or introduction of sequence(s) coding for, or controlling the transcription of sequence(s) coding for, products of interest, the genetically modified bacteria obtained and their uses, in particular for producing one or more biosourced molecules, for example a solvent, a biofuel or any (bio)chemical intermediate product. TECHNOLOGICAL BACKGROUND Bacteria belonging to the genus Clostridium are Gram-positive, strict anaerobic bacilli,capable of forming endospores and belonging to the phylum Firmicutes. This genus contains many species studied because of their pathogenic nature or their industrial and medical interest. The so-called industrially interesting, non-pathogenic Clostridium species are capable of producing compounds of interest such as acids and solvents from a wide variety of sugars and substrates ranging from glucose to cellulose. The growth of solvent-producing Clostridium bacteria (called "solventogenic") is said to be biphasic. Acids are produced during the acidogenesis phase, which corresponds to the exponential growth phase. When cell growth ceases and the bacteria enter the stationary phase, they enter the solventogenesis phase, reassimilate the produced acids and transform them into solvents. Clostridium acetobutylicum is naturally capable of producing a mixture of ethanol,of acetone and n-butanol during a so-called ABE fermentation (Figure 1). C. acetobutylicum is considered a model organism for the study of solventogenic microorganisms, due to the relatively high titers obtained during fermentations. Its genome was sequenced in 2001, and consists of a chromosome and the 180 Kb megaplasmid pSOL (Nölling J. et al., 2001), so named because it contains numerous genes involved in the solventogenesis phase, the products of which are indicated in dark in Figure 1. Lehmann and Lütke-Eversloh described in 2011 the construction of a ∆hbd mutant that no longer produces butyrate or butanol as fermentation end products, due to the absence of an enzyme with 3-hydroxybutyryl-CoA dehydrogenase activity in this mutant. The resulting mutant produces mainly ethanol,as well as a small amount of acetone. Knowledge of this microorganism has long been limited by the difficulties encountered during its genetic editing, in particular due to low transformation efficiencies and low frequencies of homologous recombination between an exogenous nucleic acid and the chromosome of this microorganism. Many genetic tools have been specifically developed to overcome these limitations (Joseph RC. et al., 2018). In particular, the creation of dedicated tools based on CRISPR-Cas9 technology now makes it possible to carry out specific, precise, rapid genome editing that leaves no mark on the genome. The strength of the CRISPR-Cas9 tool lies in the ability of the Cas9 nuclease to create a double-strand break within the targeted nucleic acid at a specific site. When an essential nucleic acid – such as the chromosome – is targeted, the microorganism will only be able to survive by repairing this break,via modification of the targeted sequence using a provided editing template. It is also possible to eliminate a non-essential nucleic acid, since creating a double-strand break in its sequence will lead to its loss rather than its repair. However, it is impossible, or very tedious, to edit a non-essential nucleic acid, in the case where no culture conditions allow it to be made essential). The inventor describes in the context of the present invention a strategy for editing the pSOL megaplasmid using a CRISPR-Cas9 tool via the creation of a bacterial mutant in which the inventors unexpectedly discovered,that this genetic element became indispensable. This indispensable character can be exploited in order to carry out modifications in a much simpler and faster manner than what is possible to carry out in the wild strain. The modification described in the present invention and which gives the megaplasmid pSOL its indispensable character can be canceled by reintroducing the deleted genetic information using a genetic tool such as the CRISPR-Cas9 tool for example. SUMMARY OF THE INVENTION The inventors describe, in the context of the present invention, bacteria of the genus Clostridium, typically solvent-forming bacteria, whose megaplasmid pSOL can be genetically modified. In particular, they describe, for the first time, a bacterium C. acetobutylicum whose hbd gene has been rendered non-functional and its use in a method aimed at transforming and preferably genetically modifying its plasmid pSOL,in particular using a CRISPR-Cas type tool. The inventors describe in particular the use of a genetic editing tool, preferably the CRISPR-Cas tool, to genetically modify the pSOL plasmid of a bacterium belonging to the genus Clostridium, in particular Clostridium acetobutylicum, said bacterium being distinguished from the wild-type strain in that it comprises a chromosomal modification making the presence of the pSOL plasmid essential for its survival. A particular chromosomal modification, preferred in the case of C. acetobutylicum, is the deletion or inactivation of the hbd gene. A particular genetically modified bacterium not expressing the product of the hbd gene, does not express the product of the gene of sequence SEQ ID NO: 34,or expresses a non-functional version of said product. A particular bacterium described by the inventors in the present text furthermore does not express the pdc gene of sequence SEQ ID NO: 35 or expresses a non-functional version thereof. The particular genetically modified bacterium not expressing the hbd gene product or expressing a non-functional version of said product can indeed be advantageously used to obtain a bacterium not further expressing a nucleic acid present on the pSOL megaplasmid, for example a non-essential nucleic acid such as the pdc gene, or expressing a non-functional version thereof. A particularly preferred genetically modified bacterium according to the invention corresponds to the strain identified in the present description as IFP 969,as registered on February 17, 2023 under deposit number LMG P-32993 with the BCCM-LMG collection (also identified herein as “Δhbd”). The invention also relates to any bacterium derived, cloned, mutant or genetically modified version thereof. The inventors further describe methods for producing a recombinant bacterium as described herein, in particular methods comprising the deletion or inactivation of the hbd gene, so as to prevent or decrease the expression of the corresponding functional protein. The inventors further describe the plasmids pCas9acr of sequence SEQ ID NO: 23, pEC750C of sequence SEQ ID NO: 24, pGRNAind of sequence SEQ ID NO: 25, pGRNAcon of sequence SEQ ID NO: 26, pAN2 of sequence SEQ ID NO: 27, pGRNA-hbd of sequence SEQ ID NO: 28, pGRNA-Δhbd of sequence SEQ ID NO: 29, pGRNA-pdc of sequence SEQ ID NO: 30,pGRNA-Δpdc of sequence SEQ ID NO: 31 and pGRNA-CΔhbd of sequence SEQ ID NO: 32, as well as the use of one, several or all of them for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium so as to improve its capacity for producing bio-sourced molecule(s), for example solvent(s), biofuel(s) or any (bio)chemical intermediate product(s). The invention relates in particular to a CRISPR tool, in particular CRISPR-Cas, for transforming and genetically modifying a bacterium. This genetic tool comprises a nuclease capable of targeting the megaplasmid pSOL. It further comprises i) a guide RNA (gRNA) comprising an RNA structure for binding to the Cas enzyme and a sequence complementary to a portion of the pSOL plasmid targeted by the Cas enzyme, and ii) a repair matrix allowing, by a homologous recombination mechanism,the replacement of the targeted portion within pSOL with a sequence of interest. The invention also relates to allelic exchange tools, such as the ACE® tool, for transforming and genetically modifying a bacterium. This genetic tool comprises i) a selection marker, ii) a counter-selection marker and iii) a nucleic acid, making it possible, by a homologous recombination mechanism, to modify the recognized portion or to replace the recognized portion within pSOL with a sequence of interest. The invention also relates to a method for transforming, and preferably genetically modifying, a bacterium belonging to the genus Clostridium comprising a pSOL plasmid in the wild state, as well as the genetically modified bacterium capable of being obtained by this method. Said method comprises a step of transforming the bacterium by introducing into said bacterium a plasmid selected from the plasmids pCas9acr of sequence SEQ ID NO: 23,pEC750C of sequence SEQ ID NO: 24, pGRNAind of sequence SEQ ID NO: 25, pGRNAcon of sequence SEQ ID NO: 26, pAN2 of sequence SEQ ID NO: 27, pGRNA-hbd of sequence SEQ ID NO: 28, pGRNA-Δhbd of sequence SEQ ID NO: 29, pGRNA-pdc of sequence SEQ ID NO: 30, pGRNA-Δpdc of sequence SEQ ID NO: 31 and pGRNA-CΔhbd of sequence SEQ ID NO: 32. Preferably, said method also comprises a step of deletion or inactivation of a gene making the presence of the plasmid pSOL essential for the survival of said bacterium, or otherwise involves a recombinant bacterium of the genus Clostridium already comprising a chromosomal modification making the presence of the plasmid pSOL essential for its survival. The inventors also describe the use of a bacterium belonging to the genus Clostridium distinguished from the corresponding wild strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential for its survival,in a process for genetically modifying a bacterium of the genus Clostridium, or for manufacturing a genetically modified derived bacterium. They also describe the use of a bacterium belonging to the genus Clostridium distinguished from the corresponding wild strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential for its survival, or of a bacterium whose chromosomal modification having made the presence of the plasmid pSOL essential for the survival of said bacterium has been corrected, for producing a biosourced molecule or a mixture of biosourced molecules, for example a solvent, a biofuel or a mixture of fuels, in particular on an industrial scale. The invention also relates to a fermentation process involving the use of a genetically modified bacterium as described in the present text,typically a bacterium belonging to the genus Clostridium distinguished from the wild strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential for its survival, or a bacterium whose chromosomal modification having made the presence of the plasmid pSOL essential for the survival of said bacterium has been corrected. The inventors finally describe kits, in particular a kit for transforming and preferably genetically modifying a bacterium belonging to the genus Clostridium, and a kit for producing a biosourced molecule, for example a solvent, a biofuel or any (bio)chemical intermediate product, using a bacterium belonging to the genus Clostridium, said kit comprising i) a bacterium belonging to the genus Clostridium according to the invention,in particular a bacterium distinguished from the wild strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential for its survival or a bacterium whose chromosomal modification having made the presence of the plasmid pSOL essential for the survival of said bacterium has been corrected, and ii) a preservation medium or a culture medium for said bacterium, in particular a suitable culture medium containing a sugar or a mixture of sugars, preferably a hexose and / or a pentose, even more preferably glucose, arabinose and / or xylose. DETAILED DESCRIPTION OF THE INVENTION Although used in industry for more than a century, knowledge of bacteria belonging to the genus Clostridium, in particular solvent-forming bacteria,remain very limited. A major constraint encountered by manufacturers concerns the impossibility of simply modifying the sequence of the megaplasmid pSOL using an editing technology, in particular using a technology involving a nuclease responsible for a double-strand cut, such as the Cas9 nuclease. The use of a nickase (endonuclease-type enzyme responsible for a single-strand cut at a restriction site) is conceivable but remains complicated. Despite the difficulties, well known to those skilled in the art, encountered in genetically modifying bacteria belonging to the genus Clostridium, the inventors have succeeded, for the first time in the context of the present invention, in obtaining a C. acetobutylicum bacterium whose sequence of the megaplasmid pSOL can be very advantageously modified in a simple and rapid manner,in particular using gene editing technology such as CRISPR-Cas technology. The inventors have in fact succeeded in making precise genetic modifications within the pSOL megaplasmid of the C. acetobutylicum strain DSM 792. The bacterium Clostridium acetobutylicum being considered as a model representative of solventogenic Clostridia,the experimental data disclosed in the context of the present description provide proof of concept to those skilled in the art. Such a modification strategy had never before been used in C. acetobutylicum. The inventors thus reveal for the first time that the pSOL megaplasmid is essential in a C. acetobutylicum strain whose hbd gene has been inactivated (also identified in the present text as a “∆hbd” strain). The possibility of modifying the pSOL megaplasmid with a genetic editing tool such as the CRISPR-Cas tool makes it possible to benefit from the strengths of this tool and similar tools, i.e., their precision, their ease of use, their speed, the fact that they allow modifications to be made down to the nucleotide, and the fact that they do not require the integration of a resistance marker into the genome of the microorganism to be modified,and can therefore be used to sequentially introduce an unlimited number of modifications. Thanks to the present invention, all of the genetic elements constituting in particular the genome of C. acetobutylicum can now be modified with an editing tool of this type. Once the various desired modifications have been made, the chromosomal modification that made the presence of the pSOL plasmid essential for bacterial survival can easily be corrected (for example, the deleted hbd gene can be reintroduced) in the genome at its original locus, thus making it possible to obtain a microorganism that no longer has more than the genetic modifications of interest, for example, modifications that improve its ability to produce a biofuel or a biosourced molecule, such as, for example, a solvent or a chemical intermediate, from biomass or from a dedicated energy crop. In the context of the present invention,"bio-sourced molecule" means a molecule, of the alcohol or ketone type, the specificity of which is that the raw material used for its production must necessarily come from plant biomass, for example lignocellulosic biomass, and not from resources of fossil origin such as oil, coal or natural gas. The implementation of the present invention may, more generally, be envisaged for modifying any non-essential genetic element, such as the plasmid pSOL, provided that a prior chromosomal modification has made it possible to make said "non-essential genetic element" essential for the survival of the bacterium (in at least one given culture condition of said bacterium). The present description thus relates in particular to the use of a genetic editing tool, preferably a CRISPR tool,involving an (endo)nuclease capable of targeting the pSOL megaplasmid to genetically modify said pSOL plasmid of a bacterium belonging to the genus Clostridium, said bacterium being distinguished from the wild strain in that it comprises a chromosomal modification making the presence of the pSOL plasmid essential for its survival. It also relates to allelic exchange tools for transforming and genetically modifying a bacterium. A particular allelic exchange tool is, for example, an ACE® tool comprising a nucleic acid comprising a sequence complementary to a portion of the pSOL plasmid usable as a homologous recombination template, making it possible, by a homologous recombination mechanism, to modify the recognized portion or to replace the recognized portion within pSOL with a sequence of interest. By "bacteria of the genus Clostridium", we mean in particular the Clostridium species said to be of industrial interest,typically solvent-forming or acetogenic bacteria of the genus Clostridium. The term "bacteria of the genus Clostridium" includes wild bacteria as well as strains derived from them, genetically modified for the purpose of improving their performance. By "Clostridium species of industrial interest" or "Clostridium bacteria of industrial interest" is meant species capable of producing, by fermentation, solvents such as ethanol, butanol, acetone or isopropanol and / or acids such as butyric acid, acetic acid or lactic acid, from sugars or oses, typically from sugars comprising 5 carbon atoms such as xylose, arabinose or fructose, from sugars comprising 6 carbon atoms such as glucose or mannose, from polysaccharides or polysaccharides such as cellulose or hemicellulose, and / or from any other source of carbon assimilable and usable by bacteria of the genus Clostridium (CO, CO2,and methanol for example). Examples of solvent-forming bacteria of interest are bacteria of the genus Clostridium producing acetone, butanol, ethanol and / or isopropanol (propan-2-ol), such as the strains identified in the literature as “ABE strain” [strains carrying out fermentations allowing the production of acetone, butanol and ethanol], “IBE strain” [strains carrying out fermentations allowing the production of isopropanol (or propan-2-ol) by reduction of acetone, butanol and ethanol] and “AIBE strain” [strains carrying out fermentations allowing the production of acetone, isopropanol (or propan-2-ol), butanol and ethanol]. In a particular preferred embodiment, the bacterium belonging to the genus Clostridium is the bacterium Clostridium acetobutylicum, for example a strain selected from ATCC 824, ATCC 55025, LMG 5710, DSM 792, DSM 1731, DSM 1732, LMG 5710, in particular the strain DSM 792. In the present text,the terms "genetic editing tool" refer to any genetic tool known to those skilled in the art which the latter knows does not allow modification of a genetic element not essential to the bacterial survival of the wild bacterium, such as the plasmid pSOL. This is for example a genetic tool allowing modification of the genome of a microorganism such as a bacterium whose functioning involves homologous recombination events requiring the use of a counter-selection marker. The expression "homologous recombination" refers to the event of substitution of a DNA segment by another which has identical (homologous) or almost identical regions. The most efficient known modification methods for obtaining genetically modified strains are based on homologous recombination events, these allowing modification of the genome in a precise and stable manner. In the context of the present invention,a “genetic element not essential for bacterial survival” is an element that can be deleted or inactivated without harming the survival of the bacterium, such as, for example, a plasmid or any mobilizable element not containing a gene essential for the survival of the bacterium under the culture conditions conventionally used by those skilled in the art. The terms “counter-selection marker” or “negative selection marker” designate any product capable of causing the death of the cell or of the genetically modified microorganism (for example, the bacterium) under certain conditions, controllable and known to those skilled in the art, for example, any toxic molecule (toxin) or any gene whose expression product allows the synthesis of a molecule toxic to the microorganism, as well as any nuclease capable of specifically targeting a nucleic acid sequence of interest within the microorganism,and any protein associated with the CRISPR tool. The toxin may be, for example, 5-Fluorouridine monophosphate (5-FUMP) or the MazF toxin of the MazE-MazF toxin-antitoxin system of Escherichia coli. The gene whose expression product allows the synthesis of a molecule toxic to the microorganism may be, for example, upp, whose product allows, among other things, the formation of 5-FUMP from 5-Fluorouracil, or mazF. The nuclease capable of specifically targeting (recognizing and binding) a nucleic acid sequence of interest within the microorganism may be, for example, a TALEN-type enzyme, a zinc finger nuclease, or a Cas nuclease of the Cas9 or Cas12 type, in particular Cas12a, for example MAD7. In the context of the present invention, the nucleic acid sequence of interest recognized by the nuclease is a genetic element not essential for the survival of the wild form of the microorganism of interest,for example, bacteria. The genetic editing tool is typically a tool for modifying the genetic material of a microorganism by homologous recombination, typically by mutation, insertion or deletion of a sequence of interest. It can be selected, for example, from allelic exchange tools (for example, the ACE® tool) or CRISPR tools using nucleases that perform double-strand cuts at the target DNA. Whatever the genetic editing tool chosen, the (endo)nuclease enzyme that can be used in the context of the invention must be capable of recognizing a genetic element that is not essential for the survival of the wild-type form of the microorganism of interest. In the case of the bacterium belonging to the genus Clostridium, in particular in the case of C. acetobutylicum, the enzyme preferably recognizes the megaplasmid pSOL. In a preferred embodiment, the genetic editing tool is a CRISPR tool,preferably CRISPR-Cas9 or CRISPR-Cas12, even more preferably CRISPR-Cas9. The introduction into the bacterium of any nucleic acid of interest can be carried out by any method, direct or indirect, known to those skilled in the art, for example by transformation, conjugation, microinjection, transfection, electroporation, etc., preferably by electroporation (Mermelstein et al, 1993). Furthermore, these nucleic acids of interest (for example DNA fragments, RNA fragments, expression cassettes or expression vectors) can be integrated into the bacterial genome by techniques which are also well known to those skilled in the art. A particular subject of the invention thus relates to a CRISPR-Cas genetic editing tool or an allelic exchange tool, for transforming and genetically modifying a bacterium. The term "transformation" refers to the incorporation of at least one exogenous nucleic acid by a cell,this acquisition of new sequence(s), for example new gene(s), being transient (if the exogenous nucleic acid carrying the genes can subsequently be eliminated) or permanent (in the case where the exogenous nucleic acid is integrated into the DNA of the host cell). When the genetic editing tool is a CRISPR-Cas tool, it preferably comprises a nuclease capable of targeting the pSOL megaplasmid. It further comprises i) one or more guide RNAs (gRNAs), each guide RNA comprising an RNA structure for attachment to the Cas enzyme and a sequence complementary to all or part, typically a portion, of the pSOL plasmid (of 180 kB) targeted by the Cas enzyme, and ii) a repair template allowing, by a homologous recombination mechanism, the replacement of the targeted portion within pSOL by a sequence of interest. The inventors have in particular developed tools and methods,described in patent EP3362559 and in application EP3578662 as well as in applications EP3898970 and FR3096373 (incorporated by reference), making it possible to modify the genome of this microorganism in a targeted manner. In particular, they described a tool using CRISPR-Cas technology comprising two nucleic acids, one containing the genetic elements allowing the controlled expression of the Cas nuclease (which carries out a double-strand cut within a nucleic acid molecule), and the other at least one guide RNA (gRNA) targeting the DNA region to be modified as well as a repair template. Preferably (see EP 3578662),at least one of said nucleic acids further comprises a sequence encoding an anti-CRISPR protein placed under the control of an inducible promoter. The genetic tool may alternatively further comprise a third nucleic acid encoding an anti-CRISPR protein preferably placed under the control of an inducible promoter. A particular preferred CRISPR-Cas tool comprises at least: - a “first” nucleic acid encoding at least one DNA endonuclease, for example the Cas9 enzyme, in which the sequence encoding the DNA endonuclease is placed under the control of a promoter, and - at least one “second” nucleic acid containing a repair template allowing, by a homologous recombination mechanism, the replacement of a portion of the targeted bacterial DNA (“target DNA sequence”) by the endonuclease with a “sequence of interest”. In this tool,either at least one of said nucleic acids further encodes one or more guide RNAs (gRNAs) or the genetic tool further comprises one or more guide RNAs, each guide RNA comprising a DNA endonuclease-binding RNA structure and a sequence complementary to the targeted portion of the bacterial DNA. Preferably, either at least one of said nucleic acids further comprises a sequence encoding an anti-CRISPR protein placed under the control of an inducible promoter, or the genetic tool further comprises a third nucleic acid encoding an anti-CRISPR protein placed under the control of an inducible promoter. A person skilled in the art can easily define the sequence and structure of the gRNAs according to the chromosomal region or the mobile genetic element to be targeted using well-known techniques (see for example the article by DiCarlo et al., 2013). Another particular subject of the invention relates to a genetic editing tool of the allelic exchange tool type,for example an ACE® tool, for transforming and genetically modifying a bacterium, based on the use of at least one selection marker and at least one counter-selection marker located between two nucleic sequences homologous to the regions located on either side of the nucleic sequence to be modified. The ACE tool according to the invention comprises i) a selection marker, ii) counter-selection marker, and iii) a sequence complementary to a portion of the plasmid pSOL usable as a homologous recombination template, allowing, by a homologous recombination mechanism,to modify the recognized portion or to replace the recognized portion within pSOL with a sequence of interest in addition. The expression "marker" or "marker gene" refers to a sequence encoding a marker protein under the control of functional regulatory elements allowing the synthesis of said protein in Clostridia. Selection marker genes can be divided into several subcategories depending on whether they confer positive or negative selection, and depending on whether the selection is conditional or not conditional on the presence of external substrates. So-called "positive selection" marker genes promote the growth of cells whose genome has been genetically modified. The detection of these positive selection marker genes is subject to the use of toxic agents (antibiotics,herbicides or drugs). These genes are, for example, antibiotic resistance genes such as the nptI and nptII genes conferring resistance to the antibiotic kanamycin; in this case, all cells having acquired the transgene will resist the antibiotic while the others will be killed. The use of positive selection marker genes of this type has the double "advantage" of allowing both the identification and rapid sorting of genetically modified cells (the only ones to survive), compared to those which have not acquired the nucleic acid of interest (the "transgene"). Conversely, so-called "counter-selection" or "negative selection" marker genes, "negatively selectable", cause the death of genetically modified cells or organisms under certain conditions, controllable and known to the experimenter. In the context of the invention, the selection marker typically makes it possible to select the integration event,by homologous recombination, in the host genome of the sequence of interest provided by the genetic tool. When present, the counter-selection marker makes it possible to select the second homologous recombination event linked to the excision of the genetic tool. The ACE® technology is based, for example, on the use of an auxotrophic mutant (for uracil in C. acetobutylicum ATCC 824 by deletion of the pyrE gene, which also causes resistance to 5-fluoroorotic acid (A-5-FO); Heap et al., 2012). The system uses the allelic exchange mechanism, well known to those skilled in the art. Following transformation with a pseudo-suicide vector, the integration of the latter into the bacterial chromosome by a first allelic exchange event is selected thanks to the resistance gene initially present on the plasmid. The integration step can be carried out in two different ways,either within the pyrE locus or within another locus: in the case of integration at the pyrE locus, the pyrE gene is also placed on the plasmid, but without being expressed (no functional promoter). The second recombination restores a functional pyrE gene and can then be selected by auxotrophy (minimal medium, not containing uracil). Since the non-functional pyrE gene also has a selectable characteristic (sensitivity to A-5-FO), other integrations are then possible on the same model, successively alternating the state of pyrE between functional and non-functional. In the case of integration at another locus, a genomic area allowing expression of the counter-selection marker after recombination is targeted (typically, an operon after another gene,preferably a highly expressed gene). This second recombination is then selected by auxotrophy (minimal medium not containing uracil). In the context of the present invention, the expression "target DNA sequence" designates any gene, intergenic region, promoter and / or regulatory sequence of interest chosen by a person skilled in the art, preferably located on the pSOL megaplasmid. These include genes coding for proteins of interest, for example enzymes involved in cellular metabolism. Another particular example of a target DNA sequence corresponds i) to all or part of the sequence coding the hbd gene (SEQ ID NO: 34), to a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides of said coding sequence,ii) to a sequence controlling the transcription of said coding sequence, typically a promoter sequence, or iii) a sequence flanking said coding sequence. A flanking sequence typically comprises 1, 10 or 20 and 1000 nucleotides, for example between 1, 10 or 20 and 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, between 1, 10 or 20 and 100 nucleotides, between 1, 10 or 20 and 50 nucleotides, or between 1, 10 or 20 and 40 nucleotides, for example between 10 and 40 nucleotides, between 10 and 30 nucleotides, between 10 and 20 nucleotides, between 20 and 30 nucleotides, between 15 and 40 nucleotides, between 15 and 30 nucleotides or between 15 and 20 nucleotides. The expressions "sequence of interest" and "nucleic acid of interest" designate a coding or non-coding sequence. For the purposes of the invention, "nucleic acid" means any natural, synthetic, semi-synthetic or recombinant DNA or RNA molecule, possibly chemically modified (i.e. comprising non-natural bases,modified nucleotides comprising for example a modified linkage, modified bases and / or modified sugars), or optimized so that the codons of the transcripts synthesized from the coding sequences are the codons most frequently found in a bacterium of the genus Clostridium for use therein. In the case of the genus Clostridium, the optimized codons are typically codons rich in adenine ("A") and thymine ("T") bases. In a particular embodiment described, the nucleic acid of interest comprises at least two complementary regions each of a target sequence, 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to said targeted DNA region / portion / sequence within the genome of the microorganism, for example the bacterial genome. These regions are capable of hybridizing to all or part of the complementary sequence of said region / portion / sequence,typically to a sequence as described above comprising at least 1 nucleotide, preferably at least 100 nucleotides, typically between 100 and 1000 nucleotides. The complementary regions of the target sequence present within the nucleic acid of interest can recognize, preferably target, the 5' and 3' flanking regions of the targeted sequence in a genetic modification tool known to those skilled in the art, typically any tool based on homologous recombination. In a particular preferred embodiment, a portion of the nucleic acid of interest further recognizes (at least partially binds), and preferably targets, ie recognizes and allows the cutting, in the genome of a Clostridium bacterium of interest, of at least one strand i) of a target sequence, ii) of a sequence controlling the transcription of a target sequence,or (iii) a sequence flanking a target sequence. The recognized sequence is also identified in this text as a “target sequence” or “targeted sequence”. In this same preferred particular embodiment, the nucleic acid of interest comprises at least one complementary region of the target sequence which is 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the targeted DNA region / portion / sequence within the bacterial genome and is capable of hybridizing to all or part of the complementary sequence of said region / portion / sequence, typically to a sequence comprising at least 5 nucleotides, preferably at least 5, 10, 14, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 15 and 30 nucleotides, preferably to a sequence comprising 18, 19, 20, 21, 22, 23,24 or 25 nucleotides. The nucleic acid(s) of interest as described in the context of the present invention are capable of deleting said target sequence(s) from the genome of the microorganism or of modifying their expression, for example of modulating / regulating them, in particular of inhibiting them, preferably of modifying them so as to render said microorganism incapable of expressing one or more proteins, in particular one or more functional proteins, from said sequence(s). According to another aspect of the invention, the nucleic acid(s) of interest as described in the context of the present invention are capable of introducing a sequence of interest into the genome of the microorganism so as to render said microorganism capable of expressing one or more proteins, in particular one or more functional proteins,from said sequence(s). The sequence of interest may be a mutated sequence of the target DNA sequence, for example of the target gene, promoter or regulatory sequence and / or a marker such as an antibiotic resistance gene or a color-generating enzyme. The sequence of interest may be referred to as an “exogenous nucleic acid” if its coding portion has no homology with the wild-type sequence for which genetic modification is sought. The sequence of interest may be longer or shorter than the replaced sequence (“target DNA sequence”), depending on the distance separating the two homologous regions. The nucleic acid of interest may be a natural, synthetic or recombinant RNA. This nucleic acid of interest may be prepared by any method known to those skilled in the art such as, for example, chemical synthesis,in vivo transcription or amplification techniques. When the nucleic acid(s) of interest are introduced into the cell directly in the form of RNA molecules (mature or precursors), for example guide RNA (gRNA), these molecules may contain modified nucleotides or chemical modifications allowing them, for example, to increase their resistance to nucleases and thus increase their lifespan in the cell. They may in particular comprise at least one modified or unnatural nucleotide such as, for example, a nucleotide comprising a modified base, such as inosine, methyl-5-deoxycytidine, dimethylamino-5-deoxyuridine, deoxyuridine, diamino-2,6-purine, bromo-5-deoxyuridine or any other modified base allowing hybridization. The nucleic acids of interest used according to the invention can also be modified at the level of the internucleotide bond as are, for example, phosphorothioates,H-phosphonates or alkyl-phosphonates, or at the backbone level as are for example alpha-oligonucleotides, 2'-O-alkyl riboses or PNA (Peptide Nucleic Acids) (Egholm et al., 1992). A particular example of a nucleic acid of interest, used to transform and / or genetically modify a Clostridium bacterium of interest, is a DNA fragment i) recognizing a coding sequence, ii) controlling the transcription of a coding sequence, or iii) flanking a coding sequence, the enzyme Hbd (3-hydroxybutyryl-CoA dehydrogenase). The nucleic acid of interest as described in the context of the present invention is preferably capable of deleting said target sequence from the genome of the microorganism, for example of the bacterium, or of modifying its expression, for example of modulating / regulating it, in particular of inhibiting it, preferably of modifying it so as to render said microorganism incapable of expressing a protein (typically an Hbd protein),in particular a functional protein, from said sequence. In a particularly preferred embodiment, the nucleic acid of interest is capable of modifying the microorganism so as to render it incapable of expressing the Hbd protein. The anti-CRISPR protein is a protein capable of inhibiting or preventing / neutralizing the action of the DNA endonuclease, typically Cas, and / or a protein capable of inhibiting or preventing / neutralizing the action of a CRISPR-Cas system, for example a type II CRISPR-Cas system when the nuclease is a Cas9 type nuclease, preferably during the phase of introduction of the nucleic acid sequences of the genetic tool into the bacterial strain of interest. This sequence is typically placed under the control of an inducible promoter different from the promoters controlling the expression of the DNA endonuclease and / or the gRNA(s),and is inducible by another inducing agent. This promoter may be selected, for example, from the Pbgal promoter (lactose-inducible), the promoter of the tetA gene, the xylA gene or the lacI gene, or a derivative thereof. The promoter controlling the expression of the anti-CRISPR protein makes it possible to advantageously control the action of the DNA endonuclease, for example the Cas9 enzyme, and thus facilitate the transformation of bacteria and the production of transformants having undergone the desired genetic modifications. The anti-CRISPR protein is typically an “anti-Cas9” protein or an “anti-MAD7” protein, i.e. a protein capable of inhibiting or preventing / neutralizing the action of Cas9 or MAD7. The anti-CRISPR protein is advantageously an “anti-Cas9” protein, for example selected from AcrIIA1, AcrIIA2, AcrIIA3, AcrIIA4, AcrIIA5, AcrIIC1, AcrIIC2 and AcrIIC3 (Pawluk et al,2018). Preferably, the “anti-Cas9” protein is AcrIIA2 or AcrIIA4. Even more preferably, the “anti-Cas9” protein is AcrIIA4. Such a protein is typically capable of very significantly limiting, ideally preventing, the action of Cas9, for example by binding to the Cas9 enzyme (Dong et al., 2017; Rauch et al., 2017). Another advantageously usable anti-CRISPR protein is an “anti-MAD7” protein, for example the AcrVA1 protein (Marino et al., 2018). A particular chromosomal modification, particularly preferred in the case of C. acetobutylicum, is the deletion or inactivation of the hbd gene. A particular genetically modified bacterium does not express the product of the gene of sequence SEQ ID NO: 34, or expresses a non-functional version of said product. In the context of the present invention,the term "hbd gene" refers in particular to the sequence SEQ ID NO: 34 (CA_C2708). The term "hbd gene" also refers to variants of said sequence SEQ ID NO: 34, in particular variants exhibiting sequence homology with said sequence SEQ ID NO: 34. The term "hbd gene" also refers to a sequence encoding a functional fragment or variant of the protein (enzyme) (S)-3-hydroxybutyryl-CoA dehydrogenase (Hbd), in particular a protein capable of / capable of exerting 3-hydroxybutyryl-CoA dehydrogenase activity. The term "hbd gene" also refers to a variant nucleotide sequence encoding a protein capable of binding in particular the promoter of the "hbd" gene (CA_C2708, SEQ ID NO: 34). In a particular embodiment, the term "hbd gene" also refers to a sequence encoding a functional fragment or variant of the Hbd protein, in particular a protein capable of / capable of exerting a 3-hydroxybutyryl-CoA dehydrogenase activity. Conversely,the non-functional version of the hbd gene product is incapable of performing this activity. A particular bacterium described by the inventors in the present text furthermore does not express the pdc gene of sequence SEQ ID NO: 35 or expresses a non-functional version thereof. In the context of the present invention, the term "pdc gene" refers in particular to the sequence SEQ ID NO: 35 (CA_P0025). The term "pdc gene" also refers to variants of said sequence SEQ ID NO: 35, in particular variants exhibiting sequence homology with said sequence SEQ ID NO: 35. The pdc gene is merely an example intended to demonstrate the possible implementation of the present invention with any gene of interest. A typical example of a variant according to the invention has a sequence homology with a sequence of interest such as the sequence SEQ ID NO: 34 or with SEQ ID NO: 35 of between 95% and 100%,and preferably between 96% and 100%. The sequence SEQ ID NO: 34 or SEQ ID NO: 35 and its variant are for example homologous to at least 95%, for example to at least 96%, to at least 97%, to at least 98%, or to at least 99%. According to a preferred embodiment, the sequence SEQ ID NO: 34 or SEQ ID NO: 35 and its variant have sequences homologous to at least 96%, to at least 97%, or to at least 98%. The particular genetically modified bacterium not expressing the hbd gene product or expressing a non-functional version of said product can be advantageously used to obtain a bacterium having at least one other genetic modification, typically a genetic modification of the pSOL megaplasmid. In a particular embodiment, this bacterium having at least one other genetic modification, does not express a nucleic acid present on the pSOL megaplasmid, for example a nucleic acid such as the pdc gene, the adhE1 gene, the adhE2 gene, the ctfA gene,the ctfB gene, or the adc gene, or expresses a non-functional version thereof. In another particular embodiment, this bacterium having at least one other genetic modification, expresses a modified version of a gene present on the pSOL megaplasmid and / or expresses an exogenous gene, i.e. absent from the wild-type version of the pSOL megaplasmid. A particularly preferred genetically modified bacterium according to the invention corresponds to the strain identified in the present description as IFP 969 as registered on February 17, 2023 under the deposit number LMG P-32993 with the BCCM-LMG collection (also identified in the present text as “Δhbd”). The invention also relates to any bacteria derived, cloned, mutant or genetically modified version thereof. The inventors further describe methods for producing a recombinant bacterium as described in the present text,in particular methods comprising the deletion or inactivation of the hbd gene, so as to prevent or reduce the expression of the corresponding functional protein, or even, possibly in addition, the addition of a sequence coding for a product of interest, preferably a method using CRISPR technology, as well as the genetically modified bacteria capable of being obtained by this method, in particular the IFP 969 bacterium. When the method implemented uses CRISPR technology, it typically comprises the steps of a method described in patent EP3362559 or in application EP3578662. The inventors further describe nucleic acids used to transform a bacterium, or a population of bacteria,belonging to the genus Clostridium. Such a nucleic acid is typically in the form of an expression cassette (or "construct") such as, for example, a nucleic acid comprising at least one transcriptional promoter or regulatory sequence of interest, operably linked (in the sense understood by a person skilled in the art) to one or more sequences (coding or not) of interest, for example to an operon comprising several coding sequences of interest whose expression products contribute to the performance of a function of interest within the bacterium, or a nucleic acid further comprising an activator sequence and / or a transcription terminator. It is typically in the form of a vector, circular or linear, single or double stranded, for example a plasmid, a phage, a cosmid, an artificial or synthetic chromosome, comprising one or more expression cassettes as defined above. Preferably,the vector is a plasmid. The nucleic acids of interest, typically the expression cassettes or vectors, may be constructed by conventional techniques well known to those skilled in the art and may comprise one or more promoters, bacterial origins of replication (ORI sequences), termination sequences, selection genes, for example antibiotic resistance genes, and sequences (“flanked regions”) allowing the targeted insertion of the cassette or vector. Furthermore, these expression cassettes and vectors may be integrated into the bacterial genome by techniques well known to those skilled in the art. ORI sequences of interest may be chosen from pIP404, pAMβ1, repH (origin of replication in C. acetobutylicum), ColE1 or rep (origin of replication in E. coli), or any other origin of replication allowing the maintenance of the vector, typically the plasmid,within a bacterial cell belonging to the genus Clostridium. Termination sequences of interest may be chosen from those of the adc, thl genes, the bcs operon, or any other terminator, well known to those skilled in the art, allowing the termination of transcription within a bacterial cell. Selection genes (resistance genes) of interest may be chosen from ermB, catP, bla, tetA, tetM, and / or any other gene for resistance to ampicillin, erythromycin, chloramphenicol, thiamphenicol, spectinomycin, tetracycline or any other antibiotic that can be used to select bacteria of the genus Clostridium well known to those skilled in the art. The plasmids pCas9acr of sequence SEQ ID NO: 23, pEC750C of sequence SEQ ID NO: 24, pGRNAind of sequence SEQ ID NO: 25, pGRNAcon of sequence SEQ ID NO: 26, pAN2 of sequence SEQ ID NO: 27, pGRNA-hbd of sequence SEQ ID NO: 28, pGRNA-Δhbd of sequence SEQ ID NO: 29, are thus described.pGRNA-pdc of sequence SEQ ID NO: 30, pGRNA-Δpdc of sequence SEQ ID NO: 31 and pGRNA-CΔhbd of sequence SEQ ID NO: 32, as well as the use of one, several or all of them for transforming, and preferably genetically modifying, a bacterium of the genus Clostridium so as to improve its capacity for producing biofuel(s) and / or biosourced molecule(s). The invention also relates to a method for transforming, and preferably genetically modifying, a bacterium belonging to the genus Clostridium comprising a pSOL plasmid in the wild state, preferably C. acetobutylicum, as well as the genetically modified bacterium capable of being obtained by this method. Said method comprises a step of transforming the bacterium by introducing into said bacterium a homologous recombination modification tool as described above, typically an expression cassette or vector,for example a plasmid selected from the plasmids pCas9acr of sequence SEQ ID NO: 23, pEC750C of sequence SEQ ID NO: 24, pGRNAind of sequence SEQ ID NO: 25, pGRNAcon of sequence SEQ ID NO: 26, pAN2 of sequence SEQ ID NO: 27, pGRNA-hbd of sequence SEQ ID NO: 28, pGRNA-Δhbd of sequence SEQ ID NO: 29, pGRNA-pdc of sequence SEQ ID NO: 30, pGRNA-Δpdc of sequence SEQ ID NO: 31 and pGRNA-CΔhbd of sequence SEQ ID NO: 32. In a particular embodiment in which the editing tool is a CRISPR tool,the transformation step is preferably carried out in the presence of an agent inducing the expression of the anti-CRISPR protein encoded by one of the sequences of the editing tool. The method preferably also comprises a step of culturing the transformed bacterium. This culture step can be carried out on a medium not containing (or under conditions not involving) the agent inducing the expression of the anti-CRISPR protein when the latter is used, and typically allowing the expression of the ribonucleoprotein complex DNA endonuclease and gRNA, for example Cas9-gRNA (in order to stop the production of said anti-CRISPR protein and to allow the action of the endonuclease). Preferably, the method for transforming, and preferably genetically modifying, a bacterium belonging to the genus Clostridium comprising a pSOL plasmid in the wild state comprises a step of genetic modification, typically of deletion or inactivation,of the gene(s) making the presence of the pSOL plasmid essential for the survival of said bacterium, or otherwise involves a recombinant bacterium of the genus Clostridium already comprising a chromosomal modification making the presence of the pSOL plasmid essential for its survival. The deletion or inactivation step is preferably carried out using a CRISPR-type genetic editing tool, for example of the CRISPR-Cas type. In a particular embodiment, the bacterium of the genus Clostridium comprising a chromosomal modification making the presence of the pSOL plasmid essential for its survival is a bacterium lacking the hbd gene or comprising a non-functional hbd gene. The method for transforming, and preferably genetically modifying, a bacterium belonging to the genus Clostridium comprising a pSOL plasmid in the wild state preferably comprises a step of introducing into the bacterium a genetic tool according to the invention. The method for transforming,and preferably genetically modifying, a bacterium belonging to the genus Clostridium comprising a pSOL plasmid in the wild state preferably comprises an additional step of genetic modification of the transformed bacterium using a genetic tool according to the invention, preferably a CRISPR type tool, for example of the CRISPR-Cas type,so as to correct the chromosomal modification that made the presence of the plasmid pSOL essential to the survival of said bacterium by restoring the wild-type version of the corresponding sequence. A particular method according to the invention is characterized in that the bacterium of the genus Clostridium is a bacterium of the genus Clostridium lacking the hbd gene or comprising a non-functional hbd gene and in that the additional step of genetic modification of the transformed bacterium aims to reintroduce the hbd gene into the genome of said bacterium or to make it functional. The inventors also describe the use of a bacterium belonging to the genus Clostridium distinguished from the corresponding wild-type strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential to its survival, in a method of genetic modification of a bacterium of the genus Clostridium,or to manufacture a genetically modified derived bacterium. A preferred subject matter thus relates to the use of a recombinant bacterium according to the invention, preferably the bacterium identified in the present description as IFP 969 as registered on February 17, 2023 under the deposit number LMG P-32993 with the BCCM-LMG collection (also identified in the present text as “Δhbd”), in a method for genetic modification / improvement of a bacterium of the genus Clostridium. Such a bacterium is typically usable as a laboratory tool for obtaining genetically improved strains of bacteria of the genus Clostridium. The inventors thus also describe the use of a bacterium belonging to the genus Clostridium distinguished from the corresponding wild-type strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential for its survival,or a bacterium whose chromosomal modification having made the presence of the plasmid pSOL essential for the survival of said bacterium has been corrected, to manufacture a genetically modified derived bacterium, usable on an industrial scale to produce a biosourced molecule or a mixture of biosourced molecules, for example a solvent, a biofuel or any (bio)chemical intermediate product, in particular a mixture of fuels, or directly to produce one or more biosourced molecule(s), in particular on an industrial scale. The present description also relates to the derived recombinant bacteria thus obtained. It also relates to the use of the derived recombinant bacterium thus obtained, to produce, thanks to the expression of the nucleic acid(s) of interest voluntarily introduced into its genome, one or more biofuel(s) and / or biosourced molecule(s),preferably on an industrial scale. The invention also relates to a fermentation process involving the use of a genetically modified bacterium as described in the present text, typically a bacterium belonging to the genus Clostridium distinguished from the wild strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential to its survival, or a bacterium whose chromosomal modification having made the presence of the plasmid pSOL essential to the survival of said bacterium has been corrected. The inventors finally describe kits, in particular a kit for transforming and preferably genetically modifying a bacterium belonging to the genus Clostridium, and a kit for producing a biofuel, a biosourced molecule or a mixture of one and / or the other, using such a bacterium. The kit for transforming and preferably genetically modifying a bacterium belonging to the genus Clostridium,preferably C. acetobutylicum, preferably comprises at least one nucleic acid of interest as described in the present text (for example two or three nucleic acids of interest, typically DNA fragments, each recognizing a target sequence) and all or part of the elements of a genetic editing tool as described in the present text making it possible to transform, and typically genetically modify a bacterium belonging to the genus Clostridium, preferably C. acetobutylicum, so that it comprises a chromosomal modification making the presence of the plasmid pSOL essential for its survival and / or to correct the chromosomal modification having made the presence of the plasmid pSOL essential for its survival. This kit may further comprise one or more consumables such as for example a preservation medium or a culture medium, one or more gRNAs, a nucleic acid usable as a repair template, at least one pair of primers,a nuclease, one or more selection molecules, an inducer adapted to an inducible promoter present within the genetic editing tool, at least one competent bacterium of the genus Clostridium (i.e. conditioned for transformation), preferably C. acetobutylicum, etc. It may otherwise comprise the essential elements for the operation of an allelic exchange tool (typically at least two nucleic acids usable as a homologous recombination template, and at least one pair of primers). The invention relates more particularly to a kit for producing one or more bio-sourced molecule(s), for example a solvent or a mixture of solvents, a biofuel or a mixture of biofuels, an intermediate (bio)chemical product or a mixture of such intermediate products, using a bacterium belonging to the genus Clostridium, preferably C. acetobutylicum,comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the invention (preferably C. acetobutylicum), i.e., a bacterium distinguished from the wild strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential for its survival, for example IFP 969, or a bacterium whose chromosomal modification having made the presence of the plasmid pSOL essential for the survival of said bacterium has been corrected, and ii) a medium, typically a preservation medium or a culture medium for said bacterium. The kit may further comprise an explanatory note. The invention further relates to the possible uses of the method or kit according to the invention for transforming and / or genetically modifying a bacterium of the genus Clostridium, typically a solventogenic bacterium of the genus Clostridium (preferably C. acetobutylicum),for example to generate improved variants of said bacterium. Finally, it relates to the possible uses of the method, the kit or a bacterium of the genus Clostridium transformed and preferably genetically modified according to the invention (preferably C. acetobutylicum), in particular to enable the production of biosourced molecules, for example solvents, biofuels, (bio)chemical intermediates, or mixtures thereof, typically on an industrial scale. A particular kit comprises an improved variant of the bacterium whose chromosomal modification having made the presence of the plasmid pSOL essential to the survival of said bacterium has been corrected,typically a variant whose plasmid pSOL has been genetically modified so as to allow or improve the production of one or more biosourced molecule(s). Each of the kits according to the invention may comprise one or more consumables such as, for example, a preservation medium or a culture medium, one or more gRNAs, a nuclease, one or more selection molecules, an inducer adapted to an inducible promoter present within the genetic editing tool, etc. The preservation or culture medium of the genetically modified bacterium (belonging to the genus Clostridium) according to the invention present within the kit is preferably supplemented with a carbon source composed of glucose and / or at least one pentose, preferably i) glucose and / or ii) arabinose and / or i) xylose. This medium preferably comprises between 0.1 and 250 g / L, more preferably between 1 and 100 g / L,of said carbon source (composed of glucose and / or arabinose and / or xylose). The preservation or culture medium of the genetically modified bacterium is preferably an RCM type culture medium, more preferably a GAPES type culture medium, even more preferably a CGM type culture medium. The examples and figures below are intended to illustrate the invention more fully without limiting its scope. In particular, these examples present the obtaining and characterization of bacteria according to the invention, in which the inactivation of the hbd gene, that of another gene of interest and / or the insertion of at least one additional gene (simulating a gene of interest), is carried out according to a particular preferred embodiment using a CRISPR-Cas9 tool. Said genes can be inactivated, or introduced, according to other particular embodiments, well known to those skilled in the art, based for example on the inactivation,or gene introduction by homologous recombination or insertional mutagenesis, as explained above. FIGURE [Fig 1] Figure 1 represents the central metabolism of C. acetobutylicum. C. acetobutylicum produces acetate, butyrate, and eventually lactate during acidogenesis. During the solventogenesis phase, butyrate and acetate are reassimilated, and the carbon flux is redirected toward the production of acetone, ethanol, and n-butanol. Ack, acetate kinase; Adc, acetoacetate decarboxylase; Adh, alcohol dehydrogenase; Ald, aldehyde dehydrogenase; Aldc, acetolactate decarboxylase; Als, acetolactate synthase; Bcd, butyryl-CoA dehydrogenase; Buk, butyrate kinase; CtfA-CtfB, butyrate-acetoacetate CoA-transferase (subunits A and B); Crt, crotonase; EtfA-EtfB, electron transfer flavoprotein (subunits α and β); Fnor, ferredoxin-NAD(P), +oxidoreductase; Hbd, 3-hydroxybutyryl-CoA dehydrogenase; HydA, hydrogenase; Ldh, lactate dehydrogenase; Pdc, pyruvate decarboxylase; Pfor, pyruvate ferredoxin oxidoreductase; Pta, phosphate acetyltransferase; Ptb, phosphate butyryltransferase; Thl, thiolase. EXPERIMENTAL PART: Materials and methods Strains, plasmids and culture media C. acetobutylicum DSM 792 (Deutsche Sammlung von Mikroorganismen und Zellkulturen, DSMZ) was cultivated at 34°C under anaerobic conditions (90% N2, 5% CO2, 5% N2) in 2YTG medium (tryptone 16 gL -1 , yeast extract 10 gL -1 , glucose 5 gL -1 , NaCl 4 gL -1 ). Escherichia coli NEB 10-beta (New England Biolabs, NEB) was grown at 37°C under aerobic conditions in LB medium (tryptone 10 gL -1 , yeast extract 5 gL -1 , NaCl 10 gL -1 ). Solid media were made by adding 15 gL -1agarose to liquid media. If necessary, erythromycin (Em, 40 mg.L -1 ) and / or thiamphenicol (Tm, 15 mg.L -1 ) were used for C. acetobutylicum cultures. Similarly, chloramphenicol (12.5 mg.L -1 in liquid medium and 25 mg.L -1 in solid medium) and / or tetracycline (20 mg.L -1 ) were used for E. coli cultures. The plasmids used in this study are shown in Table 1 below. Table 1: Plasmid Characteristics a pCas9acr (SEQ ID NO: 23) ermB, ColE1, pCB102, Pcm-tetO2 / 1-cas9, Pbgal-acrIIA4, tetR, bgaR (Wasels F. et al., 2020) pEC750C (SEQ ID NO: 24) catP, ColE1, pIP404 (Wasels F. et al., 2017) pGRNA ind(SEQ ID NO : 25) Derivative of pEC750C containing a RNA expression cassette (Pcm- 2tetO1 promoter) (Wasels F. et al., 2020) pGRNAcon (SEQ ID NO : 26) Derivative of pEC750C containing a minipromoter cassette (Wasels F. et al., 2020) pAN2 (SEQ ID NO : 27) tetA, p15A ori, Φ3TI (Heap JT et al.) pGRNA-hbd (SEQ ID NO : 28) Derived from pGRNAind, targeting hbd pGRNA-Δhbd (SEQ ID NO : 29) Derived from pGRNA-hbd, with editing matrix Δhbd pGRNA-pdc (SEQ ID NO: 30) Derivative of pGRNAcon, targeting pdc pGRNA-Δpdc (SEQ ID NO: 31) Derivative of pGRNA-pdc, with editing matrix pGRNA-ΔC : 32) pGRNAind derivative, targeting the pGRNA-Chbd Δhbd editing array (SEQ ID NO : 33) pGRNA-hbd derivative, with editing array allowing insertion of hbd aermB, erythromycin resistance gene; catP, thiamphenicol and chloramphenicol resistance gene; tetA, tetracycline resistance gene; ColE1 and p15A ori, origins of replication in E. coli; pIP404, pAMB1 and pCB102, origins of replication in C. acetobutylicum. Plasmid construction Nucleic acids were purified using the QIAquick PCR Purification Kit (Qiagen), QIAprep Spin Miniprep Kit (Qiagen) and GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich). PCR amplifications were performed with Q5 High-Fidelity DNA Polymerase (NEB). The oligonucleotides used for plasmid construction are shown in Table 2 below. Table 2: Oligonucleotide Sequence (5'-3') P01 (SEQ ID NO: 1) TCATACTTGGAGCTAATCACCCAA P02 (SEQ ID NO: 2) AAACTTGGGTGATTAGCTCCAAGT P03 (SEQ ID NO: 3) ATGCATGTCGACCAAAATCCTTCTCTGTAAATTCATG P04 (SEQ ID NO: 4) GAAAAGGTATATTCAAAATAAGTTTACAAGAATCCCC P05 (SEQ ID NO: 5)ATTTTGAATATACCTTTTTCATTAAACAGACCTCC P06 (SEQ ID NO : 6) ATGCATGAATTCTGCAAATGTTTCTGATGATAAAATAG P07 (SEQ ID NO : 7) TAAGGTACACCACACATTAGGTGA P08 (SEQ ID NO : 8) AAACTCACCTAATGTACGT09 (GTSEQ ID NO : 9) AAAAAAGTCGACGCGATCATAATCAGATTCTTTAC P10 (SEQ ID NO : 10) TTTAAAGGTTAACGGTCTAACAAATATCTTC P11 (SEQ ID NO : 11) TTAGACCGTTAACCTTTAAAGTACAAAGTGAAAC P12 (SEQ ID NO : 12) AAAAAAGTCGATCCAATCAAAGTGAAAC P12 (SEQ ID NO : 12) 13) TCATAGAATCCCCATTATCAAATG P14 (SEQ ID NO : 14) AAACCATTTGATAATGGGGATTCT P15 (SEQ ID NO : 15) TTGAAGCTTGAGCTCGGTACCCGGGCTTACCCTTGTATTCTAGTTTCTTGCC P16 (SEQ ID NO : 16) GGGGATTATCAAATCCCCATTTTTTATATAATAATTTTAGAGGAGGG A P17 (SEQ ID NO : 17) GGGGATTTGATAATCCCCATTCTTGTAAACTTATTTTGAATAATCG P18 (SEQ ID NO : 18) TCGAGATCTCCATGGACGCGTGACGACGCTTACTATTAGGGGAGGGGGGGGGGGGG pGRNA-hbd (SEQ ID NO : 28) was constructed by cloning the hybridization product of oligonucleotides P01 and P02 into pGRNAind (SEQ ID NO : 25) using BsaI and T4 DNA ligase (NEB). Thefragment obtained by overlapping PCR of amplifications obtained from DSM 792 gDNA using oligonucleotide pairs P03-P04 and P05-P06 was cloned at BamHI and SalI sites in pGRNA-hbd to obtain pGRNA-∆hbd (SEQ ID NO: 29). Plasmid pGRNA-pdc (SEQ ID NO: 30) was constructed by cloning the hybridization product of oligonucleotides P07 and P08 into pGRNAcon (SEQ ID NO: 26) using BsaI and T4 DNA ligase (NEB). The fragment obtained by overlapping PCR of the amplifications obtained from DSM 792 gDNA using oligonucleotide pairs P09-P10 and P11-P12 was cloned at BamHI and SalI sites in pGRNA-pdc to obtain pGRNA-∆pdc (SEQ ID NO: 31). The plasmid pGRNA-C∆hbd (SEQ ID NO: 32) was constructed by cloning the hybridization product of oligonucleotides P13 and P14 into pGRNAind using BsaI and T4 DNA ligase (NEB). pGRNA-Chbd (SEQ ID NO: 33) was obtained by HiFi assembly (NEB) of thepGRNA-C∆hbd digested with BamHI and SalI and amplification products obtained from DSM 792 gDNA using oligonucleotide pairs P15-P16 and P17-P18. Gene editing Plasmid constructs were introduced into C. acetobutylicum as described by Mermelstein LD et al.. Gene editing events were selected as described by Wasels F. et al. (2020) and Wasels F. et al. (2017). Oligonucleotides used for confirmation of gene editing are shown in Table 3 below. Table 3: Locus Oligonucleotide Sequence (5'-3') hbd P19 (SEQ ID NO: 19) GTAATATTATAGCAGCTATTTTAAGTTTAC P20 (SEQ ID NO: 20) AAAGGTAAGGAAATGGCTGAG pdc P21 (SEQ ID NO: 21) TTGGCGCTGTTAATGGGCTA P22 (SEQ ID NO: 22) ACCCAGCTAAATGAATGGCCT The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, may make it possible to obtain mutants with equivalent genotypes, i.e.no longer expressing the hbd and pdc gene products, or expressing a non-functional version of them. Fermentation The fermentation performances of the microorganisms described in this study were evaluated in batch. Precultures were carried out in an anaerobic chamber in a volume of 1 mL of CGM medium (KH2PO40.75 gL -1 , K2HPO40.75 gL -1 , MgSO4∙H2O 0.4 gL -1 , MnSO4∙H2O 0.01 gL -1 , FeSO4∙7H2O 0.01 gL -1 , NaCl 1.0 gL -1 , Asparagine 2.0 gL -1 , Yeast extract 5.0 gL -1 , (NH4)2SO42.0 gL -1 , Glucose 80 gL -1). After an 18-hour incubation, a volume of 500 µL of these precultures was used to inoculate 9.5 mL of CGM medium into flasks. Once crimped, the flasks were then incubated for 96 hours at 34°C, 100 rpm. At the end of fermentation, samples were centrifuged at 5000 g for 5 minutes, and the supernatants were diluted using an internal standard (final concentration of 0.5 gL -1 of n-propanol) and then filtered at 0.22 µm before being analyzed by chromatography. Solvent detection was carried out by gas chromatography on a PoraBOND-Q column (Agilent Technologies) with a flame ionization detector. Helium was used as the carrier gas at a flow rate of 1.6 mL.min -1, and the column heated from 50 to 250°C during a 30 min run. Acid detection was performed by high-performance liquid chromatography on an Aminex HPX-87H column (Biorad) coupled with a Spectra System RI-150 refractometer and a Waters 2487 dual λ UV detector set at 210 nm. The mobile phase consisted of a 0.1 M sulfuric acid solution, and the column temperature was set at 60°C. The results presented are the average of at least three independent runs. Results A Δhbd mutant was constructed in C. acetobutylicum strain DSM 792. The fermentation performances of this mutant compared to the wild-type strain are shown in Table 4 below. Table 4: Strains Solvents (gL -1 ) Ethanol Acetone Propan-2-ol n-Butanol Total DSM 792 1.1 ± 0.2 8.6 ± 0.8 0.1 ± 0.0 12.3 ± 0.7 22.1 ± 0.4 Δhbd 33.3 ± 1.3 2.9 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 36.3 ± 1.5 Acids (gL -1) Acetic acid Butyric acid Lactic acid Total DSM 792 1.6 ± 0.5 1.6 ± 0.5 0.0 ± 0.0 3.1 ± 1.0 Δhbd 0.7 ± 0.0 0.0 ± 0.0 0.5 ± 0.0 1.3 ± 0.0 This mutant is no longer capable of producing n-butanol or butyrate. It allows the production of significant quantities of ethanol, which becomes its predominant fermentation product. The quantity of acetone produced is reduced by more than 65% compared to the wild-type strain. To reduce the amount of ethanol produced by this mutant, the pSOL megaplasmid containing the adhE1 and adhE2 genes encoding enzymes with acetaldehyde dehydrogenase (Ald) activity was targeted using the CRISPR-Cas9 tool (described in application WO2017 / 064439) used for the creation of the ∆hbd mutant. The loss of the megaplasmid is easily achievable in the wild-type strain, and only requires the introduction of a plasmid allowing the expression of a gRNA targeting this nucleic acid (Wasels et al., 2017).The frequency of obtaining transformants of the wild strain containing the plasmid pCas9acr with the plasmid pEC750C is of the order of 10. 1 at 10 2 cfu.µg ADN -1 . The frequency of obtaining transformants of the wild strain containing the plasmid pCas9 acr with a plasmid derived from pGRNA con targeting the microorganism's chromosome and not containing an editing template for the targeted locus, in the presence of anhydrotetracycline (aTc), the inducer of Cas9 expression, is zero. In addition, the frequency of obtaining transformants of the wild-type strain containing the pCas9 plasmid acr with a plasmid derived from pGRNA con targeting the pSOL megaplasmid in the presence of aTc is of the order of 10 1 at 10 2 cfu.µg ADN -1 . Analysis of the transformants obtained shows that they have lost the pSOL megaplasmid. The frequency of obtaining transformants of the ∆hbd mutant containing the pCas9 plasmidacr with plasmid pEC750C is usually in the order of 10 3 cfu.µg ADN -1. Surprisingly, the transformation frequency of this mutant with a plasmid derived from pGRNAcon targeting the pSOL megaplasmid in the presence of aTc and not containing an editing template for the targeted locus is zero. This result indicates that the pSOL megaplasmid is essential in the ∆hbd mutant and cannot be eliminated, unlike what is observed in the wild-type strain. It therefore becomes possible to use the CRISPR-Cas9 tool to make precise modifications within the megaplasmid in the ∆hbd mutant. As an example, the plasmid pGRNA-∆pdc was used to inactivate the pdc gene located on pSOL. Transformation of the wild-type strain DSM 792 with this plasmid induces the loss of the pSOL megaplasmid in the resulting transformants. On the other hand, it was possible to obtain ∆hbd ∆pdc mutants whose fermentation performances are presented in Table 5 below. Table 5: Solvent Strains (gL -1) Ethanol Acetone Propan-2-ol n-Butanol Total DSM 792 1.1 ± 0.2 8.6 ± 0.8 0.1 ± 0.0 12.3 ± 0.7 22.1 ± 0.4 Δhbd 33.3 ± 1.3 2.9 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 36.3 ± 1.5 Δhbd Δpdc 32.7 ± 0.7 4.5 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 37.3 ± 0.9 Acids (gL -1) Acetic acid Butyric acid Lactic Total DSM 792 1.6 ± 0.5 1.6 ± 0.5 0.0 ± 0.0 3.1 ± 1.0 Δhbd 0.7 ± 0.0 0.0 ± 0.0 0.5 ± 0.0 1.3 ± 0.0 Δhbd Δpdc 0.2 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.2 ± 0.0 Following the various genetic edits that can be carried out in the pSOL megaplasmid using the CRISPR-Cas9 tool, the latter can be used to reintroduce the hbd gene, and thus only retain the other modifications, located on the megaplasmid and / or on the chromosome. This complementation at the locus can be carried out for example with the plasmid pGRNA-Chbd (SEQ ID NO: 33) which allows the reintroduction of a functional gene which does not impact the performance of the microorganism compared to the wild strain. The performance of DSM 792 hbd mutants C from the ∆hbd mutant are presented in Table 6 below. Table 6: Solvent Strains (gL -1) Ethanol Acetone Propan-2-ol n-Butanol Total DSM 792 1.1 ± 0.2 8.6 ± 0.8 0.1 ± 0.0 12.3 ± 0.7 22.1 ± 0.4 Δhbd 33.3 ± 1.3 2.9 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 36.3 ± 1.5 hbd C 1.8 ± 0.4 6.7 ± 0.1 0.1 ± 0.0 12.3 ± 0.1 20.9 ± 0.6 Acids (gL -1 ) Acetic acid Butyric acid Lactic acid Total DSM 792 1.6 ± 0.5 1.6 ± 0.5 0.0 ± 0.0 3.1 ± 1.0 Δhbd 0.7 ± 0.0 0.0 ± 0.0 0.5 ± 0.0 1.3 ± 0.0 hbd C0.9 ± 0.0 0.2 ± 0.1 0.1 ± 0.1 1.2 ± 0.0 The results obtained show that the complementation of the hbd gene is functional and that the mutant in which the gene has been reintroduced at its original locus behaves in the same way as the wild-type strain. Conclusions During this work, the inventors have succeeded in demonstrating the possibility and the interest of using a CRISPR-Cas9 tool to carry out precise genetic modifications within the pSOL megaplasmid of the C. acetobutylicum strain DSM 792. This strategy can be considered for the modification of any genetic element not essential to the survival of the microorganism as long as a prior chromosomal modification makes it indispensable ( / essential) to the survival of the bacterium (in at least one given culture condition). Such a modification had never been identified in C.acetobutylicum, and the fact that the pSOL megaplasmid is essential in the ∆hbd strain is unexpected. The ability to modify the pSOL megaplasmid with CRISPR-Cas9 allows one to benefit from the strengths of the tool, which are its precision, ease of use, speed, and the fact that it allows modifications to be made down to the nucleotide. All the genetic elements constituting the genome of C. acetobutylicum can now be modified with a tool of this type. Once the various desired modifications have been made, the hbd gene can easily be reintroduced into the genome at its original locus, resulting in a microorganism possessing only the modifications of interest. REFERENCES - DiCarlo, JE, Norville, JE, Mali, P., Rios, X., Aach, J., & Church, GM (2013). Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic acids research, 41(7), 4336-4343. - Dong, D., Guo, M., Wang, S., Zhu, Y., Wang, S., Xiong, Z., ...& Huang, Z. (2017). Structural basis of CRISPR–SpyCas9 inhibition by an anti-CRISPR protein. Nature, 546(7658), 436-439. -Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. 2007. The ClosTron: a universal gene knock-out system for the genus Clostridium. Journal of Microbiological Methods 70:452–464. doi:10.1016 / j.mimet.2007.05.021. - Joseph RC, Kim NM, Sandoval NR. 2018. Recent Developments of the Synthetic Biology Toolkit for Clostridium. Front. Microbiol.9:154. doi:10.3389 / fmicb.2018.00154. - Lehmann D, Lütke-Eversloh T. 2011. Switching Clostridium acetobutylicum to an ethanol producer by disruption of the butyrate / butanol fermentative pathway. Metabolic Engineering 13:464–473. doi:10.1016 / j.ymben.2011.04.006. - Marino, N. D., Zhang, J. Y., Borges, A. L., Sousa, A. A., Leon, L. M., Rauch, B. J., ... & Bondy-Denomy, J. (2018). Discovery of widespread type I and type V CRISPR-Cas inhibitors. Science, 362(6411), 240- 242. - Mermelstein LD, Papoutsakis ET. 1993.In vivo methylation in Escherichia coli by the Bacillus subtilis phage phi 3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Applied and Environmental Microbiology 59:1077–1081. doi:10.1128 / aem.59.4.1077-1081.1993. - Nölling J, Breton G, Omelchenko MV, Makarova KS, Zeng Q, Gibson R, Lee HM, Dubois J, Qiu D, Hitti J, Wolf YI, Tatusov RL, Sabathe F, Doucette-Stamm L, Soucaille P, Daly MJ, Bennett GN, Koonin EV, Smith DR. 2001. Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J Bacteriol 183:4823–4838. doi:10.1128 / JB.183.16.4823-4838.2001. - Pawluk, A., Davidson, A. R., & Maxwell, K. L. (2018). Anti-CRISPR: discovery, mechanism and function. Nature Reviews Microbiology, 16(1), 12-17. - Rauch, B. J., Silvis, M. R., Hultquist, J. F., Waters, C. S., McGregor, M. J., Krogan, N. J., & Bondy- Denomy, J. (2017). Inhibition of CRISPR-Cas9 with bacteriophage proteins.Cell, 168(1-2), 150-158. - Wasels F, Jean-Marie J, Collas F, López-Contreras AM, Lopes Ferreira N.2017. A two-plasmid inducible CRISPR / Cas9 genome editing tool for Clostridium acetobutylicum. Journal of Microbiological Methods 140:5–11. doi:10.1016 / j.mimet.2017.06.010. - Wasels F, Chartier G, Hocq R, Lopes Ferreira N. 2020. A CRISPR / Anti-CRISPR Genome Editing Approach Underlines the Synergy of Butanol Dehydrogenases in Clostridium acetobutylicum DSM 792. Applied and Environmental Microbiology 86. doi:10.1128 / AEM.00408-20.
Claims
CLAIMS 1. Use of a gene editing tool, preferably the CRISPR-Cas tool, for genetically modifying the pSOL plasmid of a Clostridium acetobutylicum bacterium, said bacterium being distinguished from the wild-type strain in that it comprises a chromosomal modification making the presence of the pSOL plasmid essential for its survival.
2. Use according to claim 1, characterized in that the bacterium belonging to the genus Clostridium lacks the hbd gene or comprises a non-functional hbd gene.
3. Use according to claim 2, characterized in that the bacterium belonging to the genus Clostridium is the strain IFP 969 registered on February 17, 2023 under the number LMG P-32993 with the BCCM-LMG collection, and a genetically modified version thereof. 4.A method for transforming, and preferably genetically modifying, a bacterium belonging to the genus Clostridium comprising a pSOL plasmid in the wild state, characterized in that the method comprises the deletion or inactivation of a gene making the presence of the pSOL plasmid essential for the survival of said bacterium, or in that the bacterium of the genus Clostridium is a recombinant bacterium comprising a chromosomal modification making the presence of the pSOL plasmid essential for its survival.
5. A method according to claim 4, characterized in that the bacterium of the genus Clostridium comprising a chromosomal modification making the presence of the pSOL plasmid essential for its survival is a bacterium lacking the hbd gene or comprising a non-functional hbd gene. 6.Method according to any one of claims 4 or 5, characterized in that it comprises a step of transforming the bacterium using a CRISPR tool and a step of genetic modification of the transformed bacterium so as to correct the chromosomal modification which made the presence of the plasmid pSOL essential for the survival of said bacterium by restoring the wild-type version of the corresponding sequence.
7. Method according to claim 6, characterized in that the bacterium of the genus Clostridium is a bacterium lacking the hbd gene or comprising a non-functional hbd gene and in that the additional step of genetic modification of the transformed bacterium aims to reintroduce the hbd gene into the genome of said bacterium or to make it functional.
8. Genetically modified bacterium belonging to the genus Clostridium capable of being obtained by the method according to any one of claims 4 to 7.
9. Use according to one of claims 1 to 3, method according to one of claims 4 to 7, or bacterium according to claim 8, characterized in that the bacterium of the genus Clostridium is a solventogenic bacterium comprising a pSOL plasmid in the wild state, preferably C. acetobutylicum.
10. Use of a bacterium belonging to the genus Clostridium distinguished from the wild strain in that it comprises a chromosomal modification making the presence of the pSOL plasmid essential for its survival, in a method of genetic modification of a bacterium of the genus Clostridium, or for manufacturing a genetically modified derived bacterium. 11.Use of a bacterium belonging to the genus Clostridium distinguished from the wild strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential for its survival or of a bacterium according to claim 8, for producing a biosourced molecule, for example a solvent or a biofuel, or a mixture of biosourced molecules.
12. Fermentation process involving the use of a bacterium belonging to the genus Clostridium distinguished from the wild strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential for its survival or of a bacterium according to claim 8. 13.Kit for producing a bio-sourced molecule, for example a solvent or a biofuel, using a bacterium belonging to the genus Clostridium, comprising i) a bacterium belonging to the genus Clostridium distinguished from the wild strain in that it comprises a chromosomal modification making the presence of the plasmid pSOL essential for its survival or a bacterium according to claim 8, and ii) a medium for preserving or culturing said bacterium.