Therapeutic crispr / cas9 gene editing approaches to the c9orf72 repeat expansion mutation in ipscs

Abstract

There are provided in vitro and in vivo methods of editing the C9ORF72 repeat expansion mutation using a nuclease to edit a nucleic acid in which the expansion is found. An exemplary method uses a Cas-9 editing system. Guide nucleic acids for editing the repeat expansion mutation are provided. Also provided is a method of mitigating or eliminating symptoms arising in a subject due to the presence of the mutation in the subject's genome.

Description

THERAPEUTIC CRISPR / CAS9 GENE EDITING APPROACHES TO THE C9ORF72 REPEAT EXPANSION MUTATION IN IPSCSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present disclosure claims priority to United States Provisional Patent Application No. 63 / 502,041 filed May 12, 2023, which is hereby incorporated by reference in its entirety for all purposes.

[0002] This application is related to PCT International Application No.: PCT / US23 / 66966, the entire disclosure of which is incorporated herein by reference for all purposes.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0003] This invention was made with government support under grant K08 NS 112330 awarded by The National Institutes of Health. The government has certain rights in the invention.BACKGROUND OF THE INVENTION

[0004] Age-related neurodegenerative diseases, including dementias and motor neuron diseases, are leading contributors to death, disability and health care expenditure worldwide — Heterozygous expansion of a GGGGCC repeat in a single allele of the C9orf72 gene is the most frequent known genetic cause of both FTD and ALS— (C9FTD / ALS). Targeting the mutant C9orf72 gene itself is the most parsimonious and potentially the most powerful therapeutic intervention. While antisense oligonucleotide (ASO) therapy showed promise in pre-clinical studies,12^ the inability of a phase I ASO trial in C9-ALS patients— demonstrates the need for more targeted approaches. Gene editing offers the advantage that a single intervention could potentially be curative / preventative.—

[0005] Expression of the C9orf72 mutant repeat expansion is thought to cause disease through the generation of toxic products derived from the repeat expansion itself. RNA harboring the mutant repeat expansion may disrupt normal RNA processing by sequesteringRNA-binding proteins12^2and production of toxic dipeptide repeats through repeat- associated non-canonical (RAN) translation.22=22Hapolinsufficiency has been proposed as an additional or alternative mechanism of disease,22=22but this is unlikely to the major contributor to C9FTD / ALS. The most compelling evidence against this hypothesis is that large-scale population sequencing— and clinical sequencing suggest that C9orf72 heterozygous loss-of-function mutations do not contribute to C9FTD / ALS — Secondly, knock-out mouse models have an autoimmune phenotype but lack neurologic disease.22^2Loss of C9orf72 function may indeed exacerbate toxic gain-of-functi on.22=22We therefore hypothesized that gene editing strategies that remove or silence the repeat expansion would arrest or reverse cellular pathology.

[0006] CRISPR gene editing holds promise to cure or arrest monogenic disease, if we know which edit will be curative at the cellular level, and can achieve such an edit reliably, safely and effectively. C9orf72 is the leading genetic cause both frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS). A method of editing the C9orf72 repeat expansion mutation for the ability to correct pathology in neurons derived from patient iPSCs would provide a significant advance in the understanding of the origins, and pathologies associated with these conditions, and open pathways to treating these conditions.BRIEF SUMMARY OF THE INVENTION

[0007] Quite surprisingly, the present invention provides an efficacious and safe CRISPR- based method of editing the C9orf72 repeat expansion mutation, and first in class guide RNAs of use in carrying out this method. The method and guide RNAs provide critical tools for gene therapy targeting the C9orf72 repeat expansion mutation, which can normalize RNA abnormalities and TDP-43 pathology. In various embodiments, the present invention provides various methods of accomplishing this gene therapy, and compositions of use in these and other methods.

[0008] Though clearly a valuable goal and target, selection of an appropriate method for gene therapy of the C9orf72 repeat expansion mutation is not immediately apparent. The most apparent strategy, editing to remove the repeat-expansion itself41 43risks off-target editing at >2500 homologous off-targets throughout the genome,44thus risking cellular death from DNA damage. Other editing approaches disrupted nearby regulatory regions on both the normal and diseased allele,41which is undesirable as homozygous knockout causes earlylethality in mice.36 38Finally, editing strategies that utilize homology directed repair43are inefficient in post-mitotic cells.45

[0009] In various embodiments, the present invention provides approaches to targeting the C9orf72 repeat expansion mutation using gene therapy. Exemplary approaches include directly targeting the mutation (bi-allelic excision of the repeat expansion region), allelespecific excision of the mutant allele leaving the normal allele intact, and bi-allelic excision of a regulator region (exon 1 A) controlling expression of the mutation. All three approaches normalize RNA abnormalities and TDP-43 pathology. Surprisingly, only repeat excision and allele-specific excision completely eliminated pathologic dipeptide repeats. Accordingly, in various embodiments, the invention provides methods of gene therapy targeting the C9orf72 repeat expansion mutation using a member selected from repeat excision, allele-specific excision and a combination thereof.

[0010] In various embodiments, the present invention provides CRISPR approaches to gene correction using patient iPSCs.

[0011] Additional objects and embodiments of the present invention will be better understood from the Detailed Description that follows. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figures 1 A and IB collectively illustrate AAV vector DNA sequence for AAV- spCas9 (SEQ ID NO:728).

[0013] Figures 2A and 2B collectively illustrate AAV vector DNA sequence for AAV-ALT (SEQ ID NO:729)

[0014] Figures 3 A and 3B collectively illustrate AAV vector DNA sequence for AAV-REx (SEQ ID NO:730)

[0015] Figure 4 illustrates a schematic of allele-specific excision (called HET(Mut)x or C9- ALT).

[0016] Figure 5 illustrates a schematic of engineered C9orf72 patient iPSC line with removal of the wild-type (WT) allele to measure the effect of editing specifically on the mutant allele. Removal of the WT allele is called HET(WT)x or C9-REF.

[0017] Figure 6 shows validation of the ddPCR assay to detect allele-specific excision at the C9orf72 locus.

[0018] Figure 7 shows validation of the ability of the ddPCR probes to measure excision of the mutant allele across clonal cell lines with the presence (C9p5 and C9p5-REF) or absence (C9p5-ALT and C9p5-KO) of the mutant allele.

[0019] Figure 8 illustrates further validation of the ddPCR mutant allele excision assay using a mixing study.

[0020] Figure 9 shows additional validation of the ability of the ddPCR probes to measure excision of the WT allele (which might occur in an off-target edit) across clonal cell lines with the presence (C9p5 and C9p5-ALT) or absence (C9p5-REF and C9p5-KO) of the WT allele.

[0021] Figure 10 shows further validation of the ddPCR WT allele excision assay using a mixing study.

[0022] Figure 11 illustrates a schematic of allele-specific gRNA location and pairing in screen.

[0023] Figure 12 illustrates on-target editing efficiency (removal of the mutant allele) as determined by ddPCR after electroporation of spCas9 and gRNA into engineered patient iPSC screening line. Each gRNA pair was tested by electroporation and performed in biological duplicate (independent electroporations). Error bars = SEM.

[0024] Figure 13 illustrates a heat map of on-target editing efficiency (removal of the mutant allele) as determined by ddPCR after electroporation of spCas9 and gRNA into engineered patient iPSC screening line. Average efficiency across two electroporations is depicted within the box corresponding to each gRNA pair. Darker color indicated higher efficiency.

[0025] Figure 14 shows top 4 allele-specific gRNA pairs validated across 3 patient iPSC lines from genetically unrelated donors via electroporation of spCas9 and gRNAs.

[0026] Figure 15 shows analysis of whole genome sequencing data from 83 individuals with repeat expansion of C9orf72.

[0027] Figure 16 illustrates a schematic of bi-allelic repeat region excision (called REx or C9-REx).

[0028] Figure 17 illustrates a schematic of engineered C9orf72 patient iPSC line with removal of the wild-type (WT) allele to measure the effect of editing specifically on the mutant repeat expansion. Removal of the WT allele is called HET(WT)x or C9-REF.

[0029] Figure 18 shows validation of our ddPCR assay to detect excision of the repeat region at the C9orf72 locus.

[0030] Figure 19 reports the ratios of edited cell line as measured by ddPCR for each combination of edited (WT-REX) and repeat region removed (C9p5-KO) cell line in the mixing study.

[0031] Figure 20 shows validation of ddPCR assay for the detection of excision of the C9orf72 repeat region.

[0032] Figure 21 shows further validation of the ddPCR C9orf72 repeat allele excision assay using a mixing study.

[0033] Figure 22 illustrates a zoomed in schematic of the placement of REx gRNAs for excision of the repeat region on either side of the GGGGCC repeat region and repeat expansion.

[0034] Figure 23 illustrates a zoomed out schematic of the placement of REx gRNAs for excision of the C9orf72 repeat region.

[0035] Figure 24 show on-target editing efficiency (excision of the C9orf72 repeat region) as determined by ddPCR after electroporation of spCas9 and gRNA into engineered patient iPSC screening line. Each gRNA pair was tested by electroporation and performed in biological duplicate (independent electroporations). Error bars = SEM.

[0036] Figure 25 shows a heat map of on-target editing efficiency (excision of the C9orf72 repeat region) as determined by ddPCR after electroporation of spCas9 and gRNA into engineered patient iPSC screening line. Average efficiency across two electroporations of spCas9 and dual gRNAs is depicted within the box corresponding to each gRNA pair. Darker color indicated higher efficiency.

[0037] Figure 26 shows top 4 repeat region excision gRNA pairs validated across 3 patient iPSC lines from genetically unrelated donors via electroporation of spCas9 and gRNAs.

[0038] Figure 27 shows percent on-target editing in an in vivo C9 mouse editing.DETAILED DESCRIPTION OF THE INVENTIONIntroduction

[0039] The CRISPR / Cas9 system is a highly specific genome editing tool and newly engineered Cas9 variants are capable of distinguishing alleles differing by even a single base pair.46 53CRISPR-Cas9 was used to edit the C9orf72 locus in patient and non-diseased control iPSCs to generate 11 isogenic lines across two genetic backgrounds.

[0040] Selected embodiments of the present invention emerged from examination of three approaches to editing the C9orf72 locus: (1) targeting the mutation itself (repeat expansion excision), (2) allele-specific excision of the mutant allele leaving the normal allele intact and (3) excision of a regulatory region (exon 1 A) that controls expression of the mutation sensestrand. Single-molecule sequencing was used to size the repeat expansion in 7 patient lines, to phase the mutation to nearby SNPs and to determine the outcome of edits involving the repeat expansion or that were otherwise indeterminable from Sanger sequencing. Robust editing and outcome measurement tools lay the groundwork to investigate gene-editing approaches for monogenic disease in human iPSCs and derived cell-types relevant to disease, and are applicable to any monogenic disease, particularly other repeat expansion disorders.

[0041] Three strategies for correcting the C9orf72 repeat expansion mutation in patient iPSCs were investigated. Each strategy capitalized on Cas9’s ability to cut DNA, which aligns with technologies that are closest to clinical prime-time.^2Two of the three approaches (repeat expansion excision and excision of the mutant allele) were found to correct RNA abnormalities, preserve protein levels, and correct dipeptide repeat and TDP43 pathology in iPSC-derived neurons from a patient line harboring -200 repeats. As an alternative approach, silencing the expression of the repeat expansion without removing it from the DNA by excising exon 1 A was performed. While this approach successfully restored the RNA profile and ameliorated TDP43 pathology, surprisingly, it did not eliminate poly-GP DPRs. Interestingly, both successful approaches, repeat expansion and allelespecific excisions, included removing the repeat expansion.

[0042] Provided herein are compositions and methods relating to treatment of disorders attributable to the C9orf72 repeat expansion mutation in human genome. Exemplary diseases treatable by the composition and methods of the invention include both frontotemporaldementia (FTD) and amyotrophic lateral sclerosis (ALS) caused by C9orf72 repeat expansion mutation in human genome.Definitions

[0043] The terms “polynucleotide” and “nucleic acid,” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0044] The term “oligonucleotide” refers to a polynucleotide of between 3 and 100 nucleotides of single- or double-stranded nucleic acid (e.g., DNA, RNA, or a modified nucleic acid). However, for the purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides are also known as “oligomers” or “oligos” and may be isolated from genes, transcribed (in vitro and / or in vivo), or chemically synthesized. The terms “polynucleotide” and “nucleic acid” should be understood to include, as applicable to the embodiments being described, single-stranded (such as sense or antisense) and doublestranded polynucleotides.

[0045] A “stem -loop structure” refers to a nucleic acid having a secondary structure that includes a region of nucleotides which are known or predicted to form a double strand (step portion) that is linked on one side by a region of predominantly single-stranded nucleotides (loop portion). The terms “hairpin” and “fold-back” structures are also used herein to refer to stem-loop structures. Such structures are well known in the art and these terms are used consistently with their known meanings in the art. As is known in the art, a stem-loop structure does not require exact base-pairing. Thus, the stem may include one or more base mismatches. Alternatively, the base-pairing may be exact, i.e. not include any mismatches.

[0046] By “hybridizable” or “complementary” or “substantially complementary” it is meant that a nucleic acid (e.g. RNA, DNA) comprises a sequence of nucleotides that enables it to non-covalently bind, i.e. form Watson-Crick base pairs and / or G / U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength. Standard Watson-Crick base-pairing includes: adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C) [DNA, RNA], In addition, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization of a DNA molecule with an RNA molecule: guanine (G) can also base pair with uracil (U). For example, G / U base-pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons in mRNA. Thus, in the context of this disclosure, a guanine (G) is considered complementary to both a uracil (U) and to an adenine (A). For example, when a G / U base-pair can be made at a given nucleotide position of a protein-binding segment (e.g., dsRNA duplex) of a subject guide nucleic acid molecule, the position is not considered to be non-complementary, but is instead considered to be complementary.

[0047] Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, variables well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. For hybridizations between nucleic acids with short stretches of complementarity (e.g. complementarity over 35 or less, 30 or less, 25 or less, 22 or less, 20 or less, or 18 or less nucleotides) the position of mismatches can become important (see Sambrook et al., supra, 11.7-11.8). Typically, the length for a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more). The temperature and wash solution salt concentration may be adjusted as necessary according to factors such as length of the region of complementation and the degree of complementation.

[0048] It is understood that the sequence of a polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable or hybridizable. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). A polynucleotide can comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target regionwithin the target nucleic acid sequence to which it will hybridize. For example, an antisense nucleic acid in which 18 of 20 nucleotides of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides. Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined using any convenient method. Exemplary methods include BLAST programs (basic local alignment search tools) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656) or by using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

[0049] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.

[0050] “Binding” as used herein (e.g. with reference to an RNA-binding domain of a polypeptide, binding to a target nucleic acid, and the like) refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid; between a subject Cas9 / guide nucleic acid complex and a target nucleic acid; and the like). While in a state of non-covalent interaction, the macromolecules are said to be “associated” or “interacting” or “binding” (e.g., when a molecule X is said to interact with a molecule Y, it is meant the molecule X binds to molecule Y in a non-covalent manner). Not all components of a binding interaction need be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), but some portions of a binding interaction may be sequence-specific. Binding interactions are generally characterized by a dissociation constant (Ka) of less than 10-6 M, less than 10-7 M, less than 108 M, less than 10-9 M, less than 1010 M, less than 1011 M, less than 1012 M, less than 10-13 M, less than 1014 M, or less than 10-15 M. “Affinity” refers to the strength of binding, increased binding affinity being correlated with a lower Ka.

[0051] By “binding domain” it is meant a protein domain that is able to bind non-covalently to another molecule. A binding domain can bind to, for example, a DNA molecule (a DNA-binding domain), an RNA molecule (an RNA-binding domain) and / or a protein molecule (a protein-binding domain). In the case of a protein having a protein-binding domain, it can in some cases bind to itself (to form homodimers, homotrimers, etc.) and / or it can bind to one or more regions of a different protein or proteins.

[0052] The term “conservative amino acid substitution” refers to the interchangeability in proteins of amino acid residues having similar side chains. For example, a group of amino acids having aliphatic side chains consists of glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains consists of serine and threonine; a group of amino acids having amide containing side chains consisting of asparagine and glutamine; a group of amino acids having aromatic side chains consists of phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains consists of lysine, arginine, and histidine; a group of amino acids having acidic side chains consists of glutamate and aspartate; and a group of amino acids having sulfur containing side chains consists of cysteine and methionine. Exemplary conservative amino acid substitution groups are: valine- leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine-glycine, and asparagine-glutamine.

[0053] A polynucleotide or polypeptide has a certain percent “sequence identity” to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same, and in the same relative position, when comparing the two sequences. Sequence identity can be determined in a number of different ways. To determine sequence identity, sequences can be aligned using various methods and computer programs (e.g., BLAST, T-COFFEE, MUSCLE, MAFFT, etc.), available over the world wide web at sites including ncbi.nlm nili.gov / BLAST, ebi.ac.uk / Tools / msa / tcoffee / , ebi.ac.uk / Tools / msa / muscle / , mafft.cbrc.jp / alignment / software / . See, e.g., Altschul et al. (1990), J. Mol. Bioi. 215:403-10.

[0054] A DNA sequence that “encodes” a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into protein, or a DNA polynucleotide may encode an RNA that is not translated into protein (e.g. tRNA, rRNA, microRNA (miRNA), a “non-coding” RNA (ncRNA), a guide nucleic acid, etc.).

[0055] A “protein coding sequence” or a sequence that encodes a particular protein or polypeptide, is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA)and is translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' terminus (N-terminus) and a translation stop nonsense codon at the 3' terminus (C-terminus). A coding sequence can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic nucleic acids. A transcription termination sequence will usually be located 3' to the coding sequence.

[0056] The terms “DNA regulatory sequences,” “control elements,” and “regulatory elements,” used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and / or regulate transcription of a noncoding sequence (e.g., guide nucleic acid) or a coding sequence (e.g., Cas9 polypeptide, or Cas9 polypeptide) and / or regulate translation of an encoded polypeptide.

[0057] As used herein, a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase and initiating transcription of a downstream (3' direction) coding or noncoding sequence. For purposes of the present disclosure, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site, as well as protein binding domains responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain “TATA” boxes and “CAT” boxes. Various promoters, including inducible promoters, may be used to drive the various vectors of the present disclosure.

[0058] The term “Untranslated Regions (UTRs)” as used herein applied to untranslated regions (UTRs) of a gene are transcribed but not translated. The 5'UTR starts at the transcription start site and continues to the start codon but does not include the start codon; whereas the 3'UTR starts immediately following the stop codon and continues until the transcriptional termination signal.

[0059] The term “zzz ci " as used herein refers to regions of DNA on the same chromosome as a reference gene.

[0060] The term “naturally-occurring” or “unmodified” or “wild type” as used herein as applied to a nucleic acid, a polypeptide, a cell, or an organism, refers to a nucleic acid, polypeptide, cell, or organism that is found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by a human in the laboratory is wild type (and naturally occurring).

[0061] “Heterologous,” as used herein, means a nucleotide or polypeptide sequence that is not found in the native nucleic acid or protein, respectively. For example, in a chimeric Cas9 protein, the RNA-binding domain of a naturally-occurring bacterial Cas9 polypeptide (or a variant thereof) may be fused to a heterologous polypeptide sequence (i.e. a polypeptide sequence from a protein other than Cas9 or a polypeptide sequence from another organism). The heterologous polypeptide sequence may exhibit an activity (e.g., enzymatic activity) that will also be exhibited by the chimeric Cas9 protein (e.g., methyltransferase activity, acetyltransferase activity, kinase activity, ubiquitinating activity, etc.). A heterologous nucleic acid sequence may be linked to a naturally-occurring nucleic acid sequence (or a variant thereof) (e.g., by genetic engineering) to generate a chimeric nucleotide sequence encoding a chimeric polypeptide. As another example, in a fusion variant Cas9 polypeptide, a variant Cas9 polypeptide may be fused to a heterologous polypeptide (i.e. a polypeptide other than Cas9), which exhibits an activity that will also be exhibited by the fusion variant Cas9 polypeptide. A heterologous nucleic acid sequence may be linked to a variant Cas9 polypeptide (e.g., by genetic engineering) to generate a nucleotide sequence encoding a fusion variant polypeptide.

[0062] “Recombinant,” as used herein, means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR) and / or ligation steps resulting in a construct having a structural coding or non-coding sequence distinguishable from endogenous nucleic acids found in natural systems. DNA sequences encoding polypeptides can be assembled from cDNA fragments or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from a recombinant transcriptional unit contained in a cell or in a cell-free transcription and translation system. Genomic DNA comprising the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of nontranslated DNA may be present 5' or 3' from the open reading frame, where such sequencesdo not interfere with manipulation or expression of the coding regions, and may indeed act to modulate production of a desired product by various mechanisms (see “DNA regulatory sequences”, below). Alternatively, DNA sequences encoding RNA (e.g., guide nucleic acid) that is not translated may also be considered recombinant. Thus, e.g., the term “recombinant” nucleic acid refers to one which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of sequence through human intervention. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a codon encoding the same amino acid, a conservative amino acid, or a non-conservative amino acid. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. When a recombinant polynucleotide encodes a polypeptide, the sequence of the encoded polypeptide can be naturally occurring (“wild type”) or can be a variant (e.g., a mutant) of the naturally occurring sequence. Thus, the term “recombinant” polypeptide does not necessarily refer to a polypeptide whose sequence does not naturally occur. Instead, a “recombinant” polypeptide is encoded by a recombinant DNA sequence, but the sequence of the polypeptide can be naturally occurring (“wild type”) or non-naturally occurring (e.g., a variant, a mutant, etc.). Thus, a “recombinant” polypeptide is the result of human intervention, but may be a naturally occurring amino acid sequence.

[0063] A “vector” or “expression vector” is a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, i.e. an “insert”, may be attached so as to bring about the replication of the attached segment in a cell.

[0064] An “expression cassette” comprises a DNA coding sequence operably linked to a promoter. “Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression.

[0065] The terms “recombinant expression vector,” or “DNA construct” are used interchangeably herein to refer to a DNA molecule comprising a vector and one insert. Recombinant expression vectors are usually generated for the purpose of expressing and / orpropagating the insert(s), or for the construction of other recombinant nucleotide sequences. The insert(s) may or may not be operably linked to a promoter sequence and may or may not be operably linked to DNA regulatory sequences.

[0066] A cell has been “genetically modified” or “transformed” or “transfected” by exogenous DNA, e.g. a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones that comprise a population of daughter cells containing the transforming DNA. A “clone” is a population of cells derived from a single cell or common ancestor by mitosis. A “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.

[0067] Suitable methods of genetic modification (also referred to as “transformation”) include e.g., viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)- mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro injection, nanoparticle- mediated nucleic acid delivery (see, e.g., Panyam et., al Adv Drug Deliv Rev. 2012 Sep. 13. pii: S0169-409X(12)00283-9. doi: 10.1016 / j.addr.2012.09.023), and the like.

[0068] The choice of method of genetic modification is generally dependent on the type of cell being transformed and the circumstances under which the transformation is taking place (e.g., in vitro, ex vivo, or in vivo). A general discussion of these methods can be found in Ausubel, et al., Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons, 1995.

[0069] By “cleavage” it is meant the breakage of the covalent backbone of a target nucleic acid molecule (e.g., RNA, DNA). Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and doublestranded cleavage can occur as a result of two distinct single-stranded cleavage events. Incertain embodiments, a complex comprising a guide nucleic acid and a Cas9 polypeptide is used for targeted cleavage of a single stranded target nucleic acid (e.g., ssRNA, ssDNA).

[0070] “Nuclease” and “endonuclease” are used interchangeably herein to mean an enzyme which possesses catalytic activity for nucleic acid cleavage (e.g., ribonuclease activity (ribonucleic acid cleavage), deoxyribonuclease activity (deoxyribonucleic acid cleavage), etc.).

[0071] By “cleavage domain” or “active domain” or “nuclease domain” of a nuclease it is meant the polypeptide sequence or domain within the nuclease which possesses the catalytic activity for nucleic acid cleavage. A cleavage domain can be contained in a single polypeptide chain or cleavage activity can result from the association of two (or more) polypeptides. A single nuclease domain may consist of more than one isolated stretch of amino acids within a given polypeptide.

[0072] A “target nucleic acid” as used herein is a polynucleotide (e.g., RNA, DNA) that includes a “target site,” “target sequence” or “targeting segment.” The terms “target site,” “target sequence” or “targeting segment.” are used interchangeably herein to refer to a nucleic acid sequence present in a target nucleic acid to which a targeting segment of a subject guide nucleic acid will bind, provided sufficient conditions for binding exist. Suitable hybridization conditions include physiological conditions normally present in a cell. For a double stranded target nucleic acid, the strand of the target nucleic acid that is complementary to and hybridizes with the guide nucleic acid is referred to as the “complementary strand;” while the strand of the target nucleic acid that is complementary to the “complementary strand” (and is therefore not complementary to the guide nucleic acid) is referred to as the “noncomplementary strand” or “non-complementary strand.” In cases where the target nucleic acid is a single stranded target nucleic acid (e.g., single stranded DNA (ssDNA), single stranded RNA (ssRNA)), the guide nucleic acid is complementary to and hybridizes with single stranded target nucleic acid. A “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of an engineered nuclease complex. A target sequence may comprise any polynucleotide, such as DNA, RNA, or a DNA-RNA hybrid. A target sequence can be located in the nucleus or cytoplasm of a cell. A target sequence can be located in vitro or in a cell-free environment.

[0073] A nucleic acid molecule that binds to the Cas9 polypeptide and targets the polypeptide to a specific location within the target nucleic acid is referred to herein as a “guide nucleic acid.” When the guide nucleic acid is an RNA molecule, it can be referred to as a “guide RNA” or a “gRNA.” A subject guide nucleic acid comprises two segments, a first segment (referred to herein as a “targeting segment”); and a second segment (referred to herein as a “protein-binding segment”). By “segment” it is meant a segment / section / region of a molecule, e.g., a contiguous stretch of nucleotides in a nucleic acid molecule. A segment can also mean a region / section of a complex such that a segment may comprise regions of more than one molecule. For example, in some cases the protein-binding segment (described below) of a guide nucleic acid is one nucleic acid molecule (e.g., one RNA molecule) and the protein-binding segment therefore comprises a region of that one molecule. In other cases, the protein-binding segment (described below) of a guide nucleic acid comprises two separate molecules that are hybridized along a region of complementarity.

[0074] A “PAM” as used herein, denotes the protospacer adjacent motif (PAM), which is a typically 2-6 base pair DNA sequence immediately proximal to the DNA sequence targeted by the nuclease (protospacer). Depending on the CRISPR system, a PAM sequence can be positioned either 5' or 3' relative to the protospacer sequence. Type V CRISPR-Cas systems show a specificity towards 5' PAM sequences that are T-rich. In contrast, Cas9, a Type II Cas, has specificity for a 3' G-rich PAM sequence.

[0075] A “PAMmer” as used herein, denotes a single stranded oligonucleotide (as defined above) (e.g., DNA, RNA, a modified nucleic acid (described below), etc.) that hybridizes to a single stranded target nucleic acid (thus converting the single stranded target nucleic acid into a double stranded target nucleic acid at a desired position), and provides a protospacer adjacent motif (PAM) sequence, thus converting the single stranded target nucleic acid into a target for binding and / or cleavge by a Cas9 polypeptide. A PAMmer includes a PAM sequence and at least one of an orientation segment (which is positioned 3' of the PAM sequence), and a specificity segment (which is positioned 5' of the PAM sequence). A specificity segment has a nucleotide sequence that is complementary to a first target nucleotide sequence in a target nucleic acid (i.e., the sequence that is targeted by the specificity segment), where the first target nucleotide sequence overlaps (in some cases 100%) with the sequence targeted by the targeting segment of the guide nucleic acid. In other words, the specificity segment is complementary with (and hybridizes to) the target site of thetarget nucleic acid. In some cases, a PAMmer having a specificity segment is referred to herein as a “5' extended PAMmer.” An orientation segment has a nucleotide sequence that is complementary to a second target nucleotide sequence in a target nucleic acid (i.e., the sequence that is targeted by the orientation segment). In some cases, a subject PAMmer includes a PAM sequence and an orientation segment, but does not include a specificity segment. In some cases, a subject PAMmer includes a PAM sequence and a specificity segment, but does not include an orientation segment.

[0076] Throughout the description below, when referring to the components (e.g., a PAMmer, a guide nucleic acid, a Cas9 polypeptide, etc.) of subject compositions and methods, terms describing the components can also be provided as nucleic acids encoding the component. For example, when a composition or method includes a Cas9 polypeptide, it is understood that the Cas9 can be provided as the actual polypeptide or as a nucleic acid (DNA or RNA) encoding the same. Likewise, when a composition or method includes a PAMmer, it is understood that the PAMmer can be provided as the actual PAMmer or as a nucleic acid (DNA) encoding the same. For example, in some cases a PAMmer is DNA, in some cases a PAMmer is a modified nucleic acid, and in some cases a PAMmer is RNA, in which case the term “PAMmer” can be provided as the actual RNA PAMmer but also can be provided as a DNA encoding the RNA PAMmer. Likewise, when a composition or method includes a guide nucleic acid, it is understood that the guide nucleic acid can be provided as the actual guide nucleic acid or as a nucleic acid (DNA) encoding the guide nucleic acid. For example, in some cases a guide nucleic acid is a modified nucleic acid, in some cases a guide nucleic acid is a DNA / RNA hybrid molecule, and in some cases a guide nucleic acid is RNA, in which case the guide nucleic acid can be provided as the actual guide RNA or as a DNA (e.g., plasmid) encoding the guide RNA.

[0077] A “host cell” or “target cell” as used herein, denotes an in vivo or in vitro eukaryotic cell, a prokaryotic cell (e.g., bacterial or archaeal cell), or a cell from a multicellular organism (e.g., a cell line) cultured as a unicellular entity, which eukaryotic or prokaryotic cells can be, or have been, used as recipients for a nucleic acid, and include the progeny of the original cell which has been transformed by the nucleic acid. It is understood that the progeny of a single cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation. A “recombinant host cell” (also referred to as a “genetically modified host cell”) is a host cellinto which has been introduced a heterologous nucleic acid, e.g., an expression vector. For example, a subject bacterial host cell is a genetically modified bacterial host cell by virtue of introduction into a suitable bacterial host cell of an exogenous nucleic acid (e.g., a plasmid or recombinant expression vector) and a subject eukaryotic host cell is a genetically modified eukaryotic host cell (e.g., a mammalian germ cell), by virtue of introduction into a suitable eukaryotic host cell of an exogenous nucleic acid.

[0078] The term “stem cell” is used herein to refer to a cell (e.g., plant stem cell, vertebrate stem cell) that has the ability both to self-renew and to generate a differentiated cell type (see Morrison et al. (1997) Cell 88:287-298). In the context of cell ontogeny, the adjective “differentiated”, or “differentiating” is a relative term. A “differentiated cell” is a cell that has progressed further down the developmental pathway than the cell it is being compared with. Thus, pluripotent stem cells (described below) can differentiate into lineage-restricted progenitor cells (e.g., mesodermal stem cells), which in turn can differentiate into cells that are further restricted (e.g., neuron progenitors), which can differentiate into end-stage cells (i.e., terminally differentiated cells, e.g., neurons, cardiomyocytes, etc.), which play a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further. Stem cells may be characterized by both the presence of specific markers (e.g., proteins, RNAs, etc.) and the absence of specific markers. Stem cells may also be identified by functional assays both in vitro and in vivo, particularly assays relating to the ability of stem cells to give rise to multiple differentiated progeny.

[0079] Stem cells of interest include pluripotent stem cells (PSCs). The term “pluripotent stem cell” or “PSC” is used herein to mean a stem cell capable of producing all cell types of the organism.

[0080] PSCs of animals can be derived in a number of different ways. For example, embryonic stem cells (ESCs) are derived from the inner cell mass of an embryo (Thomson et. al, Science. 1998 Nov. 6; 282(5391): 1145-7) whereas induced pluripotent stem cells (iPSCs) are derived from somatic cells (Takahashi et. al, Cell. 2007 Nov. 30; 13 l(5):861-72; Takahashi et. al, Nat Protoc. 2007; 2(12):3081 -9; Yu et. al, Science. 2007 Dec. 21;318(5858): 1917-20. Epub 2007 Nov. 20). Because the term PSC refers to pluripotent stem cells regardless of their derivation, the term PSC encompasses the terms ESC and iPSC, as well as the term embryonic germ stem cells (EGSC), which are another example of a PSC. PSCs may be in the form of an established cell line, they may be obtained directly fromprimary embryonic tissue, or they may be derived from a somatic cell. PSCs can be target cells of the methods described herein.

[0081] The term “induced pluripotent stem cell” or “iPSC” refers to a PSC that is derived from a cell that is not a PSC (i.e., from a cell this is differentiated relative to a PSC). iPSCs can be derived from multiple different cell types, including terminally differentiated cells. iPSCs have an ES cell-like morphology, growing as flat colonies with large nucleo- cytoplasmic ratios, defined borders and prominent nuclei. In addition, iPSCs express one or more key pluripotency markers known by one of ordinary skill in the art, including but not limited to Alkaline Phosphatase, SSEA3, SSEA4, Sox2, Oct3 / 4, Nanog, TRA160, TRA181, TDGF 1, Dnmt3b, FoxD3, GDF3, Cyp26al, TERT, and zfp42. Examples of methods of generating and characterizing iPSCs may be found in, for example, U.S. Patent Publication Nos. US20090047263, US20090068742, US20090191159, US20090227032, US20090246875, and US20090304646, the disclosures of which are incorporated herein by reference. Generally, to generate iPSCs, somatic cells are provided with reprogramming factors (e.g. Oct4, SOX2, KLF4, MYC, Nanog, Lin28, etc.) known in the art to reprogram the somatic cells to become pluripotent stem cells.

[0082] The term “somatic cell” refers to any cell in an organism that, in the absence of experimental manipulation, does not ordinarily give rise to all types of cells in an organism. In other words, somatic cells are cells that have differentiated sufficiently that they will not naturally generate cells of all three germ layers of the body, i.e. ectoderm, mesoderm and endoderm. For example, somatic cells would include both neurons and neural progenitors, the latter of which may be able to naturally give rise to all or some cell types of the central nervous system but cannot give rise to cells of the mesoderm or endoderm lineages.

[0083] The term “mitotic cell” refers to a cell undergoing mitosis. Mitosis is the process by which a eukaryotic cell separates the chromosomes in its nucleus into two identical sets in two separate nuclei. It is generally followed immediately by cytokinesis, which divides the nuclei, cytoplasm, organelles and cell membrane into two cells containing roughly equal shares of these cellular components.

[0084] The term “post-mitotic cell” refers to a cell that has exited from mitosis, i.e., it is “quiescent,” i.e. it is no longer undergoing divisions. This quiescent state may be temporary, i.e. reversible, or it may be permanent.

[0085] The term “meiotic cell” refers to a cell that is undergoing meiosis. Meiosis is the process by which a cell divides its nuclear material for the purpose of producing gametes or spores. Unlike mitosis, in meiosis, the chromosomes undergo a recombination step which shuffles genetic material between chromosomes. Additionally, the outcome of meiosis is four (genetically unique) haploid cells, as compared with the two (genetically identical) diploid cells produced from mitosis.

[0086] The terms “treatment,” “treating” and the like are used herein to generally mean obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. “Treatment” as used herein covers any treatment of a disease or symptom in a mammal, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to acquiring the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease or symptom, i.e., arresting its development; or (c) relieving the disease, i.e., causing regression of the disease. The therapeutic agent may be administered before, during or after the onset of disease or injury. The treatment of ongoing disease, where the treatment stabilizes or reduces the undesirable clinical symptoms of the patient, is of particular interest. Such treatment is desirably performed prior to complete loss of function in the affected tissues. The subject therapy will desirably be administered during the symptomatic stage of the disease, and in some cases after the symptomatic stage of the disease.

[0087] The terms “individual,” “subject,” “host,” and “patient,” are used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans.

[0088] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0089] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that statedrange, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0090] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.

[0091] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described.

[0092] It is noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a polynucleotide” includes a plurality of such polynucleotides and reference to “the polypeptide” includes reference to one or more polypeptides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0093] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specificallyembraced by the present invention and are disclosed herein just as if each and every such subcombination was individually and explicitly disclosed herein.

[0094] Disclosed herein are methods and compositions for genome engineering, including genome engineering to study and treat a frontotemporal degeneration (FTD) or amyotrophic lateral sclerosis (ALS). It is now recognized that the C9orf72 gene is the most common gene causing hereditary FTD, ALS and ALS with FTD. The invention describes genomic editing of any target cell such that there is a favorable change in the expression of C9orf72 genes, which in turn results in treatment of a disease in a subject in need thereof. Non-limiting examples of diseases include neurological diseases (e.g., FTD, ALS, etc.), cancers, and the like. Additionally, delivery of altered stem cells in a transplant altered to express a desired protein product can be similarly beneficial in a disease. Also described are cell lines and organisms with altered gene expression. Described below are genes to be targeted by the CRISPR / Cas system using the sgRNAs of the invention. Mammalian gene locations as described are relative to the UCSC Genome Brower created by the Genome Bioinformatics Group of UC Santa Cruz, software copyright the Regents of the University of California. Human genomic coordinates are provided in the GRCh37 / hgl9 assembly of the human genome, and correspond to numbers on a double stranded DNA. Thus, any position described by a genomic coordinate corresponds to either the (+) or Watson strand, or may specify its corresponding (-) or Crick strand.The Embodiments

[0095] In an exemplary embodiment, the invention provides one or more guide RNA sequence(s) active in a CRISPR system. In various embodiments, the CRISPR system edits the C9orf72 repeat expansion mutation in humans. In an exemplary embodiment the guide RNA targets and hybridizes to a site in cis with the C9orf72 repeat expansion mutation. In an exemplary embodiment, the guide RNA targets and hybridizes to a site in cis with the wild type allele of the C9orf72 gene. In an exemplary embodiment, the guide RNA targets and hybridizes to a site in cis with the mutant allele of the C9orf72 gene.

[0096] In various embodiments, the invention provides a guide nucleic acid having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 1-2, 6, 13, 21-22, 29-30, 55-712 730-732, 734-735, 737-740, and 749-1410 In variousembodiments, the invention provides a guide nucleic acid at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 1-2, 6, 13, 21-22, 29-30, 55- 712 730-732, 734-735, 737-740, and 749-1410, which binds to hybridizes to a site in cis with at least one allele of the C9orf72 gene in a manner appropriate to form a substrate for Cas9.

[0097] In various embodiments, the invention provides a guide RNA nucleic acid having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 6, 13, 734, 735, 1414-1423, and 1427-1458. In various embodiments, the invention provides a guide nucleic acid RNA at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 6, 13, 734, 735, 1414-1423, and 1427-1458, which binds to hybridizes to a site in cis with at least one allele of the C9orf72 gene in a manner appropriate to form a substrate for Cas9.

[0098] In various embodiments, the guide nucleic acid is a component of an expression vector.

[0099] In an exemplary embodiment, the invention provides a host cell containing one or more guide sequences having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 1-2, 6, 13, 21-22, 29-30, 55-712 730-732, 734-735, 737-740, and 749-1410. In an exemplary embodiment, the host cell is a component of a functional organism (e.g., a human).

[0100] In an exemplary embodiment, the invention provides a host cell containing one or more guide sequences having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 6, 13, 734, 735, 1414-1423, and 1427-1458. In an exemplary embodiment, the host cell is a component of a functional organism (e.g., a human).

[0101] In various embodiments, the one or more guide sequence is internal to a host cell and is contained within a delivery vehicle, e.g., a viral plasmid, a lipid delivery particle or the like.

[0102] In one embodiment, the compositions include a nucleic acid sequence comprising a sequence encoding a CRISPR-associated endonuclease and one or more guide RNAs, wherein the guide RNA is complementary to a target site in cis with the C9orf72 repeat expansion mutation. In some embodiments this nucleic acid is contained within an expression vector. In one embodiment, the compositions include a CRISPR-associated endonuclease polypeptide and one or more guide RNAs, wherein the guide RNA is complementary to a target site in cis with the C9orf72 repeat expansion mutation. In one embodiment, the guide nucleic acid sequence is having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 1-2, 6, 13, 21-22, 29-30, 55-712 730-732, 734-735, 737-740, and 749-1410. In one embodiment, the guide nucleic acid sequence is having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 6, 13, 734, 735, 1414- 1423, and 1427-1458

[0103] Also provided are nucleic acids encoding a CRISPR-Cas ribonucleoprotein (RNP) complex for correcting a C9orf72 GC repeat expansion mutation comprising a sequence of a guide nucleic acid having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 1-2, 6, 13, 21-22, 29-30, 55-712 730-732, 734-735, 737-740, and 749-1410, wherein the nucleic acid is delivered to a target site through a carrier, e.g., a functional carrier.

[0104] Also provided are nucleic acids encoding a CRISPR-Cas ribonucleoprotein (RNP) complex for correcting a C9orf72 GC repeat expansion mutation comprising a sequence of a guide nucleic acid having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 6, 13, 734, 735, 1414-1423, and 1427-1458, wherein the nucleic acid is delivered to a target site through a carrier, e.g., a functional carrier.

[0105] Also provided herein are methods of correcting the C9orf72 GC repeat expansion mutation in a host cell. An exemplary method includes administering to a host cell a guide nucleic acid of the invention and such auxiliary sequences and enzymes as are necessary to correct the C9orf72 GC repeat expansion mutation in a host cell.

[0106] In one embodiment, a first guide nucleic acid targets and hybridizes to a sequence upstream of the C9orf72 GC repeat expansion region. In some embodiments, a second guide nucleic acid targets and hybridizes to a sequence downstream of the C9orf72 GC repeat expansion region. In various embodiments, a first guide nucleic acid targets and hybridizes to a sequence upstream of the C9orf72 GC repeat expansion region and a second guide nucleic acid targets and hybridizes to a sequence downstream of the C9orf72 GC repeat expansion region. An exemplary first guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 1, or SEQ ID NO. 731. An exemplary second guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a SEQ ID NO: 2, or SEQ ID NO. 732 Another exemplary first guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 6, 734 and 1427-1454. Another exemplary second guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 1445-1458, 13 and 735.

[0107] An exemplary method further comprises: a. excising a region containing a C9orf72 GC repeat expansion in a mutant allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease (e.g., Cas9); and b. excising a region in the normal allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease (e.g. Cas9).

[0108] Also provided herein is a method of correcting the C9orf72 GC repeat expansion mutation in a host cell. The method includes administering to the host cell an endonuclease (e.g., Cas9) and one, two or more guide nucleic acids. In one embodiment, a first guide nucleic acid targets and hybridizes to a sequence upstream of the exon 1 A at the C9orf72 locus, and a second guide nucleic acid targets and hybridizes to a sequence downstream of the exon IB at the C9orf72 locus. An exemplary first guide nucleic acid sequence comprisesa sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 21, or SEQ ID NO: 737, and the second guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 22, or SEQ ID NO: 738 Another exemplary first guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NOs: 1414, or SEQ ID NO: 1415, and the second guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 1416-1423. The method further comprises excising a region containing exon 1 A, exon IB and at least a portion of the GC repeat expansion in the mutant allele by cleaving one or both strands of DNA at first and second target nucleic acid sequences with the endonuclease (e.g., Cas9).

[0109] In exemplary embodiments, the invention provides methods of correcting the C9orf72 GC repeat expansion mutation in a host cell comprising treating of host cell with endonuclease and one, two or more guide nucleic acids in which a first guide nucleic acid targets and hybridizes to a sequence upstream of a transcriptional start site at the C9orf72 locus, and a second guide nucleic acid targets and hybridizes to a sequence downstream of the transcriptional start site at the C9orf72 locus. The first guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 1, or SEQ ID NO. 731. and the second guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 2, or SEQ ID NO. 732. In various embodiments, the method further comprises the steps of a. excising a region that contains the transcriptional start site in the mutant allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease (e.g., Cas9); b. excising a region that contains the transcriptional start site in the normal allele by cleaving one or both strands of DNA at a first target nucleic acid sequenceand a second target nucleic acid sequence with the endonuclease (e.g., Cas9); and c. thereby changing expression level of the C9orf72 gene in the host cell.

[0110] Also provided herein are a population of engineered cells, wherein a C9orf72 GC repeat expansion mutation in the cells has been corrected by any of the methods disclosed herein.

[0111] Also provided herein are methods of treating C9orf72 GC repeat expansion associated diseases in a subject, comprising administering a population of engineered cells, wherein a C9orf72 GC repeat expansion mutation in the cells has been corrected by any of the methods disclosed above.1. C9orf72 GC Repeat Expansion

[0112] In various embodiments, the present invention is directed to in vivo or in vitro systems for use as novel therapeutics and, in some embodiments, methods of treatment, that can be used for the treatment of neurodegenerative diseases, disorders and conditions. In some embodiments, an in vivo or in vitro system described herein treats a disease, disorder, and / or condition associated with a C9orf72 locus. An exemplary disease, disorder or condition is associated with a hexanucleotide repeat extension sequence at the locus. An exemplary disease is a neurodegenerative disorder (e.g., ALS and / or FTD).

[0113] In some embodiments, a hexanucleotide repeat expansion mutation sequence comprises at least one, e.g., at least about three, at least about five, at least about ten, at least about fifteen, at least about twenty, at least about thirty, at least about forty, at least about fifty, at least about sixty, at least about seventy, at least about eighty, at least about ninety or at least about one-hundred, or at least a thousand contiguous, repeats of the hexanucleotide sequence.

[0114] In some embodiments, a human hexanucleotide expansion sequence span (and optionally encompasses) all or one or more portions of exons 1A and / or exon IB of a human C9orf72 gene.2. The CRISPR / Cas System

[0115] Exemplary compositions of the invention include a CRISPR-associated endonuclease, e.g., Cas9, one or more guide RNAs complementary to and capable ofhybridizing to a target site in cis with the C9orf72 repeat expansion mutation. In some embodiments, there is provided a nucleic acid encoding a CRISPR-associated endonuclease, e.g., Cas9, and one or more guide RNAs complementary to and capable of hybridizing to a target site in cis with the C9orf72 repeat expansion mutation. a. CRISPR-associated endonuclease

[0116] The compositions of the invention can include a CRISPR-associated endonuclease and / or a nucleic acid encoding a CRISPR-associated endonuclease.

[0117] Exemplary CRISPR-associated endonucleases include type II CRISPR / Cas system endonucleases, having endonuclease activity to cut target DNA. In an exemplary embodiment, the endonuclease provided is a Cas9 polypeptide. Cas9 is guided by a mature CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA (crRNA) that contains about 20 base pairs (bp) of unique target sequence (called spacer) and a transactivated small RNA (tracrRNA) that serves as a guide for ribonuclease Ill-aided processing of pre-crRNA. The crRNA:tracrRNA duplex directs Cas9 to target DNA via complementary base pairing between the spacer on the crRNA and the complementary sequence (called protospacer) on the target DNA. Cas9 recognizes a trinucleotide (NGG) protospacer adjacent motif (PAM) to specify the cut site (the 3rd nucleotide from PAM).

[0118] In an exemplary embodiment, there is provided a Cas9 polypeptide. By “Cas9 polypeptide” or “site-directed polypeptide” or “site-directed Cas9 polypeptide” is meant a polypeptide that binds RNA (e.g., the protein binding segment of a guide nucleic acid) and is targeted to a specific sequence (a target site) in a target nucleic acid. A Cas9 polypeptide as described herein is targeted to a target site by the guide nucleic acid to which it is bound. The guide nucleic acid comprises a sequence complementary to a target sequence within the target nucleic acid, thus targeting the bound Cas9 polypeptide to a specific location within the target nucleic acid (the target sequence) (e.g., stabilizing the interaction of Cas9 with the target nucleic acid). Naturally occurring Cas9 polypeptides bind a guide nucleic acid, and are thereby directed to a specific sequence within a target nucleic acid (a target site), and cleave the target nucleic acid (e.g., cleave dsDNA to generate a double strand break, cleave ssDNA, cleave ssRNA, etc.). A subject Cas9 polypeptide comprises two portions, an RNA-binding portion and an activity portion. An RNA-binding portion interacts with a subject guide nucleic acid. An activity portion exhibits site-directed enzymatic activity (e.g., nuclease activity, activity for DNA and / or RNA methylation, activity for DNA and / or RNA cleavage,activity for histone acetylation, activity for histone methylation, activity for RNA modification, activity for RNA-binding, activity for RNA splicing etc.). In some cases the activity portion exhibits reduced nuclease activity relative to the corresponding portion of a wild type Cas9 polypeptide. In some cases, the activity portion is enzymatically inactive.

[0119] In some embodiments, the Cas9 polypeptide is a naturally occurring polypeptide (e.g., naturally occurs in bacterial and / or archaeal cells). In various embodiments, the Cas9 polypeptide is not a naturally occurring polypeptide (e.g., the Cas9 polypeptide is a variant Cas9 polypeptide, a chimeric polypeptide as discussed below, and the like). In some embodiments, the Cas9 nuclease can have a nucleotide sequence identical to the wild type Streptococcus pyrogenes sequence. In some embodiments, the CRISPR-associated endonuclease can be a sequence from other species, for example other Streptococcus species, such as thermophilus; Psuedomona aeruginosa, Escherichia coli, or other sequenced bacteria genomes and archaea, or other prokaryotic microorganisms. In selected embodiments, the wild type Streptococcus pyrogenes Cas9 sequence is modified. For exemplary Cas9 nucleases, the nucleic acid sequence can be codon optimized for efficient expression in mammalian cells, i.e., “humanized.” A humanized Cas9 nuclease sequence can be for example, the Cas9 nuclease sequence encoded by any of the expression vectors listed in Genbank accession numbers KM099231.1 GL669193757; KM099232.1 GL669193761; or KM099233.1 GI:669193765. Alternatively, the Cas9 nuclease sequence can be, for example, the sequence contained within a commercially available vector such as PX330 or PX260 from Addgene (Cambridge, Mass.). In some embodiments, the Cas9 endonuclease has an amino acid sequence that is a variant or a fragment of any of the Cas9 endonuclease sequences of Genbank accession numbers KM099231.1 GI:669193757; KM099232.1 GL669193761; or KM099233.1 GL669193765 or Cas9 amino acid sequence of PX330 or PX260 (Addgene, Cambridge, Mass.).

[0120] Exemplary CRISPR-associated endonucleases include Cas polypeptides from Type V CRISPR systems. In one embodiment, the endonuclease is Cpfl. Cpfl is a single RNA - guided endonuclease that, in contrast to Type II systems, lacks tracrRNA. In fact, Cpfl - associated CRISPR arrays are processed into mature crRNAS without the requirement of an additional trans - activating tracrRNA. Useful Cpfl Protein include, without limitation, the Cpfl Protein disclo-ed in US9790490B2, US9745562B2, US11268082B2, US11286478B2,US20190010481A1, or US20190062735A1. In some embodiments, the endonuclease is Casl2a (type V-A), Casl2b (type V-B), and Casl2e (type V-E), or Casl2J (type V-J).

[0121] Exemplary CRISPR-associated endonucleases include CasX Proteins. A CasX polypeptide (this term is used interchangeably with the term “CasX protein”) can bind and / or modify (e.g., cleave, nick, methylate, demethylate, etc.) a target nucleic acid and / or a polypeptide associated with target nucleic acid (e.g., methylation or acetylation of a histone tail) (e.g., in some cases the CasX protein includes a fusion partner with an activity, and in some cases the CasX protein provides nuclease activity). Useful CasX Protein include, without limitation, the CasX Protein disclosed in US10570415B2, US11268082B2, US20190367924A1, US20180362590A1, US20210198330A1, or US20190093091A1.

[0122] Exemplary CRISPR-associated endonucleases include other Cas polypeptides that are naturally occurring, non-naturally occurring, or under developments. In some embodiments, the endonuclease is a Cas polypeptide from two classes (Class I and Class II) Cas polypeptides that are subdivided into at least 6 types (I- VI). Useful CRISPR-associated endonucleases include, without limitation, Cas polypeptides disclosed in US10808245B2, US11225659B2, US11168324B2, or US20210301288A1.

[0123] Assays used to determine whether a protein has an RNA-binding portion interacting with a subject guide nucleic acid are any convenient binding assay testing for binding between a protein and a nucleic acid. Exemplary assays include binding assays (e.g., gel shift assays) that include adding a guide nucleic acid and a Cas9 polypeptide to a target nucleic acid. In some cases, a PAMmer is also added (e.g., in some cases when the target nucleic acid is a single stranded nucleic acid).

[0124] Assays to determine whether a protein has an activity portion (e.g., to determine if the polypeptide has nuclease activity cleaving a target nucleic acid) can be any convenient nucleic acid cleavage assay that tests for nucleic acid cleavage. Exemplary assays include cleavage assays involving adding a guide nucleic acid and a Cas9 polypeptide to a target nucleic acid. In some cases, a PAMmer is also added (e.g., in some cases when the target nucleic acid is a single stranded nucleic acid). b. Guide Nucleic Acid for Gene Editing

[0125] In an exemplary embodiment, the invention provides a guide nucleic acid, e.g., a nucleic acid having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% orat least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NO: 1-2, 6,21-22, 29-30, 55-712 730-732, 734-735, 737-740, 749-1410, 1414-1423, and 1427-1458, as shown in Table 1, Table 2, Table 6, and Table 9. A nucleic acid molecule that binds to a Cas polypeptide and targets the polypeptide to a specific location within the target nucleic acid is referred to herein as a “guide nucleic acid”. When the guide nucleic acid is an RNA molecule, it can be referred to as a “guide RNA” or a “gRNA”. A subject guide nucleic acid comprises two segments, a first segment (referred to herein as a “targeting segment”); and a second segment (referred to herein as a “protein-binding segment”).(i). Targeting Segment

[0126] The first segment (targeting segment) of an exemplary guide nucleic acid comprises a nucleotide sequence complementary to a target site in cis with the C9orf72 repeat expansion mutation. In other words, the targeting segment of an exemplary guide nucleic acid interacts with a target site in cis with the C9orf72 gene (e.g., a single stranded RNA (ssRNA) and / or a single stranded DNA (ssDNA)) in a sequence-specific manner via hybridization (i.e., base pairing). As such, the nucleotide sequence of the targeting segment may vary and can determine the location within the target nucleic acid that the guide nucleic acid and the target nucleic acid will interact. The targeting segment of a subject guide nucleic acid can be modified (e.g., by genetic engineering) to hybridize to any desired sequence (target site) in cis with the C9orf72 gene. In some embodiments, the target site is in cis with a region comprising at least one hexanucleotide repeats (GGGGCC; or G4C2), e.g., at least about three, at least about five, at least about ten, at least about fifteen, at least about twenty, at least about thirty, at least about forty, at least about fifty, at least about sixty, at least about seventy, at least about eighty, at least about ninety or at least about one-hundred, or at least a thousand contiguous, repeats of the hexanucleotide sequence.

[0127] An exemplary targeting segment can have a length of from about 12 nucleotides to about 100 nucleotides. For example, the targeting segment can have a length of from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 5 Ont, from about 12 nt to about 40 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, or from about 12 nt to about 19 nt. For example, the targeting segment can have a length of from about 19 nt to about 20 nt, from about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt, from about19 nt to about 45 nt, from about 19 nt to about 50 nt, from about 19 nt to about 60 nt, from about 19 nt to about 70 nt, from about 19 nt to about 80 nt, from about 19 nt to about 90 nt, from about 19 nt to about 100 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 nt to about 50 nt, from about 20 nt to about 60 nt, from about 20 nt to about 70 nt, from about 20 nt to about 80 nt, from about 20 nt to about 90 nt, or from about 20 nt to about 100 nt.

[0128] An exemplary nucleotide sequence (the targeting sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) in cis with the C9orf72 repeat expansion mutation can have a length of 12 nt or more. For example, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid can have a length of 12 nt or more, 15 nt or more, 18 nt or more, 19 nt or more, 20 nt or more, 25 nt or more, 30 nt or more, 35 nt or more or 40 nt. For example, an exemplary targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid can have a length of from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50nt, from about 12 nt to about 45 nt, from about 12 nt to about 40 nt, from about 12 nt to about 35 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, from about 12 nt to about 19 nt, from about 19 nt to about 20 nt, from about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt, from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, from about 19 nt to about 60 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 nt to about 50 nt, or from about 20 nt to about 60 nt.(ii). Protein-binding segment

[0129] As an illustrative, non-limiting example, a protein-binding segment of a guide nucleic acid that comprises two separate molecules can comprise (i) base pairs 40-75 of a first molecule (e.g., RNA molecule, DNA / RNA hybrid molecule) that is 100 base pairs in length; and (ii) base pairs 10-25 of a second molecule (e.g., RNA molecule) that is 50 base pairs in length.

[0130] In an exemplary embodiment, the protein-binding segment (or “protein-binding sequence”) used in present invention is a sequence interacting with a Cas polypeptide. Useful protein-binding sequences include, without limitation, the Cas polypeptide-binding sequencesdisclosed in US11261439B2, US9738908B2, US10920221B2, US20210180055A1 or US20200291370. In an exemplary embodiment, the “protein-binding segment” comprises a duplex formed by a crRNA comprising rGrUrU rUrUrA rGrArG rCrUrA rUrGrC rU (Seq ID NO: 722) and a tracrRNA. Useful tracrRNA sequences include, without limitation, the tracrRNA sequences disclosed in US10711258B2, US20190032131A1, US20180200387A1, US20210017518A1, US20190032052A1 or US20220047722A1. In an exemplary embodiment, the “protein-binding sequence” of a single guide RNA (sgRNA) comprises rG rUrUrU rUrArG rArGrC rUrArG rArArA rUrArG rCrArA rGrUrU rArArA rArUrA rArGrG rCrUrA rGrUrC rCrGrU rUrArU rCrArA rCrUrU rGrArA rArArA rGrUrG rGrCrA rCrCrG rArGrU rCrGrG rUrGrC mU*mU*mU* rU (SEQ ID NO: 723) as shown in Table 3.

[0131] Site-specific binding and / or cleavage of the target nucleic acid can occur at locations determined by base-pairing complementarity between the guide nucleic acid and the target nucleic acid. The protein-binding segment of a subject guide nucleic acid comprises two complementary stretches of nucleotides that hybridize to one another to form a double stranded RNA duplex (dsRNA duplex).

[0132] A subject guide nucleic acid and a subject Cas polypeptide form a complex (i.e., bind via non-covalent interactions). The guide nucleic acid provides target specificity to the complex by comprising a nucleotide sequence that is complementary to a sequence of a target nucleic acid. The Cas polypeptide of the complex provides the site-specific activity. In other words, the Cas polypeptide is guided to a target nucleic acid sequence (e.g. a target sequence in a chromosomal nucleic acid; a target sequence in an extrachromosomal nucleic acid, e.g. an episomal nucleic acid, a minicircle, an ssRNA, an ssDNA, etc.; a target sequence in a mitochondrial nucleic acid; a target sequence in a plasmid; etc.) by virtue of its association with the protein-binding segment of the guide nucleic acid. In various embodiments, the invention provides a complex between a guide nucleic acid of the invention and a Cas polypeptide.(iii). Additional Sequences

[0133] In some embodiments, a guide nucleic acid comprises an additional segment or segments (in some cases at the 5' end, in some cases the 3' end, in some cases at either the 5' or 3' end, in some cases embedded within the sequence (i.e., not at the 5' and / or 3' end), in some cases at both the 5' end and the 3' end, in some cases embedded and at the 5' end and / or the 3' end, etc). For example, a suitable additional segment can comprise a 5' cap (e.g., a 7-methylguanylate cap (m7G)); a 3' polyadenylated tail (i.e., a 3' poly(A) tail); a ribozyme sequence (e.g. to allow for self-cleavage of a guide nucleic acid (or component of a guide nucleic acid, e.g., a targeter, an activator, etc.) and release of a mature PAMmer in a regulated fashion); a riboswitch sequence (e.g., to allow for regulated stability and / or regulated accessibility by proteins and protein complexes); a sequence that forms a dsRNA duplex (i.e., a hairpin)); a sequence that targets an RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like); a modification or sequence that provides for tracking (e.g., a direct label (e.g., direct conjugation to a fluorescent molecule (i.e., fluorescent dye)), conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection; a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, proteins that bind RNA (e.g., RNA aptamers), labeled proteins, fluorescently labeled proteins, and the like); a modification or sequence that provides for increased, decreased, and / or controllable stability; and combinations thereof.3, Guide nucleic acid selection

[0134] In an exemplary embodiment, one or more guide nucleic acids are selected by a screening platform. In an exemplary embodiment, the screening platform is a cell line derived from a patient harboring a C9orf72 repeat expansion. In specific embodiments, a WT allele is selectively excised in the cell line by allele-specific CRISPR editing. In some embodiments, the cell line is heterozygous comprising an uncut mutant allele and the excised WT allele.

[0135] In an exemplary embodiment, the screening platform is utilized to select allelespecific gRNA pairs for excision at the C9orf72 gene locus. In some embodiments, the allelespecific gRNA targets a single nucleotide polymorphism (SNP) in cis with the C9orf72 repeat expansion. In some embodiments, at least some SNPs on the C9orf72 gene locus is targeted by a 5’ guide nucleic acid. In some embodiments, at least some SNPs on the C9orf 72 gene locus is targeted by a 3’ guide nucleic acid. In some embodiments, the 5’ guide nucleic acids is at least 1, at least 5, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 150, at least 200, at least 300, at least 400, at least 500, at least 750, at least 1000, at least 5000, at least 10,000, at least 50, 000, at least 100, 000 or more. In someembodiments, the 3’ guide nucleic acids is at least 1, at least 5, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 150, at least 200, at least 300, at least 400, at least 500, at least 750, at least 1000, at least 5000, at least 10,000, at least 50, 000, at least 100, 000 or more. In some embodiment, each 5’ guide nucleic acid is paired with each 3’ guide nucleic acid for an excision efficiency test. In some embodiments, the excision efficiency is determined experimentally. In some embodiments, the excision efficiency is quantified by a ddPCR assay. In some embodiments, some pairs of guide nucleic acids are more efficient than others. In some embodiments, the on-targeting editing efficiency of a screened pair of guide nucleic acids is at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or more.

[0136] In an exemplary embodiment, the screening platform is utilized to select repeat expansion excision gRNA pairs for excising the C9orf72 repeat region. In some embodiments, the repeat expansion excision gRNA targets a site between exon 1 A and exon IB of the C9orf72 locus. In some embodiments, the 5’ guide nucleic acids targeting the C9orf72 repeat expansion region is at least 1, at least 5, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 150, at least 200, at least 300, at least 400, at least 500, at least 750, at least 1000, at least 5000, at least 10,000, at least 50, 000, at least 100, 000 or more. In some embodiments, the 3’ guide nucleic acids targeting the C9orf72 repeat expansion region is at least 1, at least 5, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 150, at least 200, at least 300, at least 400, at least 500, at least 750, at least 1000, at least 5000, at least 10,000, at least 50, 000, at least 100, 000 or more. In some embodiment, each 5’ guide nucleic acid is paired with each 3’ guide nucleic acid for an excision efficiency test. In some embodiments, the excision efficiency is determined experimentally. In some embodiments, the excision efficiency is quantified by a ddPCR assay. In some embodiments, some pairs of guide nucleic acids are more efficient than others. In some embodiments, the on-targeting editing efficiency of a screened pair of guide nucleic acids is at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or more.4. Method of Use

[0137] An exemplary method of cleaving any desired sequence (target site) in cis with the C9orf72 repeat expansion mutation includes contacting a target nucleic acid with a Cas polypeptide, a guide nucleic acid (e.g., a dual guide RNA, a single guide RNA, an RNA / DNA hybrid guide RNA, etc.), and a PAMmer.

[0138] In some embodiments, the designed gRNAs are those having the fewest overall off- target binding events, including those with no predicted off-target matches to the exact sequence and no predicted off-target within the first 2 bases of the PAM. In some embodiments, the gRNAs are designed and evaluated by a bioinformatic tool. In an exemplary embodiment, the bioinformatic tool is AlleleAnalyzer. In some embodiments, the gRNAs are identified based on patient sequencing data. In one exemplary embodiment, the bioinformatic tool is CRISPOR.

[0139] In some embodiments, the target sequence for gene editing is a sequence between two alternative non-coding 5’UTR start sites, exon 1A and exon IB. In some embodiments, the target sequence for gene editing is a sequence lying upstream of the non-coding 5’UTR start sites exon 1 A. In some embodiments, the target sequence for gene editing is a sequence lying downstream of the non-coding 5’UTR start sites exon IB.

[0140] In some embodiments, the GC repeat expansion mutation is knocked-out or silenced. In some embodiments, the C9orf72 mutation is knocked-out through cleaving at two target sites in cis with the C9orf72 repeat expansion mutation. In some embodiments, the C9orf72 mutation is knocked-out through cleaving at two or more target sites in cis with the C9orf72 repeat expansion mutation. In some embodiments, the C9orf72 mutation knockout is facilitated by two guide nucleic acids, e.g. gRNAs. In some embodiment, the C9orf72 mutation knockout is conducted by two or more guide nucleic acids, e.g. gRNAs. Methods and compositions disclosed herein may comprise multiple guide nucleic acids, wherein each guide nucleic acid has a different guide sequence, thereby targeting a different target sequence. In such cases, multiple guide nucleic acids can be using in multiplexing, wherein multiple targets in cis with the C9orf72 repeat expansion mutation are targeted simultaneously.

[0141] In an exemplary embodiment, a first gRNA provides target specificity to the complex by incorporating a nucleotide sequence complementary to a first target site. Asecond gRNA provides target specificity to the complex by incorporating a nucleotide sequence complementary to a second target site. Each guide nucleic acid and a subject Cas polypeptide form a complex, providing the site-specific activity, binding and / or modifying (e.g., cleave, methylate, demethylate, etc.) the target sequence (target site) in cis with the C9orf72 repeat expansion mutation. In an exemplary embodiment, the target site is located in a region between 25 kbp upstream and 28 kbp downstream of a transcription start site of the C9orf72 gene. The cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence can occur within a target sequence, 5' of the target sequence, upstream of a target sequence, 3' of the target sequence, or downstream of a target sequence. In some embodiments, the nucleic acid-guided nuclease directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and / or within the complement of the target sequence. In some embodiments, the nucleic acid-guided nuclease directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence.

[0142] In some embodiments, at least more than one GC repeat expansion region at the C9orf72 locus is excised. In some embodiments, the excision of one or more GC repeat expansion region at the C9orf72 locus is biallelic. In an exemplary embodiment, the method of correcting the C9orf72 GC repeat expansion mutation in a host cell includes administering to the host cell a system comprising an endonuclease and two or more guide nucleic acids, wherein a first guide nucleic acid targets and hybridizes with a sequence upstream of the GC repeat expansion region, and a second guide nucleic acid targets and hybridizes with a sequence downstream of the GC repeat expansion region, wherein the first guide nucleic acid sequence comprising a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO. 1, or SEQ ID NO. 731, and the second guide nucleic acid sequence comprising a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 2, or SEQ ID NO. 732. An exemplary method further comprises: a. excising a region containing a GC repeat expansion in the mutant allele by cleaving one or both strands of DNA at a first target nucleic acidsequence and at a second target nucleic acid sequence with the endonuclease; and b. excising a region in the normal allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease.

[0143] In an exemplary embodiment, the method of correcting the C9orf72 GC repeat expansion mutation in a host cell includes administering to the host cell a system comprising an endonuclease and two or more guide nucleic acids, wherein a first guide nucleic acid targets and hybridizes with a sequence upstream of the GC repeat expansion region, and a second guide nucleic acid targets and hybridizes with a sequence downstream of the GC repeat expansion region, wherein the first guide nucleic acid sequence comprising a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 6, 734, and 1427-1454, and the second guide nucleic acid sequence comprising a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 1445-1458, 13 and 735. An exemplary method further comprises: a. excising a region containing a GC repeat expansion in the mutant allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease; and b. excising a region in the normal allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease.

[0144] In some embodiments, the excision of a GC repeat expansion region at the C9orf72 locus is monoallelic. In some embodiments, the GC repeat expansion mutant allele is excised while the normal allele of the genome is maintained. In some embodiments, the GC repeat expansion mutant allele is excised by a Cas9 that can distinguish between alleles differing by a single nucleotide. In an exemplary embodiment, the method of correcting the C9orf72 repeat expansion mutation in a host cell comprises administering to a host cell an endonuclease and one, two or more guide nucleic acids. A first guide nucleic acid targets andhybridizes to a sequence upstream of the exon 1 A at the C9orf72 locus, wherein a second guide nucleic acid targets and hybridizes to a sequence downstream of the exon IB at the C9orf72 locus, wherein the first guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 21, or SEQ ID NO. 737, and the second guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 22, or SEQ ID NO. 738, and further comprising excising a region that contains exon 1 A, exon IB and at least a portion of GC repeats expansion in the mutant allele by cleaving a one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease.

[0145] In another exemplary embodiment, the method of correcting the C9orf72 repeat expansion mutation in a host cell comprises administering to a host cell an endonuclease and one, two or more guide nucleic acids. A first guide nucleic acid targets and hybridizes to a sequence upstream of the exon 1 A at the C9orf72 locus, wherein a second guide nucleic acid targets and hybridizes to a sequence downstream of the exon IB at the C9orf72 locus, wherein the first guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NOs: 1414, or SEQ ID NO: 1415, and the second guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to a sequence selected from the group consisting of SEQ ID NOs: 1416-1423, and further comprising excising a region that contains exon 1 A, exon IB and at least a portion of GC repeats expansion in the mutant allele by cleaving a one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease.

[0146] In some embodiments, a GC repeat expansion mutant allele is silenced by excising a regulatory region. In some methods, a control sequence can be inactivated such that it no longer functions as a regulatory sequence. As used herein, “regulatory sequence” can refer to any nucleic acid sequence that effects the transcription, translation, or accessibility of a nucleic acid sequence. Examples of regulatory sequences include a promoter, a transcription terminator, and an enhancer. In some embodiments, the regulatory region lies in exon 1 Awhich includes a transcriptional start site and controls the expression of the C9orf72 sensetranscript harboring the mutation.

[0147] In one embodiment, methods of correcting the C9orf72 GC repeat expansion mutation in a host cell comprises administering to a host cell an endonuclease and two or more guide nucleic acids, wherein a first guide nucleic acid targets and hybridizes to a sequence upstream of a transcriptional start site at the C9orf72 locus, and a second guide nucleic acid targets and hybridizes to a sequence downstream of the transcriptional start site at the C9orf72 locus. The first guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 1, or SEQ ID NO. 731, wherein the second guide nucleic acid sequence comprising having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 2, or SEQ ID NO. 732. An exemplary method of the invention further comprises one or more of: a. excising a region that contains the transcriptional start site in the mutant allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease; b. excising a region that contains the transcriptional start site in the normal allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and a second target nucleic acid sequence with the endonuclease; and c. changing expression level of the C9orf72 gene in the host cells.

[0148] In an exemplary embodiment, methods of correcting the C9orf72 GC repeat expansion mutation in a host cell comprises administering to a host cell an endonuclease and two or more guide nucleic acids, wherein a first guide nucleic acid targets and hybridizes to a sequence upstream of a transcriptional start site at the C9orf72 locus, and a second guide nucleic acid targets and hybridizes to a sequence downstream of the transcriptional start site at the C9orf72 locus. The first guide nucleic acid sequence comprises a sequence having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 1, or SEQ ID NO. 731, wherein the second guide nucleic acid sequence comprising having at least about 90%, about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% sequence homology to SEQ ID NO: 2, or SEQ ID NO. 732. An exemplary method of the invention further comprises the steps performed in order:a. excising a region that contains the transcriptional start site in the mutant allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease; b. excising a region that contains the transcriptional start site in the normal allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and a second target nucleic acid sequence with the endonuclease; and c. changing expression level of the C9orf72 gene in the host cells.

[0149] In some embodiments, the methods for correcting the C9orf72 GC repeat expansion mutation are selected from the group consisting of C9orf72 GC repeat expansion biallelic excision, C9orf72 GC repeat expansion mutation monoallelic excision, C9orf72 expression modification, and a combination thereof.

[0150] The effectiveness of editing the GC repeat expansion can be determined by art- recognized assays. For example, to assay for an agent-induced alteration in the level of mRNA transcripts or corresponding polynucleotides, nucleic acid contained in a sample is first extracted according to standard methods in the art. For instance, mRNA can be isolated using various lytic enzymes or chemical solutions according to the procedures set forth in Green and Sambrook (2014), or extracted by nucleic-acid-binding resins following the accompanying instructions provided by the manufacturers. The mRNA contained in the extracted nucleic acid sample is then detected by amplification procedures or conventional hybridization assays (e.g. Northern blot analysis) according to methods widely known in the art or based on the methods exemplified herein. In some embodiments, the mRNA contained in the extracted nucleic acid sample is then detected by Droplet Digital PCR (ddPCR).

[0151] In some embodiments, single molecule sequencing of a genomic region containing the repeat region is used to size the entirety of the C9orf72 GC rich repetitive region and evaluate the editing results of C9orf72 GC repeat expansion region.5. Delivery system

[0152] In an exemplary embodiment, one or more guide nucleic acid in the form of RNA or encoded on a DNA expression cassette can be introduced into a host cell. In an exemplary embodiment, the guide nucleic acid may be provided in the cassette with as one or more polynucleotides, which may be contiguous or non-contiguous in the cassette. In specificembodiments, the guide nucleic acid is provided in the cassette as a single contiguous polynucleotide.

[0153] In some embodiments, one or more vectors driving expression of one or more components of a targetable nuclease system are introduced into a host cell or in vitro. For example, a nucleic acid-guided nuclease and a guide nucleic acid can each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements, may be combined in a single vector, with one or more additional vectors providing any components of the targetable nuclease system not included in the first vector. Targetable nuclease system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5' with respect to (“upstream” of) or 3' with respect to (“downstream” of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In some embodiments, a single promoter drives expression of a transcript encoding a nucleic acid-guided nuclease and one or more guide nucleic acids. In some embodiments, a nucleic acid-guided nuclease and one or more guide nucleic acids are operably linked to and expressed from the same promoter. In other embodiments, one or more guide nucleic acids or polynucleotides encoding the one or more guide nucleic acids are introduced into a cell or in vitro environment already comprising a nucleic acid-guided nuclease or polynucleotide sequence encoding the nucleic acid-guided nuclease.

[0154] When multiple different guide sequences are used, a single expression construct may be used to target nuclease activity to multiple different, corresponding target sequences within a cell or in vitro. For example, a single vector may comprise about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences. In some embodiments, about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more such guide-sequence-containing vectors may be provided, and optionally delivered to a cell or in vitro.

[0155] A nucleic acid-guided nuclease and one or more guide nucleic acids can be delivered either as DNA or RNA. In some aspect, the invention provides methods comprising delivering one or more polynucleotides, such as or one or more vectors or linear polynucleotides as described herein, one or more transcripts thereof, and / or one or proteins transcribed therefrom, to a host cell.

[0156] In an exemplary embodiment, the delivery system is a viral vector delivery system. Viral vector delivery systems include DNA and RNA viruses. In an exemplary embodiment, the delivery system is a lentiviral vector delivery system. Lentiviral vectors are retroviral vectors able to transduce or infect non-dividing cells and typically produce high viral titers. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66: 1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT / US94 / 05700). In applications where transient expression is preferred, adenoviral based systems may be used. Adeno-associated virus (“AAV”) vectors may also be used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94: 1351 (1994). Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81 :6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989). Other useful viral vector delivery systems include, without limitation, the viral vectors disclosed in Anderson, Science 256:808-813 (1992); Nabel & Feigner, TIBTECH 11 :211-217 (1993); Mitani & Caskey, TIBTECH 11 : 162-166 (1993); Dillon. TIBTECH 11 : 167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10): 1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Bohm (eds) (1995); and Yu et al., Gene Therapy 1 : 13-26 (1994).

[0157] In some embodiments, the delivery system is a non-viral delivery system. Methods of non-viral delivery of nucleic acids include yeast systems, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipidmucleic acid conjugates, naked DNA, virions, artificial virions, agent-enhanced uptake of DNA, electroporation, cell permeable peptides, nanoparticles, nanowires (Shalek et al., NanoLetters, 2012), exosomes or molecular trojan horses liposomes (Pardridge et al., Cold Spring Harb Protoc; 2010; doi: 10.1101 / pdb.prot5407).

[0158] Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91 / 17424; WO 91 / 16024. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).

[0159] The preparation of lipidmucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).

[0160] In some embodiments, the endonuclease and gRNA are delivered via the system as disclosed in US20210139892A, comprising a) a modified RNA-binding protein (RBP) comprising: i) an RBP; and ii) one or more endosomolytic peptides (ELPs) covalently linked, directly or via a linker, to the RBP; and b) a modified cargo RNA complexed to the RBP, wherein the modified cargo RNA comprises a cargo RNA modified to include one or more RBP binding sites that are bound by the RBP present in the modified RBP.

[0161] In an exemplary embodiment, the endonuclease and gRNA are delivered as ribonucleoprotein (RNP) (e.g., a RNP comprising a site-directed modifying polypeptide, such as a Cas9 RNP or a Cpfl RNP) via a system as described in US 10851367B2 or under development. In some embodiments of such a composition, the ribonucleoprotein (e.g., a RNP comprising a site-directed modifying polypeptide, such as a Cas9 RNP or a Cpfl RNP) is co-incubated with the endosomal escape agent to form the composition. In some embodiments, the ribonucleoprotein (e.g., a RNP comprising a site-directed modifying polypeptide, such as a Cas9 RNP or a Cpfl RNP) or the endosomal escape agent is conjugated to an antibody or a fragment thereof. In some embodiments, the ribonucleoprotein (e.g., a RNP comprising a site-directed modifying polypeptide, such as a Cas9 RNP or a Cpfl RNP) is modified to include glycosylation sites. In some embodiments, the ribonucleoprotein(e.g., a RNP comprising a site-directed modifying polypeptide, such as a Cas9 RNP or a Cpfl RNP) is modified to include transduction or translocation domains.

[0162] The nucleic acid encoding a genome-targeting nucleic acid of the disclosure and / or a site-directed polypeptide can be packaged into or on the surface of delivery vehicles for delivery to cells. Delivery vehicles contemplated include, but are not limited to, nanospheres, liposomes, quantum dots, nanoparticles, polyethylene glycol particles, hydrogels, and micelles. As described in the art, a variety of targeting moieties can be used to enhance the preferential interaction of such vehicles with desired cell types or locations. The delivery systems can be viral vectors, lipid nanoparticles (LNPs) or synthetic polymers. Timing of delivery of AAV vectors and LNPs can be varied (delivered at the same time or sequentially) to further achieve spatiotemporal control of Cas9 expression and the self-inactivation. Exemplary delivery vehicles are disclosed in U.S. Aptent Publ. Nos. US2022 / 0106615, US2021 / 0032622, and US2020 / 038433, which are hereby incorporated by reference in their entirety for all purposes.

[0163] Guide RNA polynucleotides ( RNA or DNA ) and / or endonuclease polynucleotide(s) (RNA or DNA) can be delivered by viral or non-viral delivery vehicles known in the art, such as electroporation, mechanical force, cell deformation (SQZ Biotech), and cell penetrating peptides. Alternatively, endonuclease polypeptide(s) can be delivered by viral or non-viral delivery vehicles known in the art, such as electroporation or lipid nanoparticles. In further alternative aspects, the DNA endonuclease can be delivered as one or more polypeptides, either alone or pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA.

[0164] Polynucleotides can be delivered by non-viral delivery vehicles including, but not limited to, nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small molecule RNA-conjugates, aptamer-RNA chimeras, and RNA-fusion protein complexes. Some exemplary non-viral delivery vehicles are described in Peer and Lieberman, Gene Therapy, 18: 1127-1133 (2011) (which focuses on non-viral delivery vehicles for siRNA that are also useful for delivery of other polynucleotides).

[0165] Polynucleotides, such as guide RNA, SERNA, and mRNA or DNA encoding an endonuclease, can be delivered to a cell or a patient by a lipid nanoparticle (LNP). A LNP refers to any particle having a diameter of less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, a nanoparticle can range in size from 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm. LNPs can be made from cationic, anionic, or neutral lipids. Neutral lipids, such as the fusogenic phospholipid DOPE or the membrane component cholesterol, can be included in LNPs as 'helper lipids' to enhance transfection activity and nanoparticle stability. Limitations of cationic lipids include low efficacy owing to poor stability and rapid clearance, as well as the generation of inflammatory or anti-inflammatory responses.

[0166] LNPs can also be comprised of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids. Any lipid or combination of lipids that are known in the art can be used to produce a LNP. Examples of lipids used to produce LNPs are: DOTMA, DOSPA, DOTAP, DMRIE, DC-cholesterol, DOTAP-cholesterol, GAP-DMO-RIE-DPyPE, and GL67A-DOPE-DMPE-polyethyleneglycol (PEG). Examples of cationic lipids are: 98N12-5, C12-200, DLin-KC2-DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1, and 7C1. Examples of neutral lipids are: DPSC, DPPC, POPC, DOPE, and SM. Examples of PEG-modified lipids are: PEG-DMG, PEG-CerC14, and PEG-CerC20. The lipids can be combined in any number of molar ratios to produce a LNP. In addition, the polynucleotide(s) can be combined with lipid (s) in a wide range of molar ratios to produce a LNP.

[0167] A recombinant adeno-associated virus (AAV ) vector can be used for delivery. Techniques to produce rAAV particles, in which an AAV genome to be packaged that includes the polynucleotide to be delivered, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV typically requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in the rAAV genome, and helper virus functions. The AAV rep and cap genes can be from any AAV serotype for which recombinant virus can be derived, and can be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV- 4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13 and AAV rh.74. Production of pseudo typed rAAV is disclosed in, for example, international patent application publication number WO 01 / 83692.

[0168] A method of generating a packaging cell involves creating a cell line that stably expresses all of the necessary components for AAV particle production. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as aneomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79: 2077-2081), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23: 65-73) or by direct, blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259: 4661-4666). The packaging cell line can then be infected with a helper virus, such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of TAAV. Other examples of suitable methods employ adenovirus or baculovirus, rather than plasmids, to introduce PAAV genomes and / or rep and cap genes into packaging cells.

[0169] AAV vector serotypes can be matched to target cell types. For example, the following exemplary cell types can be transduced by the indicated AAV serotypes among others. In addition to adeno-associated viral vectors, other viral vectors can be used. Such viral vectors include, but are not limited to, adenovirus, lentivirus, alphavirus, enterovirus, pestivirus, baculovirus, herpesvirus, Epstein Barr virus, papovavirus, poxvirus, vaccinia virus, and herpes simplex virus.

[0170] In some cases, Cas9 mRNA, SORNA targeting one or two loci in target genes, and donor DNA are each separately formulated into lipid nanoparticles, or are all co-formulated into one lipid nanoparticle. In some examples, Cas9 mRNA is formulated in a lipid nanoparticle, while sgRNA and donor DNA are delivered in an AAV vector.

[0171] Options are available to deliver the Cas9 nuclease as a DNA plasmid, as mRNA or as a protein. The guide RNA can be expressed from the same DNA , or can also be delivered as an RNA. The RNA can be chemically modified to alter or improve its half-life, or decrease the likelihood or degree of immune response. The endonuclease protein can be complexed with the gRNA prior to delivery. Viral vectors allow efficient delivery; split versions of Cas9 and smaller orthologs of Cas9 can be packaged in AAV, as can donors for HDR. A range of non-viral delivery methods also exist that can deliver each of these components, or non-viral and viral methods can be employed in tandem. For example, nanoparticles can be used to deliver the protein and guide RNA, while AAV can be used to deliver a donor DNA .

[0172] 6. Pharmaceutical Compositions

[0173] Exemplary compounds and compositions of the present invention are useful for treating C9orf72 GC repeat expansion mutation associated diseases, conditions and / or disorders; therefore, another embodiment of the present invention is a pharmaceutical composition comprising a therapeutically effective amount of a compound, containing composition of the present invention and a pharmaceutically acceptable excipient, diluent or carrier. The compounds of the present invention (including the compositions and processes used therein) may also be used in the manufacture of a medicament for the therapeutic applications described herein.

[0174] Exemplary pharmaceutically acceptable excipients such as carriers, solvents, stabilizers, adjuvants, diluents, etc., depending upon the particular mode of administration and dosage form. Contemplated pharmaceutical compositions can be generally formulated to achieve a physiologically compatible pH, and range from a pH of about 3 to a pH of about 11, about pH 3 to about pH 7, depending on the formulation and route of administration. In alternative examples, the pH can be adjusted to a range from about pH 5.0 to about pH 8. In some examples, the compositions comprise a therapeutically effective amount of at least one compound as described herein , together with one or more pharmaceutically acceptable excipients.

[0175] Suitable excipients include, for example, carrier molecules that include large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Other exemplary excipients can include antioxidants (for example and without limitation, ascorbic acid), chelating agents (for example and without limitation, EDTA), carbohydrates (for example and without limitation, dextrin, hydroxyalkylcellulose, and hydroxyalkylmethylcellulose), stearic acid, liquids (for example and without limitation, oils, water, saline, glycerol and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.

[0176] Pharmaceutical compositions can be formulated into preparations in solid, semisolid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres, and aerosols. As such, administration of a guide RNA and / or site-directed modifying polypeptide and / or donor polynucleotide can be achieved in various ways, including oral, buccal, rectal, parenteral,intraperitoneal, intradermal, transdermal, intratracheal, intraocular, etc., administration. The active agent can be systemic after administration or can be localized using regional administration, intramural administration, or use of an implant that acts to retain the active dose at the site of implantation. The active agent can be formulated for immediate activity or it can be formulated for sustained release.

[0177] The pharmaceutical compositions of this invention may be in liquid solutions (e.g., injectable and infusible solutions). The preferred form depends on the intended mode of administration and therapeutic application, and is readily determinable by one of ordinary skill in the art. Typical pharmaceutical compositions are in the form of injectable or infusible solutions, such as pharmaceutical compositions similar to those used for passive immunization of humans. One mode of administration is parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular, intradermal, and intrasternally) or by infusion techniques, in the form of sterile injectable liquid or olagenous suspensions. As will be appreciated by the skilled artisan, the route and / or mode of administration will vary depending upon the desired results. In a preferred embodiment, the compound or composition is administered by intravenous infusion or injection. In another preferred embodiment, the compound or composition is administered by intramuscular or subcutaneous injection.

[0178] In some embodiments, the pharmaceutical composition further includes cells produced by such methods for treating C9orf72 GC repeat expansion associated diseases in a recipient patient, and organisms comprising or produced from such cells. In some embodiments, there is provided a pharmaceutical composition comprising any of the elements disclosed herein for producing a population of any of the engineered cells described herein for treating C9orf72 GC repeat expansion associated diseases in a recipient patient described herein and a pharmaceutically acceptable additive, carrier, diluent or excipient. In some embodiments, the engineered cell is a pluripotent stem cell. In many embodiments, the engineered cell is an induced pluripotent stem cells. The pharmaceutical compositions of the invention may include a therapeutically effective amount or a prophylactically effective amount of compound of the invention. In preparing the pharmaceutical composition, the therapeutically effective amount of the compound present in the pharmaceutical composition can be determined, for example, by taking into account the desired dose volumes and mode(s) of administration, the nature and severity of the condition to be treated, and the age and size of the subject.

[0179] For some conditions, particularly central nervous system conditions, it can be necessary to formulate agents to cross the blood-brain barrier ( BBB ). One strategy for drug delivery through the BBB entails disruption of the BBB, either by osmotic means such as mannitol or leukotrienes, or biochemically using vasoactive substances such as bradykinin. The potential for using BBB opening to target specific agents to brain tumors can also be an option. A BBB disrupting agent can be co-administered with the therapeutic compositions of the invention when the compositions are administered by intravascular injection. Other strategies to go through the BBB can entail the use of endogenous transport systems, including Caveolin-1 mediated transcytosis, carrier-mediated transporters such as glucose and amino acid carriers, receptor-mediated transcytosis for insulin or transferrin, and active efflux transporters such as p-glycoprotein. Active transport moieties can also be conjugated to the therapeutic compounds for use in the invention to facilitate transport across the endothelial wall of the blood vessel. Alternatively, drug delivery of therapeutics agents behind the BBB can be by local delivery, for example by intrathecal delivery, e.g. through an Ommaya reservoir (see e.g. U.S. Pat. Nos. 5,222,982 and 5,385,582, incorporated herein by reference); by bolus injection, e.g. by a syringe, e.g. intravitreally or intracranially; by continuous infusion, e.g. by cannulation, e.g. with convection (see e.g. US Application No.20070254842, incorporated here by reference); or by implanting a device upon which the agent has been reversibly affixed (see e.g. US Application Nos. 20080081064 and 20090196903, incorporated herein by reference).

[0180] Dosage regimens can also be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response) by administering several divided doses to a subject over time or the dose can be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It is especially advantageous to formulate parenteral pharmaceutical compositions in dosage unit form for ease of administration and uniformity of dosage.

[0181] Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention is dictated by and directly dependent on (a) the unique characteristics of the compound or portion and the particular therapeutic or prophylactic effect to beachieved, and (b) the limitations inherent in the art of compounding such an antibody for the treatment of sensitivity in individuals.EXAMPLESEXAMPLE 1: Therapeutic CRISPR / Cas9 Gene Editing Approaches to the C9orf72 Repeat Expansion Mutation in Patient iPSCs

[0182] Further details of this example are provided in International Application PCT / US2023 / 066966, which has published as W02023 / 220740, and Salomonsson SE et al. Validated assays for the quantification of C9orf72 human pathology. Sci Rep. 2024 Jan 8;14(1):828. doi: 10.1038 / s41598-023-50667-3. PMID: 38191789; PMCID: PMC10774390, both of which are hereby incorporated by reference in their entirety for all purposes.

[0183] Patient lines were collected from previously published or publicly available sources.30,41154155Long-range PCR— and Southern blot— were used to clinically diagnose repeat expansion mutations in the C9orf72 gene. Sizing the repeat expansion above -100 repeats was not possible using traditional sequencing techniques that required amplification because amplification failed across GC rich repetitive DNA regions. Patients can have C9orf72 repeats into the thousands. Single molecule sequencing has been demonstrated to traverse the expanded repeats of C9orf72 in plasmid— and human tissue.PacBio singlemolecule sequencing of DNA from patient iPSC lines was developed to size the repeat expansion and phase it to surrounding SNPs. By excising a 3.6-10kb genomic region centering the repeat expansion using Cas9 cutting of naked DNA, allowed enriching the target genomic loci of interest without amplification. Single-molecule sequencing was critical to determining the editing outcomes involving the C9orf72 repeat regions, and was also useful in determining editing events that differed on each allele. From these data, a patient cell line was chosen with -200 repeats and an advantageous coding SNP in the splice acceptor of exon 2 which was exploited for measuring RNA from each allele.

[0184] The C9orf72 mutation lies in the non-coding 5’UTR between two alternative start sites, exon 1A and exon IB.71^ It was hypothesized that gene editing strategies that can remove or silence the repeat expansion would be curative at the cellular level. Three editing approaches were compared to correcting the C9orf72 mutation in a patient and non-diseased control cell line. Each of these approaches capitalized on the ability of Cas9 to induce doublestranded breaks (cuts) in DNA, which aligns with the most-developed Cas9 technology currently employed in clinical tri al s.^1^ gRNAs were designed with the fewest overall off- targets, including with no predicted off-target matches to the exact sequence and no predicted off-target within the first 2 bases of the PAM, as predicted by CRISPOR.4^ The first approach excised the repeat expansion region. Given numerous predicted off-targets throughout the genome, it was not safe to cut within the repeat region itself; instead, cuts were made just 5’ and 3’ to the repeat region. Given high homology in this area, it was not possible to target a single allele, therefore this excision was designed to be bi-allelic. Interestingly, in the patient cell line, the excision occurred only on the mutant allele by chance, leaving intact the native two repeats on the WT allele. The second approach was to excise the mutant allele, leaving the normal allele intact. Newer versions of Cas9 can distinguish between alleles that differ by a single nucleotide.— By targeting SNPs in cis with the mutation, the mutant allele became targetable, even if the mutation itself was not. AlleleAnalyzer,— an open source bioinformatics tool, was used to design gRNA pairs that would result in allele-specific nuclease sites in the C9orf72 gene based on common heterozygous polymorphisms from reference data of >2500 human genomes from around the world.— All gRNA pairs designed to edit C9orf72 are shown in Table 1 and Table 2. A pair of gRNAs that span the repeat expansion and that cover the maximum number of individuals in the representative global cohort with the lowest off-target predictions was chosen, ed 21 kb of the mutant allele (alternate allele, ALT) including the repeat expansion through exon 3 was excised. In addition, the complementary 21kb excision of the WT allele (reference allele, REF) was made leaving the only the mutant allele intact as a control. The third approach was to leave the mutation in the DNA but silence its expression by excising a regulatory region. As a proof-of-concept, one such regulatory region, exon 1 A which includes a transcriptional start site and controls the expression of the C9orf72 sense-transcript harboring the mutation was excised. The REx, HET and 1 Ax excisions in a non-diseased WT line to examine effects of each approach on the normal (non-diseased) cellular expression of the C9orf72 gene were also made. As additional controls, homozygous knock-outs of the gene in the patient and WT lines, comprised of bi-allelic 21kb and 7kb excisions, respectively were made.

[0185] Editing efficiency was measured by PCR and sequencing across the edited locus in 3 independent experiments per edit. Each experiment derived from 48 hand-picked or 96 single-cell sorted clones. The efficiency of all editing was between 21 and 92% in iPSCs.Editing near the repeat region (REx, 1 Ax) was found to be significantly less efficient in the patient lines containing an expanded repeat region compared to a WT line with fewer than 10 repeats. The hypothesis was that methylation of the repeat region and promoter22^22in patient lines accounted for less accessibility of the loci to Cas enzymes and therefore lower editing efficiency. Interestingly, a large 21kb excision was surprisingly efficient (30-59%) and did not differ between patient and WT lines. These observed efficiencies were based on gRNA derived from computational predictions (highest on-target with lowest off-target rate) but have not been optimized experimentally for efficiency.

[0186] Next, the effect of each of the edits was evaluated in a patient and control line on C9orf72 RNA and protein expression levels. Using ddPCR, the two major splice isoforms of C9orf72 were quantified using exon spanning probes that cross either the exon 1 A-exon2 (variant 3) or exon IB-exon 2 (variant 2) junctions. No short isoform (variant 1) was detected in the lines, consistent with its low expression in human tissue.72121Total mRNA was additionally quantified using a probe targeting the exon 2-exon 3 junction. The majority of the total RNA derived from exon Ib-containing transcripts across all lines, with exon 1 A- containing transcript comprising only a small proportion of total transcript. A gap was noted between measured total mRNA (exon 2-exon 3 -containing transcripts) and exon 1 A- and exon IB containing transcripts only in lines containing the repeat expansion (C9-unedited, HET(Ref)x) but not in mutation-corrected patient lines (REx, HET(Alt)x, 1 Ax) or any of the WT lines. It was hypothesized that this gap was comprised of 1 A-transcript that retains the repeat expansion resulting from sense expression of the mutation, which would not be measurable due to inability to amplify repetitive RNA and also because primers targeting exon 1 A and exon 2 would be too far apart form an amplicon. Interestingly, a decrease in 1 A expression was also observed in each of the correct mutant lines compared to the unedited patient line, but no effect of editing on 1 A-expression in the WT lines, suggesting the possibility of upregulation of normal 1 A transcription in the diseased state.

[0187] Lying between exons 1 A and IB, the sense repeat expansion is expressed from exon 1 A; therefore, only exon 1 A-containing transcripts have the possibility of expressing the mutation. Using single-molecule sequencing, an advantageous coding C SNP (rsl0757668) in the exon 2 splice acceptor to the repeat expansion was phased. Using probes that differed by a single nucleotide targeting this SNP, the percentage of expression of 1 A- and IB-containing transcripts derived from each allele was determined. Just as with the ddPCR probes,transcripts with retained repeat expansions / introns as the probes are exon-exon spanning were not detected. Surprisingly, most (>90%) exon-lA containing transcript derived from the mutant allele in the unedited patient lines, suggesting at least some normal splicing of the mutant transcript. The imbalance was corrected by repeat expansion excision. Together with the decreased in 1 A-containing transcript levels after gene correction, these data suggested an upregulation of exon 1 A transcripts off of the mutant allele, which implicated transcriptional upregulation of the mutation as a possible biological driver of disease. In contrast to exon 1 A regulation, exon IB-containing transcripts derived predominantly (>68%) from the WT allele, which was restored to nearly 50% with repeat expansion excision. Excision of exon 1 A also restored bi-allelic expression of exon IB-containing transcripts, which suggested that the mere presence of the repeat expansion in the DNA did not solely account for altered IB- containing transcript expression. As expected, excision of either allele resulted in elimination of expression from that allele.

[0188] C9orf72 protein was quantified using the Simple Western system (WES). Antibody specificity was validated using the knock-out line. This antibody cannot distinguish between protein derived from exon-1 A and exon IB-containing transcripts as these transcripts produce an identical protein isoform. None of the therapeutic edits (Rex, HETx, 1 Ax) reduced the C9orf72 protein levels in the patient line, and only exon 1 A-excision reduced C9orf72 expression in the WT line. These results indicated that the C9orf72 protein was also regulated post-transcriptionally, which is advantageous for gene therapy as even major alterations of the gene (such as removal of an entire allele) did not alter total protein levels in cells. Additionally, nine commercially available C9orf72 antibodies were tested for immunocytochemistry and did not find any that were specific for C9orf72 (i.e., they either had no signal or showed signal in our 2 KO lines).

[0189] The ability of therapeutic edits to reverse the pathology caused by the C9orf72 mutation. C9orf72 is transcribed off of both the sense and anti-sense strands was evaluated. The data suggested that sense transcription of the mutation starts from exon 1 A, since excision of exon 1 A closed the gap in “undetectable” sense transcript. It is unknown where anti-sense transcription initiates. The mutant repeat expansion was translated through non- canonical RAN translation from transcripts derived from both and sense and anti-sense strands to form 5 dipeptide repeat proteins (DPRs) which are thought to be toxic. 10 antibodies targeting each of these DPRs were evaluated using MSD’s sandwich ELISA andfound 2 antibody combinations that could reliably detect the presence of poly-GA and poly- GP DPRs above background level defined by out KO line. Poly-GA expression was eliminated by each of the therapeutic edits (C9-Rex, HET(Alt)x, 1 Ax) but unchanged by excision of the WT allele (C9-HET(Ref)x)). Poly-GP was also eliminated by removal of the repeat expansion (Rex, HET(Alt)x) but not excision of exon 1A (1 Ax), owing to anti-sense transcription of the repeat expansion. Excision of the WT allele more than doubled the amount of poly-GP expression (HET(Ref)x), indicating that regulation of the mutation itself was dynamic and worthy of further exploration.

[0190] The pathological hallmark of C9-FTD / ALS is loss of TDP-43 expression from nuclei and TDP-43 aggregation in the cytoplasm of affected neurons — These events are thought to be independent. Loss of nuclear TDP43 was detected in aged 7-week old neurons derived from the unedited patient cell line which showed a non-significant trend toward increase compared to our edited lines. This effect was non-significantly amplified after 17- hour treatment with a proteosome inhibitor MG132. After a 16 hour treatment with 1 uM MG132 of 7-week old neurons derived from all of the isogenic patient lines, a significant effect of genotype of nuclear loss of TDP43 was found. Whereas 72% of TDP43 -positive neurons in our unedited patient line had lost nuclear TDP43 after treatment with MG132, this rate was on average < 20% in each of the therapeutically edited lines (REx, HET(Alt)x, 1 Ax). Interestingly, the KO line had the highest rate of nuclear loss of TDP43 compared to other edited lines whereas removal of either the mutant or WT allele did not show this finding, suggesting the TDP43 pathological changes may be impact by complete, but not partial, loss of C9orf72 expression.DISCUSSION

[0191] Three strategies were investigated for correcting the C9orf72 repeat expansion mutation in patient iPSCs. Each strategy capitalized on Cas9’s ability to cut DNA, which aligned with technologies closest to clinical prime-time.^1^2Two of the three approaches (repeat expansion excision and excision of the mutant allele) corrected RNA abnormalities, preserved protein levels, and corrected dipeptide repeat and TDP43 pathology in iPSC- derived neurons from a patient line harboring -200 repeats. As an alternative approach, silencing the expression of the repeat expansion without removing it from the DNA by excising exon 1 A was attempted. While this approach successfully restored the RNA profile and ameliorated TDP43 pathology, it did not eliminate poly-GP DPRs. Interestingly, both ofthe successful approaches, repeat expansion and allele-specific excisions, included removing the repeat expansion.Methods

[0192] Cell line generation, maintenance and determination of editing efficiencies. iPSC generated by others41,54,55from patients harboring the C9orf72 mutation and a control cell line without mutation (WTC— ) was used. iPSCs were maintained in mTesR plus, passaging at 60-80% confluency. All cell lines had a normal karyotype and negative monthly mycloplasma testing.

[0193] The inducible motor neuron transcription factor transgene cassette42122was first knowked-in in the CLYBL safe-harbor locus of a C9-patient line using spCas9 and gRNA. This transgene includes human NGN2, ISL1, LHX3 (hNIL) under the TET operator and is inducible by doxycycline, mCherry (for positive selection) and neomycin antibiotic resistance (for negative fluorescence). Red-fluorescing cells were sorted via FACS to isolate single, live cells. Each resulting clonal cell line was analyzed for incorporation of the transgene in the CLYBL locus by PCR with preservation of one of the alleles. Number Variation (CNV) ddPCR was used to pick a clone with a single transgene insertion of the hNIL plasmid to mitigate the risk of integration of the transgene at genomic loci other than CLYBL.

[0194] To engineer each iPSC line HiFi spCas9 protein (Macolabs, UC Berkeley) and two gRNAs were used to create an excision. gRNAs were designed to have no exact off-target matches and the lowest predicted off-targets using CRISPOR (Homo sapiens - USCS Dec. 2013 (GRCh38 / hg38)).45Cas9-gRNA RNP (spCas9 (40pM), sgRNA (100pM)) was delivered by nucleofection (Lonza AAF-1002B, Lonza AAF-1002X, Pulse Code = DS138) to 350,000 iPSCs suspended in 20 pl of P3 Buffer. The cells were recovered with mTesR plus supplemented with ROCK1 inhibitor (Selleckchem SI 049) at 10 pM and Clone R (Stemcell 05888). Approximately 50% of iPSCs died within the first 24 hours of electroporation, as expected. Following a 48-72 hour recovery, the pool of edited cells was collected and either hand-picked 48 clones or sorted single live cells via FACS to a single well on a 96-well plate. Single cell sorting was performed using a BD FACSAria Fusion (Beckton Dickinson) by the Gladstone Flow Cytometry Core. The QC alignment of each laser was verified with Cytometer Setup and Tracking Beads (Becton Dickinson) before sample acquisition. A forward scatter threshold of 15,000 was set to eliminate debris from list mode data, and a fixed number of events was collected. In some experiments mCherry fluorescence (excitation561nm, emission 610nm) was also used to define sorting parameters. Drop delay determination and 96-well plate set-up setup was done using Accudrop beads (Becton Dickinson). Gating on forward scatter area versus height and side scatter area versus height was used to make the single cell determination. The specifications of the sort layout included single cell precision, 96-well collection device and target event of 1. After cultures reached 60-70% confluency, each well was split into two wells of a new 48- or 96-well plate, one for sequencing and the other to continue the cell line. Clones were screened based on the presence of an excision band using PCR (primers and expected band size from). PCR was performed across each the 5’ and 3’ cut site, with one primer site located inside the excision region, to ensure absence of a band (for homozygous edits) or presence of the WT allele (for heterozygous edits). For all lines except C9-REx, the excision band (MCLAB) was Sanger sequenced. If the sequence was ambiguous (i.e., had overlapping nucleotide reads at the same mapped nucleotide position) the line was subcloned to achieve clone purity and clean sequencing. All lines were karyotyped (WiCell or Cell Line Genetics) after editing.

[0195] For all lines except C9-REx, editing efficiency was determined based on the PCR amplification of an excision band, and in the case of homozygous excisions, the absence of the WT band, in each clone (48 hand-picked clones or 96 single-cell FACS sorted clones).. For C9-Rex, this approach was not used since PCR could not amplify the large repeat expansion, and hence could not distinguish clones with excision of both the mutant and WT allele from clones with excision of the WT allele only. Therefore, single-molecule sequencing of clonal REx lines was used to determine the percentage of clones with an excision of the repeat expansion region (as described below).

[0196] PacBio single molecule sequencing to size the repeat expansion and determine repeat expansion excision (C9-REx) edits. Because polymerase amplification failed to accurately size the entirety of the C9orf72 GC rich repetitive region, single molecule sequencing— of a genomic region containing the repeat region was used. High molecular weight DNA was collected using Genomic Tip (Qiagen 10243) and confirmed absence of smearing by running the DNA on a 1.5% agarose gel. The Gladstone Genomics Core performed library preparation according to the “No Amp Targeted Sequencing” published protocol2^22using 3-5 ug of DNA per sample as measured by Qubit. Briefly, the free ends of purified genomic DNA were blocked and then the gene region of interest was excised using spCas9, a gRNA targeting 5’ to the repeat expansion and a gRNA targeting 3’ to the repeatexpansion . Excising the genomic region harboring the repeat expansion yielded a 2639 bp fragment from the WT allele and a variable size of the mutant allele fragment depending on the size of the CCCCGG repeat. Adapters and barcodes were ligated to blunt free ends of DNA and sequenced 3-5 barcoded lines per SMRT Cell on either a Sequel I or Sequel II sequencer. A 3 -pass filter was used such that each molecule of DNA had to be sequenced 3 times to be included in analysis. Repeat counts were compared from sequencing to Southern blot, performed by Celplor using 20 ug of input DNA and the previously published protocol.—

[0197] iPSC differentiation into motor neurons. The hNIL transgene cassette TET-on system in the CLYBL safe-harbor locus of a C9-patient line and WT line was used. Introduction of doxycycline for 3 days induced the expression of 3 human transcription factors NGN2, ISL1, LHX3. The previously published protocolwas followed with notable exceptions, including higher concentrations of the growth factors BDNF, GDNF and NT-3.

[0198] RNA quantification by ddPCR. 2-week old induced neurons were lysed with papain (Worthington LK003178) and RNA was isolated using Quick-RNA Microprep Kit (Zymo R1051). cDNA was synthesized using iScript™ Reverse Transcription Supermix (Biorad 1708841) and 500 ng of RNA. ddPCR was run with 3 technical replicates of each of 3 biologic replicates (independent wells of differentiated neurons) on the QX100 Droplet Reader (Bio-Rad 186-3002). Each ddPCR reaction consisted of 12.5 uL of 2x SuperMix for Probes (no dUTP) (Bio-Rad 186-3024), primer / probe, 5 ng of cDNA, and nuclease-free water up to 25 pL. Droplets were generated with QX 100 Droplet Generator (Bio-Rad 186-3001) and 20 pL of the reaction mixture with 70 pL of oil. The ddPCR reactions were run in a Deep Well C1000 Thermal Cycler (Bio-Rad 1851197) with the following cycling protocol: (1) 95°C for 10 min; (2) 94°C for 30 s; (3) 58°C for 1 min; (4) steps 2; and 3 repeat 39 times; (5) 98°C for 10 min; (6) hold at 4°C. Positive samples were thresholded as those with >10 positive droplets to avoid error due to noise. Positive droplets were quantified for each target and normalized the amount to our loading control (UBE2D2) (Bio-Rad QuantaSoft™ Analysis Pro Software). This housekeeping gene was chosen because its expression level remained stable across iPSCs and differentiated neurons—.

[0199] For allele-specific expression of exon 1 A- and IB-containing transcripts, a coding SNP in the exon 2 splice acceptor (rs!0757668) in the patient line was utilized. The ddPCRprobe was centered on this SNP and used the same primers as above to amplify the exon 1 A- exon 2 (Thermo, 4332077) and exon IB-exon 2 junctions (Thermo, 4332077). Expression from each allele was quantified in a single reaction and reported as a ratio.

[0200] C9orf72 protein quantification by Simple Western. Protein quantification was performed by streptavidin-based Simple Western— capillary reaction (WES; Bio-Techne) according the manufacturers protocol (Jess & Wes Separation Module SM1001 to SM1012— ), with the following specifications: protein was collected from cultured neurons 2- weeks post-induction in RIPA buffer with protease inhibitor and sonicated for 5 min, and denatured at 90 degrees C for 10 min. 0.3 ug / ul protein from each sample was mixed with lul 5x Master Mix and 0. lx Sample Buffer (EZ Standard Pack PS-ST01EZ-8) to a total volume of 5 ul. 3 ul of this mix was loaded per sample onto a 12-230 kDa plate (ProteinSimple SM- W004-1). Primary antibodies were mouse anti-C9orf72 (GeneTex, GTX634482, Figure 11) at a 1 : 100 dilution and rabbit anti-GAPDH (AbCam, AB9485) at 1 : 1000 dilution (total volume lOul per lane). Duplexed secondaries included 9.5ul of mouse (ProteinSimple, DM-002) and 0.5 ul of 20x anti-rabbit (ProteinSimple, 043-426) per lane. Reaction times: 25 min separation time at 375V, 5 min antibody dilutant time, 30 min primary antibody, 30 min secondary antibody; quantification at 4 seconds of detection (high dynamic range). Each antibody produced a single peak corresponding to each antibody under these optimized conditions: 57 kDa (C9orf72) and 42 kDa (GAPDH). Area under the curve was quantified for each peak and C9orf72 AUC was normalized to GAPDH AUC for each sample. Averages across 3 biological replicates (independent wells of neuronal differentiation) of neurons aged 14-days post-induction from each edited cell line were compared to the average protein expression of their respective unedited controls.

[0201] Dipeptide repeat quantification by Meso Scale Discovery (MDS) sandwich ELISA. 2 antibody combinations were found to be specific for detecting DPRs in 14-day-old iPSC-derived neurons harboring the C9orf72 repeat expansion. The manufacturer’s protocol for the Small Spot Streptavidin Plate (L45SA, MSD) was followed. Poly-GA was detected using anti-GA antibody (MABN889, Millipore) at 1 mg / ml (capture) and 2 mg / ml (detect) final concentration and 18 pg total protein per sample (blocking buffer A, solution PBS). Poly-GP was detected using anti-GP antibody (affinity purified TALS828.179 from TargetALS, purification lot A-I 0757 and stock concentration 1.39 mg / ml). A-I 0757 anti-GP antibody was used at a final concentration of 2 mg / ml capture and 4 mg / ml detect with 18.5qg total protein per sample (blocking buffer A, solution TBS). The plate was coated with capture antibody overnight at 4°C with no agitation. The plate was blocked with 3% MSD Blocker A (R93BA, MSD) in IX DPBS for 1 hour at 750 rpm, then incubated for 1 hour with protein lysate at 750 rpm at room temperature. Detection antibody was added after the lysate for 1 hour. Washes were performed between steps thrice with IX DPBS + 0.05% Tween-20. MSD Read Buffer A (R92TG, MSD) was added to the plate before being immediately placed in the MSD Model 1250 Sector Imager 2400 plate reader. Signal was calculated by comparing luminescence intensity for each control or edited patient line to background (i.e., C9-KO line), data was presented as a fold change above C9-KO baseline / background level.

[0202] TDP43 immunocytochemistry and quantification. 7-week-old neurons were fixed by adding 4% PFA directly to culture media for 30 min followed by 3 PBS washes of 10 min each. Cells were permeabilized by IX DPBS 0.1% Triton-X in 3 washes of 10 min each at room temperature and blocked with IX DPBS 0.1% Triton-X + 5% BSA for 1 hour at room temperature. Primary antibodies: rabbit anti-TDP43 (10782-2-AP, Proteintech) at 1 :500, beta- III-tubulin (480011, Invitrogen) at 1:250. Primary antibodies were incubated overnight at 4°C. Secondary antibodies included Goat anti-rabbit Alexa Fluor 488 nm and Goat antimouse Alexa Fluor 594 nm. Secondary antibodies were incubated at room temperature for 1 hour. DAPI (D1306, ThermoFisher Scientific) was added to the penultimate of five, 5 min PBS washes. After staining, cells were scanned on the ImageXpress Micro Confocal (Molecular Devices). TDP43 cells were quantified by hand-counting.EXAMPLE 2: RNA Delivery via AAV in vivoSYNTHESIS OF AAV FOR CAS9 AND GRNA DELIVERY

[0203] The C9orf72 GC repeats expansion editing were conducted by CRISPR / Cas 9. The CRISPR system comprising Cas9 and gRNAs can be packaged in a single adeno-associated virus (AAV) particle to be delivered into the target cells. A promoter, for example, a single Hl promoter, can efficiently express both Cas9 and gRNAs. Due to this unique genetic element, an assembly composed of any Cas9 gene packaged in a single recombinant AAV, called AAV-H1- CRISPR, and a large number, for example 2 gRNAs, was possible. The ability to add gRNA allowed AAV-H1 -CRISPR to generate double-strand breaks unmatched site-specifically, thus minimizing the risk of known off-target mutagenesis.

[0204] 1. Assembly of virus constructs. In order to facilitate the rapid assembly of viral vectors from modular components in the field of commercial laboratories, synthetic reusable modular cassettes were synthesized for subsequent targets. The vector for C9orf72 repeat expansion gene editing were assembled to contain the specific Hl-gRNA modules and the Cas9 endonuclease. The final assembly were verified by restriction mapping followed by complete sequencing. The final product was provided as an assembled viral construct of 1 mg of transfection grade C9orf72 ORF target locus specific AAV shuttle plasmid DNA without endotoxin and sequence errors.

[0205] 2. Preparation and analysis of AAV-H1-CRISPR stock. Packaging of viral constructs, purification of viral particles and molecular survey of viral titer purity and infectivity were performed by cGMP certified core facilities according to industry standards. Production of viral stocks suitable qualitatively and quantitatively for preclinical studies. Prepared and purified by cGMP, with minimal infectivity of 0.9 IU / viral genome, minimal titer of viral genome 1012 / ml and minimal yield of 1014infectious units Endotoxin- free AAV stock.

[0206] 3. Quantitative characterization of AAV-H1-CRISPR genome targets and off- target sites. The on target and predicted off target sites in the infected cell population were sequenced in depth. The modified / unmodified allele ratio provided a quantitative measure of efficiency; the on-target / off-target modification ratio became the final measure of specificity. The virus was tested in vivo using engineered mouse and human biopsy samples. rAAV:Cas9 / gRNA Administration

[0207] AAV CRISPR / Cas9 were injected via tail vein into mice at day 0 and day 5 with PBS for control animals. At day 5, one pair (AAV and PBS) animals were subjected to a retro orbital bleed for a blood sample, euthanized and tissues harvested. The second pair of animals received a second tail vein injection of AAV-Cas9 or PBS and were euthanized for harvest of tissue 7 days later after retro orbital bleed. Tissues harvested were mouse frontal cortex, temporal cortex, parietal cortex, cerebellum and spinal cord tissues.EXAMPLE 3: RNP Delivery Via RBP System in vivoBinding of Conjugated endosomolytic polypeptide (ELP)-RNA binding protein Variants to Guide RNAs or RNP

[0208] In one instance, the RNA binding protein (RBP) was the N-terminal domain of a human U1A protein, also referred to herein as “U1A”. In some cases, the ELP was a synthetically modified ppTG21 peptide bearing a pyridyl disulfide leaving group to facilitate conjugation.

[0209] The purified Cas9 was mixed with a variant guide RNA (i.e., a guide RNA with or without one or more SL, as described above), as described in Rouet et al. (ibid). A prepared Cas9 solution was added to the prepared solution of sgRNA at the desired concentration. Guides or RNP were used to test their capacity to be bound by U1 A variants and U1A- ppTG21 conjugates by fluorescence polarization binding assays using the experimental design described in Hochstrasser et al. Mol Cell. 2016 Sep. 1; 63(5):840-51. doi: 10.1016 / j.molcel.2016.07.027.

[0210] Biolayer interferometry (BLI) was used to assess the capacity of Cas9 RNPs containing sgRNA variants to bind U1 A (or U1 A-ppTG21 conjugates) as well as to assess the persistence of any binding events. These assays approximated the experimental design described in Richardson et al. (Nat Biotechnol. 2016 March; 34(3):339-44. doi:10.1038 / nbt.3481). These experiments relied on a Cas9 protein covalently, site-specifically labeled with a biotin moiety, allowing loading onto a BLI sensor bearing streptavidin.Genome Editing Using U1A Variants and Modified Guide RNAs

[0211] Genome editing was performed as described in Rouet et al. (ibid), in particular the genome editing relying on the 1NLS Cas9 construct. Cas9 RNP was prepared and applied either alone, with addition of ppTG21, or with addition UlA-ppTG21 conjugates. Cas9 RNP mixtures were added to cells and returned to the incubator. Cells were harvested 44-48 h later, and genomic DNA were harvested. T7E1 analysis was performed as described in Rouet et al. (ibid).

[0212] An experiment was performed to assess the genome editing ability of different configurations of variant sgRNA bound by different UlA-ppTG21 conjugates (e.g. U1A(1), U1A(2), or U1A(3), which respectively represent U1 A monoconjugated, bisconjugated, or trisconjugated with ppTG21). Another editing experiment was performed to assess the abilityof the Cas9 RNP with adaptor-recruited ELPs (arELP) to perform ligand-enhanced (and thus, receptor-mediated) genome editing.RNP administration

[0213] Various routes of administration suitable for use in a method of the present disclosure include various enteral and parenteral routes of administration, including, e.g., intratumoral, peritumoral, intramuscular, intratracheal, intracranial, subcutaneous, intradermal, topical application, intravenous, intraarterial, rectal, nasal, oral, and other enteral and parenteral routes of administration.EXAMPLE 4: Treatment of the ALS / FTD phenotype of FVB C9-500 miceMOUSE MODELS C9-500

[0214] The C9-500 BAC (Tg(C9orf72)500Lpwr) transgenic mouse line expresses a human C9orf72 gene with -500 hexanucleotide repeats (GGGGCC; or G4C2) in intron. The C9orf72 BAC transgenic line C9-500 was created by Dr. Laura P.W. Ranum (University of Florida). Briefly, a -98 kbp human bacterial artificial chromosome (BAC) 002:B7 subclone m5 30 (Chr9:27, 527, 137-27,625,470 [Human Genome, February 2009, GRCh37 / hgl9]) was microinjected into pronuclei of fertilized mouse eggs with an FVB / NJ background. The BAC has -52 kbp of transcriptionally-upstream (telomeric) and -19 kbp of transcript! onally- downstream (centromeric) flanking sequences that contain no other complete loci or confirmed genes (June 2016). Founder males were bred to FVB / NJ inbred females for germline transmission, establishing four C9-BAC founder lines. Founder line C9-500 (56 IKK) was identified with a single copy of the transgene harboring -500 GGGGCC repeats. The transgene analysis performed on the hemizygous mice suggested a single copy of the transgene had integrated on chromosome 6 (114,939,853-114,939,873 [mouse mmlO]) and resulted in a 20 bp deletion of genomic region. The mice expressed the transgene and that dipeptide repeat (DPR) levels of polyGP (as measured by ELISA) are 100X higher than background at two months of age (See https: / / www.jax.org / strain / 029099).

[0215] Other mouse models under development and manifesting the C9orf72 GC repeats expansion associated syndromes were also suitable targets for in vivo study.Mouse Embryofibroblasts (MEFs)

[0216] The C9-500 BAC (Tg(C9orf72)500Lpwr) transgenic mouse Mouse embryo fibroblasts (MEFs) were prepared from 17 day gestation embryos by mechanical andenzymatic dissociation and maintained in DMEM supplemented with 10% fetal bovine serum. MEF cells were prepared as previously described (Behringer et al., Manipulating the mouse embryo: A laboratory manual, Fourth edition. Cold Spring Harbor Laboratory Press, 2014) and genotyped by PCR using primers specific for the HIV transgene (Kopp J B, et al. Proc Natl Acad Sci USA 1992; 89: 1577-1581; Dickie P, et al. Virology 1991; 185: 109-119).DNA Analysis

[0217] Genomic DNA were isolated from cells / tissues using any standard protocol. Genomic DNA were analyzed by single molecule sequencing of a genomic region containing the repeat region.RNA Analysis and quantification by ddPCR

[0218] Total RNA was prepared from tissues using any standard protocol. Mouse frontal cortex, temporal cortex, parietal cortex, cerebellum and spinal cord tissues were lysed by papain (Worthington LK003178) and RNA was isolated using Quick-RNA Microprep Kit (Zymo R1051). cDNA was synthesized using iScript™ Reverse Transcription Supermix (Biorad 1708841) and 500 ng of RNA. ddPCR was run with 3 technical replicates of each of 3 biologic replicates (independent wells of differentiated neurons) on the QX100 Droplet Reader (Bio-Rad 186-3002). Each ddPCR reaction consisted of 12.5 uL of 2x SuperMix for Probes (no dUTP) (Bio-Rad 186-3024), primer / probe, 5 ng of cDNA, and nuclease-free water up to 25 pL. Droplets were generated with QX 100 Droplet Generator (Bio-Rad 186-3001) and 20 pL of the reaction mixture with 70 pL of oil. The ddPCR reactions were run in a Deep Well C1000 Thermal Cycler (Bio-Rad 1851197) with the following cycling protocol: (1) 95°C for 10 min; (2) 94°C for 30 s; (3) 58°C for 1 min; (4) steps 2; and 3 repeat 39 times; (5) 98°C for 10 min; (6) hold at 4°C. Positive samples were thresholded as those with >10 positive droplets to avoid error due to noise. Positive droplets were quantified for each target and normalized the amount to our loading control (UBE2D2) (Bio-Rad QuantaSoft™ Analysis Pro Software).

[0219] For allele-specific expression of exon 1 A- and IB-containing transcripts, a coding SNP in the exon 2 splice acceptor (rsl0757668) in our patient line were utilized, our ddPCR probe was centered on this SNP and used the same primers as above to amplify the exon 1 A- exon 2 (Thermo, 4332077) and exon IB-exon 2 junctions (Thermo, 4332077). Expression from each allele was quantified in a single reaction and reported as a ratio.Protein quantification by Simple Western

[0220] C9orf72 protein quantification was performed by streptavidin-based Simple Western capillary reaction (WES; Bio-Techne) according to the manufacturers protocol (Jess & Wes Separation Module SM1001 to SM101282), with the following specifications: protein was collected from mouse frontal cortex, temporal cortex, parietal cortex, cerebellum and spinal cord tissues in RIPA buffer with protease inhibitor and sonicated, and denatured. Protein from each sample was mixed with Sample Buffer (EZ Standard Pack PS-ST01EZ-8) and this mix was loaded per sample onto a 12-230 kDa plate (ProteinSimple SM-W004-1). Primary antibodies were mouse anti-C9orf72 (GeneTex, GTX634482,) at a 1 : 100 dilution and rabbit anti-GAPDH (AbCam, AB9485) at 1 : 1000 dilution (total volume lOul per lane). Duplexed secondaries included mouse (ProteinSimple, DM-002) and anti-rabbit (ProteinSimple, 043- 426) per lane. Each antibody was produced a single peak corresponding to each antibody. Area under the curve was quantified for each peak and C9orf72 AUC was normalized to GAPDH AUC for each sample. Averages across 3 biological replicates (independent wells of neuronal differentiation) of mouse frontal cortex, temporal cortex, parietal cortex, cerebellum, and spinal cord tissues from each edited cell line was compared to the average protein expression of their respective unedited controls.Dipeptide repeat quantification by Meso Scale Discovery (MDS) sandwich ELISA.

[0221] Poly-GA and poly-GP were quantified as follows: The manufacturer’s protocol for the Small Spot Streptavidin Plate (L45SA, MSD) was followed. Poly-GA was detected using anti-GA antibody (MABN889, Millipore) at 1 mg / ml (capture) and 2 mg / ml (detect) final concentration and 18 pg total protein per sample (blocking buffer A, solution PBS). Poly-GP was detected using anti-GP antibody (affinity purified TALS828.179 from TargetALS, purification lot A-I 0757 and stock concentration 1.39 mg / ml). A-I 0757 anti-GP antibody was used at a final concentration of 2 mg / ml capture and 4 mg / ml detect with 18.5 pg total protein per sample (blocking buffer A, solution TBS). The plate was coated with capture antibody overnight at 4°C with no agitation. The plate was blocked with 3% MSD Blocker A (R93BA, MSD) in IX DPBS for 1 hour at 750 rpm, then incubated for 1 hour with protein lysate at 750 rpm at room temperature. Detection antibody was added after the lysate for 1 hour. Washes were performed between steps thrice with IX DPBS + 0.05% Tween-20. MSD Read Buffer A (R92TG, MSD) was added to the plate before being immediately placed in the MSD Model 1250 Sector Imager 2400 plate reader. Signal was calculated by comparingluminescence intensity for each sample to background (i.e., C9-K0 line), data was presented as a fold change above C9-K0 baseline / background level.

[0222] TDP43 immunocytochemistry and quantification. Samples or tissues were fixed by directly adding 4% PFA for 30 min or after perfusion of mouse tissues followed by 3 PBS washes of 10 min each. Cells were permeabilized by IX DPBS 0.1% Triton-X in 3 washes of 10 min each at room temperature and blocked with IX DPBS 0.1% Triton-X + 5% BSA for 1 hour at room temperature. Primary antibodies: rabbit anti-TDP43 (10782-2-AP, Proteintech) at 1 :500, beta-III-tubulin (480011, Invitrogen) at 1 :250. Primary antibodies were incubated overnight at 4°C. Secondary antibodies included Goat anti-rabbit Alexa Fluor 488 nm and Goat anti-mouse Alexa Fluor 594 nm. Secondary antibodies were incubated at room temperature for 1 hour. DAPI (D1306, ThermoFisher Scientific) was added to the penultimate of five, 5 min PBS washes. After staining, cells were scanned on the ImageXpress Micro Confocal (Molecular Devices). TDP43 cells were quantified by handcounting.Treatment regimen study

[0223] Mice with ALS / FTD phenotype was employed to evaluate the efficacy of rAAV:Cas9 / gRNA C9orf72. Prior to treatment study, mice were randomized into treatment groups based on body weight, gait analyses, grip strength, cage behavior, and open field testing or a combination of outcomes. Histological analyses included assessment of neuromuscular junctions in the tibialis and diaphragm muscles, quantification of motor neuron ventral roots, and immunohistochemistry of the brain and spinal cord using a variety of antibodies. Assessment of RNA foci and colocalization with neurons (Neu-N) in the brain or lower motor neurons (ChAT) in the spinal cord were performed.

[0224] Mice were assessed weekly for body weight change, gait analyses, grip strength, cage behavior, open field testing, assessment of neuromuscular junctions in the tibialis and diaphragm muscles, quantification of motor neuron ventral roots, immunohistochemistry of the brain and spinal cord using a variety of antibodies, and RNA foci and colocalization with neurons (Neu-N) in the brain or lower motor neurons (ChAT) in the spinal cord. The doses of test item to be administered was calculated daily in mg / kg based on the latest body weight of the mice.

[0225] For treatment, a first group of fifteen C9-500 BAC transgenic mice (after 14 weeks old) was iv injected at least one dose of rAAV:Cas9 / gRNA C9orf72. A second group of fifteen mice was iv injected with the same dose of control rAAV. From week 14 to week 20, data of clinical relevancy was collected and compared across all groups.

[0226] The clinical endpoints were evaluated based on data of gait analyses, grip strength, cage behavior, open field testing, assessment of neuromuscular junctions in the tibialis and diaphragm muscles, quantification of motor neuron ventral roots, immunohistochemistry of the brain and spinal cord using a variety of antibodies, and RNA foci and colocalization with neurons (Neu-N) in the brain or lower motor neurons (ChAT) in the spinal cord from C9-500 BAC model.EXAMPLE 5: Screen of allele-specific gRNAs to test the efficiency of excision of the mutant c9orf72 allele by CRISPR spCas9 gRNA pairs in human iPSCs harboring a mutant c9orf72 repeat expansion.

[0227] A screen of pairs of gRNAs was performed to determine which gRNA pairs had maximal excision efficiency for excising the C9orf72 mutant allele (allele-specific excision). The ability of pairs of gRNAs to excise the mutant C9orf72 allele in a patient iPSC line harboring -200 repeats was measured. Each gRNA was designed to target a single nucleotide polymorphism (SNP) in cis with the C9orf72 repeat expansion so that pairs of gRNAs selectively excised the mutant allele, leaving the normal allele intact.

[0228] An allele-specific gRNA 5’ was paired to the mutant repeat expansion with guide nucleic acid sequence as labeled by guide names 1-6 (corresponding to guide nucleic acids- DNA sequences in SEQ IDs 29, 570, 482, 700, 440, and 384; or guide nucleic acid-RNA sequences in SEQ IDs 739, 1266, 1178, 1398, 1136, and 1180) with an allele-specific gRNA 3’ to the repeat expansion with guide nucleic acid sequence as labeled by guide names A-D (corresponding to guide nucleic acids-DNA sequences in SEQ IDs 30, 290, 217, and 629; or guide nucleic acid-RNA sequences in SEQ IDs 740, 984, 911, and 1327) and tested their efficiency for excision of the mutant C9orf72 allele. The following allele-specific guide nucleic acids (see Table 7) were tested. Each 5’ guide nucleic acid was tested in combination with each 3’ guide nucleic acid.Table 7: Allele-specific guide nucleic acid tested for efficiency of excision of the mutant C9orf72 allele

[0229] The gRNAs were ordered from Synthego. Cas9-gRNA RNP (spCas9 (40pM), sgRNA (100pM)) was delivered by nucleofection (Lonza AAF-1002B, Lonza AAF-1002X, Pulse Code = DS 138) to 150,000 iPSCs suspended in 20 pl of P3 Buffer. The cells were recovered with mTesR plus supplemented with ROCK1 inhibitor (Selleckchem SI 049) at 10 pM and Clone R (Stemcell 05888). Following a 48 hour recovery, DNA from the pool of edited cells using Quick Extract (VMR 76081-768) was collected. Our novel excision reporter ddPCR assay which detected excision events was used to quantify excision efficiency.

[0230] A loss of a ddPCR probe centered on exon 2 to report on editing (excision of the mutant allele would lead to loss of probe binding site) was used. Normalizing probe binding to a housekeeping genomic loci (RPB30, Bio-Rad Assay ID dHsaCP2500350) allowed quantifying excision frequency to determine copy number or ratio. ddPCR was run with 3 technical replicates of each of 2 biologic replicates (independent electroporation events) on the QX100 Droplet Reader (Bio-Rad 186-3002). Each ddPCR reaction consisted of 12.5 uL of 2x SuperMix for Probes (no dUTP) (Bio-Rad 186-3024), primer / probe, 5 ng of DNA, and nuclease-free water up to 25 pL. Droplets were generated with QX 100 Droplet Generator (Bio-Rad 186-3001) and 20 pL of the reaction mixture with 70 pL of oil. The ddPCR reactions were run in a Deep Well Cl 000 Thermal Cycler (Bio-Rad 1851197) with the following cycling protocol: (1) 95°C for 10 min; (2) 94°C for 30 s; (3) 58°C for 1 min; (4) steps 2; and 3 repeat 39 times; (5) 98°C for 10 min; (6) hold at 4°C. Positive droplets for each target were quantified and the amount was normalized to the loading control (RPB30) (BioRad QuantaSoft™ Analysis Pro Software).

[0231] Some pairs of gRNAs were found to be more efficient than others and that while some individual gRNAs performed better overall, the pairs nonetheless had to be tested experimentally as an inefficient gRNA could decreased the overall efficacy (such as pair C6). In addition, there was no computational method to predict which gRNA pair was the most efficient, this must also be determined experimentally.EXAMPLE 6: in vivo validation of allele-specific excision and repeat expansion excision approaches in a mouse model of C9-ALS / FTD.

[0232] The BAC-C9orf72 mouse (JAX 029099)83‘84was chosen because it displays a number of features consistent with human C9-ALS, including: -500 repeats expressed at levels similar to those recorded in humans, motor neuron loss, motor deficits, pathologic hallmarks of human disease (RNA foci, dipeptide repeat expression, TDP-43 pathology) and early lethality (by 4-10 months). In addition, this mouse model contains a single insertion of the human mutant gene. Excising the human gene in this mouse was therefore a good model for the heterozygous, allele-specific excision in human cells. The human transgene had been sequenced in this mouse and it was found that it contained our target SNPs.

[0233] Three AAVs were generated: One containing spCas9 (AAV-spCas9; FIG.1A and FIG. IB), a second containing the two ALT gRNAs (encoded by SEQ ID NO: 724(CACAATATTTCTTTTAAGTC)) and by SEQ ID NO: 725 (GATAAGAACTTCTCACAGAG)) and a GFP reporter (AAV- ALT; FIG. 2A and FIG. 2B) and a third containing the REx gRNAs (encoded by SEQ ID NO: 726 (GGGCGTGGTCGGGGCGGGCC) and by SEQ ID NO: 727 (TAGCGCGCGACTCCTGAGTT)) as shown in Table 4 and a GFP reporter (AAV-REx; FIG.3A and FIG. 3B). Sequences encoding the gRNAs are in upper case in FIGs. 2 and 3. Three C9-mice were injected at 12 weeks of age with both the AAV-spCas9 and AAV-ALT. An additional three C9-mice at 12 weeks of age were injected with AAV-spCas9 and AAV- REx. An additional twelve mice were injected with PBS as sham-injected controls. Each mouse was injected with 4ul total volume per hemisphere (2ul of each vector) of 4el0-4el 1 vg / ml virus into the striatum with the following coordinates (AP 0.2, ML 2.0, DV 2.5 mm from Bregma) using convection-enhanced delivery.

[0234] The mice were sacrificed at 6 weeks post injection and the effects of allele-specific vs repeat region excision vs sham injected control on C9orf72 pathology, including the percentage of cells demonstrating RNA foci and the level of C9orf72-dipeptide repeats polyGA and polyGP were measured. The editing efficiency using ddPCR assays and singlemolecule sequencing were determined.EXAMPLE 7: Allele specific excision of mutant alleles in ALS / FTD patient cells

[0235] An iPSC line from an ALS / FTD patient carrying a pathogenic C9orf72 repeat expansion for allele specific excision which excises the mutant allele alone, leaving the normal allele intact was used.Construction of AAV for Cas9 and gRNA delivery

[0236] The guide nucleic acids sequences that would excise a large segment of the C9orf72 locus which includes an allele-specific 5’ guide nucleic acid to the mutant repeat expansion were selected, e g , SEQ IDs 29, 570, 482, 700, 440, 384, 739, 1266, 1178, 1398, 1136, or 1180 and an allele-specific 3’ guide nucleic acid to the repeat expansion e.g., SEQ IDs 30, 290, 217, 629, 740, 984, 911, and 1327. Through those guide nucleic acids pairs, at least 20 kb of the mutant allele (HET(Mut)x) starting at least lOkb upstream of exon 1A and stretching all the way through exon 4 were obtained. At least two types of AAV were generated for cell transfusion: a first one containing spCas9 (AAV-spCas9), a second one containing the nucleic acids sequences encoding a pair of allele-specific gRNAs (AAV- gRNA 5 ’&3 ’) and a reporter.Transfusion iPSC cultures of AAV vectors

[0237] iPSC cultures from an ALS / FTD patient carrying a pathogenic C9orf72 are cotransduced with AAV-SpCas9 and AAV-gRNA 5’&3’. After 7 days, genomic DNA was harvested and analyzed for genome editing using ddPCR assays and single-molecule sequencing.Dipeptide repeat quantification by Meso Scale Discovery (MDS) sandwich ELISA.

[0238] To evaluate the effects of allele specific excision, Poly-GA and poly-GP were quantified in the AAV vectors co-transduced C9orf72 ALS / FTD iPSC cell lines and untreated control cell line. The manufacturer’s protocol for the Small Spot Streptavidin Plate (L45SA, MSD) was followed. Poly-GA was detected using anti-GA antibody (MABN889, Millipore) at 1 mg / ml (capture) and 2 mg / ml (detect) final concentration and 18 pg total protein per sample (blocking buffer A, solution PBS). Poly-GP was detected using anti-GP antibody (affinity purified TALS828.179 from TargetALS, purification lot A-I 0757 and stock concentration 1.39 mg / ml). A-I 0757 anti-GP antibody was used at a final concentration of 2 mg / ml capture and 4 mg / ml detect with 18.5 pg total protein per sample (blocking buffer A, solution TBS). The plate was coated with capture antibody overnight at 4°C with no agitation. The plate was blocked with 3% MSD Blocker A (R93BA, MSD) in IX DPBS for 1 hour at 750 rpm, then incubated for 1 hour with protein lysate at 750 rpm at room temperature. Detection antibody was added after the lysate for 1 hour. Washes were performed between steps thrice with IX DPBS + 0.05% Tween-20. MSD Read Buffer A (R92TG, MSD) was added to the plate before being immediately placed in the MSD Model 1250 Sector Imager 2400 plate reader. Signal was calculated by comparing luminescence intensity for each sample to background (i.e., C9-KO line), data was presented as a fold change above C9-KO baseline / background level.

[0239] TDP43 immunocytochemistry and quantification. TDP-43 accumulates were quantified in the AAV vectors co-transduced C9orf72 ALS / FTD iPSC cell lines and untreated control cell line. Cells were fixed by directly adding 4% PFA for 30 min or after perfusion of mouse tissues followed by 3 PBS washes of 10 min each. Cells were permeabilized by IX DPBS 0.1% Triton-X in 3 washes of 10 min each at room temperature and blocked with IX DPBS 0.1% Triton-X + 5% BSA for 1 hour at room temperature. Primary antibodies: rabbit anti-TDP43 (10782-2-AP, Proteintech) at 1 :500, beta-III-tubulin (480011, Invitrogen) at 1 :250. Primary antibodies were incubated overnight at 4°C.Secondary antibodies included Goat anti-rabbit Alexa Fluor 488 nm and Goat anti-mouse Alexa Fluor 594 nm. Secondary antibodies were incubated at room temperature for 1 hour. DAPI (D1306, ThermoFisher Scientific) was added to the penultimate of five, 5 min PBS washes. After staining, cells were scanned on the ImageXpress Micro Confocal (Molecular Devices). TDP43 cells were quantified by hand-counting.

[0240] RNA foci visualization and quantification. The average percentage of the total number of cells containing RNA foci and the number of foci per 100 cells were calculated in the AAV vectors co-transduced C9orf72 ALS / FTD iPSC cell lines and untreated control cell line. Cells were imaged using a Widefield microscope. For quantification, at least 20 pictures were taken from randomly chosen microscopic fields, containing 100-300 cells for each treatment. The number of foci was counted.EXAMPLE 8: Allele-specific gRNA pairs screeningDesign of a C9orf72 repeat region excision screening platform to test the efficiency of excision of the mutant C9orf72 repeat expansion and the entire repeat region by CRISPR spCas9 gRNA pairs.

[0241] A screen of pairs of gRNAs to determine which gRNA pairs had maximal excision efficiency for excising the C9orf72 mutant allele (allele-specific excision) was performed (See Figure 4). This screen was performed on a cell line engineered for screening gRNA pairs. The cell line derived from a patient harboring a C9orf72 repeat expansion with -200 GGGGCC repeats. The WT allele was selectively excised using spCas9 and the allelespecific gRNAs were: CTCTGTGAGAAGTTTTTATC (SEQ ID NO. 21; or SEQ ID NO. 737) and GACTTAGAAGAAATATTGTG (SEQ ID NO. 22; SEQ ID NO. 738). (See Figure 5). The line was ensured to be heterozygous by PCR and sanger sequencing across the uncut mutant allele and the excised WT allele. The engineered line had a normal karyotype.

[0242] Next, a ddPCR assay that can accurately report on excision of the C9orf72 locus was developed. A probe with sequence homology to exon 2 was generated (probe sequence CCAAGCTAGGAACTCACTACCACTG (SEQ ID NO. 1411), primers GATAGGCCACCCTTGAAAGG (SEQ ID NO. 1412), GGAGAGGGTAAGAAATATCACTGAC(SEQ ID NO. 1413)) as shown in Table 5. The probe region was PCR amplified and probe binding, copy number and ratio of probe binding to a control region (RPB30, BioRad dHsaCP 1000485) with a known copy number of 2 werequantified. In the assay, only one allele was present in the engineered screening line - the mutant allele; therefore, a successful excision event resulting in a loss of the mutant allele was measured as a loss of probe binding, i.e., a decrease in copy number or ratio of C9orf72 probe binding compared to RPB30 binding.

[0243] ddPCR was run with 2 biologic replicates (independent electroporation events) on the QX100 Droplet Reader (Bio-Rad 186-3002). Each ddPCR reaction consisted of 12.5 uL of 2x SuperMix for Probes (no dUTP) (Bio-Rad 186-3024), primer / probe, 5 ng of DNA, and nuclease-free water up to 25 pL. Droplets were generated with QX 100 Droplet Generator (Bio-Rad 186-3001) and 20 pL of the reaction mixture with 70 pL of oil. The ddPCR reactions were run in a Deep Well Cl 000 Thermal Cycler (Bio-Rad 1851197) with the following cycling protocol: (1) 95°C for 10 min; (2) 94°C for 30 s; (3) 59°C for 1 min; (4) steps 2; and 3 repeat 39 times; (5) 98°C for 10 min; (6) hold at 4°C. The positive droplets for each target were quantified and the amount was normalized to the loading control (RPB30) (Bio-Rad QuantaSoft™ Analysis Pro Software).

[0244] This assay was validated by mixing a cell line with heterozygosity at the C9orf72 locus with an unedited C9orf72 patient line. The assay was shown to be linear at all concentrations from 0% heterozygous cell line (100% unedited line), 25%, 50%, 75% and 100% heterozygous cell line, as shown in Figure 6, validating the ddPCR assay.

[0245] As expected, there was no probe binding when the mutant allele was intact (C9p5 and C9p5-REF). The assay detected 100% excision of the mutant allele in C9p5-ALT and C9p5-KO, as expected as these lines were clonal and lack mutant or both C9 alleles, respectively (Figure 7). These data validated the ddPCR probes for excision of the mutant allele. When measuring editing on the mutant allele, a patient (C9P5) cell line with an intact repeat region on both alleles (C9p5) and a cell line harboring only a single mutant allele with an intact repeat region (C9P5-REF) showed 0% ON-target editing in the assay, as expected, because the ddPCR amplified the intact region. The assay showed 100% ON-target editing (or loss of ddPCR probe binding) for a cell line in which one allele’s repeat region was excised but the other was intact (C9P5-ALT) and a cell line in which both allele’s repeat region was excised (C9P5-KO).

[0246] The mutant allele excision assay was further validated by mixing a cell line with heterozygosity at the C9orf72 locus (loss of the mutant allele; C9p5-ALT) with an unedited C9orf72 patient line (C9p5). The assay was linear at all concentrations from 0%heterozygous cell line (100% unedited line), 25%, 50%, 75% and 100% heterozygous cell line (Figure 8). This confirmed that the assay could detect excisions of the mutant allele from 0% to 100% excision.

[0247] As expected, there was negligible probe binding when the WT allele was intact (C9p5 and C9p5-ALT). The assay detected 100% excision of the WT allele in C9p5-REF and C9p5-KO, as expected as these lines were clonal and lack WT or both C9 alleles, respectively (Figure 9). These data validated the ddPCR probes for excision of the WT allele. In other words, when measuring editing on the wild-type allele, a patient (C9P5) cell line with an intact repeat region on both alleles (C9p5) and a cell line harboring only a single wild-type allele with an excised repeat expansion (C9P5-ALT) showed 0% ON-target editing in our assay, as expected, because the ddPCR amplified the intact region. The assay showed 100% ON-target editing for a cell line in which the WT allele was excised but the other was intact (C9P5-REF) and a cell line in which both allele’s wild-type region was excised (C9P5- KO).

[0248] The WT allele excision assay was validated by mixing a cell line with heterozygosity at the C9orf72 locus (loss of the WT allele; C9p5-REF) with an unedited C9orf72 patient line (C9p5). The assay was linear at all concentrations from 0% heterozygous cell line (100% unedited line), 25%, 50%, 75% and 100% heterozygous cell line (Figure 10). This confirmed that the assay could detect excisions of the WT allele from 0% to 100% excision. The ability of pairs of gRNAs to excise the mutant C9orf72 allele in the engineered system was also measured.

[0249] The ability of pairs of gRNAs to excise the mutant C9orf72 allele in our engineered system were then measured. Each gRNA was designed to target a single nucleotide polymorphism (SNP) in cis with the C9orf72 repeat expansion so that pairs of gRNAs would selectively excise the mutant allele, leaving the normal allele intact. An allele-specific gRNA 5’ to the mutant repeat expansion (labelled 1-7) were paired with an allele-specific gRNA 3’ to the repeat expansion (labelled A-H) (see Figure 11).

[0250] The following allele-specific gRNAs (see Table 8) were tested. SEQ IDs NO. 1414-1423 were identified sequences based on patient sequencing data. Each 5’ guide nucleic acid in combination with each 3’ guide nucleic acid was tested.Table 8: Allele-specific guide nucleic acid tested for efficiency of excision of the mutantC9orf72 allele

[0251] gRNAs were ordered from Synthego. Cas9-gRNA RNP (spCas9 (40pM), sgRNA (100pM)) was delivered by nucleofection (Lonza AAF-1002B, Lonza AAF-1002X, Pulse Code = DS 138) to 150,000 iPSCs suspended in 20 pl of P3 Buffer. The cells were recovered with mTesR plus supplemented with ROCK1 inhibitor (Selleckchem SI 049) at 10 pM and Clone R (Stemcell 05888). Following a 48 hour recovery, DNA from the pool of edited cellsusing Quick Extract (VMR 76081-768) was collected. Our novel excision reporter ddPCR assay (as described above) was used to quantify excision efficiency.Allele-specific excision efficiencies of spCas9 and gRNA pairs in human patient iPSCs harboring a C9orf72 mutant repeat expansion

[0252] Some pairs of gRNAs were more efficient than others (see Fig. 12 and Fig. 13) and that while some individual gRNAs performed better overall, the pairs nonetheless had to be tested experimentally as an inefficient gRNA could decreased the overall efficacy (such as pair Fl). In addition, there was no computational method to predict which gRNA pair was the most efficient, this must also be determined experimentally.

[0253] The top 4 allele-specific gRNA pairs were validated across 3 patient iPSC lines from genetically unrelated donors via electroporation of spCas9 and gRNAs (Figure 14). In contrast to the screening cell line, these patient lines had both C9 alleles intact. Editing efficiencies roughly recapitulated the screening outcomes, with some variation in individual patients.

[0254] The whole genome sequencing data from 83 individuals with repeat expansion of C9orf72 were analyzed (Figure 15). The percentage of heterozygous SNP frequency targeted by the allele-specific gRNAs of the 15 allele-specific guides ranges from 24% to 100% in the sample population. These data indicated what percent of this sample patient population is eligible for the gRNAs targeting the corresponding SNP.EXAMPLE 9: Repeat expansion excision gRNA pairs screeningDesign of a C9orf72 repeat region excision screening platform to test the efficiency of excision of the mutant C9orf72 repeat expansion and the entire repeat region by CRISPR spCas9 gRNA pairs.

[0255] A screen of pairs of gRNAs was performed to determine which gRNA pairs had maximal excision efficiency for excising the C9orf72 repeat region (and the C9orf72 repeat expansion) (Figure 16). This strategy was bi-allelic in that each gRNA was designed to cut on both the mutant and WT allele. This screen was performed on a cell line engineered for screening gRNA pairs. The cell line was derived from a patient harboring a C9orf72 repeat expansion with -200 GGGGCC repeats. The WT allele was selectively excised using spCas9 and the allele-specific gRNAs were: CTCTGTGAGAAGTTTTTATC (SEQ ID NO. 21; orSEQ ID NO. 737) and GACTTAGAAGAAATATTGTG (SEQ ID NO. 22; SEQ ID NO. 738). (See Figure 17). The line was ensured to be heterozygous by PCR and sanger sequencing across the uncut mutant allele and the excised WT allele. The engineered line had a normal karyotype.

[0256] Next, a ddPCR assay to accurately report on excision of the C9orf72 repeat region was developed. A probe with sequence homology to exon 1 A was generated (probe sequence CTGCTGCCCGGTTGCTTCTC (SEQ ID NO. 1424), primers CGCTTGGTGTGTCAGCCGTC (SEQ ID NO. 1425), and GCAGGCACCGCAACCGCAG (SEQ ID NO. 1426)). The probe region was PCR amplified and probe binding, copy number and ratio of probe binding to a control region (RPP30, Bio-Rad Assay ID dHsaCP2500350) with a known copy number of 2 were quantified. In the assay, only one allele was present in the engineered screening line - the mutant allele, therefore a successful excision event resulting in a loss of the mutant allele was measured as a gain of probe binding, i.e., an increase in detected copy number or ratio of C9orf72 probe binding compared to RPP30 binding.

[0257] ddPCR was run with 3 technical replicates of each of 2 biologic replicates (independent electroporation events) on the QX100 Droplet Reader (Bio-Rad 186-3002). Each ddPCR reaction consisted of 12.5 uL of 2x SuperMix for Probes (no dUTP) (Bio-Rad 186-3024), primer / probe, 5 ng of DNA, and nuclease-free water up to 25 pL. Droplets were generated with QX 100 Droplet Generator (Bio-Rad 186-3001) and 20 pL of the reaction mixture with 70 pL of oil. The ddPCR reactions were run in a Deep Well C1000 Thermal Cycler (Bio-Rad 1851197) with the following cycling protocol: (1) 95°C for 10 min; (2) 94°C for 30 s; (3) 62.5°C for 1 min; (4) steps 2; and 3 repeat 39 times; (5) 98°C for 10 min; (6) hold at 4°C. Positive droplets for each target were quantified and the amount was normalized to our loading control (RPP30) (Bio-Rad QuantaSoft™ Analysis Pro Software).

[0258] This assay was validated by mixing a cell line with the C9orf72 repeat region removed (WT-REx) with a C9orf72 knock-out patient line (C9p5-KO). The assay was shown to be linear at all concentrations from 0% heterozygous cell line (100% unedited line), 25%, 50%, 75% and 100% heterozygous cell line.

[0259] This assay was validated by mixing a cell line with heterozygosity at the C9orf72 repeat region (WT-REX, which has on GGGGCC repeat region removed and the other intact) with C9orf72 patient line in which both allele (and their repeat regions) have been knocked-out (C9p5-KO). The assay was linear at all concentrations from 0 (no editing or 100% KO cell line), 25%, 50%, 75% to 100% edited cell line (Figures 18 and 19). In the assay, only one allele was present in the engineered screening line - the mutant allele, therefore a successful excision event that results in a loss of the C9orf72 repeat region was measured as a gain of probe binding, i.e., an increase in detected copy number or ratio of C9orf72 probe binding compared to RPP30 binding.

[0260] This ddPCR assay was validated across several engineered clonal lines and it was found the assay behaved as predicted (Figure 20). A WT (WTC) or patient (C9P5) cell line with an intact repeat region on both alleles shows minimal signal in the assay, as expected, because a normal repeat length of 2-3 repeats was hard to amplify. The assay detected a copy number of 1 for a cell line in which one allele’s repeat region was excised but the other was intact (C9REx). A cell line in which both repeat regions were excised (WTREx) yielded a copy number of 2. A cell line harboring only a single mutant allele with an intact repeat region (C9Ref) showed no signal because the primer binding sites were absent on the WT allele and the mutant repeat expansion fails amplification. A KO cell line (C9KO) showed no signal, as expected and validated the specificity of our assay.

[0261] The repeat region (REx) excision assay was further validated by mixing a cell line with both repeat regions excised (WT-REx) and a C9orf72 patient line with both an expanded (-250 repeats) and normal (2 repeats) on each allele. The assay was linear at all concentrations from 0% editing (100% unedited C9p5 patient line), 25%, 50%, 75% and 100% edited cell line (100% WTC-REx) (Figure 21). This confirmed that the assay can detect excisions of the mutant allele from 0% to 100% excision. The ability of pairs of gRNAs to excise the C9orf72 repeat region in the engineered system was measured. A gRNA 5’ was paired to the mutant repeat expansion (labelled 1-16) with an allele-specific gRNA 3’ to the repeat expansion (labelled A-D).

[0262] Figure 22 illustrates a zoomed in schematic of the placement of REx gRNAs for excision of the repeat region on either side of the GGGGCC repeat region and repeat expansion. gRNAs are labelled 1-16 on the 5’ side of the repeat region and gRNAs are labelled A-D on the 3’ side of the repeat region. Placement of primers and probe of the repeat region excision detection ddPCR assay are shown. Primers flank the repeat region so that excision of repeat region brings the primers closer together, leading to gain-of-function signal on the ddPCR assay.

[0263] The gRNAs were localized in the intron between exon 1 A and exon IB and did not cut in the coding exons (Figure 23).

[0264] The assay was validated across several engineered clonal lines and found our assay behaved as predicted. A WT or patient (C9P5) cell line with an intact repeat region on both alleles showed no signal in our assay, as expected, because the primers were too far apart, leading to amplification failure. The assay detected a copy number of 1 for a cell line in which one allele’s repeat region was excised but the other was intact (C9REx). A cell line in which both repeat regions were excised (WTREx) yielded a copy number of 2. A cell line harboring only a single mutant allele with an intact repeat region (C9Ref) and a KO cell line (C9KO) showed no signal, as expected. The ability of pairs of gRNAs to excise the C9orf72 repeat region in our engineered system was then measured. gRNA 5’ to the mutant repeat expansion (labelled 1-16) were paired with gRNA 3’ to the repeat expansion (labelled A-D).

[0265] The following gRNA pairs as shown in Table 9 were tested. Each 5’ gRNA in combination with each 3’ gRNA was tested.Table 9 Repeat expansion guide nucleic acid tested by repeat region excision screening platform

[0266] gRNAs were ordered from Synthego. Cas9-gRNA RNP (spCas9 (40pM), sgRNA (100pM)) was delivered by nucleofection (Lonza AAF-1002B, Lonza AAF-1002X, Pulse Code = DS 138) to 150,000 iPSCs suspended in 20 pl of P3 Buffer. The cells were recovered with mTesR plus supplemented with ROCK1 inhibitor (Selleckchem SI 049) at 10 pM and Clone R (Stemcell 05888). Following a 48 hour recovery, DNA from the pool of edited cells using Quick Extract (VMR 76081-768) was collected. The novel excision reporter ddPCR assay (as described above) was used to quantify excision efficiency.C9orf72 repeat region excision efficiencies of spCas9 and gRNA pairs in human patient iPSCs harboring a C9orf72 mutant repeat expansion

[0267] Some pairs of gRNAs were more efficient than others (see Figure 24, Figure 25) and that while some individual gRNAs performed better overall, the pairs nonetheless had to be tested experimentally as an inefficient gRNA could decreased the overall efficacy (such as pair CIO). In addition, there was no computational method to predict which gRNA pair was the most efficient, this must also be determined experimentally.

[0268] The on-target editing efficiency (excision of the C9orf72 repeat region) was determined by ddPCR after electroporation of spCas9 and gRNA into engineered patientiPSC screening line (Figure 24). Each gRNA pair was tested by electroporation and performed in biological duplicate (independent electroporations).

[0269] Figure 25 shows a heat map of on-target editing efficiency (excision of the C9orf72 repeat region) as determined by ddPCR after electroporation of spCas9 and gRNA into engineered patient iPSC screening line. Average efficiency across two electroporations of spCas9 and dual gRNAs is depicted within the box corresponding to each gRNA pair. Darker color indicated higher efficiency.

[0270] Top 4 repeat region excision gRNA pairs were validated across 3 patient iPSC lines from genetically unrelated donors via electroporation of spCas9 and gRNAs (Figure 26). In contrast to the screening cell line, these patient lines had both C9 alleles intact. Editing efficiencies roughly recapitulated the screening outcomes, with some variation in individual patients.EXAMPLE 10: in vivo validation of allele-specific excision and repeat expansion excision approaches in a mouse model of C9-BAC

[0271] A dual AAV expression system was used to deliver spCas9 in one vector and dual gRNAs in a second vector. 2 ul of total AAV (50 / 50 mix of spCas9-AAV and dual gRNA- AAV) were injected into 10 week old C9-BAC transgenic mice (J AX #029099). Mice (n = 3 to 4 mice per group) received PBS (control), spCas9-AAV + REX-gRNA-AAV (targeting bi- allelic site for excision of the intronic repeat region) or spCas9-AAV + ALT-gRNA-AAV (targeting SNPs to selectively excise the mutant allele). Successful editing, i.e., removal of the human C9 repeat region, was seen in the mice (Figure 27). Up to about 2.5% of human C9orf72 transgene repeat expansion was edited. Additional optimization of the delivery vehicle is likely to increase editing efficiency.

[0272] The gRNAs used in these experiments were alt gRNAs: 5’ TCTGTGAGAAGTTCTTATC (SEQ ID NO:29) and 3’ GACTTAAAAGAAATATTGTG (SEQ ID NQ:30), and rex gRNAs: 5’ AACTCAGGAGTCGCGCGCTA (SEQ ID NO:1) and 3’ GGCCCGCCCCGACCACGCCC (SEQ ID NO:2; SEQ ID NO:732) (Tables 7 and 8)

[0273] All headings and section designations are used for clarity and reference purposes only and are not to be considered limiting in any way. For example, those of skill in the art will appreciate the usefulness of combining various embodiments from different headings and sections as appropriate according to the spirit and scope of the technology described herein.

[0274] All references cited herein are hereby incorporated by reference herein in their entireties and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[0275] Many modifications and variations of this application can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments and examples described herein are offered by way of example only, and the application is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which the claims are entitled.

[0276] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

[0277] All publications and patents cited in this specification are herein incorporated by reference for all purposes as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmedREFERENCES1. Cantarero-Prieto, D., Leon, P. L., Blazquez-Fernandez, C., Juan, P. S. & Cobo, C. S. The economic cost of dementia: A systematic review. Dementia 19, 2637-2657 (2020).2. Deb, A., Thornton, J. D., Sambamoorthi, U. & Innes, K. Direct and indirect cost of managing alzheimer’s disease and related dementias in the United States. Expert Rev. Pharmacoecon. Outcomes Res. 17, 189-202 (2017).3. Deb, A., Sambamoorthi, U., Thornton, J. D., Schreurs, B. & Innes, K. Direct medical expenditures associated with Alzheimer’s and related dementias (ADRD) in a nationally representative sample of older adults - an excess cost approach. Aging Ment. Health 22, 619- 624 (2018).4. Jia, J. et al. The cost of Alzheimer’s disease in China and re-estimation of costs worldwide. Alzheimers Dement 14, 483-491 (2018).5. Gladman, M. & Zinman, L. The economic impact of amyotrophic lateral sclerosis: a systematic review. Expert Rev. Pharmacoecon. Outcomes Res. 15, 439-450 (2015).6. GBD 2015 Neurological Disorders Collaborator Group. Global, regional, and national burden of neurological disorders during 1990-2015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet Neurol. 16, 877-897 (2017).7. DeJesus-Hernandez, M. et al. Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron 72, 245-256 (2011).8. Renton, A. E. et al. A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron 72, 257-268 (2011).9. Majounie, E. et al. Frequency of the C9orf72 hexanucleotide repeat expansion in patients with amyotrophic lateral sclerosis and frontotemporal dementia: a cross-sectional study. Lancet Neurol. 11, 323-330 (2012).10. Jiang, J. et al. Gain of Toxicity from ALS / FTD-Linked Repeat Expansions in C9ORF72 Is Alleviated by Antisense Oligonucleotides Targeting GGGGCC-Containing RNAs. Neuron 90, 535-550 (2016).11. Sareen, D. et al. Targeting RNA foci in iPSC-derived motor neurons from ALS patients with a C9ORF72 repeat expansion. Sci. Transl. Med. 5, 208ral49 (2013).12. Donnelly, C. J. et al. RNA toxicity from the ALS / FTD C9ORF72 expansion is mitigated by antisense intervention. Neuron 80, 415-428 (2013).13. Tran, H. et al. Suppression of mutant C9orf72 expression by a potent mixed backbone antisense oligonucleotide. Nat. Med. (2021) doi: 10.1038 / s41591-021-01557-6.14. Liu, Y. et al. Variant-selective stereopure oligonucleotides protect against pathologies associated with C9orf72-repeat expansion in preclinical models. Nat. Commun. 12, 847 (2021).15. A Study to Assess the Safety, Tolerability, and Pharmacokinetics of BIIB078 in Adults With C9ORF72-Associated Amyotrophic Lateral Sclerosis - Full Text View - ClinicalTrials.gov. https: / / clinicaltrials.gov / ct2 / show / NCT03626012.16. Knott, G. J. & Doudna, J. A. CRISPR-Cas guides the future of genetic engineering. Science 361, 866-869 (2018).17. Wang, S. et al. Nuclear export and translation of circular repeat-containing intronic RNA in C9ORF72-ALS / FTD. Nat. Commun. 12, 4908 (2021).18. Lagier-Tourenne, C. et al. Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration. Proc Natl Acad Sci USA 110, E4530-9 (2013).19. Celona, B. et al. Suppression of C9orf72 RNA repeat-induced neurotoxicity by the ALS-associated RNA-binding protein Zfpl06. eLife 6, (2017).20. Zu, T. et al. RAN proteins and RNA foci from antisense transcripts in C9ORF72 ALS and frontotemporal dementia. Proc Natl Acad Sci USA 110, E4968-77 (2013).21. Ash, P. E. A. et al. Unconventional translation of C9ORF72 GGGGCC expansion generates insoluble polypeptides specific to c9FTD / ALS. Neuron 77, 639-646 (2013).22. Gendron, T. F. et al. Cerebellar c9RAN proteins associate with clinical and neuropathological characteristics of C9ORF72 repeat expansion carriers. Acta Neuropathol. 130, 559-573 (2015).23. Mori, K. et al. The C9orf72 GGGGCC repeat is translated into aggregating dipeptide- repeat proteins in FTLD / ALS. Science 339, 1335-1338 (2013).24. Mori, K. et al. Bidirectional transcripts of the expanded C9orf72 hexanucleotide repeat are translated into aggregating dipeptide repeat proteins. Acta Neuropathol. 126, 881— 893 (2013).25. Wen, X. et al. Antisense proline-arginine RAN dipeptides linked to C9ORF72- ALS / FTD form toxic nuclear aggregates that initiate in vitro and in vivo neuronal death. Neuron 84, 1213-1225 (2014).26. Mackenzie, I. R. et al. Dipeptide repeat protein pathology in C9ORF72 mutation cases: clinico-pathological correlations. Acta Neuropathol. 126, 859-879 (2013).27. Mann, D. M. A. et al. Dipeptide repeat proteins are present in the p62 positive inclusions in patients with frontotemporal lobar degeneration and motor neurone disease associated with expansions in C9ORF72. Acta Neuropathol. Commun. 1, 68 (2013).28. Ryan, S., Rollinson, S., Hobbs, E. & Pickering-Brown, S. C9orf72 dipeptides disrupt the nucleocytoplasmic transport machinery and cause TDP-43 mislocalisation to the cytoplasm. Sci. Rep. 12, 4799 (2022).29. Nanaura, H. et al. C9orf72-derived arginine-rich poly-dipeptides impede phase modifiers. Nat. Commun. 12, 5301 (2021).30. Shi, Y. et al. Haploinsufficiency leads to neurodegeneration in C9ORF72 ALS / FTD human induced motor neurons. Nat. Med. 24, 313-325 (2018).31. Ciura, S. et al. Loss of function of C9orf72 causes motor deficits in a zebrafish model of amyotrophic lateral sclerosis. Ann. Neurol. 74, 180-187 (2013).32. Balendra, R. & Isaacs, A. M. C9orf72-mediated ALS and FTD: multiple pathways to disease. Nat. Rev. Neurol. 14, 544-558 (2018).33. Shao, Q. et al. C9orf72 deficiency promotes motor deficits of a C9ALS / FTD mouse model in a dose-dependent manner. Acta Neuropathol. Commun. 7, 32 (2019).34. gnomAD. https: / / gnomad.broadinstitute.org / gene / ENSG00000147894.35. Harms, M. B. et al. Lack of C9ORF72 coding mutations supports a gain of function for repeat expansions in amyotrophic lateral sclerosis. Neurobiol. Aging 34, 2234.el3-9 (2013).36. Burberry, A. et al. Loss-of-function mutations in the C9ORF72 mouse ortholog cause fatal autoimmune disease. Sci. Transl. Med. 8, 347ra93 (2016).37. O’Rourke, J. G. et al. C9orf72 is required for proper macrophage and microglial function in mice. Science 351, 1324-1329 (2016).38. Zhu, Q. et al. Reduced C9ORF72 function exacerbates gain of toxicity from ALS / FTD-causing repeat expansion in C9orf72. Nat. Neurosci. 23, 615-624 (2020).39. Sudria-Lopez, E. et al. Full ablation of C9orf72 in mice causes immune system- related pathology and neoplastic events but no motor neuron defects. Acta Neuropathol. 132, 145-147 (2016).40. Abo-Rady, M. et al. Knocking out C9ORF72 Exacerbates Axonal Trafficking Defects Associated with Hexanucleotide Repeat Expansion and Reduces Levels of Heat Shock Proteins. Stem Cell Reports 14, 390-405 (2020).41. Pribadi, M. et al. CRISPR-Cas9 targeted deletion of the C9orf72 repeat expansion mutation corrects cellular phenotypes in patient-derived iPS cells. BioRxiv (2016) doiilO.l 101 / 051193.42. Selvaraj, B. T. et al. C9ORF72 repeat expansion causes vulnerability of motor neurons to Ca2+-permeable AMPA receptor-mediated exci totoxi city. Nat. Commun. 9, 347 (2018).43. Ababneh, N. A. et al. Correction of amyotrophic lateral sclerosis related phenotypes in induced pluripotent stem cell-derived motor neurons carrying a hexanucleotide expansion mutation in C9orf72 by CRISPR / Cas9 genome editing using homology-directed repair. Hum. Mol. Genet. 29, 2200-2217 (2020).44. CRISPOR. http: / / crispor.tefor.net / .45. Ferreira da Silva, J., Meyenberg, M. & Loizou, J. I. Tissue specificity of DNA repair: the CRISPR compass. Trends Genet. 37, 958-962 (2021).46. Lee, S. H., Park, Y.-H., Jin, Y. B., Kim, S.-U. & Hur, J. K. CRISPR Diagnosis and Therapeutics with Single Base Pair Precision. Trends Mol. Med. (2019) doi: 10.1016 / j.molmed.2019.09.008.47. Watry, H. L. et al. Rapid, precise quantification of large DNA excisions and inversions by ddPCR. BioRxiv (2020) doi: 10.1101 / 2020.04.13.039297.48. Shin, J. W. et al. Permanent inactivation of Huntington’s disease mutation by personalized allele-specific CRISPR / Cas9. Hum. Mol. Genet. 25, 4566-4576 (2016).49. Feliciano, C. M. et al. Allele-Specific Gene Editing Rescues Pathology in a Human Model of Charcot-Marie-Tooth Disease Type 2E. Front. Cell Dev. Biol. 9, 723023 (2021).50. Monteys, A. M., Ebanks, S. A., Keiser, M. S. & Davidson, B. L. Crispr / cas9 editing of the mutant huntingtin allele in vitro and in vivo. Mol. Ther. 25, 12-23 (2017).51. Gybrgy, B. et al. Allele-specific gene editing prevents deafness in a model of dominant progressive hearing loss. Nat. Med. 25, 1123-1130 (2019).52. Maule, G. et al. Allele specific repair of splicing mutations in cystic fibrosis through AsCas 12a genome editing. Nat. Commun. 10, 3556 (2019).53. Patrizi, C. et al. Allele-specific editing ameliorates dominant retinitis pigmentosa in a transgenic mouse model. Am. J. Hum. Genet. 108, 295-308 (2021).54. CS52iALS-C9nxx - Cedars-Sinai Biomanufacturing Center. https: / / biomanufacturing.cedars-sinai.org / product / cs52ials-c9nxx / .55. CS29iALS-C9nxx - Cedars-Sinai Biomanufacturing Center. https: / / biomanufacturing.cedars-sinai.org / product / cs29ials-c9nxx / .56. Bram, E. et al. Comprehensive genotyping of the C9orf72 hexanucleotide repeat region in 2095 ALS samples from the NINDS collection using a two-mode, long-read PCR assay. Amyotroph. Lateral Scler. Frontotemporal Degener. 20, 107-114 (2019).57. Buchman, V. L. et al. Simultaneous and independent detection of C9ORF72 alleles with low and high number of GGGGCC repeats using an optimised protocol of Southern blot hybridisation. Mol. Neurodegener. 8, 12 (2013).58. Ebbert, M. T. W. et al. Long-read sequencing across the C9orf72 “GGGGCC” repeat expansion: implications for clinical use and genetic discovery efforts in human disease. Mol. Neurodegener. 13, 46 (2018).59. Giesselmann, P. et al. Analysis of short tandem repeat expansions and their methylation state with nanopore sequencing. Nat. Biotechnol. 37, 1478-1481 (2019).60. DeJesus-Hernandez, M. et al. Long-read targeted sequencing uncovers clinicopathological associations for C9orf72-linked diseases. Brain 144, 1082-1088 (2021).61. Gillmore, J. D. et al. CRISPR-Cas9 In Vivo Gene Editing for Transthyretin Amyloidosis. N. Engl. J. Med. 385, 493-502 (2021).62. Frangoul, H. et al. CRISPR-Cas9 Gene Editing for Sickle Cell Disease and 0- Thalassemia. N. Engl. J. Med. 384, 252-260 (2021).63. Stadtmauer, E. A. et al. CRISPR-engineered T cells in patients with refractory cancer. Science 367, (2020).64. Haeussler, M. et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol. 17, 148 (2016).65. Keough, K. C. et al. AlleleAnalyzer: a tool for personalized and allele-specific sgRNA design. Genome Biol. 20, 167 (2019).66. Sudmant, P. H. et al. An integrated map of structural variation in 2,504 human genomes. Nature 526, 75-81 (2015).67. Ozcan, K. A., Ghaffari, L. T. & Haeusler, A. R. The effects of molecular crowding and CpG hypermethylation on DNA G-quadruplexes formed by the C9orf72 nucleotide repeat expansion. Sci. Rep. 11, 23213 (2021).68. Cohen-Hadad, Y. et al. Marked Differences in C9orf72 Methylation Status and Isoform Expression between C9 / ALS Human Embryonic and Induced Pluripotent Stem Cells. Stem Cell Reports 7, 927-940 (2016).69. Malik, I., Kelley, C. P., Wang, E. T. & Todd, P. K. Molecular mechanisms underlying nucleotide repeat expansion disorders. Nat. Rev. Mol. Cell Biol. 22, 589-607 (2021).70. van Blitterswijk, M. et al. Novel clinical associations with specific C9ORF72 transcripts in patients with repeat expansions in C9ORF72. Acta Neuropathol. 130, 863-876 (2015).71. Rizzu, P. et al. C9orf72 is differentially expressed in the central nervous system and myeloid cells and consistently reduced in C9orf72, MAPT and GRN mutation carriers. Acta Neuropathol. Commun. 4, 37 (2016).72. Vatsavayai, S. C., Nana, A. L., Yokoyama, J. S. & Seeley, W. W. C9orf72-FTD / ALS pathogenesis: evidence from human neuropathological studies. Acta Neuropathol. 137, 1-26 (2019).73. Shen, C.-C. et al. Synthetic switch to minimize CRISPR off-target effects by selfrestricting Cas9 transcription and translation. Nucleic Acids Res. 47, el3 (2019).74. Kelkar, A. et al. Doxycycline-Dependent Self-Inactivation of CRISPR-Cas9 to Temporally Regulate On- and Off-Target Editing. Mol. Ther. 28, 29-41 (2020).75. Hanlon, K. S. et al. High levels of AAV vector integration into CRISPR-induced DNA breaks. Nat. Commun. 10, 4439 (2019).76. Nelson, C. E. et al. Long-term evaluation of AAV-CRISPR genome editing for Duchenne muscular dystrophy. Nat. Med. 25, 427-432 (2019).77. Miyaoka, Y. et al. Isolation of single-base genome-edited human iPS cells without antibiotic selection. Nat. Methods 11, 291-293 (2014).78. Fernandopulle, M. S. et al. Transcription Factor-Mediated Differentiation of Human iPSCs into Neurons. Curr. Protoc. Cell Biol. 79, e51 (2018).79. No-Amp targeted sequencing - PacBio. https: / / www.pacb.com / products-and- services / applications / targeted-sequencing / no-amp-targeted-sequencing / .80. iNeuron RNA-Seq | Kampmann Lab. https: / / kampmannlab.ucsf.edu / ineuron-rna-seq.81. Nguyen, U., Squaglia, N., Boge, A. & Fung, P. A. The Simple WesternTM: a gel-free, blot-free, hands-free Western blotting reinvention. Nat. Methods 8, v-vi (2011).82. Simple Western Technical Library :: ProteinSimple. https: / / www.proteinsimple.com / technical_library. html?product=simplewestern&doctype=pro duct insert&def li st=li st.83. Liu, Y. et al. C9orf72 BAC Mouse Model with Motor Deficits and Neurodegenerative Features of ALS / FTD. Neuron 90, 521-534 (2016).84. Nguyen, L. et al. Survival and Motor Phenotypes in FVB C9-500 ALS / FTD BAC Transgenic Mice Reproduced by Multiple Labs. Neuron 108, 784-796. e3 (2020).85. Sachdev A, Gill K, Sckaff M, Birk AM, Aladesuyi Arogundade O, Brown KA, Chouhan RS, Issagholian-Lewin PO, Patel E, Watry HL, Bernardi MT, Keough KC, Tsai Y- C, Smith AST, Conklin BR, Clelland CD. Reversal of C9orf72 mutation-induced transcriptional dysregulation and pathology in cultured human neurons by allele-specific excision. Proc Natl Acad Sci USA. 2024 Apr 23;121(17):e2307814121. PMCID:PMC 1104710486. Salomonsson SE, Maltos AM, Gill K, Aladesuyi Arogundade O, Brown KA, Sachdev A, Sckaff M, Lam KJK, Fisher IJ, Chouhan RS, Van Laar VS, Marley CB, McLaughlin I, Bankiewicz KS, Tsai YC, Conklin BR, Clelland CD. Validated assays for the quantification of C9orf72 human pathology. Sci Rep. 2024 Jan 8; 14(1):828. PMCID: PMC1077439087.87. Meijboom KE, Abdallah A, Fordham NP, Nagase H, Rodriguez T, Kraus C, Gendron TF, Krishnan G, Esanov R, Andrade NS, Rybin MJ, Ramie M, Stephens ZD, Edraki A, Blackwood MT, Kahriman A, Henninger N, Kocher J-PA, Benatar M, Brodsky MH, Petrucelli L, Gao F-B, Sontheimer EJ, Brown RH, Zeier Z, Mueller C. CRISPR / Cas9- Mediated Excision of ALS / FTD-Causing Hexanucleotide Repeat Expansion in C9ORF72 rescues major disease mechanisms in vivo and in vitro. BioRxiv. 2022 May 1788. Piao X, Meng D, Zhang X, Song Q, Lv H, Jia Y. Dual-gRNA approach with limited off-target effect corrects C9ORF72 repeat expansion in vivo. Sci Rep. 2022 Apr5; 12(1):5672. PMCID: PMC8983752Attorney Docket No.: 061818-5531-WO Additional Sequences - InformalTable 1 all patients guide nucleic acids (gNAs)Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal92Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal93Attorney Docket No.: 061818-5531-WO Additional Sequences - InformalAttorney Docket No.: 061818-5531-WO Additional Sequences - InformalAttorney Docket No.: 061818-5531-WO Additional Sequences - Informal96Attorney Docket No.: 061818-5531-WO Additional Sequences - InformalAttorney Docket No.: 061818-5531-WO Additional Sequences - InformalAttorney Docket No.: 061818-5531-WO Additional Sequences - Informal99Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal100Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal101Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal102Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal103Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal104Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal105Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal106Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal107Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal108Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal109Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal110Attorney Docket No.: 061818-5531-WO Additional Sequences - InformalAttorney Docket No.: 061818-5531-WO Additional Sequences - Informal112Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal113Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal114Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal115Attorney Docket No.: 061818-5531-WO Additional Sequences - Informal116Attorney Docket No.: 061818-5531-WO Additional Sequences - InformalTable 3 guide nucleic acids (gNAs) binding sequence117Attorney Docket No.: 061818-5531-WO Additional Sequences - InformalTable 4: DNA sequences encoding gRNAs for in vivo validation of allele-specific excision118Attorney Docket No.: 061818-5531-WO Additional Sequences - InformalTable 5 Probe and primer sequence homology to exon 2Attorney Docket No.: 061818-5531-WO Additional Sequences - InformalTable 6 Allele-specific guide nucleic acid identified based on patient sequencing data

Claims

WHAT IS CLAIMED IS:

1. A guide nucleic acid sequence complementary to a target site in cis with the mutation for correcting a C9orf72 GC repeat expansion mutation on a segment of DNA, wherein the guide nucleic acid sequence is at least 90% identical to SEQ ID NOs: 1-2, 6, 13, 21-22, 29-30, 55-712 730-732, 734-735, 737-740, 749-1410, 1414-1423, or 1427-1458.

2. The guide nucleic acid sequence complementary to a target site in cis with the mutation for correcting a C9orf72 GC repeat expansion mutation of claim 1, wherein the target site is located in a region between 25 kbp upstream and 28 kbp downstream of a transcription start site of the C9orf72 gene.

3. The guide nucleic acid sequence complementary to a target site in cis with the mutation for correcting a C9orf72 GC repeat expansion mutation of claims 1 or 2, wherein the guide nucleic acid is administered in a delivery vehicle selected from viral vectors, lipid nanoparticles (LNPs), a modified RNA binding protein, and synthetic polymers.

4. The guide nucleic acid sequence complementary to a target site in cis with the mutation for correcting a C9orf72 GC repeat expansion mutation of claim 4, wherein the delivery vehicle is recombinant adeno-associated virus (AAV) vector.

5. A composition for correcting a C9orf72 GC repeat expansion mutation on a segment of DNA comprising a guide nucleic acid sequence complementary to a target site in cis with the mutation, wherein the guide nucleic acid sequence is at least 90% identical to SEQ ID NOs: 1-2, 6, 13, 21-22, 29-30, 55-712 730-732, 734-735, 737-740, 749-1410, 1414-1423, or 1427-1458; and a pharmaceutically acceptable carrier.

6. The composition for correcting a C9orf72 GC repeat expansion mutation of claim 5, wherein the target site is located in a region between 25 kbp upstream and 28 kbp downstream of a transcription start site of the C9orf72 gene.

7. The composition for correcting a C9orf72 GC repeat expansion mutation of claims 4 or 5, wherein the composition is administered in a delivery vehicleselected from viral vectors, lipid nanoparticles (LNPs), a modified RNA binding protein, and synthetic polymers.

8. The composition for correcting a C9orf72 GC repeat expansion mutation of claim 7, wherein the delivery vehicle is recombinant adeno-associated virus (AAV) vector.

9. A nucleic acid encoding CRISPR-Cas ribonucleoprotein (RNP) complex for correcting a C9orf72 GC repeat expansion mutation on a segment of DNA comprising a sequence of a guide nucleic acid having a sequence is at least 90% identical to SEQ ID NOs: 1-2, 6, 13, 21-22, 29-30, 55-712 730-732, 734-735, 737-740, 749-1410, 1414-1423, or 1427-1458, wherein the nucleic acid is delivered to a target site through a delivery vehicle.

10. The nucleic acid of claim 9, wherein the delivery vehicle is selected from selected from viral vectors, lipid nonoparticles (LNPs), a modified RNA binding protein, and synthetic polymers.

11. A method of correcting a C9orf72 GC repeat expansion mutation on a segment of DNA in a host cell comprising administering to the host cell an endonuclease and two or more guide nucleic acids, wherein a first guide nucleic acid targets and hybridizes to a sequence upstream of the exon 1 A at the C9orf72 locus, and a second guide nucleic acid targets and hybridizes to a sequence downstream of the exon IB at the C9orf72 locus.

12. The method of claim 11, wherein each guide nucleic acid is administered in a delivery vehicle independently selected from viral vectors, lipid nanoparticles (LNPs), a modified RNA binding protein, and synthetic polymers.

13. The method of claim 12, wherein at least one of the delivery vehicles is recombinant adeno-associated virus (AAV) vector.

14. The method of claim 11, wherein a first guide nucleic acid is targeting a sequence upstream of the GC repeat expansion region, wherein a second guide nucleic acid is targeting a sequence downstream of the GC repeat expansion region, the first guide nucleic acid sequence comprising a sequence is at least 90% identical to SEQ IDNOs: 6, 734 or 1427-1454, and the second guide nucleic acid sequence comprising a sequence is at least 90% identical to SEQ ID NOs: 1445-1458, 13 or 735.

15. The method of claim 14, further comprising excising a region that contains a GC repeats expansion in the mutant allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease.

16. The method of claim 15, further comprising excising a region in the normal allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease.

17. The method of claim 16, further comprising changing expression level of the C9orf72 gene in the host cell.

18. The method of claim 11, wherein a first guide nucleic acid is targeting a sequence upstream of the exon 1 A at the C9orf72 locus, wherein a second guide nucleic acid is targeting a sequence downstream of the exon IB at the C9orf72 locus, wherein the first guide nucleic acid sequence comprising a sequence is at least 90% identical to SEQ ID NOs: 21, 737, 1414 or 1415, wherein the second guide nucleic acid sequence comprising a sequence is at least 90% identical to SEQ ID NOs: 22, 738, or 1416- 1423, and further comprising excising a region that contains exon 1 A, exon IB and at least a portion of GC repeats expansion in the mutant allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease.

19. The method of claim 18, wherein a first guide nucleic acid comprising a sequence at least 90% identical to SEQ ID NOs. 1, 6, or 734 targets a sequence upstream of a transcriptional start site at the C9orf72 locus, and a second guide nucleic acid comprising a sequence at least 90% identical to SEQ ID NOs: 2, 13, 732, 753, or 1427-1454 targets a sequence downstream of the transcriptional start site at the C9orf72 locus.

20. The method of claim 19, further comprising excising a region that contains the transcriptional start site in the mutant allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and at a second target nucleic acid sequence with the endonuclease.

21. The method of claim 20, further comprising excising a region that contains the transcriptional start site in the normal allele by cleaving one or both strands of DNA at a first target nucleic acid sequence and a second target nucleic acid sequence with the endonuclease.

22. The method of claim 21, further comprising changing expression level of the C9orf72 gene in the host cell.

23. A population of engineered cells modified by the method of any of the claims 11-22, wherein a C9orf72 GC repeat expansion mutation in the cells have been corrected.

24. A method of treating C9orf72 GC repeat expansion mutation associated diseases in a subject, comprising administering a population of engineered cells, wherein the C9orf72 GC repeat expansion mutation have been corrected by the method of any of the claims 11-22.

23. The method of claim 10, wherein the C9orf72 GC repeat expansion mutation associated disease is a neurodegenerative disease, frontotemporal disorder (FTD), amyotrophic lateral sclerosis (ALS), or ALS with FTD.

Images