Temperature-sensitive baculovirus expression vector system for the production of baculovirus virion-free biopharmaceuticals
Patent Information
- Application Number
- EP2024725026
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-04-26
- Filing Date
- 2024-04-26
- Publication Date
- 2026-03-04
AI Technical Summary
The current baculovirus/insect cell technology produces large amounts of contaminating baculovirus virions, which are difficult and costly to remove, leading to reduced yield and quality of biopharmaceutical products, especially for intracellular VLPs and AAV vectors, due to their co-production with biopharmaceuticals.
A temperature-sensitive baculovirus system is developed where essential genes for baculovirus particle formation and secretion, such as GP41 and VP1054, are mutated to prevent virion production at non-permissive temperatures, allowing for the production of biopharmaceuticals free from contaminating virions.
This approach significantly reduces the production of baculovirus virions by up to 1000-fold at non-permissive temperatures, enhancing the yield and purity of biopharmaceutical products like VLPs and AAV vectors, making the process more efficient and cost-effective.
Smart Images

Figure 000042 
Figure 000043 
Figure 000044
Abstract
Description
[0001]P134699PC00 Title: Temperature-sensitive baculovirus expression vector system for the production of baculovirus virion-free biopharmaceuticals FIELD: The invention relates to temperature-sensitive baculoviruses that can be used for the production of a biopharmaceutical product for human or veterinary use. INTRODUCTION The baculovirus / insect cell expression system is an important production system for biopharmaceutical manufacture (Liu et al., 2013. Protein Express Purif 90: 104–116 ; Van Oers et al., 2015. J Gen Virol 96: 6–23; Chambers et al., 2018. Current Protocols Protein Science 91: 5-4). Large scale production of vaccines and gene therapy vectors can be performed using the Sf9 cell / Autographa californica multiple nuclear polyhedrovirus (AcMNPV) baculovirus system (Smith et al., 2009. Mol Therapy 17: 1888-1896; Cox, 2012. Vaccine 30: 1759-1766), but other baculoviruses and other cell lines are also being used. The baculovirus expression vector system excels in terms of efficient cell infection, high expression levels, post- translational modifications, scalability, flexibility and safety. The market for baculovirus-derived products has a promising perspective, now that vaccines for human use became available, including Cervarix®, FluBlok®, Nuvaxovid® (NVX- CoV2373), and VidprevtynTMBeta. Especially (enveloped) Virus-Like Particles ((e)VLPs) have a bright future for vaccine purposes because of their excellent biosafety when compared to classical vaccines and the improved immunological properties in comparison to subunit vaccines (Metz and Pijlman, 2011. J Invertebrate Pathol 107: S16-S30; Pijlman, 2015. Biotech J 10: 659-670). Moreover, baculovirus expression vector systems play an increasingly important role in the manufacturing of GMP grade adeno-associated virus (AAV) vectors for clinical use. Since the marketing authorization for Uniqure’s Glybera®, an AAV-based gene therapy product produced in insect cells, the interest of large pharmaceutical companies in gene therapy applications has constantly been increasing, and several other products have been registered meanwhile. The current baculovirus / insect cell technology, however, is characterized by the co-production of large amounts of two types of baculovirus particles being budded viruses (BVs) and occlusion-derived viruses (ODVs) (Figure 1A). Baculovirus BVs are needed to start the initial infection of cultured cells and newly produced BVs are secreted during infection into the culture medium. Contrary, ODVs accumulate in the nucleus of infected cells and are only needed for in vivo infection of caterpillars. These contaminating virions (especially BVs) are produced in large amount and contaminate a biopharmaceutical product such as a recombinant protein, a recombinant viral vector such as AAV, or VLPs. Residual baculovirus virions in biopharmaceutical formulations may enter mammalian / human cells and some baculovirus promoters might be activated (Kenoutis et al., 2006. J Virol 80: 4135-4146; Murges et al., 1997. J Gen Virol78: 1507-1510) or trigger an immune response (Abe and Matsuura, 2010. Current Gene Therapy 10: 226-231; Ono et al., 2014. J Virol 88: 2157-2167). For all human applications the final product has to be free of residual contaminating baculovirus virions and baculovirus DNA from a safety and regulatory point of view (see www at mdpi.com / 2076-393X / 9 / 12 / 1504). The extra downstream purification steps to remove the baculovirus virions are laborious and costly (Vicente et al., 2011. J Invertebrate Pathology 107: S42-S48). In addition, final yield and quality of a biopharmaceutical product can drastically decline when trying to reach a desired purity level. Prevention of baculovirus virion formation is therefore important for the production of a biopharmaceutical product, especially the production of intracellular VLPs and AAV vectors, as well as of extracellular secreted products (e.g. glycoprotein subunits, enveloped VLPs, and AAV to some extent). To avoid the inclusion of baculovirus virions, genes that are essential for virus production, such as genes encoding VP80 and GP64, have been deleted from a viral vector, allowing a trans-complementing cell line expressing said protein to produce infecting viruses, while a final production step is performed in a non- complementing cell line thereby minimizing production of baculovirus virions (Marek et al., 2011. Biotechnol Bioeng 108: 1056-1067; Chaves et al., 2018. J Gen Virol 99: 265–274). Recently, a CRISPR-Cas mediated approach was used to hamper production of VP80 or GP64 during a final production step (Bruder and Aucoin, 2023. Vaccines 11: 225). However, the limitations of such a system are that two cell lines (complementation cells and production cells) are needed. In addition, there is a risk of complementation / recombination between the baculovirus vector and the gene in the complementing cell line; there may be issues with genetic stability of the complementing cell line, and there is a need for high multiplicity of infection (MOI) to infect the production cell line. The co-production of baculovirus virions is a problem for all biopharmaceutical products produced with the baculovirus expression vector system (BEVS) and hampers the broad scale application of this system. There is thus a need for methods and means to minimize the presence of baculovirus virions in a biopharmaceutical product such as a recombinant protein, including a subunit vaccine, a viral vector such as AAV, virus-like particles or viral replicon particles, prior to the purification of said biopharmaceutical product. BRIEF DESCRIPTION OF THE INVENTION The current baculovirus expression system produces baculovirus particles that contaminate the biopharmaceutical product and must be removed during downstream purification. These necessary purification steps to remove baculovirus particles leads to considerable reduction of the final product yield and are often difficult and costly. For certain virus-like particles (VLPs), and especially for enveloped (e)VLPs, purification is almost impossible as these products share many (bio)physical characteristics (size, charge, density) with baculovirus particles (Vicente et al., 2011. J Invert Pathol 107: S42-S48). The possibility to combine the high production efficiency of a baculovirus expression system with a technology characterized by reduced biological contamination, will represent a breakthrough for applying the baculovirus expression system for the production of biologicals. The improved features of the technology will open the way for development of new products, which could not be produced using the currently existing technology, or not with the same quality / purity / or not cost effective. As such the developed technology will have a significant impact for the industrialization of the production process of (e)VLPs and viral vectors (including AAV) and has high potential to become the new standard for production of all clinical grade baculovirus expression system-based products. In one aspect, the invention provides a method for the production of a biopharmaceutical product, comprising (a) infecting an insect cell with a baculovirus, said baculovirus comprising an exogenous gene coding for a biopharmaceutical product, and (b) maintaining the infected insect cell under conditions such that the biopharmaceutical product is produced, wherein the genome of said baculovirus comprises a mutation in a gene such that the encoded baculovirus protein, and hence the baculovirus vector, is temperature-sensitive (ts). Said gene may be a gene that is essential for baculovirus particle formation and / or secretion. The infected insect cell is used during production of the biopharmaceutical product at a non-permissive temperature for said ts baculovirus (see Figure 1C). Said ts baculovirus preferably is, or is derived from, an Alphabaculovirus such as Autographa californica multicapsid nucleo-polyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV). In methods of the invention, the gene that is essential for baculovirus particle formation and / or secretion may be selected from open reading frame (ORF) 81, encoding GP41, and ORF54, encoding VP1054, of AcMNPV, or from a gene that is homologous to ORF81 or ORF54 of a related virus. In methods of the invention, the temperature of the infected insect cell may be shifted during production of the biopharmaceutical product to a temperature above a critical temperature. In methods of the invention, the ts baculovirus comprising an exogenous gene coding for a biopharmaceutical product may be produced before step (a) in an insect cell at a permissive temperature below the critical temperature (see Figure 1B). In methods of the invention, the gene comprising the ts mutation replaces the corresponding wild type gene and is placed at the native locus of the corresponding wild type gene, or is placed and is expressed from another locus in the baculovirus genome. Said gene comprising the ts mutation may be expressed under control of its native promoter, or an another promoter. Said other promoter may be the baculovirus p10 promoter. In methods of the invention, the biopharmaceutical product may be a recombinant protein, an (enveloped) virus-like particle, a viral replicon particle, or a viral vector, such as an adeno associated virus (AAV). Said biopharmaceutical product preferably is a recombinant adeno associated virus. In methods of the invention, the biopharmaceutical product preferably is encoded by an exogenous gene or open reading frame inserted into the baculovirus genome. Said exogenous gene or open reading frame preferably is under the control of a promoter such as the polyhedrin or p10 promoter. In methods of the invention, other baculovirus genes, such as cathepsin, chitinase, p26, p74 and / or pl0,may be disrupted in the ts baculovirus genome. Disruption of one or more of these genes may result in improved production of a biopharmaceutical product. In one aspect, the invention provides a use of a baculovirus with a temperature-sensitive (ts) mutation in a gene that is essential for baculovirus particle formation and / or secretion, for production of a biopharmaceutical product as described herein. FIGURE LEGENDS Figure 1. Overview of temperature-sensitive baculovirus expression vector system. A standard baculovirus expression vector system produces a mixture of the biopharmaceutical compound, like VLPs or AAVs, and contaminating baculovirus particles. Moreover, ODVs are formed in the nuclei of infected cells (A). The temperature-sensitive baculovirus efficiently produces new baculovirus virions at the permissive temperature of 27 °C (B). A simple temperature-switch to elevated temperatures (>33 °C) inhibits baculovirus particle formation and results in a contaminant-free biopharmaceutical product (C). Figure 2. Construction and phenotyping gp41 temperature-sensitive bacmids. (a) The SacB-CAT cassette was inserted into the gp41 locus (a1). A second counter- selection recombineering step replaced the SacB-CAT cassette for the gp41ts gene (a2), resulting in the Acgp41ts bacmid (a3). (b). Low MOI infections of the gp41ts mutants expressing eGFP from the polh promoter were incubated at 27 °C, 32 °C, 33 °C or 34 °C and were monitored for viral spread by eGFP production. The panels in the second row show enlargements of the indicated boxes. Figure 3. Comparison between the standard BEVS and the bac-free BEVS with Acgp41ts-eGFP. (a) Sf9 cells were infected at MOI=10 TCID50 / cell. At 3 hpi the inoculum was washed and cells were incubated at 27 °C or the lowest non- permissive temperature of 33°C. Fluorescence microscopy pictures at 4 dpi (a). Pictures are representative of the entire well and replicate infections. The BV titers were determined at 4 days post-infection (b). The average and standard deviation of 6 replicates are shown and the detection limit of the assay is indicated by a dotted line. Figure 4. Transmission electron microscopy images. Sf9 cells were infected with Ac- eGFP (a) and Acgp41ts-eGFP (b) and incubated at 34 °C. TEM images were prepared as described in materials and methods. Nu=nucleus, Cy=cytoplasm, VS=virogenic stroma. Figure 5. Design and results of the FMDV VLP construct. The FMDV Pa / 2A region as well as the 3C domain was inserted in the baculovirus constructs under control of the polh (ph) promoter. Polyprotein cleavage is also indicated (a). Immunostaining directed at VP2 region on western blot analysis in non-mutant (AcbAce56) and gp41ts mutant baculovirus at 27 ºC in infected cells and culture fluid (b). The AcGFP virus was used as negative control in the immunostaining. Figure 6. Comparison of wt (Bace56) and gp51ts BEVS for the production of FMDV VLPs. Sf9 cells were infected at high (a) and low (b) MOI and incubated at 27 °C or 33 °C. At 3 days post infection the culture medium as harvested and BVs were quantified using end point dilution assays. The amount of VP0 in the cells (c) and in the culture fluid (d) was determined with Western blotting using an anti- antibody against the VP2 domain, visualizing mainly VP0. An immunoblot (d lower panel) with anti-VP39 antiserum was used as a proxy for BV presence in the culture medium. Figure 7. Expression of WNV prME with the BEVS and ts BEVS. Sf9 cells were infected with Ac-prME and the ts mutant Acgp41ts-prME at MOI=5 TCID50 / cell. Both viruses have prME expressed from the polh promoter and with the A261C stabilizing mutation in WNV E. At 3 hpi, the cell monolayer was washed and cells were incubated at 27°C or 33°C. (a) Representative microscopy pictures at 3 dpi. Mock-infected Sf9 cells (healthy) and AcGFP-infected cells served as controls. (b) Infectious BV titer in the culture fluids at 3 dpi, measured by end- point dilution assay on Sf9ET cells at 27 °C. The average of 4 replicate infections + / - stdev is visualized, the dotted line indicates the detection limit of the assay. (c) Western blot immunodetection of concentrated cell pellet and culture fluid at 3 dpi, stained for the E protein with monoclonal panflavivirus antibody 4G2. Figure 8. Average baculovirus titer at 72, 96, and 120 hours after MOI 10 ActsGp41-eGFP infection. Each bar in the bar chart represents an average titer value of a technical duplicate experiment. The baculovirus titer was determined in technical duplicate by Endpoint Dilution Assays. Error bars represent the spread in titer outcome between technical duplicate measurements. The 27 °C control was kept at 26 °C in the biocontrol, the 33 °C control was a small culture flask. Figure 9. Time course profiles of Acgp41TS baculovirus titers for MOI 0.01 TCID50 / mL infections in bioreactors. Temperatures were shifted between 33-40 hpi and one control run remained at 27 °C. Baculovirus titers were measured with TCID50 assays. The dashed grey line indicates the measurement threshold of the TCID50 assay. Figure 10. gp41ts BEVS for the production of FMDV VLPs. The P1 / 2A FMDV structural cassette and 3C protease were expressed from the p10 promoter in the gp41ts BEVS (A). Sf9 cells in suspension were infected at high MOI and incubated at 33 °C. At 3 days post infection the culture medium as harvested and BVs were quantified using end point dilution assays (B) and qPCR (C). FMDV VP0 in the culture fluid was determined with Western blotting using an antibody against the VP2 domain, visualizing mainly VP0 (D, lower panel), and quantified by ELISA (E). An immunoblot (D upper panel) with anti-VP39 antiserum was used as a proxy for BV presence in the culture medium. Figure 11. Expression of WNV prME with the gp41ts BEVS. The gp41ts virus had prME expressed from the polh promoter and with the A261C stabilizing mutation in WNV E (A), resulting in partly cysteine-linked dimerization of E protein compared to wildtype E (B). Sf9 cells were infected with Acgp41ts-prME at MOI=5 TCID50 / cell. At 3 hpi, the cell monolayer was washed and cells were incubated at 27°C or 33°C. Infectious BV titer in the culture fluids at 3 dpi, measured by end-point dilution assay on Sf9ET cells at 27 °C (C). The average of 4 replicate infections + / - stdev is visualized. Western blot immunodetection of concentrated cell pellet and culture fluid at 3 dpi, stained for the E protein with monoclonal panflavivirus antibody 4G2 (D). Figure 12. Scale-up of gp41ts BEVS in shake flask and stirred-tank bioreactor. ExpiSf9 cells were infected with Acgp41ts-eGFP, the ts virus expressing gp41ts from its native locus, either in shake flasks or stirred-tank bioreactor. Infection was performed with high MOI, and the temperature was increased to 33 °C at the start of the infection (0 hpi or 3 hpi). The percentage of infected cells was monitored by flow cytometry (A) and budded virus production was monitored over time (B). A shake flask incubated at 27 °C served as control. Figure 13. Phenotyping gp41 and vp1054 temperature-sensitive bacmids. A ts mutation was introduced in gp41 (gp41ts), vp1054 (vp1054ts), or a double mutation in both gp41 and vp1054 (vp1054ts / gp41ts). The non-mutated bacmid (Ac-egfp) served as control. Low MOI infections of the mutants expressing eGFP from the polh promoter were incubated at 27 °C, 31 °C 32 °C, 33 °C or 34 °C and were monitored for viral spread by eGFP production. The white boxes indicate a single- cell infection phenotype. DETAILED DESCRIPTION OF THE INVENTION Definitions The term “baculovirus”, as is used herein, refers to a member of a family of viruses that infects Arthropods, including insects. The baculovirus family comprises a total of four genera termed Alphabaculovirus, Betabaculovirus, Gammabaculovirus and Deltabaculovirus, of which viruses of the genus Alphabaculovirus are preferred for this invention. Baculoviruses comprise a circular, double-stranded DNA genome ranging from 80 to 180 kbp. The best studied Alphabaculovirus is Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV). Said virus comprises a 134 kilo base pairs (kbp) genome. Bombyx mori nucleopolyhedrovirus (BmNPV) is another Alphabaculovirus comprising a genome of 128 kbp. The term “biopharmaceutical product”, as is used herein, refers to a product that may be used as a medicine, vaccine or other form of prophylaxis. The term especially refers to a recombinantly produced drug such as a recombinant protein, for example a hormone or a protein for use as a vaccine, a viral vector, for example recombinant adeno associated virus (AAV) or another viral vector for use in gene therapy, as well as an enveloped or non-enveloped virus-like-particle (VLP) or viral replicon particles (VRP) for human and animal vaccine purposes. A biopharmaceutical product may correspond to a single chain protein or peptide, or may be a complex structure such as an antibody, an (enveloped) VLP, or a VRP. In the latter cases, the individual components may be expressed from a single recombinant baculovirus, or from more than one recombinant baculovirus. A biopharmaceutical may be administered to a subject in need thereof for prophylactic or curative treatment of a disease or condition in said subject. Said subject may be an animal, preferably a domesticated animal, or a human. The term “domesticated animal”, as is used herein, refers to an animal that has been selectively bred and genetically adapted to live alongside humans. A domesticated animal may be a companion animal, such as a dog or cat, a farm animal such as a sheep, cow, or pig, or a draft animal such as a horse, donkey or camel. The term “exogenous”, as is used herein, refers to a genetic element, such as a gene of part of a gene such as a promoter, that is introduced at a non-natural position in a genome, such as a baculovirus genome. Said genetic element may originate from a baculovirus genome, in which case it is introduced at a non- natural location, also termed exogenous location, within the genome. As an alternative, said genetic element may originate from another organism, such as another virus, from a cell such as an insect or animal cell, or may be synthetic, meaning that it did not occur in nature. The genetic elements may also be adapted from their natural form for optimal expression levels of a biopharmaceutical product in insect cells at an elevated temperature. The term “baculovirus virion”, as is used herein, refers to either an occlusion- derived virus (ODV) virion which is naturally present in a polyhedrin protein matrix or a budded virus (BV) virion, which is released from infected host cells later during the secondary infection. Both particle types comprise a similar baculovirus nucleocapsid, a large oligomer composed of many copies of various protein subunits that encapsulates the genomic DNA. The term “a gene that is essential for baculovirus particle formation and / or secretion”, as is used herein, refers to a gene that encodes a capsid protein that is present in ODV and BV particles, such as VP39 protein, p6.9 protein, ORF54 (VP1054), 38K, Ac53, VP91, VLF-1, BV / ODV-C42, P78 / 83, BV / ODV-EC27, 49K, and VP80 (Zhao et al., 2019. Viruses 11: E595), AC102, EC27, C42, P78 / 83 (Hepp et al., 2018. J Virol 92: e00111-e00118), or a protein that is involved in egress of nucleocapsids from the host nucleus such as GP41 and GP64. The term “temperature sensitive mutation”, as is used herein, refers to a variant of a gene that encodes a protein that normally functions at a reduced temperature, termed permissive temperature, but has an altered function, preferably is inactive, at a higher temperature (i.e. non-permissive temperature). Said permissive temperature is below a critical temperature, such as below 32 ºC, or below 30 ºC. Said permissive temperature preferably is above 20 ºC, such as 25 ºC, 26 ºC, 27 ºC, 28 ºC, or 29 ºC. Said non-permissive temperature is preferably a temperature at which the biopharmaceutical product remains active. Said non- permissive temperature is above a critical temperature, such as above 32 ºC, above 32.5 ºC, above 33 ºC, above 33.5 ºC, above 34 ºC, above 34.5 ºC, above 35 ºC, above 35.5 ºC, above 36 ºC, above 36.5 ºC, or above 37 ºC. A temperature sensitive mutation may be present in one or more genes that are essential for baculovirus particle formation and / or secretion, including GP41 and / or ORF54. The term virus-like particle (VLP), as is used herein, refers to a virus-derived structure made up of one or more molecules with the ability to self-assemble, mimicking the form and size of a virus particle but lacking the genetic material of said virus. A VLP is able to enter a host cell, but is unable to replicate and form particles in the infected host cell and thus is not able to spread from said host cell to other cells. The term “viral replicon particle (VRP)”, as is used herein, refers to a virus- derived particle that carries un incomplete viral genome in combination with a gene of interest to allow replication of that viral genome (self-amplifying RNA) and expression of the incorporated gene of interest for vaccination purposes. Such a VRP may be derived from an alphavirus or a flavivirus. The term “GP41”, as is used herein, refers to a protein that participates in the egress of nucleocapsids from the host nucleus. The protein from AcMNPV is characterized by NCBI Reference Sequence: NP_054110.1 and UniProt accession number P32651. A related protein from BmNPV is characterized by Genbank accession number BBN66115.1 and UniProt accession number A0A679DZH6. These two proteins are 95 % identical, with 22 out of 410 amino acid being different. The term “ORF54”, as is used herein, refers to a viral capsid associated protein, which is also termed VP1054. The protein from AcMNPV is characterized by GenBank accession number AIU56953 and UniProt accession number A0A097PUV6. A related protein from BmNPV is termed VP1054 and is characterized by NCBI Reference Sequence NP_047459.1 and UniProt accession number U3RAR5. ORF54 of AcMNPV and VP1054 of BmNPV (NP_047459.1) are 96% identical with 16 out of 365 amino acid differences. The term “multiplicity of infection (MPI)”, as is used herein, refers to the number of viral particles or virions that are added per cell during infection. If one million virions are added to one million cells, the MOI is one. If ten million virions are added to one million cells, the MOI is ten. In this context, the term “high MOI” refers to an MOI of 3 or more, such as 5 or more. The term “low MOI” refers to an MOI of less than 3, such as below 1. The term “purifying a biopharmaceutical product”, as is used herein, refers to the purification of one or more biopharmaceutical products, which comprises a series of processes intended to isolate said one or more biopharmaceutical products from a complex mixture, usually tissues or cells, and / or remainders thereof. Various purification strategies can be followed. For example, a biopharmaceutical product can be separated based on size, for example in a method called size exclusion chromatography. Alternatively, a biopharmaceutical product can be purified based on charge, e.g. through ion exchange chromatography or free-flow- electrophoresis, or based on hydrophobicity (hydrophobic interaction chromatography). It is also possible to separate biopharmaceutical products based on molecular conformation, for example by affinity chromatography. Said purification may involve the use of a specific tag, for example at the N-terminus and / or C-terminus of the protein. After purification, the biopharmaceutical products may be concentrated. This can for example be carried out with lyophilization or ultrafiltration. The term “tag” or “tagged”, as is used herein, refers to the addition of an oligo- or polypeptide, for example to the amino (N) or carboxy (C) terminus of a biopharmaceutical protein. The addition of a tag allows to isolate or immobilize said biopharmaceutical product. Commonly used tags include a poly-histidine tag such as a 6x(His) tag, a myc tag, a glutathione-S-transferase tag, a HiBiT tag (Promega, Madison, Wisconsin), a FLAG tag, a HA tag, a STREP tag, a C-tag or multimeric tags such as a triple FLAG tag (WO2001027293). A proteinase recognition sequence may be positioned in between the protein of interest and a tag allowing removal of the tag, when required. Baculovirus expression vector systems (BEVS) and ts mutants Temperature-sensitive mutants of baculovirus proteins in AcMNPV that affected virus replication and / or virion formation at elevated temperature have been identified already in 1979. These mutants were proposed as a basis for (i) further understanding the control of occluded virus development, (ii) further understanding the mechanism of baculovirus infection, which is of considerable importance in relationship to the use of these viruses as biological pesticides, and (iii) the development of a genetic map for exploring AcMNPV as a potential vector for recombinant DNA research in invertebrates (Lee and Miller, 1979. J Virol 240- 252). Two of the temperature-sensitive (ts) mutants were mapped and characterized in 1997 (Olszewski and Miller, 1979. Virol 233: 292-301; Olszewski and Miller, 1979. J Virol 71: 5040–5050). Further ts mutants have been described in Carstens et al., 1994 (Carstens et al., 1994. Virology 204: 323-337). However, none of these ts mutants have been used, or have been suggested to be used, in a baculovirus expression vector system (BEVS). In 1979 the BEVS system was not yet developed (Smith et al., 1983. Mol Cell Biol 3: 2156-2165). In 1994, the ts mutants were used to analyse baculovirus gene regulation from a fundamental point of view (Carstens et al., 1994. Virology 204: 323-337) and the authors report on ts mutations in genes required for late gene expression (late essential factors; lef genes). Such ts mutants in lef-genes are not suitable for the current invention as they interfere with the level of production of a biopharmaceutical product. Surprisingly, the present invention clearly shows that these ts mutants, at the non-permissive temperature, can be used for the production of biopharmaceuticals and result in a significant reduction of co-produced baculovirus particles. In methods of the invention, any genome derived from a baculovirus used for the recombinant expression of a biopharmaceutical product may be used. For example, the baculovirus genome may be derived from AcMNPV, BmNPV, Helicoverpa armigera NPV, or Spodoptera exigua multiple NPV, preferably from AcMNPV or BmNPV. In particular, the baculovirus genome may be derived from AcMNPV (Genbank accession no. GCA_000838485.1) or BmNPV (GenBank accession no. NC_001962.1), or related sequences. In case the biopharmaceutical product is a complex product that comprises various subunits encoded by different baculoviruses, the genomes of all implemented recombinant baculoviruses comprise the same ts gene or ts genes that is / are essential for baculovirus particle formation and / or secretion, so as to avoid complementation of one genome by another. In other words, when several baculoviruses are used to infect the same biopharmaceutical-producing insect cell, each of these baculoviruses may carry a ts mutation in the same gene or genes that is / are essential for baculovirus particle formation and / or secretion, preferably even the same ts mutation(s). The baculovirus expression vector system (BEVS) has been available for decades, and has been effectively used in vaccine production, gene therapy, and a host of other applications. To date, eleven BEVS-derived products have been approved for use, including four human vaccines (Cervarix against cervical cancer caused by human papillomavirus (GlaxoSmithKline Biologicals, Brentford, UK), Flublok and Flublok Quadrivalent against seasonal influenza (Sanofi Pasteur, Paris, France), Nuvaxovid / Covovax (Novavax, Gaithersburg, MD) and VidPrevtyn Beta (Sanofi / GSK) against COVID-19, several human therapeutics (Provenge against prostate cancer (Dendreon, Seal Beach, CA), valoctocogene roxaparvovec (AAV5-hFVIII-SQ; Ozelo et al., 2022. New Engl J Med 386: 1013-1025), Hemgenix (etranacogene dezaparvovec; CSL Behring LLC), and Glybera against hereditary lipoprotein lipase deficiency (uniQure, Amsterdam, The Netherlands), and five veterinary vaccines (Porcilis Pesti, BAYOVAC CSF E2, Circumvent PCV, Ingelvac CircoFLEX and Porcilis PCV) (see Hong et al., 2022. Front Bioeng Biotechnol 10: 994743). Insect cells are generally not anchorage dependent and can be maintained in suspension culture. In addition, they can be maintained in serum-free culture medium. Furthermore, when insect cells are infected with recombinant baculoviruses, they in general produce properly folded proteins with post- translational modifications, including phosphorylation, N- and O-glycosylation, correct signal peptide cleavage, proper proteolytic processing, acylation, palmitoylation, myristoylation, amidation, carboxymethylation, and prenylation. In addition, the baculovirus expression system can accommodate multi-gene, or large gene insertions. Suitable insect cell lines include Sf21 (Spodoptera frugiperda cell line IPLB- Sf-21-AE), Sf9, a clonal isolate derived from IPLB-Sf-21-AE, Tn-368 (larval cells from Trichoplusia ni; DSMZ no. ACC 177), BTI-TN-5B1-4 (ovarian cells of Trichoplusia ni such as High Five™ (Wickham et al., 1992. Bio-technol Prog 8: 391–396)), and derivatives thereof such as SuperSf9-1, SuperSf9-2, and SuperSf9- 3 cells (Oxford Expression Technologies, Oxford, UK), virus-free HighFive, and HighFive variants that are adapted to suspension growth and serum-free growth (Boyce Thompson Institute, Ithaca, NY (USA)). The system may also be used with derivatives of these cell lines, such as ExpiSF cells (ThermoFisher Scientific) and rhabovirus free Sf cells, such as SfRVN® cells (Sigma-Aldrich). Further suitable insect cells are derived from Bombyx mori (e.g. BM-5) and Mamestra brassicae (e.g. 2g2; Yamomoto et al., 2022. J Biosci Bioeng 134: 432-440). As an alternative, or in addition, also complete organisms, such as whole T. ni, Bombyx mori or Spodoptera spp. insect larvae, may be used as a suitable host in a baculovirus expression vector system according to the invention, employing one or more ts baculoviruses. In methods of the invention, insect cells are used to propagate a recombinant ts baculovirus at a permissive temperature below a critical temperature, and to produce a biopharmaceutical product at a non-permissive temperature, above a critical temperature. Said ts mutation is present in on or more genes that is / are essential for baculovirus particle formation and / or secretion. The inventors have shown that by employing such ts baculovirus, production of a biopharmaceutical product at a non-permissive temperature results in a reduction, preferably absence, of budded virions and / or occlusion derived virions, the two forms of a baculovirus. The number of baculovirus virions that are produced in methods of the invention at a non-permissive temperature is preferably reduced by a factor 100 in comparison to the number of virions produced by the host cell using a non-ts baculovirus genome, or in comparison to using said ts baculovirus genome at a permissive temperature. More preferably, the number of baculovirus virions is reduced by at least a factor 1000, 10,000 or 100,000, in comparison to the number of virions produced by said ts baculovirus genome at a permissive temperature. Preferably the level of produced virions at a non-permissive temperature is below the detection limit. Methods to generate a recombinant ts baculoviral genome that is able to express a biopharmaceutical product are known in the art. Reference for such methods are provided by, e.g., Sambrook et al.2014. Molecular Cloning: A Laboratory Manual (4 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA; Davis et al., (1995) Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA; Methods in Enzymology: Guide to Molecular Cloning Techniques Vol.152, S. L. Berger and A. R. Kimmel Eds., Academic Press Inc., San Diego, USA (1987)), which are all incorporated by reference herein in their entireties. Said methods include any cloning method, including traditional cloning methods such as restriction-ligation, Gibson Assembly (Gibson et al., 2009. Nature Methods 6: 343–345), Golden Gate Assembly (Engler et al., 2008. PLOS ONE 3 e3647), Gateway cloning (Katzen, 2007). Expert Opin Drug Discov 2: 571–89), Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR- associated protein (Cas)-mediated techniques (Sanbio / Origene, Rockville, MD), and Topo Cloning (ThermoFisher Scientific, Waltham, MA). Said methods include the generation of a ts mutation in a baculovirus genome. Said ts mutation may comprise one or more ts mutants in a gene that is essential for baculovirus particle formation and / or secretion as described in, for example, Lee and Miller, 1979 (Lee and Miller, 1979. Virol 233: 292-301) and / or Carstens et al., 1994 (Carstens et al., 1994. Virology 204: 323-337). Said ts mutant preferably is a ts mutant in GP41 and / or ORF54 of AcMNPV, or in a gene that is homologous to GP41 and / or ORF54 of a related virus. Amino acid sequences of GP41 and ORF54 of AcMNPV are provided herein below, as well as related proteins encoded by BmNPV. Preferred ts mutants comprise a mutation in the gene encoding GP41, causing a I317T alteration in GP41, and / or a mutation in the gene encoding ORF54, resulting in a P286S alteration in ORF54 of AcMNPV. I317 of GP41 and P286 of ORF54 are conserved amino acid residues between AcMNPV and BmNPV. A corresponding alteration in a GP41 and / or ORF54 related gene from another baculovirus will likely also result in a ts sensitive baculovirus. Other mutations in these genes or mutations in other baculovirus genes that are required for particle formation and / or secretion, and that render the baculovirus temperature sensitive, can also be used in this method. A ts mutant may be generated by altering the gene encoding a product that is essential for baculovirus particle formation and / or secretion, such as GP41 and ORF54. As an alternative, or in addition thereto, a gene comprising a ts mutation may be expressed from an exogenous location in the baculovirus genome. Said gene harboring a ts mutation may be expressed from an exogenous location under control of an exogenous promoter, such as the polyhedrin (polh) or p10 promoter. A preferred promoter is the baculovirus p10 promoter. Methods to produce a biopharmaceutical product such as a recombinant protein, a viral vector, a virus-like particle or replicon particle, are known in the art. Most baculovirus expression systems involve the use of an intermediate plasmid vector into which the foreign gene is cloned. Said plasmid vector is subsequently transferred to a baculovirus genome using techniques such as homologous recombination or site-directed transposition. Further improvements may result in efficient generation of recombinant baculovirus (Kitts and Possee, 1993. Biotechniques 14: 810–817; Possee et al., 2008. Biotechn Bioengineer 101: 1115–1122). A gene encoding a biopharmaceutical product may be placed under control of a suitable promoter such as the polyhedrin (polh) or p10 promoter. One or more of the baculovirus genes cathepsin, chitinase, p26, p74 and pl0 may be disrupted in the ts baculovirus genome to enhance production of said biopharmaceutical product. Suitable commercial baculovirus systems Bac‐to‐Bac® (ThermoFisher Scientific), BaculoDirectTM(Thermo Fisher Scientific), and BacPAK™ Baculovirus Expression System (Takara Bio, Kusatsu, Japan). In methods for the production of a biopharmaceutical product, insect cells are infected with a ts baculovirus and incubated above a critical temperature, such that the cells express the biopharmaceutical product but do not, or hardly produce baculovirus virions. The incubation above a critical temperature, such as above 32.5 or above 33 ºC, may be done either at the start of the production process, for example if the insect cell was infected with a high MOI of the ts baculovirus, or during the production run, for example when the insect cell was infected with a low MOI of the ts baculovirus. The invention further provides a use of a baculovirus with a temperature- sensitive (ts) mutation in a gene that is essential for baculovirus particle formation and / or secretion, for production of a biopharmaceutical product. Said ts baculovirus preferably is, or is derived from, an alphabaculovirus such as Autographa californica multicapsid nucleo-polyhedrovirus (AcMNPV) and or Bombyx mori nucleopolyhedrovirus (BmNPV). Said biopharmaceutical product preferably is a recombinant protein, a recombinant virus or a virus-like particle, a viral replicon particle, or a viral vector. Bioharmaceutical product The methods of the invention allow the generation of a biopharmaceutical product in a baculovirus-mediated expression vector system, preferably in the absence of baculovirus virions. In embodiments of the invention, said biopharmaceutical product is a recombinant protein, a recombinant viral vector, a virus-like particle, or a replicon particle. Said biopharmaceutical product may be codon-optimized to enhance expression of said biopharmaceutical product in insect cells. As is known to a person skilled in the art, expression of a recombinant product may be influenced by features such as preferred codon usage of the host cell in which the protein of interest will be expressed, the GC content, RNA stability, and potential secondary structure formation of the resulting coding sequence. Codon optimization refers to the selection of codons in a sequence encoding a protein of interest for optimal expression of the protein of interest in a host cell such as an insect cell. A single amino acid may be encoded by more than one codon. For example, arginine and leucine are each encoded by a total of 6 codons. Codon optimization, i.e. the selection of a preferred codon for one or more amino acid residues for expression in a specific organism may play a critical role, especially when proteins are expressed in a heterologous system. Codon optimization is offered by commercial institutions, such as ThermoFisher Scientific, called Invitrogen GeneArt Gene Synthesis, GenScript, called GenSmart™ Codon Optimization, or GENEWIZ, called GENEWIZ’s codon optimization tool. Said recombinant protein may be any protein that can be produced in a ts BEVS according to the invention, such as a therapeutic enzyme, an antibody, and / or a vaccine. Said therapeutic enzyme may be an enzyme involved in fibrinolysis, cancer treatment, enzyme replacement therapy, and treatment of other rare and common diseases. Examples of a therapeutic enzyme include, for example, ^-gluco- cerebrosidase, used to treat Gaucher's disease, L-asparaginase, used to treat acute lymphoblastic leukemia, ^ ^glucosidase, used to treat Pompe disease, glycosaminoglycan alpha-L-iduronohydrolase, used to treat Hurler syndrome, adenosine deaminase, used to treat a severe combined immunodeficiency disease, or a pancreatic enzyme such as a lipase, amylase, protease and mixtures thereof, used to treat exocrine pancreatic insufficiency and other digestive disorders, accompanying cystic fibrosis. Said antibody may be a monovalent or multivalent antibody, a single-chain antibody such as a camelid-derived VHH antibody, and a bispecific or trispecific antibody. The term antibody includes antibodies comprising immunoglobulin heavy and light chain molecules, single heavy chain variable domain antibodies, and variants and derivatives thereof, including scFv, tandem scFv, scFab, and improved scFab (Koerber et al., 2015. J Mol Biol 427: 576-86), and chimeric variants of monoclonal and single heavy chain variable domain antibodies. The term antibody also includes antibody mimetics such as, for example, described in Skerra, 2007 (Skerra, 2007. Current Opinion Biotechnol 18: 295-304) and in Škrlec et al., 2015 (Škrlec et al., 2015. Trends Biotechnol 33: 408-418). Said antibody may be a chimeric, humanized or fully human antibody. Said antibody may be conjugated to a drug or toxin to deliver said drug or toxin to a specific site, which may be especially useful for killing cancer cells or microbes. Said antibody may include an Fc region, or part thereof, for example to trigger phagocytosis of the antibodies and / or activation of immune cells to induce antibody- dependent cellular cytotoxicity (ADCC) and / or cytokine production. Examples of such therapeutic antibodies include trastuzumab, a monoclonal antibody that binds human epidermal growth factor receptor 2, rituximab, a chimeric monoclonal antibody that binds cluster of differentiation 20 (CD20), and infliximab, a chimeric monoclonal antibody that binds tumor necrosis factor alpha. Said vaccine confers active immunity against a harmful agent by stimulating the immune system of an individual to attack the agent. After stimulation by a vaccine, antibody-producing cells, called B lymphocytes, remain sensitized and ready to respond to the agent if it enters a vaccinated individual. Examples of suitable vaccines that may be produced by BEVS are subunit vaccines, toxoid vaccines, and virus-like particles (VLPs). A suitable vaccine may comprise one or more proteins. Said one or more proteins may be derived from the same agent, or from different agents. Subunit vaccines may comprise a protein that is normally expressed on the surface of an agent such as a bacterium of virus. Examples of recombinantly produced subunit vaccines include ENGERIX-B (GlaxoSmithKline Biologicals), GARDASIL-9 (Merck Sharp & Dohme Corp.), SHINGRIX (GlaxoSmithKline Biologicals) and NUVAXOVID (Novavax). Toxoid vaccines comprise an inactivated toxin and may prevent toxin- mediated diseases such as tetanus, diphtheria, and pertussis. One or more inactivated toxins may be combined to protect against diphtheria, tetanus, and / or whooping cough. VLPs present viral antigens in a more authentic conformation than individual proteins. VLPs mimic the structure of virus particles they are derived from and display excellent adjuvant properties, being capable of inducing innate and cognate immune responses (Liu et al., 2013. Protein Expr Purif 90: 104–116). Examples of such VLPs include MERS-CoV-VLP (Wang et al., 2018. Oncotarget 8: 12686-12694), human papillomaviruses 11, 16 and 18 VLPs (Rose et al., 1994. J Gen Virol 75: 2445-2449), human papillomaviruses 1618 and 58 VLPs (Zhang et al., 2010 / Vaccine 28: 3479-3487), Coxsackievirus B4 VLP (Hassine et al., 2020. Mol Biol Rep 47: 2835–2843), rabies (Leme et al., 2022. Mol Biotechnol 973: 1 (1007 / s12033-022-00586-x)), and influenza-derived VLPs (Sari-Ak et al., 2019. in “High-Throughput Protein Production and Purification”, ed. R. Vincentelli (New York, NY: Humana), 213–226)). A recombinant virus that may be produced by BEVS includes a recombinant adeno associated virus (AAV) and a lentivirus vector. Different BEVS may result in the production of a recombinant AAV, including a system comprising three baculoviruses (Urabe et al., 2002. Hum Gene Ther 13: 1935–1943); a system comprising two baculoviruses (Smith et al., 2009. Mol Ther 17: 1888-1896); and a OneBac System for production of recombinant adeno-associated virus (Mietzsch et al., 2014. Hum Gene Ther 25: 212-222; Mietzsch et al., 2017. Hum Gene Ther Methods 28: 15-22). In addition, BEVS for generation different AAV serotypes have been described (Wu et al., 2021. Curr Gene Ther 21: 167-176). Besides AAV, BEVS have been used to generate recombinant lentivirus vectors (Lesch et al., 2008. Gene Ther 15: 1280-1286), and may be used for other viral vectors or to generate virus-based replicon particles based on, for example adenovirus, vaccinia virus, or herpes simplex virus. In addition, BEVS may be used to generate replicon particles, especially viral replicon particles (VRPs). A VRP is a linear, single-stranded RNA molecule that encodes a replicase protein, in addition to a biopharmaceutical product such as an antigenic protein. Said replicase enables amplification of the RNA upon delivery into a cell, which yields high amounts the biopharmaceutical product that is produced in said cell. VRPs may be derived from both positive-sense and negative- sense RNA viruses. Said RNA viruses include alphaviruses such as Venezuelan equine encephalitis virus (VEE), Sindbis virus (SINV), and Semliki forest virus (SFV), and flaviviruses such as Dengue virus and Zika virus. After being produced, a biopharmaceutical product is to be purified and recovered from the cell culture medium. Said downstream processing typically includes several steps such as clarification, concentration, chromatography, and formulation. A first step in downstream processing is the clarification of the cell culture medium to remove cell debris and other impurities. This can be achieved by common techniques such as centrifugation and / or filtration, including depth filtration and tangential flow filtration. The resulting clarified medium may be concentrated to reduce the volume and increase the concentration of the biopharmaceutical product. This can be achieved by techniques such as ultrafiltration, precipitation, and adsorption. A next step may be chromatography, which involves separating and purifying the protein of interest from other impurities based on their physicochemical properties such as charge, size, and hydrophobicity. This can be achieved by one or more techniques such as ion exchange, size exclusion, and affinity chromatography. Finally, the purified biopharmaceutical product may be formulated for storage and distribution. This can involve the addition of stabilizers, buffers, and other excipients to maintain stability and potency during storage and transport. EXAMPLES Example 1. Methods Cell lines Spodoptera frugiperda (Sf) insect cells were maintained in 250 mL suspension flasks shaking at 110 rpm at 27 °C. Sf9 cells were cultured in Sf900II serum-free medium (Gibco; Waltham, MA, USA) supplemented with 50 µg / mL gentamycin. For larger scale experiments ExpiSf9 cells (ThermoFisher Scientific, Waltham, MA, USA) were used and grown in ExpiSf chemically-defined medium (Gibco). Construction of a bacmid with a ts mutation (I317T) in the gp41 gene Linear recombination fragments were amplified by high-fidelity Q5 PCR (New England BioLabs, Ipswich, MA, USA), followed by template digestion with DpnI (New England Biolabs) and DNA purification (Illustra GFX, Burlington, MA, USA) according to the manufacturer’s protocols. A SacB-CAT negative selection cassette was amplified from pRDAX-EMMI-008 (Addgene plasmid #130216) with primers GP41-SacBCAT-F and GP41-SacBCAT-R (Table 1). The overhang PCR resulted in 50 bp homology to gp41. The E. coli recombineering-proficient strain GB05-red ET (GeneBridges GmbH, Heidelberg, Germany) containing the AcMNPV AcBace56 bacmid (Pijlman et al., 2020. Viruses 12: 1448) was grown with shaking at 37°C in 5 mL LB medium to an OD600 of 0.3 using 110 µl overnight culture as inoculum. The expression of recombineering enzymes was induced by addition of 180 µl 10% L-arabinose and incubation with shaking at 37°C for 35 minutes. The cells were pelleted by centrifugation at 20.000xg for 30 seconds at 4°C and were made electrocompetent by two washing steps in double distilled (dd) H2O. The pellet was resuspended in 50 µl ddH20 and was electroporated with ~300 ng SacB-CAT linear recombineering cassette at 1350 V followed by recovery in 1 mL LB medium for 2 h shaking at 37°C. The cells were concentrated by centrifugation and were plated onto LB agar with 50 µg / mL kanamycin and 20 µg / mL chloramphenicol. Plates were incubated at 37°C for 1-2 days and colonies were re-streaked on new plates with 50 µg / mL kanamycin and 20 µg / mL chloramphenicol before screening by PCR of the GP41 locus. Positive clones were grown overnight and bacmids were isolated by a standard alkaline lysis protocol. Insertion of the cassette in the gp41 locus was confirmed by PCR, restriction mapping, and sequencing. Negative selection recombineering was employed to seamlessly replace the selection cassette with the gene containing the point mutation. The entire gp41 open reading frame with the I317T mutation was amplified by PCR with primers ac81-gp41-F and gp41-R (Table 1). The forward primer was extended with part of the 3’ of ac81 to extend the homologous region. The PCR product had 240 bp homology to the bacmid at the 5’ end, and 150 bp homology at the 3’ end. GB05-red ET cells containing the Acbace56-SacBCAT bacmid were induced with arabinose and made electrocompetent as described above. Following electroporation of ~500- 700 ng gp41ts PCR product and recovery for 2 h, the cells were washed twice in ddH2O and spread on salt-less LB agar with 50 µg / mL kanamycin and 6% (w / v) sucrose. Plates were incubated at 37°C for 1-2 days and colonies were re-streaked in duplicate onto salt-less agar plates containing 50 µg / mL kanamycin and 6% sucrose, or 50 µg / mL kanamycin and 20 µg / mL chloramphenicol. Colonies that had grown on sucrose but not on chloramphenicol were further screened with PCR. Finally, the Acgp41ts bacmid was confirmed by restriction mapping, sequencing of the GP41 locus, and next-generation sequencing of the entire bacmid (Macrogen Novaseq, Seoul, South Korea). Purified bacmids were electroporated into DH10B electrocompetent cells followed by the addition of the bac-to-bac helper plasmid (pMON7124). Viral infection experiments to determine critical temperatures For this experiment eGFP was introduced by transposition into the wt Acbace56 and the Acgp41ts bacmid via standard bac-to-bac transposition (Invitrogen, Waltham, MA, USA). Virus stocks were created and amplified in Sf9 insect cells at 27°C. Next, Sf9 cells were seeded in a 6-well plate or T25 flask to ~60% confluency approximately 1 h prior to infection. Virus was added to the culture fluid at an MOI of 0.1, or at 1050% tissue culture infectious dose (TCID50) units / cell and the cells were incubated at 27 °C on a shaking platform for virus absorption. At three hours post infection (hpi) the inoculum was removed and the monolayer was washed 3x 5 min. with pre-warmed medium. The cells were further incubated in medium at the indicated permissive or non-permissive temperatures. The cells were kept in the closed incubator and were only removed from the incubator shortly for sampling or monitoring by fluorescence microscopy and were then transported in a heated box to minimize cooling of the cells. The effective temperature in the incubators was monitored with a temperature probe at 1- minute intervals. The incubator set at 34°C had a 48-hour average of 34.40°C with temperature fluctuations between 34.36°C-34.46°C. For incubations at 32°C, the 48-hour average was 32.27°C, fluctuating between 32.35°C and 32.20°C. Transmission electron microscopy (TEM) of infected cells Sf9 cells were infected with Ac-egfp or Acgp41ts-egfp at an MOI of 10 TCID50 / cell and incubated at 34°C for 72 h. Cells were collected by centrifugation and fixated in 2.5% glutaraldehyde in 0.1 M phosphate / citrate for 1 h at RT. TEM specimens were prepared by solidification in 3% gelatin, ethanol dehydration, and embedding in Spurr resin as described elsewhere (Sánchez-Andrea et al., 2022. Frontiers Microbiol 13: 816605). Cells were visualized by using a JEM1400 transmission electron microscope (JEOL Ltd., Tokyo, Japan) operated at 120 kV. SDS-PAGE and Western blot analysis Cell suspension samples were pelleted by centrifugation for 5 min. at 7600xg. The culture fluid was precipitated by the addition of 3x acetone, incubation at -20°C for 1 h, and centrifugation for 10 min. at 1500xg. The cell pellet and precipitated medium pellet were dissolved in 1xPBS with cOmplete™ protease inhibitor (Roche) and mixed with SDS-PAGE loading buffer. For reducing SDS-PAGE the sample mixtures contained 10% β-mercaptoethanol or 50 mM DTT. Samples were boiled for 10 min. at 95°C before analyses on SDS-PAGE. Proteins on the SDS-PAGE gel were stained with Coomassie Brilliant Blue staining or were visualized by UV photography (stain-free gels, BioRad, Hercules, CA, USA). The proteins were subsequently blotted onto a polyvinylidene fluoride membrane followed by immunodetection. Membranes were blocked with 1% skim milk powder in 1x PBS with 0.05% Tween-20 (PBS-T). The primary antibody was diluted in 1% milk powder in PBS-T, and the alkaline-phosphatase conjugated secondary antibodies were diluted 1:2500 in PBS-T. Membranes were washed with PBS-T in between incubation steps and immunodetection was visualized with NBT / BCIP colorimetric stain (Roche, Basel, Switzerland). Anti-VP39 (1:1500, from mouse; obtained from Robert M Kotin (University of Massachusetts Medical School), anti-mouse IgG (Sigma-Aldrich, St. Louis, MO, USA), anti-Rat IgG (Sigma-Aldrich). Production of FMDV VLPs The FMDV strain O1 / Manisa / TUR / 69 P1-2A and 3C coding sequence with flanking Gateway AttB sites was ordered as a synthetic gene cloned into pUC57 (Genscript Biotech, Piscataway, NJ, USA). The construct was designed based on research by Porta et al. (2013), where a HIV-1 ribosomal frameshift site was introduced between the P1-2A and 3C sequence to downregulate 3C levels and thereby optimize VLP production (Porta et al., 2013. J Virol Methods 187: 406-412). The AttB sites allowed for cloning from pUC57 into pDONR207 and subsequently into pDest8 by Gateway BP or LR clonase, respectively (ThermoFisher Scientific). Recombinant baculoviruses were constructed by bac-to-bac transposition in E. coli containing Acbace56 or Acgp41ts and the bac-to-bac helper plasmid, followed by bacmid transfection in Sf9 insect cells. Sf9 cells were infected at an MOI of 10 or 0.1 and incubated at 27°C or 33°C for 3 days, following a similar procedure as described above for the GFP viruses. FMDV VLPs were detected on western blots of infected cells and culture medium with an antibody against VP2 (1:400, from mouse; obtained from Erwin van den Born, MSD Animal Health). Production of WNV prME SVPs The structural cassette of WNV prME was based on the Dutch isolate (MW228499) (Vlaskamp et al., 2020. Euro Surveill 25: 2001904) and comprises the prM and E genes. In this construct, the last 18 residues of the WNV capsid (GGTAGFTILLGLIACAGA) preceded by the residues ‘MAA’ were N-terminally fused to prME and served as a signal sequence to direct the polyprotein to the endoplasmic reticulum (ER) (De Lorenzo et al., 2020. J Virol 95: e01415-20; Taylor et al., 2016. Virology 496: 186-193). The L21 cDNA leader sequence was placed at the 5’ end for efficient translation initiation (Sano et al., 2002. FEBS Lett 532: 143- 146). The synthetic DNA construct (Integrated DNA Technologies, Coralville, IA, USA) was flanked by Gateway AttB sites to enable Gateway cloning into pDONR207 and subsequently pDest8. The construct used for the experiments described here carried an envelope stabilizing cysteine mutation (A261C) in the E protein sequence, which was introduced by direct mutagenesis PCR using the 5’ phosphorylated primers prME-A261C-F and prME-A261C-R (Table 1). The purified PCR product was circularized by T4 ligase and electroporated into electrocompetent E. coli DH10β. After transfer of the structural cassette into pDEST8, recombinant baculoviruses were constructed by bac-to-bac transposition in E. coli followed by transfection of Sf9 insect cells. After infection of fresh cells with the generated baculovirus stock, WNV SLPs formation in the cell pellet and culture fluid of infected cells was analyzed after 3 days at 27° or 33°C. This was done by staining for the E protein with the pan-flavivirus E antibody (4G2, 1:100, from mouse; ATCC HB-112) or a cocktail of three WNV (subtype KUNV OR393) monoclonal E antibodies (3.91D, 3.67G, and 2B2, 1:50, from mouse (Blitvich et al., 2003. J Clin Microbiol 41: 1041-1047). Scaling-up temperature strategy in bioreactors ExpiSf9 cells were grown in 0.5 L miniBio or 3L glass reactor vessels (Getinge, Göteborg, Sweden) controlled by myControl bioreactor controllers (Getinge). The working volume of each reactor vessel was 0.3-2.0 L. Reactors were inoculated at target starting densities of 0.5-1.0x106viable cells / mL. The pH in the culture fluid was not controlled but was maintained by the buffering capacity of the medium and fluctuated between pH 5.7-6.1. The dissolved oxygen concentration was controlled at 30% of air saturation using Lumisens optical dissolved oxygen sensors (Getinge) and sparging with pure oxygen through open pipe spargers. In addition, a constant headspace aeration rate of 0.01 vvm (volume of air sparged per unit volume of growth medium) was applied. Agitation with marine impellers was set to 266-600 rpm by keeping the tip speed constant among the different reactor sizes. Reactor temperature was controlled by either Peltier heating / cooling or a combination of a heating blanket and a cooling finger. Cells were counted by trypan blue exclusion using a TC20 Automated Cell Counter (Bio-Rad) or by manual counting using DHC-F01 cell counting chambers (Incyto, Cheonan-si, South Korea). Online measurements of viable and total cell density, viability, and infected cells were performed by differential digital holographic microscopy (DDHM) using iLine F holographic microscopes (Ovizio, Brussels, Belgium). Table 1. Primers used in this research Primer Sequence (5’-3”) Homologous recombination gp41 GP41- GCGTTATTACAACACCCCTCCGCCGCTGAGGTATCCCTCTAATCCGGCA ACGGCACATATACCTGCCGTTC SacBCAT-F GP41- CGCGTTGGCGGCCGACGTTAAGAAGGTGGCGTTCTGGAACATGCTGGG CTGCTTTACGCCCCGCCCTGCCA SacBCAT-R ac81-gp41-FCGCTTTTTTGTCACAACAACTATATTATAAGTAATCCGTATATTGAGTTTTGT AATCATAAGAGTACAAATAAAAAGTATGACAGATGAACGTGGC gp41-RTTATGCAGTGCGCCCTTTWNV prME cloning prME-A261C-FGCAGGAAGGTTGTTTGCACCAAGCTCTGGprME-A261C-RGACCCTAGAGCCACAACAFMDV cloning P13CD-NotI-FCCGTATGCGGCCGCGATGAACAAACGACCCAAP13CD-XbaI-RAGATCTTCTAGATTCGAACTCGP1 seqTGATCCCTATTAGCCCTTC3CD seqGAATTTGGTGATGTCTCTGResults Construction of a temperature-sensitive baculovirus with a ts mutation in gp41 The GP41 ts mutation was implemented into the BEVS in the ac80 open reading frame at the original gp41 locus. A temperature-sensitive mutation (I317T) was seamlessly introduced in gp41 by two-step lambda red recombineering (see Figure 2). A selection cassette, containing the negative selection marker SacB (converting sensitivity to sucrose) and positive selection marker chloramphenicol acetyltransferase (CAT, converting resistance to chloramphenicol) was inserted into the gp41 (Ac80) open reading frame. A second recombineering step replaced the SacB-CAT cassette for the gp41 gene with a point-mutation from ATA (Ile) to ACA (Thr) at residue 317 (I317T). The resulting bacmid comprises gp41 without remnants of the selection cassette and contains the I317T ts point mutation (see Figure 2a). The integrity of the bacmid and presence of the point-mutation were confirmed by next-generation sequencing of the bacmid DNA. Characterization of the Acgp41ts virus with an eGFP reporter To visualize and monitor viral spread, eGFP was expressed from the polh promoter in the wildtype (Ac) and ts (Acgp41ts) viruses. The non-permissive temperature was determined as the temperature at which a single-cell infection phenotype would be observed. Sf9 cells were infected at 27°C with the wild-type bacmid or the gp41ts mutant at low MOI (0.01 TCID50 / cell). At 3 hpi at 27°C, the inoculum was replaced by fresh medium and cells were incubated at 27°C, 32°C, 33°C, or 34°C (see Figure 2b). Single-cell infections were observed for the Acgp41ts mutant at 33°C and 34°C, coherent with previous reports (Olszewski and Miller, 1997. Virology 233: 292-301; Lee and Miller,1979. J Virol 31: 240-252). At 32°C, the virus was largely attenuated and only local spread of the virus infection was visible, as better seen in the enlarged pictures. Virus release kinetics were determined at permissive and non-permissive temperatures. Cells were infected at high MOI (5 TCID50 / cell) at 27°C for 3 h. The residual virus was washed from the cell monolayer and then the cells were incubated at 27°C or 33°C for 3 days. At 27°C, high virus titers were obtained (>108TCID50 / mL) similar to the standard BEVS. At 33°C budded virus contaminants were reduced by 2700-fold to only 105TCID50 / mL (Figure 3b). This corresponds to a BV production rate of 0.2 TCID50 per cell, or one TCID50 per 5 cells. At the elevated temperatures, BVs were produced at high titers in Sf9 cells when the wild type AceGFP construct was used (Figure 3b). The eGFP expression was slightly lower at 33°C, but was similar for the mutant and the wild-type baculovirus at this temperature (Figure 3a). Nucleocapsid production in the cell nucleus did still occur for Acgp41ts-eGFP at 34°C as visualized by transmission electron microscopy (Figure 4). Nucleocapsids were also found close to the nuclear membrane, suggesting that nucleocapsid assembly and internuclear transport were still intact. This is in-line to tsB1074 that was previously described with the same point-mutation in gp41 (Olszewski and Miller, 1997. Virology 233: 292-301). Implementing the gp41ts expression system for FMDV VLP production We next bridged these results obtained with the temperature sensitive BEVS from a reporter protein (GFP) to relevant biopharmaceutical products, such as VLP vaccines for human and veterinary use. Foot-and-mouth disease (FMD) is an economically important animal disease that is caused by FMD virus (FMDV) (family Picornaviridae). In FMD endemic areas, vaccination is used as a preventive method (Doel, 2003. Virus Res 91: 81-99). FMD virions consist of an RNA molecule and a capsid composed of VP1, VP2, VP3 and VP4 proteins. In this study the P1 / 2A sequence of FMDV strain O1 Manisa, encoding the structural polyprotein P1 / 2A, was expressed from the baculovirus polh promoter. Via a NotI frameshift sequence, the FMDV 3C protease (3Cpro) was also expressed, as this is needed to cleave the P1 / 2A polyprotein into the individual structural proteins VP0, VP3, and VP1 (see Figure 5a). In mature virions, VP0 is further processed into VP4 and VP2 via an autocatalytic cleavage. The P1 virus stock was used to infect Sf9 cells at 27°C. The infected cells were analyzed by reducing SDS-PAGE followed by Western blot analysis to confirm successful polyprotein processing (Figure 5b). This showed that the VP2 domain was detected in the cells of both wt and gp41ts viral backbones as part of VP0, hence indicating that the P1 / PA polyprotein is successfully cleaved, indicating that 3Cpro is expressed as well. In the culture fluid VP0 was also the dominant protein found, but a smaller molecular mass protein was also recognized by the VP2 antibody, possibly reflecting mature virions harboring VP2. The FMDV VLPs were subsequently produced at 27°C and 33°C. Infection at 27°C showed that the Acgp41ts virus was able to produce high titer virus stocks at the permissive temperature, while a 2-log reduction in BV titers was found at 33°C compared to 27°C (Figure 6) when infecting with an MOI of 10. This effect was enhanced when infecting with MOI 0.1, with an average titer of 104 TCID50 / mL (Figure 6b). Analyses of the cells and the culture fluid on SDS-PAGE followed by Western blotting (Figure 6c, d) revealed that similar levels of VP0, could be detected in all samples, irrespective of the incubation temperature during production. On the contrary, baculovirus contaminants, visualized by immunostaining of the VP39 baculovirus capsid protein (Figure 6d), were significantly reduced at 33°C. This finding corresponds to the reduction in infectious BV titer that was determined by the end-point dilution assay and indicates that large amounts of non-infectious BVs are not released. Production of WNV prME subviral particles with the new gp41ts system We next compared the standard BEVS to our newly developed gp41ts BEVS for the production of WNV subviral particles (SVPs) using the wt Ac and Acgp41ts virus bacmids, respectively. Cells were infected with a high MOI and incubated at 27°C or 33°C for three days (Figure 7a). The culture fluid and cells were harvested and analyzed for BV and SVP production. The tsBEVS efficiently produced virus at 27°C, suitable for the creation of high titer virus stocks, but at 33°C the budded virus production was reduced 263-fold to 4.4x105infectious particles per mL (Figure 7b). With a seeding cell density of 1x106cells / mL, each cell produced only ~0.4 TCID50. Contrary, the wild-type bacmid Ac-prME produced similar BV titers at both high and low temperatures. Moreover, WNV SVPs were produced at both 27°C and 33°C and E protein monomers and dimers could be detected in the cell pellet and culture fluid (Figure 7c). Scaling-up of temperature strategy in bioreactors To assess whether a similar BV reduction can be achieved in scalable cultivation systems as in smaller culture flasks, the temperature strategy was scaled up to stirred tank bioreactors. Cells were infected with the temperature-sensitive ActsGp41-eGFP virus at a high MOI (8-10 TCID50 / mL) and after 3 hours the temperature in the bioreactors was increased from 27°C to 33°C, which took 5-10 minutes. Two shake flask control conditions were cultivated at 27°C and 33°C without temperature shift. The bioreactors and shake flasks were kept at setpoint until harvest at 120 hours post-infection (hpi), but samples were also taken at 72 and 96 hpi. Baculovirus titers were significantly higher in the control condition cultured at 27 °C compared to the bioreactor and shake flask cultures cultured at 33°C (Figure 8). A similar reduction in baculovirus concentrations was measured in bioreactors and shake flasks, as in small scale cultures, showing the temperature- switch strategy is suitable for scale-up. To further show scalability, a low MOI strategy was performed in stirred tank bioreactors. ExpiSf9 insect cells were infected with an Acgp41ts-mutant virus at an MOI of 0.01 TCID50 / cell in 3L bioreactors. The cell density at infection was 2x106viable cells / mL in a working volume of 2L. The bioreactors were continuously monitored with a holographic microscope. The moment of temperature shift from 27°C to, in this case 34°C, was based on the detection of an increasing average cell diameter from the online measurements. Different time points for the temperature- shift were executed based on increasing the measurement resolution of the online microscope to make early detection of diameter increase possible. The earliest temperature shift (33 hpi) resulted in the lowest baculovirus titers (Figure 9). The temperature-switch time points are now much later than with the high MOI regime, as an initial BV production round is needed to allow infect of the whole cell culture. Conclusions By using a temperature sensitive mutant of AcMNPV with a (I317T) mutation in the gp41 gene and applying a temperature shift during the production of two biopharmaceutical products (FMDV and WNV (sub)VLPs), we were able to reduce the production of contaminating budded viruses at least 2-logs, with minimal impact on the levels of product production. The temperature-dependent regulation of BV secretion was scaled-up to stirred-tank bioreactors and we were able to reduce the production of contaminating budded baculovirus particles (BVs) for both high and low MOI infection strategies. Example 2. Methods The materials and methods were used as described in example 1, unless stated otherwise. Viral infection experiments to determine critical temperatures Viral titers were determined by end-point dilution assay on SF9ET cells (CRL- 3357™, ATCC). Production of FMDV VLPs FMDV VLPs were detected on western blots of infected cells and culture medium with an antibody against VP2 (1:400, from mouse; obtained from Erwin van den Born, MSD Animal Health) and by ELISA with antibody targeting VP2. A commercial anti-VP2 antibody suitable for Western blotting and ELISA is, for example, any one of the recombinant mouse anti-VP2 antibodies F1412SA, 23HA6, 23FB4 and 19DG5 of Creative Biolabs (Shirley, New York, USA). Infectious BV titer in the clarified culture fluid was determined by endpoint dilution assay on Sf9ET cells. Viral DNA copies in the culture fluid were quantified by qPCR. The clarified culture fluid was passaged through a filter with 0.45 μM pore size (Satorius Minisart). A 200 µL aliquot was subsequently pelleted by centrifugation at 21.000 x g for 5 minutes. The resulting viral pellet was dissolved in 20 µL TE buffer. To release viral DNA, the heat-treatment method specified in the BaculoQUANT virus extraction and titration kit (Oxford Expression Technologies) was employed. Quantitative Real-Time PCR was performed using the SYBR™ Select Master Mix (Thermo Fisher Scientific) with primers that amplify vp80 (Table 2). A 10log dilution series of a plasmid containing the viral vp80 ORF (pJET-vp80) served as a calibration curve and was used for calculating viral genome copy numbers. For generating pJET-vp80, Ac-vp80 ORF was amplified by PCR from AcMNPV DNA with primers vp80-forward and vp80-reverse (Table 2). The PCR product was cloned in pJET1.2 / blunt with the CloneJET PCR cloning kit (ThermoFisher Scientific). The resulting in pJET-vp80 plasmid was verified by Sanger Sequencing (Macrogen). Scaling-up temperature strategy in bioreactors ExpiSf9 cells were grown in 0.5 L miniBio reactor vessels (Getinge) with a 0.3 L working volume, controlled by myControl bioreactor controllers (Getinge). For the high-MOI infection process, the reactor was inoculated at a starting density of 1.0x106viable cells / mL and was infected at cell concentration at time of infection (CCI) of 2.0x106cells / mL with Acgp41ts-eGFP at an MOI of 10 TCID50 / cell. The pH in the culture fluid was not controlled but was maintained by the buffering capacity of the medium. The dissolved oxygen concentration was controlled at 30% of air saturation using Lumisens optical dissolved oxygen sensors (Getinge) and sparging of pure oxygen through open pipe spargers. In addition, a constant headspace aeration rate of 1 L / hour air was applied. Agitation with marine impellers was set to 300 rpm. At 3 hpi, the temperature was elevated from 27°C to 33°C. The temperature of the working volume was maintained at setpoint by a heating block (miniBIO). In parallel, 125 mL shake flasks were inoculated and infected at the same CCI and MOI and were either incubated at 27°C, at 33°C, or followed the same temperature switch regime as the bioreactor (from 27°C to 33°C at 3 hpi). Samples were collected at 0 dpi (5-10 minutes after addition of the virus), and at 1-5 dpi. The percentage of infected cells was calculated by measuring the fraction of GFP-positive cells by using a C6 Plus Flow Cytometer (BD Accuri) at an emission of 533 / 30 nm. The samples were measured in three technical replicates. Data was analyzed by FlowJo Software v10 (BD Biosciences). Healthy, non-infected ExpiSf9 cells were measured for gating single cells and autofluorescence. Infectious BV titers in the culture fluid were determined by endpoint dilution assays on ExpiSf9 cells, which was performed in technical duplicate. For the low-MOI infection strategy, the reactors were inoculated at target starting densities of 0.5-1.0x106viable cells / mL and infected with an MOI of 0.01 TCID50 / cell. The incubation temperature was switched from 27 °C to 34 °C at 40 hpi, 35 hpi, or 33 hpi. A control bioreactor infection remained at 27 °C for the entire run. Samples were collected at multiple timepoints and the infectious BV titer was determined by endpoint dilution assay. Table 2. Primers used in example 2 addition to primers in Table 1 qPCR Sequence (5’-3”) primers vp80-F GAAACGGCTGTACGAATAC vp80-R GATCGAGATTGTACAGGTTTAG Implementing the gp41ts expression system for FMDV VLP production We next wanted to investigate the application of BacFreetssystem for a higher- value product. Foot-and-mouth disease is an economically important veterinary disease caused by the foot-and-mouth disease virus (FMDV; Family Picornaviridae). In FMD endemic areas, vaccination is used as a preventive method (Doel, 2003. Virus Res 91: 81-99). FMD virions consist of an RNA molecule and a capsid composed of VP1, VP2, VP3 and VP4 proteins. In this study the P1 / 2A sequence of FMDV strain O1 Manisa, encoding the structural polyprotein P1 / 2A, was expressed from the baculovirus polh promoter. Via a NotI frameshift sequence, the FMDV 3C protease (3Cpro) was also expressed, as this is needed to cleave the P1 / 2A polyprotein into the individual structural proteins VP0, VP3, and VP1 (see Figure 10a). In mature virions, VP0 is further processed into VP4 and VP2 via an autocatalytic cleavage. The FMDV VLPs were subsequently produced at 27°C and 33°C. Infection at 27°C showed that the Acgp41ts virus was able to produce high titer virus stocks at the permissive temperature, while a 3.5-log reduction in BV titers was found at 33°C compared to 27°C (Figure 10B) when infecting with an MOI of 10. qPCR and western blot analyses were performed to confirm these results by orthologous methods. qPCR showed that the elevated temperature resulted in a 99.81% reduction (-2.7 log10) in viral DNA copies in the filtered culture fluid (Figure 10C). Western blot immunodetection of the culture fluid also showed significantly less baculovirus capsid protein (VP39) (Figure 10D, top). Analyses of the cells and the culture fluid on SDS-PAGE followed by Western blotting revealed that similar levels of VP0 could be detected in all samples, irrespective of the incubation temperature during production (Figure 10D, bottom), which was confirmed by ELISA quantification (Figure 10E). This suggests that the BacFree production of FMDV VLPs results in >99% reduction in contaminating baculovirus particles without yield loss. Production of WNV prME subviral particles with the new gp41ts system We next implemented the newly developed gp41ts BEVS for the production of West Nile Virus (WNV) subviral particles (SVPs), which are enveloped VLPs (eVLPs) lacking the WNV capsid protein (Figure 11A). Enveloped VLPs have different secretion routes than capsid VLPs, as they must acquire an envelope from e.g. the ER membrane or plasma membrane. The BEVS operates under slightly acidic conditions and this can result in the production of the less immunogenic eVLPs containing spiky post-fusion E-trimers, normally only formed after membrane fusion with a host cell (post-fusion state). We therefore introduced a stabilizing A261C mutation in the WNV E protein coding region (Figure 11B). Expression of WNV prME eVLPs with Acgp41tsshowed a reduction of 99.62% (-2.4 log10) of infectious BV contaminants at 33°C compared to 27°C (Figure 11C). Moreover, WNV eVLPs were produced at both 27°C and 33°C, and E protein monomers and dimers could be detected in the cell pellet and culture fluid on western blot (Figure 11D). Scaling-up of temperature strategy in bioreactors We assessed whether a similar BV reduction could be achieved in scalable cultivation systems. The high MOI infection process with Acgp41tswas scaled up to 125 mL ExpiSf9 suspension cultures in shake flasks and a table-top continuous stirred-tank bioreactor (CSTR) containing 300 mL. Cells were infected with the temperature-sensitive Acgp41ts-eGFP virus at a high MOI (10 TCID50 / mL). After 3 hours, the temperature in the bioreactor or shake flask was increased from 27°C to 33°C. Two shake flasks were cultivated as controls at 27°C or 33°C without temperature shift. The bioreactors and shake flasks were kept at setpoint until harvest at 120 hpi, but samples were also taken at 72 and 96 hpi. At all conditions tested, the infection progressed similarly and most cells (>90%) were infected at 24 hpi (Figure 12A). BV titers were several log scales higher in the control condition (cultured at 27°C) compared to the bioreactor and shake flasks cultured at, or shifted to 33°C (Figure 12B). A similar reduction in BV titers was measured in bioreactors and shake flasks, showing that the temperature-switch strategy is suitable for scale-up. To further show scalability, a low MOI strategy was performed in stirred tank bioreactors. The temperature-switch time points are now much later than with the high MOI regime, as an initial BV production round is needed to allow infection of the whole cell culture. We made use of a baculovirus expressing the gp41ts gene exogenously from the p10 promoter. Reactors were inoculated at a target density of 1x106viable cells / mL at 27°C. At 2.0x106viable cells / mL, cells were infected with the gp41 temperature-sensitive baculovirus at an MOI of 0.01 TCID50 / cell. The temperature was shifted to 34°C at 33 hpi, 35 hpi, or 40 hpi. One bioreactor acted as a control and was cultivated at 27°C with no temperature shift. The bioreactors were continuously monitored with a holographic microscope. The moment of temperature shift from 27°C to, in this case 34°C, was based on the detection of an increasing average cell diameter from the online measurements. The reduction in BV titers with this low MOI strategy were about 100-fold, where the earliest temperature shift (33 hpi) resulted in the lowest baculovirus titers. Example 3. Methods The materials and methods were used as described in example 1, unless stated otherwise. Construction of a bacmid with a ts mutation in the gp41 gene and VP1054 ts mutation The temperature-sensitive mutations were introduced in the AcMNPV bacmid BACe56 by Red / ET recombineering in GB08-RED E. coli cells (Red / ET recombination kit, GeneBridges, Cat.nr K009). For introduction of the gp41 ts mutation, the SacB-CAT negative selection cassette (Addgene plasmid #130216) was first inserted in the gp41 ORF, followed by scar-less replacement for the gp41 gene containing I317T mutation (Gblock, Integrated DNA Technologies). Integrity of the bacmid and the presence of the point mutation in gp41 was confirmed by next-generation sequencing (Macrogen). For introduction of the vp1054 ts mutation, the RpsL-CAT selection cassette (Gene Bridges) was inserted into the vp1054 ORF, followed by replacement for the vp1054 gene containing P286S mutation (Side-directed mutagenesis kit, New England BioLabs). The presence of the vp1054 ts mutation was confirmed by Sanger sequencing of the vp1054 locus (Macrogen). Results Construction of a temperature-sensitive baculovirus with a ts mutation in gp41 The GP41 ts mutation was implemented into the BEVS in the ac80 open reading frame at the original gp41 locus (Acgp41ts). A temperature-sensitive mutation (I317T) was seamlessly introduced in gp41 by two-step lambda red recombineering. The integrity of the bacmid and presence of the point-mutation were confirmed by next-generation sequencing of the bacmid DNA. Similarly, the VP1054 ts mutation was implemented into the BEVS (Acvp1054ts), and into the GP41 ts bacmid (creating a vp1054ts / gp41ts double-mutant) by two-step lambda red recombineering. To visualize and monitor viral spread, eGFP was expressed from the polh promoter in the wildtype (Ac) and ts viruses. The non-permissive temperature was determined as the temperature at which a single-cell infection phenotype would be observed. Sf9 cells were infected at 27°C with the wild-type bacmid, the gp41ts mutant, the vp1054ts mutant, or the vp1054ts / gp41ts double mutant at low MOI (0.01 TCID50 / cell). At 3 hpi at 27°C, the inoculum was replaced by fresh medium and cells were incubated at 27°C, 31°C, 32°C, 33°C, or 34°C (see Figure 13). Single-cell infections were observed for the Acgp41ts mutant at 33°C and 34°C, coherent with previous reports (Olszewski and Miller, 1997. Virology 233: 292-301; Lee and Miller,1979. J Virol 31: 240-252). At 32°C, the virus was largely attenuated and only local spread of the virus infection was visible. The vp1054ts mutant appeared non-permissive at 34°C, whereas the double mutant showed a single-cell infection phenotype at 32°C and large attenuation at 31°C. Conclusion By using a temperature sensitive mutant of AcMNPV with a (I317T) mutation in the gp41 gene and applying a temperature shift during the production of two biopharmaceutical products (FMDV and WNV (sub)VLPs), we were able to reduce the production of contaminating budded viruses at least 2-logs, with minimal impact on the levels of product production. The temperature-dependent regulation of BV secretion was scaled-up to stirred-tank bioreactors and we were able to reduce the production of contaminating budded baculovirus particles (BVs) for both high and low MOI infection strategies. Sequences 1. gp41 ts of AcMNPV. I317T is bold and underlined. MTDERGNFYY NTPPPLRYPS NPATAIFTSA QTYNAPGYVP PATVPTTVAT RDNRMDYTSR SNSTNSVAIA PYNKSKEPTL DAGESIWYNK CVDFVQKIIR YYRCNDMSEL SPLMILFINT IRDMCIDTNP ISVNVVKRFE SEETMIRHLI RLQKELGQSN AAESLSSDSN IFQPSFVLNS LPAYAQKFYN GGADMLGKDA LAEAAKQLSL AVQYMVAEAV TCNIPIPLPF NQQLANNYMT LLLKHATLPP NIQSAVESRR FPHINMINDL INAVIDDLFA GGGDYYHYVL NEKNRARVMS LKENVAFLAP LSASANTFNY MAELATRAGK QPSMFQNATF LTSAANAVNS PAAHLTKSAC QESLTELAFQ NETLRRFIFQ QINYNKDANA IIAAAAPNAT RPNTKGRTA 2. gp41 ts of BmNPV. I311 is bold and underlined. MTDERGNFYY NTPPPPLRYP SNPATAIFTS AQTYNNAPGY VPPTTRDNKM DTSRSNSTNS VAIAPYNKSK EPTLDAGESI WYNKCVDFVQ KIIRYYRCND MSELSPLMIH FINTIRDMCI DTNPINVNVV KRFESEETMI RHLIRLQKEL GQGNAAESLS SDSNIFQASF VLNSLPAYAQ KFYNGGADML GKDALAEAAK QLSLAVQYMV AESVTCNIPI PLPFNQQLAN NYMTLLLKHA TLPPNIQSAV ESRRFPHINM INDLINAVID DLFAGGGDYY HYVLNEKNRA RIMSLKENVA FLAPLSASAN IFNYMAELAT RAGKQPSMFQ NATFLTSAAN AVNSPAAHLT KNACQDSLTE LAFQNETLRR FIFQQINYNK DANAIIAAAA PNVTRPNTKG RTV 3. ORF54 of AcMNPV. P286 is bold and underlined MCSTKKPIKL DLCASVKLTP FKPMRPPKPM QCWIHPRRAN CKVTRPRNNY SDPDNENDML HMTVLNSVFL NEHAKLYYRH LLRNDQAEAR KTILNADSVY ECMLIRPIRT EHFRSVDEAG EHNMSVLKII IDAVIKYIGK LADDEYILIA DRMYVDLIYS EFRAIILPQS AYIIKGDYAE SDSESGQSVD VCNELEYPWK LITANNCIVS TDESRQSQYI YRTFLLYNTV LTAILKQNNP FDVIAENTSI SIIVRNLGSC PNNKDRVKCC DLNYGGVPPG HVMCPPREIT KKVFHYAKWV RNPNKYKRYS ELIARQSETG GGSASLRENV NNQLHARDVS QLHLLDWENF MGEFSSYFGL HAHNV 4. VP1054 of BmNPV (NP_047459.1). P286 is bold and underlined MCSTKKPIKL DLCASVKLTP FKPMRPPKPM QCWIHPRRAN CKVTRPRNNY SDPDNENDML HMTVLNSVFL NEHAKLYYRH LLRNDQAEAR KTILNADDVY ECVLIKPIRT EHFRSVDEAG EHNMGVLKII IDTVIKYIGK LADDEYILIA DRMYVDLIYS EFRAIILPQS AYIIKGDYAE SDSESGQSVD VCNELKYPWN LITANSFIVS TDESRQSQYI YRTFLLYNTV LTAILKQNNP FNVIAENTSI SIIVRNLGNC PNNKDRVKCC DLNYGGIPPG HVMCPPREIT KKVFHYAKWV RNPNKYKRYS ELIARQSEAG GASASLRENV NNQLHARDAS QLHLLDWENF MGEFSSYFGL HAHNV
Claims
Claims 1. A method for the production of a biopharmaceutical product, comprising: (a) infecting an insect cell with a baculovirus, said baculovirus comprising an exogenous gene coding for a biopharmaceutical product, and (b) maintaining the infected insect cell under conditions such that the biopharmaceutical product is produced, wherein the genome of said baculovirus comprises a temperature-sensitive (ts) mutation in a gene that is essential for baculovirus particle formation and / or secretion, and wherein the infected insect cell is maintained for production of the biopharmaceutical product at a non-permissive temperature of said ts baculovirus.
2. The method according to claim 1, wherein the ts baculovirus is, or is derived from, an Alphabaculovirus such as Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV).
3. The method according to claim 1 or claim 2, wherein said gene that is essential for baculovirus particle formation and / or secretion is selected from GP41 and ORF54 (VP1054) of AcMNPV, or from a gene that is homologous to GP41 or ORF54 of a related virus.
4. The method according to any one of claims 1 to 3, wherein the infected insect cell is used for production of the biopharmaceutical product above a critical temperature, preferably above 33 ºC.
5. The method according to any one of claims 1 to 4, wherein the ts baculovirus comprising an exogenous gene coding for a biopharmaceutical product is produced before step (a) in an insect cell at a permissive temperature below a critical temperature, preferably below 32 ºC.
6. The method according to any one of claims 1 to 5, wherein the gene comprising the ts mutation is expressed from its native location or from an exogenous location in the baculovirus genome.
7. The method according to any one of claims 1 to 6, wherein the gene comprising the ts mutation is expressed under control of its native promoter, or an exogenous promoter.
8. The method according to claim 7, wherein the exogenous promoter is the baculovirus p10 promoter.
9. The method according to any one of claims 1 to 8, wherein the biopharmaceutical product is a recombinant protein, a recombinant viral vector, a virus-like particle or a viral replicon particle.
10. The method according to any one of claims 1-9, wherein the biopharmaceutical product is a viral vector such as a recombinant adeno associated virus.
11. The method according to any one of claims 1 to 10, wherein the biopharmaceutical product is encoded by a exogenous gene in the baculovirus genome under the control of a polyhedrin or p10 promoter.
12. The method of any one of claims 1 to 11, wherein one or more of the baculovirus genes cathepsin, chitinase, p26, p74 and pl0 are disrupted in the ts baculovirus genome.
13. Use of a baculovirus with a temperature-sensitive (ts) mutation in a gene that is essential for baculovirus particle formation and / or secretion, for production of a biopharmaceutical product.
14. The use according to claim 13, wherein the ts baculovirus is, or is derived from, an Alphabaculovirus such as Autographa californica multicapsid nucleo- polyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV).
15. The use according to claim 13 or 14, wherein the biopharmaceutical product is a recombinant protein, a recombinant viral vector, a virus-like particle, or a viral replicon particle.