Compositions for modulating expression of sodium voltage-gated channel alpha subunit 2 and uses thereof

Abstract

Provided herein are compositions and methods for increasing expression of the sodium voltage-gated channel alpha subunit 2 (SCN2A) gene in SCN2A-expressing cells. Further provided herein are uses of such compositions to treat neurological disorders associated with SCN2A expression deficiency.

Description

COMPOSITIONS FOR MODULATING EXPRESSION OF SODIUM VOLTAGE-GATED CHANNEL ALPHA SUBUNIT 2 AND USES THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 504,570, filed May 26, 2023, which is incorporated by reference herein in its entirety for all purposes. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (REGT_004_01WO_SeqList_ST26.xml; Size: 433,393 bytes; and Date of Creation: May 14, 2024) are herein incorporated by reference in their entirety. TECHNICAL FIELD

[0003] The disclosure relates to gene expression modulation and methods of using the same. BACKGROUND

[0004] Heterozygous loss-of-function mutations in the sodium voltage-gated channel alpha subunit 2 (SCN2A) gene, which encodes the sodium channel Nav1.2, lead to autism spectrum disorder, intellectual disability, and childhood seizures. The SCN2A gene is highly expressed in the central nervous system (CNS), where it is essential to the proper functioning of neurons. Mouse models show that mutations compromising the proper functioning of the encoded Nav1.2 sodium channel disrupt the functionality of CNS neurons in the cerebral cortex and cerebellum, affecting the proper functioning of these brain regions. Moreover, neurons lacking Nav1.2 are hyper-excitable, and mouse models of SCN2A-haploinsufficiency have increased sensitivity to pro- convulsive drugs. Restoring SCN2A expression can reverse these deficits, demonstrating that adeno-associated virus (AAV) -based gene therapies are a potential treatment for SCN2A-haploinsufficiency. However, several obstacles must be overcome for this approach to be successfully implemented. SUMMARY

[0005] Provided herein is a vector comprising: (a) a transgene polynucleotide sequence encoding a sequence-specific DNA-targeting module (DTM) fused to a transactivator (TA); (b) a regulatory element polynucleotide sequence that specifically restricts expression of the transgene to sodium voltage-gated channel alpha subunit 2 (SCN2A)-expressing cells in the brain; and (c) a promoter polynucleotide sequence. In some embodiments, the SCN2A-expressing cells are excitatory pyramidal neurons. In some embodiments, the SCN2A-expressing cells are cerebellar granule cells.

[0006] In some embodiments of the vectors provided herein, the DTM comprises a nuclease-deficient CRISPR-associated protein. In some embodiments, the vector further comprises a polynucleotide sequence encoding a guide RNA (gRNA). In some embodiments, the gRNA targets the SCN2A gene. In some embodiments, the gRNA specifically hybridizes to a regulatory region of the SCN2A gene. In some embodiments, the regulatory region of the SCN2A gene is a promoter or an enhancer. In some embodiments, the gRNA specifically hybridizes to an enhancer region of the SCN2A gene comprising the nucleotide sequence set forth in SEQ ID NO: 11, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14. In some embodiments, the gRNA specifically hybridizes to a promoter region of the SCN2A gene comprising the nucleotide sequence set forth in SEQ ID NO: 15 or 16. In some embodiments, the gRNA is operatively linked to a promoter recognized by RNA polymerase III. In some embodiments, the gRNA is operatively linked to a human U6 polymerase III promoter. In some embodiments, the human U6 polymerase III promoter comprises the sequence of SEQ ID NO: 366. In some embodiments, the vector further comprises a polynucleotide sequence encoding a second gRNA targeting the SCN2A gene. In some embodiments, the gRNA comprises a spacer encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in any one of SEQ ID NOs: 17-313. In some embodiments, the gRNA comprises a spacer encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in any one of SEQ ID NOs: 374-402. In some embodiments, the gRNA comprises a scaffold encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 365.

[0007] In some embodiments of the vectors provided herein, the nuclease-deficient CRISPR-associated protein is a nuclease-deficient Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas11, Cas12, Cas13, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or another Cas ortholog. In some embodiments, thenuclease-deficient CRISPR-associated protein is dCas9. In some embodiments, the dCas9 is Staphylococcus aureus dCas9, Streptococcus pyogenes dCas9 or Campylobacter jejuni dCas9 or a dCas9 from an orthologous bacterial species. In some embodiments, the dCas9 is encoded by the nucleotide sequence of SEQ ID NO: 326, 327, 328, or 329. In some embodiments, the dCas9 is encoded by a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 326, 327, 328, or 329.

[0008] In some embodiments of the vectors provided herein, the DTM comprises (a) a zinc finger transcription factor or a portion of a zinc finger transcription factor; or (b) a DNA binding domain of a zinc finger transcription factor. In some embodiments, the zinc finger transcription factor is a C2H2 zinc finger transcription factor. In some embodiments, the C2H2 zinc finger transcription factor comprises the DNA binding domain of a Zif268 zinc finger transcription factor or another humanized C2H2 zinc finger transcription factor, or a sequence derived from said DNA binding domain. In some embodiments, the DNA binding domain of a Zif268 zinc finger transcription factor targets the SCN2A gene.

[0009] In some embodiments of the vectors provided herein, the DTM comprises (a) a transcription activator-like protein effector (TALE) protein or a portion of a TALE protein; or (b) a DNA binding domain of a TALE protein. In some embodiments, the DNA binding domain of a TALE protein targets the SCN2A gene.

[0010] In some embodiments of the vectors provided herein, the promoter is a minimal promoter. In some embodiments, the promoter is recognized by RNA polymerase II. In some embodiments, the promoter is a chicken beta-actin (CBA) promoter, a GUSB240 promoter, a GUSB379 promoter, a HSVTK promoter, a CMV promoter, a SV40 early promoter, a SV40 late promoter, a metallothionein promoter, a murine mammary tumor virus (MMTV) promoter, a Rous sarcoma virus (RSV) promoter, a polyhedrin promoter, an EF-1 alpha promoter, a dihydrofolate reductase (DHFR) promoter or a phosphoglycerol kinase (PGK) promoter.

[0011] In some embodiments of the vectors provided herein, the transactivator is VP16, VP32, VP48, VP64, VPR, a MS2-SAM system, p65, Rta, the CITE-D domains of p300 or a SunTag. In some embodiments, the transactivator is encoded by the nucleotide sequence of SEQ ID NO: 330, 331, 332, 333, 334, 335, or 336 or a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 330, 331, 332, 333, 334, 335, or 336.

[0012] In some embodiments of the vectors provided herein, the vector comprises, in 5'-3' order: (a) the promoter polynucleotide sequence; (b) the regulatory polynucleotide sequence; and (c) the transgene polynucleotide sequence. In some embodiments of the vectors provided herein, the vector comprises, in 5'-3' order: (a) the regulatory polynucleotide sequence; (b) the promoter polynucleotide sequence; and (c) the transgene polynucleotide sequence.

[0013] Provided herein is a vector, wherein (a) the transgene polynucleotide sequence encodes the amino acid sequence of SEQ ID NO: 337, 341, 345, or 349; or an amino acid sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the amino acid sequence of SEQ ID NO: 337, 341, 345, or 349; or (b) the transgene polynucleotide sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 338, 339, 340, 342, 343, 344, 346, 347, 348, 350, 351, or 352, or a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 338, 339, 340, 342, 343, 344, 346, 347, 348, 350, 351, or 352.

[0014] In some embodiments of the vectors provided herein, the vector further comprises an artificial intron.

[0015] In some embodiments of the vectors provided herein, the vector further comprises a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE), a hepatitis B virus posttranscriptional regulatory element (HBVPRE), a RNA transport element (RTE), a WPRE3 or a wsl3 regulatory element. In some embodiments, the WPRE comprises or is encoded by the sequence of SEQ ID NO: 353. In some embodiments, the WPRE3 comprises or is encoded by the sequence of SEQ ID NO: 364.

[0016] In some embodiments of the vectors provided herein, the vector further comprises a polyadenylation signal sequence. In some embodiments, the polyadenylation signal sequence is a Simian virus 40 polyadenylation signal (SV40pA) sequence. In some embodiments, the SV40pA sequence comprises or is encoded by the sequence of SEQ ID NO: 354. In some embodiments, the polyadenylation signal sequence is a human growth hormone polyadenylation signal (bGHpA) sequence. In some embodiments, the bGHpA sequence comprises or is encoded by the sequence ofSEQ ID NO: 355. In some embodiments, the polyadenylation signal sequence is a human ȕ-globin polyadenylation signal (hBGpA) sequence. In some embodiments, the hBGpA sequence comprises or is encoded by the sequence of SEQ ID NO: 356. In some embodiments, the polyadenylation signal sequence is a soluble form of Neuropilin-1 (sNRP1) sequence. In some embodiments, the sNRP1 sequence comprises or is encoded by the sequence of SEQ ID NO: 357. In some embodiments, the polyadenylation signal sequence is a sNRP1-2x sequence. In some embodiments, the sNRP1-2x sequence comprises or is encoded by the sequence of SEQ ID NO: 358. In some embodiments, the polyadenylation signal sequence is a Furin polyadenylation signal (FpA) sequence. In some embodiments, the FpA sequence comprises or is encoded by the sequence of SEQ ID NO: 359. In some embodiments, the polyadenylation signal sequence is a SV40min sequence. In some embodiments, the SV40min sequence comprises or is encoded by the sequence of SEQ ID NO: 360. In some embodiments, the polyadenylation signal sequence is a bGHmin sequence. In some embodiments, the bGHmin sequence comprises or is encoded by the sequence of SEQ ID NO: 361. In some embodiments, the polyadenylation signal sequence is a SV40full sequence. In some embodiments, the SV40full sequence comprises or is encoded by the sequence of SEQ ID NO: 362. In some embodiments, the polyadenylation signal sequence is a bGHfull sequence. In some embodiments, the bGHfull sequence comprises or is encoded by the sequence of SEQ ID NO: 363.

[0017] In some embodiments of the vectors provided herein, the vector is a viral vector. In some embodiments, viral vector is an adeno-associated virus (AAV) vector. In some embodiments, the AAV vector comprises a first AAV inverted terminal repeat (ITR) located upstream of the promoter polynucleotide sequence and a second AAV ITR located downstream of the transgene polynucleotide sequence. In some embodiments, the first AAV ITR is an AAV2 ITR and the second AAV ITR is an AAV2 ITR. In some embodiments, the first AAV ITR comprises the sequence of SEQ ID NO: 367 and the second AAV ITR comprises the sequence of SEQ ID NO: 368.

[0018] Provided herein is a vector, comprising in 5'-3' order: (a) a 5' ITR; (b) a RNA polymerase III promoter; (c) a polynucleotide sequence encoding a gRNA; (d) a regulatory polynucleotide sequence; (e) a minimal promoter; (f) an artificial intron; (g) a transgene polynucleotide sequence; (h) a WPRE; (i) a polyadenylation signal sequence; and (j) a 3' ITR.

[0019] Provided herein is a vector, comprising in 5'-3' order: (a) a 5' ITR; (b) a RNA polymerase III promoter; (c) a polynucleotide sequence encoding a gRNA; (d) a minimal promoter; (e) a regulatory polynucleotide sequence; (f) an artificial intron; (g) a transgene polynucleotide sequence; (h) a WPRE; (i) a polyadenylation signal sequence; and (j) a 3' ITR.

[0020] In some embodiments of the vectors provided herein, the vector is suitable for delivery via a non-viral delivery system. In some embodiments, the non-viral delivery system is a lipid nanoparticle or an exosome.

[0021] Provided herein is a viral particle comprising a vector disclosed herein. In some embodiments, the viral particle is a recombinant AAV (rAAV) particle. In some embodiments, the rAAV particle is an AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, AAV-PHP.A, AAV-PHP.B, AAV-PHP-S, AAV-PHPeB, AAV-CAP.B10, AAV2- r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN serotype particle.

[0022] Provided herein is a population of viral particles comprising a plurality of viral particles disclosed herein.

[0023] Provided herein is a pharmaceutical composition comprising a vector, a viral particle or the population of viral particles disclosed herein, and a pharmaceutically acceptable carrier, vehicle or diluent.

[0024] Provided herein is a cell comprising a vector or a viral particle disclosed herein. In some embodiments, the cell is a mammalian cell or an insect cell.

[0025] Provided herein is a method of producing a rAAV particle, the method comprising: (i) culturing a cell disclosed herein under conditions allowing for packaging the rAAV particle; and (ii) harvesting the cultured host cell or culture medium for collection of the rAAV particle. In some embodiments, the rAAV particle comprises an AAV1, AAV2, AAV5, AAV6, AAV8, AAV9, AAV-PHP.A, AAV- PHP.B, AAV-PHP-S, AAV-PHPeB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN capsid protein.

[0026] Provided herein is a method for treating neurological disorders related to SCN2A-haploinsufficiency in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein.

[0027] Provided herein is a method for treating or reducing the risk, severity, frequency or length of seizures in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein.

[0028] Provided herein is a method for preventing or reducing the risk of autism spectrum disorder (ASD) in a subject who has or is at risk of having ASD, the method comprising administering to the subject a therapeutically effective amount of a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein.

[0029] In some embodiments of the methods disclosed herein, the subject is between about 2 years old and about 18 years old. In some embodiments, the subject is older than 18 years.

[0030] In some embodiments of the methods disclosed herein, the vector, viral particle, population or pharmaceutical composition is administered to the subject via intracerebroventricular injection, intrathecal injection, intracarotid artery injection, or intraparenchymal injection.

[0031] In some embodiments of the methods disclosed herein, the vector, viral particle, population or pharmaceutical composition is administered to the subject in a single dose. In some embodiments, the single dose comprises from about 10E+9 to about 10E+14 viral particles.

[0032] Provided herein is a method for increasing levels of SCN2A expression in SCN2A-expressing cells in the brain, the method comprising contacting the cells with a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein. In some embodiments, the SCN2A-expressing cells comprise a loss- of-function mutation in one copy of the SCN2A gene. In some embodiments, the SCN2A-expressing cells are excitatory pyramidal neurons. In some embodiments, the SCN2A-expressing cells are cerebellar granule cells.

[0033] Provided herein is a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein, for use as a medicament. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] FIG.1 is a bar graph depicting results from screening of mouse Scn2a promoter- targeting guides in a luciferase assay system. n=2 biological replicates of 4 technical replicates each. “FC” = fold change.

[0035] FIG. 2 is a bar graph depicting results from in vitro screening of mouse Scn2a targeting with co-transfection of U6-gRNA- and dCas9-VP64-containing plasmids into mouse neuro-2A cells. n=2-5 biological replicates of 3 technical replicates for each guide. “FC” = fold change.

[0036] FIG. 3A is a bar graph depicting results from screening of human SCN2A promoter-targeting guides in a luciferase assay system. n=2 biological replicates of 4 technical replicates each. “FC” = fold change.

[0037] FIG. 3B is a bar graph depicting results from in vitro screening with co- transfection of U6-gRNA- and dCas9-VP64-containing plasmids into KELLY cells. n=2 biological replicates of 3 technical replicates for each guide sequence. “FC” = fold change. DETAILED DESCRIPTION

[0038] The disclosure provides compositions and methods for increasing expression of the sodium voltage-gated channel alpha subunit 2 (SCN2A) gene specifically in SCN2A- expressing cells (e.g., SCN2A-expressing cells in the brain). Such cells include excitatory pyramidal neurons and cerebellar granule cells. Heterozygous loss-of- function mutations in the SCN2A gene, responsible for coding the alpha subunit of the Nav1.2 sodium channel, result in a condition of haploinsufficiency. This condition disrupts the normal functioning of various types of neurons, including excitatory pyramidal neurons and cerebellar granule cells, among others. SCN2A mutations are linked to a variety of neurological disorders, such as autism spectrum disorders, intellectual disability, developmental delay, and epilepsy. The disclosure provides vectors comprising elements that restrict expression of a transgene encoding a fusion protein to specific subtypes of SCN2A-expressing neurons affected by SCN2A- haploinsufficiency. The fusion protein specifically targets the SCN2A gene and modulates expression of said gene, thus increasing SCN2A expression in these neurons. The compositions and methods provided herein are useful for normalizing brain function and reducing symptoms associated with SCN2A-haploinsufficiency, including seizures and autism spectrum disorder (ASD). Therapeutic effects are achieved by selectively restoring normal cell activity in the brain.VECTORS

[0039] Provided herein are vectors comprising regulatory and transgene elements that increase SCN2A expression in SCN2A-expressing cells. The disclosure provides a vector comprising: (a) a transgene polynucleotide sequence encoding a sequence- specific DNA-targeting module (DTM) fused to a transactivator (TA); (b) a regulatory element polynucleotide sequence that specifically restricts expression of the transgene to SCN2A-expressing cells in the brain; and (c) a promoter polynucleotide sequence. The transgene sequence encodes a fusion protein comprising a SCN2A-sequence- specific DTM fused to a transactivator.

[0040] In some embodiments, the SCN2A-expressing cells are excitatory pyramidal neurons. In some embodiments, the SCN2A-expressing cells are cerebellar granule cells.

[0041] Vectors provided herein comprise a transgene polynucleotide sequence encoding a programmable DTM targeted to a genomic sequence (or sequences) that regulates the SCN2A gene. In some embodiments, a transgene polynucleotide sequence is codon-optimized (e.g., optimized for expression in human cells).

[0042] In some embodiments, a DTM comprises components from a CRISPR / Cas system or derived from a from a CRISPR / Cas system. In some embodiments, a DTM comprises a nuclease-deficient CRISPR-associated protein. GUIDE RNA

[0043] In some embodiments (for example, when a DTM comprises a nuclease- deficient CRISPR-associated protein), the vector further comprises a polynucleotide sequence encoding a guide RNA (gRNA). In some embodiments, a gRNA targets the SCN2A gene or a sequence that regulates the SCN2A gene. In some embodiments, a gRNA specifically hybridizes to a regulatory region of the SCN2A gene (e.g., specifically hybridizes under conditions present in a nucleus of the cell). In some embodiments, a gRNA specifically hybridizes to a control region, promoter, enhancer, intron, exon, transcription start site, coding region, or non-coding region of the SCN2A gene. In some embodiments, a gRNA specifically hybridizes to promoter 1a, promoter 1b or promoter 1c of the SCN2A gene. Exemplary gRNA target regions for the SCN2A gene are provided in Table 1. In some embodiments, the gRNA specifically hybridizes to a target sequence of the SCN2A gene comprising the nucleotide sequence set forth in Table 1. In some embodiments, the gRNA specifically hybridizes to an enhancer regionof the SCN2A gene comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14. In some embodiments, the gRNA specifically hybridizes to a promoter region of the SCN2A gene comprising the nucleotide sequence set forth in SEQ ID NO:15 or 16. In some embodiments, the gRNA comprises a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to a target sequence of the SCN2A gene comprising the nucleotide sequence set forth in Table 1.

[0044] gRNAs described herein may comprise one or more spacer sequences. In some embodiments, a spacer sequence is capable of hybridizing to a target sequence of the SCN2A gene. In some embodiments, a spacer sequence comprises a nucleotide sequence that is, at least partially, hybridizable to an equal length of a sequence (e.g., a target sequence) of the SCN2A gene. Exemplary hybridization conditions are described herein. In some embodiments, the spacer sequence may function to direct an RNP complex comprising the guide nucleic acid to the SCN2A gene for detection and / or modification. The spacer sequence may function to direct a ribonucleoprotein (RNP) to the SCN2A gene for modification.

[0045] In some embodiments, a spacer sequence comprises at least 5 to about 50 contiguous nucleotides that are complementary to a target sequence in the SCN2A gene. In some embodiments, a spacer sequence comprises at least 5 to about 50 linked nucleotides. In some embodiments, a spacer sequence comprises at least 5 to about 50, at least 5 to about 25, at least about 10 to at least about 25, or at least about 15 to about 25 linked nucleotides. In some embodiments, the spacer sequence comprises 15-28 linked nucleotides. In some embodiments, a spacer sequence comprises 15-26, 15-24, 15-22, 15-20, 15-18, 16-28, 16-26, 16-24, 16-22, 16-20, 16-18, 17-26, 17-24, 17-22, 17-20, 17-18, 18-26, 18-24, or 18-22 linked nucleotides. In some embodiments, the spacer sequence comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides.

[0046] In some embodiments, a spacer sequence comprises a nucleotide sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to a target sequence of the SCN2A gene. A spacer sequence is capable of hybridizing to an equal length portion of the SCN2A gene. In some embodiments, a spacer sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence selected from Table 2. In some embodiments, a spacersequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in any one of SEQ ID NOs: 17-313. In some embodiments, a spacer sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 96. In some embodiments, a spacer sequence is encoded by the sequence set forth in SEQ ID NO: 96. In some embodiments, a spacer sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 181. In some embodiments, a spacer sequence is encoded by the sequence set forth in SEQ ID NO: 181. In some embodiments, a spacer sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 167. In some embodiments, a spacer sequence is encoded by the sequence set forth in SEQ ID NO: 167. In some embodiments, a spacer sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 67. In some embodiments, a spacer sequence is encoded by the sequence set forth in SEQ ID NO: 67. In some embodiments, a spacer sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 65. In some embodiments, a spacer sequence is encoded by the sequence set forth in SEQ ID NO: 65. In some embodiments, a spacer sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 95. In some embodiments, a spacer sequence is encoded by the sequence set forth in SEQ ID NO: 95. In some embodiments, a spacer sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 94. In some embodiments, a spacer sequence is encoded by the sequence set forth in SEQ ID NO: 94. In some embodiments, a spacer sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 89. In some embodiments, a spacer sequence is encoded by the sequence set forth in SEQ ID NO: 89. In someembodiments, a spacer sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in any one of SEQ ID NOs: 374-402. In some embodiments, the spacer sequence comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides that are capable of hybridizing to a target sequence of the SCN2A gene. In some embodiments, the spacer sequence comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides that are complementary to a target sequence of the SCN2A gene.

[0047] It is understood that spacer sequences of gRNAs need not be 100% complementary to that of a target sequence of a target nucleic acid (e.g., the SCN2A gene) to hybridize or hybridize specifically to the target sequence. For example, the spacer sequence may comprise at least one alteration, such as a substituted or modified nucleotide, that is not complementary to the corresponding nucleotide of the target sequence. Spacer sequences are further described throughout herein.

[0048] In some embodiments, gRNAs described herein may comprise a scaffold sequence. The scaffold sequence is a constant part of the gRNA that forms a stable complex with a Cas9 protein. The scaffold sequence is critical for the correct positioning and function of the Cas9 nuclease, allowing it to interact with the target DNA. The scaffold sequence does not change regardless of the DNA target sequence, which allows the same scaffold to be used in different gRNA constructs. In some embodiments, a scaffold sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence selected from Table 8. In some embodiments, a scaffold sequence is encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 365.

[0049] In some embodiments, the polynucleotide sequence encoding the gRNA is operatively linked to a promoter (e.g., a RNA polymerase III promoter). In such embodiments, the vector comprises two promoters: (1) the promoter regulating the expression of the transgene polynucleotide sequence; and (2) the promoter regulating the expression of the polynucleotide sequence encoding the gRNA. In some embodiments, the promoter regulating the expression of the polynucleotide sequence encoding the gRNA is recognized by RNA polymerase III. In some embodiments, thepromoter regulating the expression of the polynucleotide sequence encoding the gRNA is a human U6 promoter. In some embodiments, a promoter is a minimal human U6 (hU6) Pol3 promoter comprising the sequence of SEQ ID NO: 366 in Table 9. In some embodiments, a promoter is a human U6 (hU6) promoter, a mouse U6 promoter or a human H1 promoter. In some embodiments, a promoter is an E2 promoter

[0050] In some embodiments, a vector comprises a first polynucleotide sequence encoding a first gRNA and a second polynucleotide sequence encoding a second gRNA. In such embodiments, both the first gRNA and the second gRNA target the SCN2A gene or a sequence that regulates the SCN2A gene. DNA-TARGETING MODULE (DTM)

[0051] In some embodiments, a DTM comprises a nuclease-deficient CRISPR- associated protein (also known as a catalytically inactive CRISPR nuclease). Such modified proteins can be referred to as “dead Cas” or “dCas” proteins. For example, a Cas9 protein can be rendered catalytically inactive by introducing point mutations into each of its two nucleolytic domains. Examples of such mutations include D10A and H840A. These mutations block the nucleolytic activity of Cas9 but do not impact its binding to its target. Thus, dCas proteins can be used to deliver cargo to specific genomic locations even though they lack the ability to cleave or nick target nucleic acid sequences.

[0052] In some embodiments, a DTM comprises a nuclease-deficient CRISPR- associated protein that is a nuclease-deficient Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas11, Cas12, Cas13, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or another Cas ortholog. In some embodiments, a DTM comprises dCas9. In some embodiments, a dCas9 is Staphylococcus aureus (Sa) dCas9, Streptococcus pyogenes dCas9 or Campylobacter jejuni dCas9. In some embodiments, a dCas9 is from an orthologous bacterial species.

[0053] In some embodiments, a dCas9 is encoded by a codon-optimized nucleotide sequence (e.g., optimized for expression in human cells). In some embodiments, a dCas9 is encoded by any of the nucleotide sequences in Table 4. In some embodiments, a dCas9 is encoded by the nucleotide sequence of SEQ ID NO: 326, 327, 328, or 329. In some embodiments, a dCas9 is encoded by a nucleotide sequence at least about 90%,about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 326, 327, 328, or 329. In some embodiments, a dCas9 is encoded by a fragment of the nucleotide sequence of SEQ ID NO: 326, 327, 328, or 329, wherein the fragment encodes a protein that is capable of forming a complex with the gRNA and targeting the SCN2A gene.

[0054] In some embodiments, a DTM comprises a zinc finger transcription factor or a portion of a zinc finger transcription factor. Zinc finger transcription factors comprise a DNA binding domain comprising zinc finger motifs. In some embodiments, a DTM comprises a DNA binding domain of a zinc finger transcription factor. In some embodiments, the zinc finger transcription factor is a C2H2 zinc finger transcription factor. A C2H2 zinc finger transcription factor comprises Cys2His2 zinc finger motifs. In some embodiments, the C2H2 zinc finger transcription factor comprises the DNA binding domain of a Zif268 zinc finger transcription factor, or a sequence derived from said DNA binding domain. In some embodiments, the C2H2 zinc finger transcription factor comprises the DNA binding domain of a humanized C2H2 zinc finger transcription factor, or a sequence derived from said DNA binding domain. In some embodiments, a zinc finger transcription factor is derived from a vertebrate animal with low immunogenicity. In some embodiments, a DTM comprises a DNA binding domain of a zinc finger transcription factor (e.g., Zif268), wherein the DNA binding domain targets the SCN2A gene. In some embodiments, a DNA binding domain of a zinc finger transcription factor is genetically engineered to target the SCN2A gene. Examples of zinc finger transcription factors and their uses for modulation of gene expression are provided in US 9,234,016 and US 2016 / 0039893.

[0055] In some embodiments, a DTM comprises a transcription activator-like protein effector (TALE) protein, or a portion of a TALE protein. TALE proteins comprise a central domain responsible for DNA binding, a nuclear localization signal, and a domain that activates the target gene transcription. In some embodiments, a DTM comprises a DNA binding domain of a TALE protein. In some embodiments, a DTM comprises a DNA binding domain of a TALE protein that targets the SCN2A gene. In some embodiments, a DNA binding domain of a TALE protein is genetically engineered to target the SCN2A gene. Examples of TALE proteins and their uses for modulation of gene expression are provided in US 8,586,526, US 9,394,545 and US 9,522,936.

[0056] The vectors provided herein encode a fusion protein wherein the DTM described above is functionally fused to a transactivator. In some embodiments, a transactivator is VP16, VP32, VP48, VP64, VPR, a MS2-SAM system, p65, Rta, the CITE-D domains of p300 or a SunTag. Exemplary SunTag constructs are provided in US 2017 / 0219596. In some embodiments, a transactivator is encoded by any of the nucleotide sequences in Table 5. In some embodiments, a transactivator domain is encoded by the nucleotide sequence of SEQ ID NO: 330, 331, 332, 333, 334, 335, or 336. In some embodiments, a transactivator is encoded by a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 330, 331, 332, 333, 334, 335, or 336.

[0057] In some embodiments, the vectors provided herein encode nuclear localization signals (NLSs) that flank the DTM in the fusion protein. In some embodiments, a NLS is a simian virus 40 (SV40) NLS. In some embodiments, a NLS is a nucleoplasmin NLS. In some embodiments, a vector encodes a SV40 NLS and a nucleoplasmin NLS flanking the DTM in coding frame with the fusion protein.

[0058] In some embodiments, the vectors provided herein encode one of the transgenes in Table 6 (NLS-SadCas9-NLS-VP64, NLS-miniSadCas9v2-NLS-VP64, NLS- miniSadCas9v4-NLS-VP64 or NLS-miniSadCas9v5-NLS-VP64).

[0059] Provided herein is a vector comprising a transgene polynucleotide sequence that encodes the amino acid sequence of SEQ ID NO: 337, 341, 345, or 349. Further provided herein is a vector comprising a transgene polynucleotide sequence that encodes an amino acid sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the amino acid sequence of SEQ ID NO: 337, 341, 345, or 349.

[0060] Provided herein is a vector comprising a transgene polynucleotide sequence comprising or consisting of the nucleotide sequence of SEQ ID NO: 338, 339, 340, 342, 343, 344, 346, 347, 348, 350, 351, or 352. Further provided herein is a vector comprising a transgene polynucleotide sequence comprising or consisting of a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 338, 339, 340, 342, 343, 344, 346, 347, 348, 350, 351, or 352.REGULATORY ELEMENT

[0061] Vectors provided herein comprise a regulatory element (RE) that specifically restricts expression of the transgene to SCN2A-expressing cells (for example, excitatory pyramidal neurons) in the brain. REs are regulatory sequences (promoters, enhancers, etc.) that may drive protein expression in a tissue or cell specific manner. In some embodiments, a RE comprises any of the nucleotide sequences in Table 3. In some embodiments, a RE comprises the nucleotide sequence of SEQ ID NO: 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, or 325. In some embodiments, a RE comprises a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, or 325.

[0062] In some embodiments, a vector provided herein comprises, in 5'-3' order: (a) the promoter polynucleotide sequence; (b) the regulator element; and (c) the transgene polynucleotide sequence. In some embodiments, a vector provided herein comprises, in 5'-3' order: (a) the regulatory element; (b) the promoter polynucleotide sequence; and (c) the transgene polynucleotide sequence. The location and orientation of the regulatory element polynucleotide sequence can be varied. PROMOTER

[0063] Vectors provided herein comprise a promoter sequence that regulates expression of the transgene. In some embodiments, a promoter is a minimal promoter. In some embodiments, a promoter is recognized by RNA polymerase II.

[0064] In some embodiments, a promoter is a constitutive promoter. In some embodiments, a promoter is an inducible promoter. In some embodiments, a promoter is a tissue-specific promoter. In some embodiments, a promoter is the chicken beta- actin (CBA) promoter, the GUSB240 promoter, the GUSB379 promoter, the HSVTK promoter, the CMV promoter, the SV40 early promoter, the SV40 late promoter, the metallothionein promoter, the murine mammary tumor virus (MMTV) promoter, the Rous sarcoma virus (RSV) promoter, the polyhedrin promoter, the EF-1 alpha promoter, the dihydrofolate reductase (DHFR) promoter or the phosphoglycerol kinase (PGK) promoter.

[0065] In some embodiments, a vector provided herein further comprises an artificial intron. In some embodiments, a vector provided herein further comprises a chimeric intron. POST-TRANSCRIPTIONAL REGULATORY ELEMENT

[0066] In some embodiments, a vector provided herein further comprises or encodes a woodchuck hepatitis virus post-transcriptional element (WPRE). See, e.g., Wang and Verma, Proc. Natl. Acad. Sci., USA, 96: 3906-3910 (1999). In some embodiments, a WPRE comprises the sequence of SEQ ID NO: 353. In some embodiments, a vector comprises or encodes a hepatitis B virus posttranscriptional regulatory element (HBVPRE) and / or a RNA transport element (RTE). In some embodiments, the WPRE or HBVPRE sequence is any of the WPRE or HBVPRE sequences disclosed in US 6,136,597 or US 6,287,814. In some embodiments, a vector provided herein further comprises or encodes a WPRE3 or a wsl3 regulatory element. In some embodiments, he WPRE3 comprises or is encoded by the sequence of SEQ ID NO: 364.

[0067] In some embodiments, a vector provided herein further comprises or encodes a polyadenylation (polyA) signal sequence. As used herein, a “polyadenylation signal sequence” refers to a DNA sequence that when transcribed regulates the addition of a polyA tail to the mRNA transcript. In some embodiments, a polyA signal sequence comprises the sequence set forth in Table 7. In some embodiments, a polyA signal sequence is a SV40, human, bovine or rabbit polyA signal sequence. In some embodiments, a polyA signal sequence is a SV40 polyA signal sequence (SV40pA). In some embodiments, SV40pA comprises the sequence of SEQ ID NO: 354. In some embodiments, a polyA signal sequence is a human growth hormone polyA signal sequence (bGHpA) or a bovine growth hormone polyA signal sequence. In some embodiments, the bGHpA comprises the sequence of SEQ ID NO: 355. In some embodiments, a polyA signal sequence is a human ȕ-globin polyA signal sequence (hBGpA). In some embodiments, the hBGpA comprises the sequence of SEQ ID NO: 356. In some embodiments, the polyadenylation signal sequence is a soluble form of Neuropilin-1 (sNRP1). In some embodiments, the sNRP1 comprises or is encoded by the sequence of SEQ ID NO: 357. In some embodiments, the polyadenylation signal sequence is sNRP1-2x. In some embodiments, the sNRP1-2x comprises or is encoded by the sequence of SEQ ID NO: 358. In some embodiments, the polyadenylation signal sequence is Furin polyadenylation signal (FpA). In some embodiments, the FpAcomprises or is encoded by the sequence of SEQ ID NO: 359. In some embodiments, the polyadenylation signal sequence is SV40min. In some embodiments, the SV40min comprises or is encoded by the sequence of SEQ ID NO: 360. In some embodiments, the polyadenylation signal sequence is bGHmin. In some embodiments, the bGHmin comprises or is encoded by the sequence of SEQ ID NO: 361. In some embodiments, the polyadenylation signal sequence is SV40full. In some embodiments, the SV40full comprises or is encoded by the sequence of SEQ ID NO: 362. In some embodiments, the polyadenylation signal sequence is bGHfull. In some embodiments, the bGHfull comprises or is encoded by the sequence of SEQ ID NO: 363.

[0068] In some embodiments, a vector provided herein further comprises or encodes a Kozak sequence (for example, a DNA sequence transcribed to an RNA Kozak sequence). In some embodiments, a vector comprises a Kozak sequence upstream of the transgene. In some embodiments, the Kozak sequence is encoded by GCCACC (SEQ ID NO: 369). In some embodiments, the Kozak sequence (e.g., RNA Kozak sequence) comprises or consists of ACCAUGG (SEQ ID NO: 370), GCCGCCACCAUGG (SEQ ID NO: 371), CCACCAUG (SEQ ID NO: 372) or CCACCAUGG (SEQ ID NO: 373).

[0069] In some embodiments, a vector provided herein further comprises a TATA transcriptional regulatory activation site (see, e.g., Francois et al., (2005) J. Virol. 79(17):11082–11094).

[0070] In some embodiments, a vector provided herein comprises (a) the promoter polynucleotide sequence; (b) the regulatory element; and (c) the transgene polynucleotide sequence; (d) an artificial intron; and (e) a WPRE. In some embodiments, a vector provided herein comprises (a) the promoter polynucleotide sequence; (b) the regulatory element; and (c) the transgene polynucleotide sequence; (d) a WPRE; and (e) a polyA signal sequence. In some embodiments, a vector provided herein comprises (a) the promoter polynucleotide sequence; (b) the regulatory element polynucleotide sequence; and (c) the transgene polynucleotide sequence; (d) an artificial intron; and (e) a polyA signal sequence. In some embodiments, a vector provided herein comprises (a) the promoter polynucleotide sequence; (b) the regulatory element polynucleotide sequence; and (c) the transgene polynucleotide sequence; (d) an artificial intron; (e) a WPRE; and (f) a polyA signal sequence.PLASMIDS OR VIRAL EXPRESSION CASSETTES

[0071] In some embodiments, the vectors provided herein are plasmids or viral expression cassettes that comprise additional nucleic acid sequences. In some embodiments, the vectors provided herein may be used to generate recombinant virus particles to serve as viral vectors for gene delivery. In some embodiments, the vectors provided herein are formulated for use with via non-viral delivery systems. Further provided herein are plasmids comprising any of the vector nucleic acid sequences disclosed herein.

[0072] In some embodiments, a vector provided herein is non-integrating. In some embodiments, a vector provided herein is non-replicating.

[0073] In some embodiments, a vector provided herein is a viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector. In some embodiments, an AAV vector comprises a first AAV inverted terminal repeat (ITR) located upstream of the promoter polynucleotide sequence and a second AAV ITR located downstream of the transgene polynucleotide sequence. In some embodiments, the first AAV ITR and the second AAV ITR comprise the sequence in Table 10. In some embodiments, the first AAV ITR comprises the sequence of SEQ ID NO: 367 and the second AAV ITR comprises the sequence of SEQ ID NO: 368. ITRs are sequences that mediate AAV proviral integration and packaging of AAV DNA into virions. In some embodiments, an AAV vector comprises a first AAV ITR and a second AAV ITR flanking the polynucleotide sequences to be packaged into a recombinant AAV (rAAV) particle. In some embodiments, the first AAV ITR is an AAV2 ITR and the second AAV ITR is an AAV2 ITR. AAV expression cassettes and related plasmids provided herein can be used in production of rAAV particles.

[0074] In some embodiments, an AAV vector provided herein is self-complementary. In some embodiments, an AAV vector provided herein is single-stranded.

[0075] In some embodiments, a vector provided herein, comprises, in 5'-3' order: (a) a 5' ITR; (b) a RNA polymerase III promoter; (c) a polynucleotide sequence encoding a gRNA; (d) the regulatory element; (e) a minimal promoter; (g) the transgene polynucleotide sequence; (h) a WPRE; (i) a polyadenylation signal sequence; and (j) a 3' ITR. In some embodiments, a vector provided herein, comprises, in 5'-3' order: (a) a 5' ITR; (b) a RNA polymerase III promoter; (c) a polynucleotide sequence encoding a gRNA; (d) a minimal promoter; (e) the regulatory element; (g) the transgenepolynucleotide sequence; (h) a WPRE; (i) a polyadenylation signal sequence; and (j) a 3' ITR. The location and orientation of the regulatory element polynucleotide sequence can be varied.

[0076] In some embodiments, these sequences comprise, in 5'-3' order: (a) a 5' AAV2 ITR; (b) a hU6 promoter; (c) a polynucleotide sequence encoding a gRNA; (d) the regulatory element; (f) the transgene polynucleotide sequence; and (h) a 3' AAV2 ITR. In some embodiments, these sequences further comprise any combination of (1) an artificial intron; (2) a WPRE; and (3) a polyadenylation signal sequence (e.g., a SV40 polyadenylation signal sequence). In some embodiments, these sequences comprise, in 5'-3' order: (a) a 5' AAV2 ITR; (b) a hU6 promoter; (c) a polynucleotide sequence encoding a gRNA; (d) the regulatory element polynucleotide sequence; (e) a beta- globin promoter; (f) an artificial intron; (g) the transgene polynucleotide sequence; (h) a WPRE (WPRE3); (i) a SV40 polyadenylation signal sequence; and (j) a 3' AAV2 ITR.

[0077] Further provided herein is a viral particle (also referred to as a virion) comprising any of the vectors, expression cassettes or nucleic acid molecules provided herein. In some embodiments the viral particle is a rAAV particle. In some embodiments, the rAAV particle is an AAV9 serotype particle. In some embodiments, the rAAV particle is an AAV-PHP.eB, AAV-DJ or AAV2 serotype particle. In some embodiments, the rAAV is an AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh32.33, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, snake AAV, bearded dragon AAV, AAV2i8, AAV2g9, AAV-LK03, AAV7m8, AAV Anc80, TM-AAV6, AAV- PHP.A, AAV-PHP.B, AAV-PHP.S, AAV-PHPeB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH or AAV2-GMN serotype particle.

[0078] Provided herein is a population of viral particles comprising a plurality of viral particles disclosed herein. Provided herein is a population of rAAV particles comprising a plurality of rAAV particles disclosed herein.

[0079] In some embodiments, a vector provided herein is suitable for delivery via a non-viral delivery system. In some embodiments, a vector provided herein is formulated for delivery via a non-viral delivery system. In some embodiments, a non- viral delivery system is a lipid nanoparticle or an exosome. In some embodiments, non- viral systems for gene delivery may be lipid-based, polymer-based or othernanomaterial-based. Cationic lipids or cationic polymers can be complexed with nucleic acid molecules to produce synthetic vehicles for gene delivery.

[0080] Provided herein is a cell comprising any of the vectors or viral particles disclosed herein. In some embodiments, the cell is a mammalian cell. In some embodiments, a mammalian cell is a HEK293 cell. In some embodiments, the cell is an insect cell. In some embodiments, the insect cell is a Spodoptera frugiperda cell (for example, the Sf9 or ExpiSf9™ cell lines). The Sf9 insect cell line (Thermo Fisher Scientific, Waltham, MA) is a clonal isolate derived from the parental S. frugiperda cell line IPLB-Sf-21-AE. ExpiSf9™ cells (Thermo Fisher Scientific, Waltham, MA) are a non-engineered derivative of Sf9 insect cells that have been adapted for high- density suspension growth. PHARMACEUTICAL COMPOSITIONS

[0081] Provided herein are pharmaceutical compositions comprising any of the vectors, viral particles, nucleic acid molecules, populations of viral particles disclosed herein, and a pharmaceutically acceptable carrier, vehicle or diluent. “Pharmaceutically acceptable” refers to a material that is not toxic or otherwise undesirable, i.e., the material may be administered to a subject without causing any undesirable biological effects. In general, a pharmaceutically acceptable material has one or more benefits that outweigh any undesirable biological effect that the material may have. Undesirable biological effects may include, for example, excessive toxicity, irritation, allergic response, and other problems and complications.

[0082] For injection, the carrier will typically be a liquid. For other methods of administration, the carrier may be either solid or liquid.

[0083] In some embodiments, a pharmaceutical composition may comprise other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, adjuvants and / or diluents.

[0084] In some embodiments, a pharmaceutical composition comprises at least one pharmaceutically acceptable carrier, excipient, and / or vehicle, for example, solvents, buffers, solutions, dispersion media, coatings, antibacterial agents, antifungal agents, isotonic agents, and absorption delaying agents. In some embodiments, the pharmaceutically acceptable carrier, excipient, and / or vehicle comprises saline, buffered saline, dextrose, water, glycerol, sterile isotonic aqueous buffer, or a combination thereof. In some embodiments, the pharmaceutically acceptable carrier,excipient, and / or vehicle comprises phosphate buffered saline, sterile saline, lactose, sucrose, calcium phosphate, dextran, agar, pectin, peanut oil, sesame oil, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), or a suitable mixture thereof. In some embodiments, the compositions disclosed herein further comprise emulsifying or wetting agents, or pH buffering agents. Such species may be present in small amounts (e.g., less than 10% by weight of the composition, such as less than 5% by weight of the composition, 2% by weight of the composition, 1% by weight of the composition, or less).

[0085] In some embodiments, a pharmaceutical composition further comprises one or more other pharmaceutical ingredients, such as one or more preservatives or chemical stabilizers. Examples of preservatives and chemical stabilizers include, but are not limited to, chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, parachlorophenol, and albumin. In some embodiments, the compositions disclosed herein further comprise antibacterial agents and / or antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal; isotonic agents, such as sugars and sodium chloride; and / or agents delaying absorption, such as aluminum monostearate and gelatin.

[0086] In some embodiments, a pharmaceutical composition is in a form of an injectable solution or dispersion, such as an aqueous solution or dispersion. In some embodiments, a pharmaceutical composition is a sterile powder for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions may be prepared in water, glycerol, liquid polyethylene glycols, oils, or any combination thereof. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the pharmaceutical compositions provided herein.

[0087] In some embodiments, a pharmaceutical composition is suitable or formulated for intracerebroventricular injection, intrathecal injection, intracarotid artery injection, or intraparenchymal injection. METHODS OF PRODUCING rAAV PARTICLES

[0088] Provided herein are methods of producing rAAV particles by using any of the vectors, AAV expression cassettes, nucleic acid molecules and cells disclosed herein.

[0089] Provided herein is a method of producing a rAAV particle, the method comprising: (i) culturing a cell comprising a vector or an AAV expression cassette disclosed herein under conditions allowing for packaging the rAAV particle; and (ii) harvesting the cultured host cell or culture medium for collection of the rAAV particle.

[0090] In some embodiments, a method of producing a rAAV particle comprises providing to a cell: (a) a vector (i.e., a nucleic acid template comprising an AAV expression cassette) comprising two AAV ITRs located 5' and 3' to the polynucleotide sequences desired to be packaged into the rAAV particle, and (b) AAV sequences sufficient for replication of the nucleic acid template and encapsidation into AAV protein capsids (e.g., AAV rep sequences and AAV cap sequences encoding the AAV capsid subunits, also referred to as “helper functions”). Typically, the AAV rep and cap sequences will not be flanked by AAV ITRs, to prevent rescue and / or packaging of these sequences.

[0091] The vector (nucleic acid template), rep sequences, cap sequences, and any other helper functions required for producing the rAAV particles disclosed herein may be delivered to the packaging host cell using any appropriate genetic element. Further details on methods of preparing rAAV particles are provided in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY; Fisher et al, J. Virol., 70:520-532 (1993) and US 5,478,745.

[0092] The nucleic acid template and AAV rep and cap sequences are provided under conditions such that virus vector comprising the nucleic acid template packaged within the AAV protein capsid is produced in the cell. The method can further comprise the step of collecting the virus vector from the cell. The virus vector can be collected from the medium and / or by lysing the cells.

[0093] The cell can be a cell that is permissive for AAV viral replication. Any suitable cell known in the art may be employed. In some embodiments, the cell is a mammalian cell (e.g., a HEK293 cell). In some embodiments, the cell can be a trans-complementing packaging cell line that provides functions deleted from a replication-defective helper virus, e.g., HEK293 cells or other E1a trans-complementing cells. The helper sequences may be embedded in a chromosome or maintained as a stable extrachromosomal element.

[0094] In some embodiments, rAAV particles are produced using the triple transfection method, as described in US 6,001,650. In some embodiments, the rAAVs are produced by transfecting a host cell with an AAV vector (i.e., AAV expression cassette) to bepackaged into rAAV particles, an AAV helper function vector, and an accessory function vector. An AAV helper function vector encodes the “AAV helper function” sequences (i.e., rep and cap), which function in trans for productive AAV replication and encapsidation. Non-limiting examples of AAV helper function vectors include pHLP19 and pRep6cap6 vector, described in US 6,001,650 and US 6,156,303, respectively. The accessory function vector encodes nucleotide sequences for non- AAV derived viral and / or cellular functions upon which AAV is dependent for replication (i.e., “accessory functions”). The accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (e.g., other than herpes simplex virus type-1) and vaccinia virus.

[0095] In some embodiments, rAAVs are produced using recombinant baculovirus vectors. Production of rAAVs using baculovirus vectors is described in, for example, Urabe et al. (2002) Hum Gene Ther 13(16):1935-1943; Smith et al. (2009) Mol Ther 17(11):1888-1896; US 8,945,918; US 9,879,282; and US 2018 / 0371495. In some embodiments, a baculovirus vector genome is derived from Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV), Bombyx mori nuclear polyhedrosis virus (BmNPV), Helicoverpa armigera (HearNPV) or Spodoptera exigua MNPV. Baculovirus vectors are used to produce recombinant AAVs in insect cells (e.g., Spodoptera frugiperda cells). In some embodiments, the Sf9 or ExpiSf9™ Spodoptera frugiperda cell lines are used to produce rAAVs. In some embodiments, methods of the disclosure comprise co-infecting insect cells with populations of recombinant baculoviruses (rBVs) to produce rAAV disclosed herein. At least two populations of rBVs may be used in the methods of the disclosure. Methods for generating recombinant baculovirus are known in the art (see, e.g., the Bac-to-Bac®Baculovirus Expression System (Thermo Fisher Scientific, Waltham, MA)).

[0096] In some embodiments, a rAAV particle produced by the methods provided herein comprises an AAV9 capsid protein. In some embodiments, a rAAV particle produced by the methods provided herein comprises an AAV-PHP.eB, AAV-DJ or AAV2 capsid protein. In some embodiments, a rAAV particle produced by the methods provided herein comprises an AAV1, AAV2, AAV3 (including types 3A and 3B),AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh32.33, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, snake AAV, bearded dragon AAV, AAV2i8, AAV2g9, AAV-LK03, AAV7m8, AAV Anc80, TM-AAV6, AAV- PHP.A, AAV-PHP.B, AAV-PHP.S, AAV-PHPeB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH or AAV2-GMN capsid protein. METHODS OF USING VECTORS

[0097] Provided herein are methods for increasing the expression of wild-type (or normally functioning) SCN2A in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein. The subject has a heterozygous loss-of-function mutation in the SCN2A gene. A loss-of-function mutation may be a nonsense or missense mutation or a deletion.

[0098] Provided herein is a method for increasing levels of SCN2A expression in SCN2A-expressing cells in the brain, the method comprising contacting the cells with a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein. In some embodiments, the SCN2A-expressing cells comprise a loss- of-function mutation in one copy of the SCN2A gene. In some embodiments, the SCN2A-expressing cells are excitatory pyramidal neurons. In some embodiments, the SCN2A-expressing cells are cerebellar granule cells.

[0099] In some embodiments, a vector provided herein increases SCN2A mRNA expression. Levels of mRNA expression may be measured by a Northern blot, a nuclease protection assay (NPA), in situ hybridization or reverse transcription- polymerase chain reaction (RT-PCR).

[0100] In some embodiments, a vector provided herein increases SCN2A protein expression (i.e., expression of the alpha subunit of sodium channel Nav1.2). Levels of protein expression may be measured by a Western blot or immunohistochemistry.

[0101] Provided herein is a method for treating a neurological disorder related to SCN2A-haploinsufficiency in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein.

[0102] Provided herein is a method for treating or reducing the risk, severity, frequency or length of seizures in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein.

[0103] Provided herein is a method treating or preventing autism spectrum disorder (ASD) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein.

[0104] In some embodiments, the rAAV comprises an AAV9 capsid protein. In some embodiments, the rAAV particle comprises an AAV-PHP.eB, AAV-DJ or AAV2 capsid protein. In some embodiments, the rAAV particle comprises an AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh32.33, AAVrh.8, AAVrh.10, AAVrh32.33, AAVrh.74, AAVhu.68, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, snake AAV, bearded dragon AAV, AAV2i8, AAV2g9, AAV-LK03, AAV7m8, AAV Anc80, TM-AAV6, AAV-PHP.A, AAV-PHP.B, AAV-PHP.S, AAV-PHPeB, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH or AAV2-GMN capsid protein.

[0105] In some embodiments, the subject is human. In some embodiments, the subject is less than 2 years old. In some embodiments, the subject is between about 2 years old and about 18 years old. In some embodiments, the subject is older than 18 years.

[0106] In some embodiments, the vector, viral particle, population of viral particles or pharmaceutical composition is administered to the subject via intracerebroventricular injection, intrathecal injection, intracarotid artery injection, or intraparenchymal injection.

[0107] In some embodiments, the vector, viral particle, population of viral particles or pharmaceutical composition is administered to the subject in a single dose. In some embodiments, the single dose comprises from about 10E+9 to about 10E+14 viral particles.

[0108] Further provided herein is a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein, for use as a medicament.

[0109] In some embodiments, efficacy of a vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein may be tested in an animal model of SCN2A-medidated neurological disorders (e.g., a mouse model) or an inducedpluripotent stem cell (iPSC) model of SCN2A-medidated neurological disorders. The animal models may include SCN2A + / -: B6.129-Scn2a<tm1Mml>, SCN2A R102X, SCN2A Tyr84X, SCN2A R1626X, and SCN2A Q54X mouse models. The iPSC models may include SCN2A p. Tyr84 and SCN2A C959X cells.

[0110] A vector, a viral particle, a population of viral particles or a pharmaceutical composition disclosed herein may be tested in the following experiments: - In vitro demonstration of the level of expression of several DTMs at the RNA and protein level; - In vitro demonstration of upregulation of the SCN2A gene for specific gRNA sequences at the RNA and protein level; - In vivo demonstration of specificity of expression of the transgene in the target cellular population in WT mouse brain using immunofluorescence; - In vivo demonstration of upregulation of SCN2A expression in the brain of WT mice at the RNA and protein level; - In vivo demonstration of upregulation of SCN2A expression in the brain of SCN2A+ / - mice at the RNA and protein level; - Demonstration of improved vestibulo-ocular reflex plasticity in treated vs untreated SCN2A + / - mice; and - Demonstration of improved seizure sensitivity in treated vs untreated SCN2A + / - mice DEFINITIONS

[0111] Unless otherwise noted, the terms used herein have definitions as ordinarily used in the art. Some terms are defined below, and additional definitions can be found within the rest of the detailed description.

[0112] The term “a” or “an” refers to one or more of that entity, i.e., can refer to plural referents. As such, the terms “a,” “an,” “one or more,” and “at least one” are used interchangeably herein. In addition, reference to “an element” by the indefinite article “a” or “an” does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there is one and only one of the elements.

[0113] Unless otherwise stated or otherwise evident from the context, the term “about” means within 10% above or below the reported numerical value (except where such number would exceed 100% of a possible value or go below 0%). When used in conjunction with a range or series of values, the term “about” applies to the endpointsof the range or each of the values enumerated in the series, unless otherwise indicated. As used in this application, the terms “about” and “approximately” are used as equivalents.

[0114] As used herein, the term “gRNA molecule” or “gRNA” refers to a guide RNA that is capable of targeting a CRISPR nuclease or a nuclease-deficient CRISPR- associated protein to a target nucleic acid. Depending on context, the term “gRNA molecule” refers to a guide ribonucleic acid or to a nucleic acid encoding a gRNA.

[0115] As used herein, the term “sequence identity” refers to the extent to which two optimally aligned polynucleotides or polypeptide sequences are invariant throughout a window of alignment of residues, e.g., nucleotides or amino acids. An “identity fraction” for aligned segments of a test sequence and a reference sequence is the number of identical residues which are shared by the two aligned sequences divided by the total number of residues in the reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence. “Percent identity” is the identity fraction times 100. Percentage identity can be calculated using the alignment program Clustal Omega, available at ebi.ac.uk / Tools / msa / clustalo using default parameters. See, Sievers et al., “Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega” (2011 October 11) Molecular Systems Biology 7:539. For the purposes of calculating identity to the sequence, extensions, such as tags, are not included.

[0116] As used herein, a regulatory sequence (e.g., a promoter) is considered to be “operatively linked” when it is in a functional location and orientation in relation to a nucleic acid sequence it regulates to control transcriptional initiation and / or expression of that sequence.

[0117] As used herein, the term “self-complementary” when referring to an AAV vector refers to an AAV vector comprising a nucleic acid (i.e., a DNA) that forms a dimeric inverted repeat molecule that spontaneously anneals, resulting in earlier and more robust transgene expression compared with conventional single-strand (ss) AAV genomes. See, e.g., McCarty, Molecular Therapy 16(10):1648-1656 (2008). Unlike conventional ssAAV, self-complementary AAV (scAAV) can bypass second-strand synthesis, the rate-limiting step for gene expression. Moreover, double-stranded scAAV is less prone to DNA degradation after viral transduction, thereby increasing the number of copies of stable episomes.

[0118] As used herein, the terms “treat,” “treating” or “treatment of” (and grammatical variations thereof) mean that the severity of the subject's condition is reduced, at least partially improved or stabilized and / or that some alleviation, mitigation, decrease or stabilization in at least one clinical symptom is achieved and / or there is a delay in the progression of the disease or disorder.

[0119] As used herein, the terms “prevent,” “preventing” and “prevention” (and grammatical variations thereof) refer to prevention and / or delay of the onset of a disease, disorder and / or a clinical symptom(s) in a subject and / or a reduction in the severity of the onset of the disease, disorder and / or clinical symptom(s) relative to what would occur in the absence of the compositions and / or methods described herein. The prevention can be complete, e.g., the total absence of the disease, disorder and / or clinical symptom(s). The prevention can also be partial, such that the occurrence of the disease, disorder and / or clinical symptom(s) in the subject and / or the severity of onset is less than what would occur in the absence of the compositions and / or methods described herein.

[0120] In some embodiments, a nucleic acid sequence provided herein is a nucleic acid sense strand (e.g., 5' to 3' strand), or in the context of a viral sequences a plus (+) strand. In some embodiments, a nucleic acid sequence is a nucleic acid antisense strand (e.g., 3' to 5' strand), or in the context of viral sequences a minus (-) strand.

[0121] As used herein, a “therapeutically effective amount” is the amount of a vector, viral particles, a population of viral particles or a pharmaceutical composition provided herein that is effective to treat a disease or disorder in a subject or to ameliorate a sign or symptom thereof. The “therapeutically effective amount” may vary depending, for example, on the disease and / or symptoms of the disease, severity of the disease and / or symptoms of the disease or disorder, the age, weight, and / or health of the patient to be treated, and the judgment of the prescribing physician.

[0122] All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated by reference in their entireties for all purposes. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not be taken as an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.DIenegA2NCSehtfosunq TCt a t cgtgtTgtacactcatct CAT T TGAGaaATGGTAaaAcCgAoeiSACg c t g t aA At c g c g cACAATACA GGT CATAggCCA AACTG A ATTggttt ataTgger n4793goin t15 619i 6 93 56 0ta8to1:-141:-29eg 3r gnn2rh416526r0h11056aH A tc 2 1 c 1 1Ar rNeceRgencanay p h hr y n nalT E Epm1 2e 0x -0E A- A.2 21Nele CNCba m SahShTNnEnEDIQESecne ctugct ccgtct ttgtaTGTAgagg acgtttcttaaGTCAT T ACAGTqtecga tcaScgaa ctc ttggtgtac TcacccaacaAAAAatatgattggcgagcACTATTTctttgagagactg a CG taACAACT T C CATTGTATCCG ATG CTCCCTnoi0t2 65a558t63o1:-8gn 2r60525HnAhc5661recenpayhTnE30- A2Ne Cm Sa hN nEDIQESecneu TAA AqeCAT AC AGCSGTGGGT TA GCTCTCACCTCCTT T TaAatc catat atcTT ct att AGTT CGACTTA GC gtgacttata TCaaaggacgagTACCGTAtt TACaaTT CTGC C TA AGTTCAT TCGCGCG noi2t2 14a56 68t 93o1gn:- 28212Hn rAhc95861recenpayhTnE40- A2Ne Cm Sa hN nEDIQESecneu GTqeT CGTTTAT CTG AAS CATGTAAC CA ATA TGTA CGCG AtAGCGTGT GCATTGgtGgt TGCAA T ACT TGTTG AATGTTCAA G ACCATACTTAA G GTT CGTGGT CATA A A A AgtGCTA noi3t2 0a5 658t61-13ogn:2r04625HnAhc5961recenpayhTnE50- A2Ne Cm Sa hN nEDIQESecneuqGcce cgaCACTGAGTTCATGA aGtagaTGGTACCCA TCTcc gaatcaSAT ctaacgCT TAATACATTCCCA ACAT c aA AcgaaGACCT TAACTA A ATATgTaacccatgnoi7t2 272 3a5 6678t 2 5 36253o1:-gnn2r0712 1:-07652 26r 3 5H Ahc 2 1hc3461rerceencpanyhaTnhEnE607-0A-2AN2e CNCm S Sa hnhNEnEDIQESecneuq CG TACTgaggc TAttacT TgtAAGTAGTCAAT CTCACCCTAAAAeSA ATGCAT gAgtagcg TGT gGtgGTA GTT CAGTACCGA G G ATA A ATTG ACCACCGAT TA noi0t3 18 23 39a58t6 8511661 93o :-gnHn2r7083:- 2523Ahc1566r 41hc05861rercencepanayh hTnEnE809-0A-2AN2Ne C Cm ShSanhNEnEDIQESTT GATTGTACACAT TTAAT ATGG GAGCecAC TGGACTTGACTCACA TGT TG TTAGTATA ATnAeu TAGq CAAATT T TGAA T GAACTAAATACATTT TATGC CGATGGGeT CATTGTTTG TAT AACAACT GTSA AGATTG AT TCTTATAGtG ATAATA AtttTTATATTA AGTTCCA ATCCTT CGCA GTAATGACCTTGTnoi5t3 64a568t683o1:-gnn2r550395H Ahc 761recenpayhTnE01- A2Ne Cm Sa hN nEDIQESecneu ATGT TGTACCT G at ggttGTa gCqeTSTTAAT TTA AGTTCCACAATCTT CGC AC TAAgatac TCAAccctGTA GTATGACTTGTCT CGacga gtc CGTTAT CAgacgATATnoi6t3 65 73 85 93 44a5958558t63o1:-16163gn 2r0653 1:- 52r5703 1:-952r7335HnAhc2161hc5161hc5261rer rceceen ncpanyhahahTnEnEnE112-131A- -2A2AN N2CNeSC CmhShSan nhNE EnEDIQESecneuGGTqTS TACATAAA AGACTTTgg gaac AGA A G CAATTGGTATTTTAT TATAaatctaa TG gTAeATTA GCCATAA G GTATTgaag atcAcTCG GATGTGT TG A GGTGAA A A AaatgtGT TA noi09t4a5 68t6 6123ogn:- 220445Hn rAhc3161recenpayhTnE41- A2Ne Cm Sa hN nEDIQESecneuATGTAqTeS TAACTGC C TA AT GT TATT CGATCTGCG AC CATTTCG CATTTA ATG TTTTTTG A ATAGCACAA ATCAATA ATTATGGAA G ACA GCCAT TACTA A CA AGTG TTTACATnoi3t2 68a58t6 813o :-93gnn2r6825H Ahc8761reteopmyoTrP10- A2NeCSmamoN rPDIQESecneu C GqeCSTTGA AGTA G A A AA AA GACAA GAC TTGGGAATA A A A GTGTA AAG CGTTACATGT ATTG GGTATgtT AGaaaaT TTAAA GTTAGATG AT aCc TctACCATtAActa TTcttaaATG A G noi99t2a5 258t61-43ogn:2r99225HnAhc5261reteopmyoTrP20- A2NeCSmamoN rPDIQESecTnTACG GATgae T CA tagtgagac TTA A GACAGTTTAC CCACCAA TTTTTuGTGATA TacctcaacagATaaAGACT CG TCGTATT TGGT CTAGCT CGGqGTATACc aagtGTACGT TATCAAGGeSGTCTGTCCTACCcatca attaacTTCTCCCGTTACATTTATTTA GCGTT CGCGTCATnoita8t3ognHnAepyTemaN72842829292030313132333330101111121313141415151516161141414141414141414141419191919191919191919191919195 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 516 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 651 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 16: : : : : : : : : : : : : : : : : : : : : : : : :12 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2:r r r r r r r r r r r r r r r r r r r r r r r r r2h h h h h h h h h h h h h h h h h h h h h h h h hrC C C C C C C C C C C C C C C C C C C C C C C C ChC 2030405060708090011121311020304050607080900111213140 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01- - - - - - - - - - - - - - - - - - - - - - - - -0AAAAAAAAAAAAAAAAAAAAAAAAA- A N RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN gg g g g g g g g g g g g g g g g g g g g g g g gR_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _g1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2_0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 02- - - - - - - - - - - - - - - - - - - - - - - - -0AAAAAAAAAAAAAAAAAAAAAAAAA-2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2ANNNNNNNNNNNNNNNNNNNNNNNNN2C C C C C C C C C C C C C C C C C C C C C C C C CNS S S S S S S S S S S S S S S S S S S S S S S S SCh h h h h h h h h h h h h h h h h h h h h h h h hSn n n n n n n n n n n n n n n n n n n n n n n n nhE E E E E E E E E E E E E E E E E E E E E E E E EnEONDIQESecneuqeSediuGnoit6a728386989403969891 3 7 8 2 0 7 8 8 8 4 0 4 1 0 0 2 3 3t1919191919298028282902912919293939394949596948687898989898on1 1 1 1 1 1 2 2 2 2 2222 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3n5a65 5 5 5 5 5 5 5 525252525252 2 2 2 2 2 2 2 2 2 216165165161616161616161616161616165 5 5 5 5 5 5 5 5 5 5161616 6 6 6 6 6 6 6 68: : : : : : : : : : : : : : : : : : :1 1:1 1 1 1 1 1 132gr2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2:2 2:2:2: : : : :hhrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChr2Chr2 2 2 2ChrChrChr rChChC 516 7 8 9 0 1 2 3 4 5 6 7 8 9 1020304050607001-010101020000000000000000000011012013 4 50101010 0-0-0-0-0-0-0- A- A- - - - - - - - - - - - - - - - - - -AAAAAAAeAAAAAAAAAAAAAAAAAAA NNNN NNNNNNNmNNNNNNNNNNNNNNNNNRgRgRgRgRgR RaR R R R R R R R R R R R R R R R R R R R Rng_g g g g g g g g g g g g g g g g g g g g_ _ _ _ _g_g_A2_02_2_2_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _1-0-0-02-02-04 4 4 4 4 4 4 4 4 4 4 4 4 4 4-0-0-0-0-0-0-0-0-0-0-0 0 0 0 0 01-01-01-01-01-01-0-NR A2A2A2A2A2A2A2A2A2A- - - - -A2A2A2A2A2A2A2A2A2A2AA2A2A2A2A2A2A2gs NNNNNNNNNNNNNNNNNNN2N2NNNNNNN9a C C C C C C C C C C C C C C C C C C C CNCCSC C C C C CC S S S S S S S S S S S S S S S S S S S S S mS S S S S Sa h h h h h h h h h h h h h h h h h h h h h omomomommmsnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnErPrPrProProProPrPONDIQESecneuqeSediuGnoit3a93979999999107021212 3 4 6 9 0 0 2 3 3 4 4 8 8 9 3 3 9t83838383838393939391391391 139391 2 239 9 92929292929292929393939on2 2 2 2 2 2 2 2 2 2 2 2 2 232323 3 3 3 3 3 3 3 3 3 3 3n5a65 5 5 5 5 5 5 5 5 5 5 52525252525252 2 2 2 2 216:165:16:16:165:16:16:16:16:16:16:16:165:16:16:16:16:16:16:165 5 5 5 5 5:16:16:16:16 6 6 6:1:1:1 1832 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2:2:2grhhrChr r r r r r r r r r r r r r r r r r r r r r r r r rChChChChChChChChChChChChChChChChChChChChChChChChChChC 809001112131415161718 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 50 0 0 0 0 0 0 0 0 01010202 2 2 2 2 2 2 2 2 3 3 3 3 3 3- - - - - - - - - - - - -0-0-0-0-0 0 0 0 0 0 0 0 0 0 0AAAAAAAAAAAAAAAAA- A- A- A- A- A- A- A- A- A- A- AeN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RN RNNNma g g g g g g g g g g g g g g g g g g g g g g g g gRgRgRgn _1_01_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _010101 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1A - A- A- A-0A-0A-0A-0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0A- A- A- A- - - - - - - - - - - - - - - - - -N2 2 2 2 2 2 2 2 2 2A2A2AAAAAAAAAAAAAAAARNNNNNNNNNNNN2N2N2 2 2 2 2 2 2 2 2 2 2 2 2 2gs C C C C C C C C C C C C C CN CN CNNNNNNNNNNNN9a S S S S S S S S S S S S S S S SCSCSCSC C C C C C C C CC mmmmmmmmmmmmmmmmmmmSmS S S S S S S Sa o o o o o o o o o o o o o o o o o o o omomomomommmmsrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrProProPro oPrPrPONDIQESecneuqeSediuGnoit1a414242444444495667 6 9 4 1 4 0 3 9 5 3 4 1 6 8 4 0 5 8t9393939393939393963973973989999900000010202040404060707070on2 2 2 2 2 2 2 2 2 2 2323 3 3 4 4 4 4 4 4 4 4 4 4 4 4 4n5a65 5 5 5 5 5 5 5 5 5 52 2525252 2 2 2 2 2 2 2 2 2 2 216161616161616161616165161616165165 5 5 5 5 5 5 5 5 5 5161616 6 6 6 6 6 6 6 68: : : : : : : : : : : : : : : : : : :1:1 1 1 1 1 1 1 132gr2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2:2:2:2: : : : :hhrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChr2Chr2 2 2 2ChrChrChr rChChC 637038393041424-0A-0A-0A-0A-0A-0A-102 3 4 5 6 7 8 9 0 1 2 3 4 5A00-000000000000000101010101016017018019 0 10102020A- A- - - - - - - - - - - - - - - - - - -eNNNNNNN AAAAAAAAAAAAAAAAAAAm RgRgRgRgRgR RNNNNNNNNNNNNNNNNNNNNNa_ _ _ _ _g_g_ R R R R R R R R R R R R R R R R R R R R Rn1 1 1 1 1 1 1 g_g g g g g g g g g g g g g g g g g g g g00 0 0 0 0 05_5_5_5_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _A- - - - - - -NA 0 0 0 050505 5 5 5 5 5 5 5 5 5 5 5 5 5 52A2A2A2A2A2A2 - - - - - -0-0-0-0-0-0-0-0-0-0-0 0 0 0 0gNNNNNNNAAAAAAAAAA- - - - -R2s N2N2N2N2N2N2N2N2N2AN2AN2AN2AN2AN2AN2AN2AN2AN2AAN2N29Ca SCSCSCSCSCSCS C C C C C C C C C C C C C C CNC ma omomomommmShShShShShShShShShShShShShShSChSChSChSChSChSChShsrPrPrProProProPrPnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEONDIQESecneuqeSediuGnoit8a8699980802262035 8 7 8 1 3 7 3 0 0 6 9 2 7 3 8 9 4 8 8t04040414141413 3 4 441414141 162626272444444446464747474848484on2 2 2 2 2 2 2 2 2 2424 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7n5a65 5 5 5 5 5 5 5252 25252525252 2 2 2 2 2 2 2 2 216161616161616516165161651616165 5 5 5 5 5 5 5 5 5161616 6 6 6 6 6 6 6 6 6 68: : : : : : : : : : : : : : : : :1 1 1 1:1 1 1 1 1 1 132gr2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2:2:2:2: : : : : : :hhrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChr2Chr2 2 2 2 2 2 2ChrChrChr r r r rChChChChChC 223 4 5 6 7 8 9 0 1 2 3 1 2 3 4 1 2 3 4 5 6 7 8 9 002 2 2 2 2 2 2 3 3 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 11121-0-0-0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0AAA- A- A- - - - - - - - - - - - - - - - - - - - - - -eAAAAAAAAAAAAAAAAAAAAAAAmN RN RN RN RN RN RN RNNNNNNNNNNNNNNNNNNNNNa g g g g g g gRgRgR R R R R R R R R R R R R R R R R R Rn _ _ _ _ _ _ _ _ _g_g g g g g g g g g g g g g g g g g g5 5 5 5 5 5 5 5 5 5_5_5_6_ _ _ _ _ _ _ _ _ _ _ _ _ _ _A N0 0 0 0 0 0 0 0 0 0 0 0 0606 6 7 7 7 7 7 7 7 7 7 7 7 7- - - - - - - - - - - - - -0-0-0-0 0 0 0 0 0 0 0 0 0 0gAAAAAAAAAAAAAAAAA- A- - - - - - - - - -R2s N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2AN2AN2AAAAAAAAN2N2 2 2 2 2 2 29a C C C C C C C C C C C C C C C C C C C C CNCNCNNNNNC S S S S S S S S S S S S S S S S S S S S S S SC C C C Ca h h h h h h h h h h h h h h h h h h h h h h hShShShS SsnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnhEnhEnEONDIQESecneuqeSediuGnoit2a97999011161817071926 4 5 5 6 6 7 9 0 0 0 7 7 9 0 0 1 1t47474757575757393934936936 693936363636373737373737383838383on2 2 2 2 2 2 2 2 2 2 2 2 292929 9 9 9 9 9 9 9 9 9 9 9 9n5a65 5 5 5 5 5 5 5 5 5 5 5 5 52 2 2 2525252 2 2 2 2 2 2161616161616161616161616161651651651616165 5 5 5 5 5 5161616 6 6 6 6 68: : : : : : : : : : : : : : : : : : : : : :1:1:1 1 1 132 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2:2:2:2:grhhr r r r r r r r r r r r r r r r r r r r r r r r r r2rChChChChChChChChChChChChChChChChChChChChChChChChChChChC 3114015161718191 02-0 003040506070809001112131415 6 7 8 9 0 1-0-0-0-0-0-0-0-0-0-0-0-0-01-01-01-01 1 2 2-0-0-0-0-eA-0A-0A-0A-0A-0A- AAAAAAAAAAAAAAAAAAAAAA NNNNNNNN RN RN RN RN RN RNNNNNNNNNNNNNNNm R R R R R R R R R R R R R R RaR R R R R R Rg_g_g g g g g g g g g g g g g g g g g g gng_g_g_g_g_g_g_202_02_02_02_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _020202 2 2 2 2 2 2 2 2 2 2 2 2 2A707 7 7 7 7 7-0-0-0-0-0-0- -A- A- A- A- A- -0-0-0-0-0-0-0-0-0-0-0-0-0-0-N2 2 2 2 2A2A2A2A2A2A2A2A2A2AAAAAAAR A2A2A2A2A2A2A2NNNNNNNNN2 2 2 2 2 2 2gs NNNNNNNC C C C C C C C CN CN CNNNNNNNNNN9a C C C C C C C S S S S S S S S S S SCSCSC C C C C C C CC S S S S S S S mmmmmmmmmmmmmSmS S S S S S Sa h h h h h h h o o o o o o o o o o o o o omomomommmmsnEnEnEnEnEnEnErPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrProProPro oPrPrPONDIQESecneuqeSediuGnoit4a84878888898989898989 3 3 4 5 5 6 7 7 8 8 8 8 9 4 5 3 0t39393939393939393893939 9 99393939393939393939393041626263646on2 2 2 2 2 2 2 2 2 2 2 2 292929 9 9 9 9 9 9 9 0 0 0 0 0n5a65 5 5 5 5 5 5 5 5 5 5 52 25252525252 2 3 3 3 3 3165161616161616161616165161616516161616165 5 5 5 5 5 516161616 6 6 6 68: : : : : : : : : : : : : : : : : : : : : : :1 1 1:1:132 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2:2:2 2 2:2grhhr r r r r r r r r r r r r r r r r r r r r r r r r r rChChChChChChChChChChChChChChChChChChChChChChChChChChChC 223242526272829203132333435 6 7 8 9 0 1 2 3 40-0-0-0-0-0-0-0-0-0-0-0-03-03-03-03 3 4 4 4 4 4-0-0-0-0-0 0 0 1020304050AAAAAAAAAAAAAAAAAAAA- A- A- A0-0-0-0-0-eNNNNNNNNNNNNNNNNNNNNN AAAAAm R R R R R R R R R R R R R R R R R R R R RN RN RNNNNNa g_g g g g g g g g g g g g g g g g g g g g g gR R R R Rn2_02_02_02_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _g g g g g020202 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2_ _ _ _ _A -NA-2A-2A-2A-2A-02A-02A-0-0-0-0-0-0-0-0-0-0-0-0-0-0-0- 808 8 8 82A2A2A2A2A2A2A2AAAAAAAAA-0-0-0-0-RgNNNNNNNNNNN2 2 2 2 2 2 2 2 2A2A2A2A2A29s Ca SCSCSCSCSCSCSCSCSCSCN SCN SCNNNNNNNNNN SCSCSCSCSCSCSCSC C C NNNNNC ma omomomomomomomomomomomomomomomS S S ComomomommmmSChSChSChSChShsrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrPrProProPro oPrPrPnEnEnEnEnEONDIQESecneuqeSediuGnoit1a4945575260757586 8 4 5 5 0 1 3 9 4 8 0 6 3 9 4 8 9 6 6t6060606060600606080281281828383838384848585868687878889809on3 3 3 3 3 3 3 3 3 3232 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2n5a65 5 5 5 5 5 5 5 535353 35353 3 3 3 3 3 3 3 3 3 3 31616161616516161616161616516165 5 5 5 5 5 5 5 5 5 5 5161616 6 6 6 6 6 6 6 6 6 68: : : : : : : : : : : : : : : : :1 1 1 1 1 1 1 1 1 1:132gr2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2:2:2:2: : : : : : :hhrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChr2Chr2 2 2 2 2 2 2ChrChrChr r r r rChChChChChC 607 8 9 0 1 2 3 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 800 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 19102-0-0-0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0AAA- A- A- - - - - - - - - - - - - - - - - - - - - - -eAAAAAAAAAAAAAAAAAAAAAAAmN RN RN RN RN RN RN RNNNNNNNNNNNNNNNNNNNNNa g g g g g g gRgRgR R R R R R R R R R R R R R R R R R Rn _ _ _ _ _ _ _ _ _g_g g g g g g g g g g g g g g g g g g8 8 8 8 8 8 8 8 9 9_9_9_9_ _ _ _ _ _ _ _ _ _ _ _ _ _ _A N0 0 0 0 0 0 0 0 0 0 0 0 0909 9 9 9 9 9 9 9 9 9 9 9 9 9- - - - - - - - - - - - - -0-0-0-0 0 0 0 0 0 0 0 0 0 0gAAAAAAAAAAAAAAAAA- A- - - - - - - - - -R2s N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2AN2AN2AAAAAAAAN2N2 2 2 2 2 2 29a C C C C C C C C C C C C C C C C C C C C CNCNCNNNNNC S S S S S S S S S S S S S S S S S S S S S S SC C C C Ca h h h h h h h h h h h h h h h h h h h h h h hShShShS SsnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnhEnhEnEONDIQESecneuqeSediuGnoit7a0516133723344055 0 0 7 4 1 3 0 1 0 2 5 8 9 3 7 2 0 1 4t92929285161615 6 6616161616171818191915151515151616171818152on3 3 3 3 3 3 3 3 3 3636 6 6 6 6 6 7 7 7 7 7 7 7 7 7 7 9n5a65 5 5 5 5 5 53535353 35353 3 353 3 3 3 3 3 3 3161616516516165161616161616165165 5 5 5 5 5 5 5 5 5161616 6 6 6 6 6 6 6 6 6 68: : : : : : : : : : : : : : : : :1:1 1 1 1 1 1 1 1 1 132gr2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2:2:2: : : : : : : :hhrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChr2Chr2 2 2 2 2 2 2ChrChrChr r r r rChChChChChC 122 3 1 1 2 3 4 5 6 7 8 9 0 1 2 3 1 2 3 4 5 6 7 8 902 2 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 00110-0-0-0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0AAA- A- A- - - - - - - - - - - - - - - - - - - - - - -eAAAAAAAAAAAAAAAAAAAAAAAmN RN RN RN RN RN RN RNNNNNNNNNNNNNNNNNNNNNa g g g g g g gRgRgR R R R R R R R R R R R R R R R R R Rn _ _ _ _ _ _ _ _ _g_g g g g g g g g g g g g g g g g g g9 9 9 0 1 1 1 1 1 1_1_1_1_ _ _ _ _ _ _ _ _ _ _ _ _ _ _A N0 0 0 1 1 1 1 1 1 1 1 1 1111 1 1 2 2 2 2 2 2 2 2 2 2 3- - - - - - - - - - - - - -1-1-1-1 1 1 1 1 1 1 1 1 1 1gAAAAAAAAAAAAAAAAA- A- - - - - - - - - -R2s N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2AN2AN2AAAAAAAAN2N2 2 2 2 2 2 29a C C C C C C C C C C C C C C C C C C C C CNCNCNNNNNC S S S S S S S S S S S S S S S S S S S S S S SC C C C Ca h h h h h h h h h h h h h h h h h h h h h h hShShShS SsnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnhEnhEnEONDIQESecneuqeSediuGnoit0a6567617085868296 9 6 4 6 3 5 2 8 3 1 6 9 2 9 0 9 0 1 1t2929292929292929 992920931313232333334353313141415151617171on3 3 3 3 3 3 3 3 3 3939 9 9 9 9 9 9 9 0 0 0 0 0 0 0 0 0n5a65 5 5 5 5 5 5 5 5 53 3535353 3 3 3 4 4 4 4 4 4 4 4 4161616161616161616165161616165 5 5 5 5 5 5 5 5 5 5 5 5161616 6 6 6 6 6 6 6 6 6 68: : : : : : : : : : : : : : : :1 1 1 1 1 1:1 1 1:1 132gr2 2 2 2 2 2 2 2 2 2 2 2 2 2 2:2:2:2:2: : : : : :hhrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChrChr2Chr2 2 2 2 2 2 2ChrChrChr r r r rChChChChChC 203 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 700 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 2 0 0 0 0 0 0 08090-0-0-0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0AAA- A- A- - - - - - - - - - - - - - - - - - - - - - -eAAAAAAAAAAAAAAAAAAAAAAAmN RN RN RN RN RN RN RNNNNNNNNNNNNNNNNNNNNNa g g g g g g gRgRgR R R R R R R R R R R R R R R R R R Rn _ _ _ _ _ _ _ _ _g_g g g g g g g g g g g g g g g g g g3 3 3 3 3 3 3 3 3 3_3_3_3_ _ _ _ _ _ _ _ _ _ _ _ _ _ _A N1 1 1 1 1 1 1 1 1 1 1 1 1313 3 3 3 3 4 4 4 4 4 4 4 4 4- - - - - - - - - - - - - -1-1-1-1 1 1 1 1 1 1 1 1 1 1gAAAAAAAAAAAAAAAAA- A- - - - - - - - - -R2s N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2N2AN2AN2AAAAAAAAN2N2 2 2 2 2 2 29a C C C C C C C C C C C C C C C C C C C C CNCNCNNNNNC S S S S S S S S S S S S S S S S S S S S S S SC C C C Ca h h h h h h h h h h h h h h h h h h h h h h hShShShS SsnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnEnhEnhEnEONDIQESecneuqeGASAGTTGA Aaage C T T AiCAaaaagtttagC CtAAACCa c a gg ggtGAGTAAAAAAtagcct c caGTAAAAccaag gt ad T T CuC GAATTtcaa taA CTGTCTT ATCCTGA GGGT c tca agcttaGnoita7t18 819 910212121 2 323 3 4 4 5 5 6nect tgacct gc aa tato014040140404040402402 2 2 2 2 2 2 240404040404040 0 0u aqat agat at ctg ctnn5a651656565656565656565656565654654654656 es gt8:1 1 1 1 1t at tgatgcta cgc ag ga32:2:2:2:2:1 12:2:1 1 12:2: :1:1:1:1:1:1:1:naa c atccac at ttagggrhrhrhrhrhrhrhrhr2hr2hr2hr2hr2hr2hr2hr2 2hrhrhe tmat gcta gaccgth C C C C C C C C C C C C C C C C C Celteg c ca cgccggyatcc trc cagagcttaccccatoagg a t gt011012131415161718191021222324252627tgt 2al-0-0-0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 u etcactatagtttcct gacccattgtacaggeAAA- A- A- A- A- A- A- A- A- A- A- A- A- A- A- Age n gccc caccatNNNNr eu tt gcc g tt gmaR R R RNNNNNNNNNNNNNNy qacccgtg tagcng_g_g_gR_gR_gR_gR_gR R R R R R R R R R r e a a_g_g_g_g_g g g g g g alS g gca gtaggggA4N1414141414 4 4 4 4 4 4_4_4_4_4_4_4 p- - - - -1-1-1-1-1-1-1-1-1-1-1-1-1mvRgA2A9s N2AN2AN2AN2AAAAAAAAAAAA- Aex olN2N2N2N2N2N2N2N2N2N2 2 2 2Eag rea CC SC C C C C C C C C C C C CNCNCNCNC.3 e emtoa hShShShShShShS S S S S S S S S S Sel m otmsnEnEnEnEnEnEnhEnhEnhEnhEnhEnhEnhEnhEnh h hEnEnEnEbaaysur orT NC i PQESggggttagcgaggaaatcggggg acc gtcacaa tcc cgaacc gt a agGA Aga cggg gta tagtcgacgcgg c ga ccagcccc gggagcccga cccgggagG c AGgTa ccccaggacga accggccaggaagaaggtcc ctt cc acacgaccct ctcc acacgacG c AC tatcccgac ca cacccccaggtagcgtagc ccg acaaggaatc tc ccg acaaggatcAt CGccccggac atgta cccgggtgcaagacggc catcgt ctctac gcggcgaacccttttc ccttgcac gcggcgaacccttttcTgC ctcCagccttggcg ggcc ccttcg g a ccg a gt gccc tta gt gccc ttg g aaca cgag ccg tcac ctcgcg cc gaagg ag gatcac cccgaagg ag gatAc c cgcac Cgttg cg gg acgtgaggg acgacccgaccaggg ccc cgattt accaggg ccc cgattG Aagatctcagg cc aacaggat a cgagtcgaggaagcgag cccacgtgtaagcgag ctccacgttGacccgccgaga cg ggtgtacggct accc gccagccag gcccgc atc gca ccag gcccgc at GT cctcccgtga ccacgcgat cgg ga agaacgt c ct acgtta ggtacact acgt ctaCCtacccggcctatcc caecgtcc ccgcggcagacatccggcccgcg cagacatccggcccgcgAcccttgcg ccgc cggtn ge acctccggg gtcctctc cc gccgacgctctc cc gccgaTgTcccc ga cctc agctctttu ac a c cga gct g g a a gct g g aAaagt g a c ccqe gtcgg cgcgcgcggcaca c a ccc g gcgg a a c a cAc g c c g ggtgc ccc g g gtgc c g gTc a g g g a tSga g gcctccc ggcgc g gccg g c gTcacagccgcgccac1 23.3.n re 3ienasptoV_V2_V2_mama mS S2SNu nHyoSrPNCNCNCQESgtaaaagggagggg acgg gccc cttg tcgactt cc cccggc a cc caga ccg g cc caga c gagacc gccc cc gg accttctgg ggccagatc ttg gg cggctcttg ggccggcggaa ggctac ga aa aggaccggcacgagcgt ga ccccgccaacgag agg gtt cat gac ccgc cgc tcccc cc atg cctg cg ga g ggca gcag ga g ggcattcgc ccct cgtatt acccc cgg gtac aatt acgg gtacgaa tcttg cct ggccaa tcttg cct ggg g c ggcg ggtcctg t ttgt g cc gt g c ggg a c cggg gcctcacgg g t tt a gc tt a ggg gagcg ataacgc tcc c agga c agcca gt ct ctccg a gcacag cg ctgg c gc agccg tag gttgc gaatgca ctag cg ctggttgcgatagtctt caca agagtcgtt cacag ga gggacccgccacgg cacggctagcacacgctaaa gggg cttc ga ctga cctt agctcctgac gtc cg tt ccagtc ga ctga ct gcttg acta tgga tc gg acta tggaecggct cc gctc cc ca acatc gccgc gcccccgctat aa attc g cg gt aa attc g cgn ae gac gggcg gctccttcc g cgacgccacccgcct gcaccga ga cc gcaccga gau a gccgcq ge a cgcctccacgctcggggacgctcggcagacggatggca gcgggatggca gacggtccc gcacaccgagcggagggccgtccgaaggg agggt aaggg agggS ctacccgcccggtgcccggcgccgggagcccccggcaggggaaaagggt gtacgggaaaagggt t3.1 13 3.4 7.eV V7_V V V2_ _ _2_S2S2S S2maN N N NSNC C C CNCQEScatt gatgg t gcaaga gg a g g g g g a a g a g c a t c g c a t g a a g c t c a t g c c actac aagggaactcccg acggccgga c g c g g c a g c t g a g c c g a g g a a g a a c a gtgct gaaaaga ga ccga gcgggtg c a a c asta g a a c a a g a a c a t g t t a a c a c c g t c g a g a a g accaccgaat gtt ccggaggcc og a t g c a g g a c g g c a a g ctcgctacg ag gagcctgagggat aagt a atca c c a c g t g a a g a a c g t a g g a a c g a c c a g a g g a cg gc tg neg g g g g g g g t c g g c a a c a c a t c a a g a a c a t ggaa gtt a g gaattatcat caactgcc gc a atgta gtatcttaccgsge eccc g a a t g c c g g t c t a g a a c g neg a t g a t c c g c t a g a t c a c g g g c a c a c c a t g a a acgtgtt tatg gcg ttcggg atggtt gg a neua c c a t g a c c g a g g a g c a g g g c a g g g g agtattg gttg tggg aagg uqt t g a g g qec g g g g a t g g a c c a g a t gtgggcgcat tag g Sc t c a t g g a g a c g a a g c cca tatgagcg cagtesagtacttagcgctcccctga g aaatc acagc cttgggttcggtegccdittnec ga c at ana at cegc cagggtta ggt tgagtagag oeaic cc c a g cagc lcra nuga c attgt gtgggaagtggguVogatg Lgccaaagacg cgccac ag nqeaSagggggaaaag aaaacaagcc g aaaagaggtgga gtycralp sseue.37.mei2 xce ruaeV7pS.S_V2_E.24ma S S elem9saNNCNCbaaCT NdONDIQESa g a g c g c c g a g c g g a c a c c a a c c g a a g g a c a t c a t c a t c a t c a t c c t g a g c g g a g a g a t g c a g g a c c a c t a g a a g g g g c a g c t g g a c a c g g a c c a c g t g a t g g t c t g c a a g g t g t a c c t c g t g g t t a g g a a c g a c t t c a a c a t g g g g c a c a g c c a c a a g c a g g g g g g g g tecc g g g g g g a a g a a g a a c a a g a t c a a t g a c a t c a a g a c g a g g a t g g a c a a g a a g a a c a c g c a t a t g c c g g t cnec a c a a g c t g a a c a t c a t g a t g a t c g t g a t g a t c c guc a g c a g c c t c c a g c g c c a g a t g g g t c a c g g g c a c aqa c a g g a t c a a c g a g g g g a a g a a g g t c a c c a t g a c cea a c g a g t c g t g c a a c g a g a a c a a c t c g a g g g c a g g gSc a g g c t c g t g a a g a c c a t c a a c g c t g t c g g g g a t g g a c a a g c g c g a c g t g a a g g c c a t c g a t c c t c a t g g a gtnairtaroVhSssei uc ee rp uaS.Sem9asaN CdONDIQESc g g c a a g a t c a t c a t c a t c a t c c t g a g c g g a g a g a a g a a c g t c c a c t a g a a g g g g c a g c t g g a c a c g g a c c a g a g g a t g g t c t g c a a g g t g t a c c t c g t g g t t a g c g g c a a c t t c a a c a t g g g g c a c a g c c a c a a g c a g geca c a t c g a c g g g g g g a a g a a g a a c a a g a t c a a t g a a t a g a a c g c g a g g a t g g a c a a g a a g a a c a c g c a t a tnec t a g a t c c a c a a g c t g a a c a t c a t g a t g a t c g t g auc c a t g a a c a g c a g c c t c c a g c g c c a g a t g g g t c a aqg a g g a g c a c a g g a t c a a c g a g g g g a a g a a g g t c a ceg t t g a g g a a c g a g t c g t g c a a c g a g a a c a a c t c g a gSa c c a g a t c a g g c t c g t g a a g a c c a t c a a c g c t g t c g a c g a a g c a c a a g c g c g a c g t g a a g g c c a t c g a t c c ttnai / rtarnoohdVSocssei uc ee rp uaS.Sem9asaN CdONDIQESg c a g g a c c g g g a g c a c c g c c g a c c g a c a c t a c a a g a t g g c a a g a t c t t t c t c a t a a t c c t t a g t g t a c g t g a a a a a t g t c c a a t a a a a g g g t c a a c t t g a c g a a a g a t c a g a g a a t g g t t t g t a a g g t g t a c c t c g t g t g c g g t t g g a a a c t t t a a t c t g g g a c a c a c t c a a aecc t c t a t a a c a t c g a t g c g g c g a a g a a g a a t t a a a t a a c c g g t t t a a a a a g c a t g a t t g g a c a a g a a g a a c a cnet g a t t c g t t a a a t t c a t c a a c t g a a t a t c a t g a t g aug g g c a t a c c a t a a a c a g g a g c c t t c a a c g g c a a a t gqa a t g a c a g a t g a c c a t a g g c t t a a c g a g g g a a a a a aeg g c a t g g a t t g a g c a a t g a c t c g t g t a a g g a c a a t aSg g c a t g g a g c a g c t t a c g c t c g t a a a c a c c a t g a a c g c t a g a g a c g a a g c a c t a g c c c g a t g t a a a a g c a a tt dn ea zi iramitVpo1#seicepSemaNONDIQESc a a c a c a a g a c g a g a a c a a c c a g a g a g g g a g g g a g a g a a a c c t a t c t a c t a c a t g c a g g a g a c g g a g g g g c t t a g a c a g c t a g a t t t g t t a g t g a a g g t t a a t a t c c a c g c c g a g g g g g a c a t c c a g c g c c a g t a g a t c g g t c a c g c c a c t g t c g a c a a c a a c a t geca a c g a c a g g c a g g c c a a a c t c a t g t c g t t g g t t c a a c a g a a c c a g c c c t t g t c t c c a t a c a g g t t g t a g anet g g t c t t g a a t g t a a t c g c c g a t g c g a a a g t c g a cug g t c a g c g t g a g g c c c c g g c c a c a c a a g c c g a a c aqg g t g g a c c c c t t t g t g a c a g a a a a a g a c g c a g a a gea c t c g g g a a g a a c a c c g c g a g t a c c t a g a a a g g g a aSg c t g t t c a c g c t g g a c g a g a a c g g g a a c t c t g a t a g t g a c c a a g g t g a c c a a c g t c a g g c g g g t g c t c a t g ctnairagnVoLsesnei ec ge op ypS.Sem9asaN CdONDIQESaggaatcgacgaattattcagtactcagga gagaacttaaaaaacattaagaagttgaag tgtgatcgaggaaaataagatcatcttcat acgaactaattggggcggaagtcatggtcc gacgtgcagcttatagagcatatattaata tctaaagaatgaccgcggaataggtcgctcc atggtagtaatgtcgcaatcgcgcagaccaa ctgcggcacatctacagtgggaaaaaacccg ccacgatattcattacggactcgatcaggca ttacggatgagtactctgaactaatgaaagg agtgataatgaggctgaggcaaaggacaccg gatggacgtccaagtgaacgtcagcactgat tcgtaattgtgactgacaccggtcagtatgg tacaagatatgctataccattgactacgcggecggcggacaagaccgtcgagaggtgactgctc agaatcatgaaatttgggagatagagtggctnecgggttgcaaacgaagtgatccgcaaaacccuggacatgtagaagcaacgacaggatgacgtgqtgctgcttggcatggtatagttaactgacgaeaagaggcaactgcctacgaatcaataccggcSccttaaagcaatggcaattacaaacagggat t c c t g c a t t a c a a t t a t g t c g a g g c t a a g g ctnairaVseicepSemaNsrotavitcasnartgnidoct t t g t g t g g t t c c c t g g t a g c c a c g c a t c c c c ana a a g a g a g g a g c c g c g a a g a c a g t g t g c c c c t gec c c c c c t c t c c c t a c g g t t a c g g c a g c g a g t g csa a a t a t a t t t g t c c c a a c c g c a t a c t c t c t a g ceg g g c g c g c g a a t g c g c c t c g a g a g a c a a g t c g ccc c c g c g g g a c c g a a a c t c g a g a a g c a c c a t t c tnt t t t t t t t a g c t c c g a c g a c t a a t g c t c g t t t aec c c a c a c a a a g g c c g a g a a c c g c c a a t c g t t g gut t t c t c t c c g c g a t g g c c g t a t c c c c g g g g g a a gqa a a a a a a a g a g t c c t t g t c c c a g a t g t a t t t c c aeg g g g g g g g c a a a g g c c g t c c t g g a a g g g c c a c c gsc c c g c g t c a c c c t g t g a c g t g c t g t g c c t g g g g g t t t t t t t t a t c c c t a t c a t a g c g t a a c c c t g g a tet t t c t c t c a t t a c g g c a g t c g c t c c g g a c t g c g tdit t t t t t t c g a a t t t g g g g t t c t c t g c t c c c a c t gta a a a a a a a a c g c c c a a t a t t t a t a t g c c c c a t a tog g g g g g g g a a a c g g g c g g t t g g a g a g c a g g g a c celc c c t c t c t a g c c t g c g c c g a a g a g c c t c t a g a a cca a a t a t a t a a g t c a a a t a t c c a c a c c a a c c g g t aug g g t g t g t a g a t c c g c c g a c c g g g g g g c c t a c g cng g g c g c g c g c c g t a c c g c g g g g t c t g c t t c c a a tyet t t a t a t a c a c a c c a t g g g g a t c c a a c c c t c a c g c c c g c g t g c t c g g c g t c g g c g t g a c c a crcg t t a c aang g g t g t a t t c g c g t c g c t a c t g g g g a c c a t t a t clepuc c c a c a c a c c t a a c t a c c a t a t a t t c g c c a a c g c q g g g g g g g g t a g g c c t g a t g a c c g a t a a g c g g c g g c c c g c g c t a g c c t a g c c g g mea a c a c c t c g t g g g c geSa a a t a t a t g g c a c g a g t t g g t a a c t c a t a t g a c a g g g t g t g c g c g t c g c a a c a c g c g t c c a g g a c c a gxE.5)1)e(2)(3(le 616 6 4bmaa P1P1P6PRP 56atTN V V V V Vp RNDIQ ccaacagtcgagtaggtctaccggggaacccccgcctaccctttccaggtaaaccgag a at g tdIT VGPKEQTPR KRT K N K V P D a a g c t a g g t a g t t YL YFI SK G S E P F g a c a ag t at c cng a a t a c a t a N RLNKE P SKKIDIEIEAEAY A K Y Y R D g t a g a g g a g g a c a K D K Y K D t a g t a a g a t c a t cc t g t a tsKY EGQ E KE ERD D T N D L t t g t a g c g c a c a a g g g t a t ga g aecA ADFLA E GKFSSQQI QKTD L K L E N A t c t a g g K R Y K M D a g a t c t g g a g t a aa g cnPL KP SRE V K T N K a c g t c g t t g g g c ac a ceV GVNQY L LVL N A W a a t c g g g a a t t c gg g guGLKSN ENS G I E R a t a g a a c t t a t t at c tqHE IDTVNE Y T V L G g t a t g g a t a a t t ac c a g a ceg g gsIKVRS Y YI TV KQR K NRK L E D Y S c g t t t t t a t g a g g F T E L E G g g a g t a a g a a g a ta t teG TIVRQIQ RQLFIK NNPNII D Y N R S a c a a g a a c t a a a a a t a a g a a g g a c g ag a tna c ceE R KKA VRK F SFD F N Y K Y A K I D I K V T E g g a a g t a a c c g a a a c g a g g a c a t t ga c tgg t csencR R K T E n K H T E YIK R S L YQL KQN M DKD L E FQA L Y T I S t N E L V D G a g a a a c g c t a a c g V A R P F g a t t a a g a a c a a gg g ca eI K K R L L E L R N S S a c g t c a a g g a t t ta a gr uI N N K M K P R E D L a c c g t t g a t g a t ca g tt qL N I V F I P K Y N K a a a c g a g a t g t a ag t g a t ayeSA R N I K E F M S R L K E V V K c c a g c c t t a a c t t M K G Y E A I K R N A K D G E A c t c c g a t tc c grc a cac a c g a l c c apc a g m - e9-9xsaE.C6d4ds6iPca )aeCd46ePdit)eele aS-Vo cnaS Vo cnS-S ni eu- -el ebmaa L LmqSLSLcuuqTN N Na(esN Nn(esttatagaagcgatagactaggttgttgagacgtaaaagctactagaggaaagctcg a c g a c c t t c c t a g a a a a a a c c t a a a c c g g g a a g c t a gg g a c g a g a t t t t c g c g c t t t a t g t c a c t a t c g a c a a g ac g t t g t t g c t a c c g g a a a a g a c t g a g g c g c t g t a g a g ga a t a t a a t g g t t g g c c c g g c t g a g a t c c c t c t a g t a a ga g g a g a g t t a a a t g a t c t c a g t g a c g t t g a c t t g t a g ct c g a c a a t t a a t a c g a g c a a g a c g a g a a a g a g g g t a t ga g a c t a g a c a a g t a a a c g t a t a t t t a c c a t g a g a t c t gt a a t c a c t a c a a g a a a a a g c c t t a c g c a g t c a c g t c g ta c a a c a a g g a c g g c g a a g t g a t a t t a a a a t t a a t c g g gg g g a c t a a a a c a c t g g t g t c a c g c t t g a c t t a t a g a a ca a t c a t a a a t t a g a c g a g c c a g a a c a a a t a t g t a t g g aa a t a c a t a g a t a c c g t t a g c g a c t g a a a t g a c g t t t t ta a c g c c a c c a a g a g c a t t g a a a a c a g t a g c g g g a g t a aa c a t a t g g t c g a t a a a t a t g a c t a a c t t g a c a c a a g a at t a a a a t c c t c a a a c t c a a t g a g a c c a g g g a a t a a g a aa a t a c c a a t t g a g a t g t c a a c a c g g a t a a c g g g a a g t at t g c c c g a c t a c g a a a a c g c a c c a c a t a a t c a c g a g g aa c a c t g a a c g t a t t c a a c t t t g a g t g a a a c t a g a a a c gg t c a t t a a c a g g g t a a a a t a t g a a a t g a a t c g a t t a a gc a t t a a a g t c a a c g a a g a c c a c a a t c g t a c g a c g t c a aa c a a a a a g a a t a t a a a a a a t t a t a t c c t g g c a c c g t t gc c g c a c c a g a c c c a c a a a a a a t t g t t t g a t g a a a c g a gc a a g g t t a c t t c c a a g a a c t a t c a g c c g a a c c c a g c c t a g c g a a c g g a g t a a t c c a a g a a c a a c c a g g a c t c c g a t -9saCd4a6SPdeze )d1ie-Vi tocnS-mi eleLSLtp cuqN No(unesttactaaccagctcgactaccattcggaagacttggaagttgttaacgaatcgagtggataccggggatttattgcaacattatacagatagaccactaccgatataccgcttaattataattatgagtagttgacgaccttcctagaaaaaacctaaaccgggatacatggacgagattttcgcgctttatgtcactatcaggacacgttgttgctaccggaaaagactgaggcgctatcatcaatataatggttggcccggctgagatccctcgcacaaaggagagttaaatgatctcagtgacgttgactctaggtcgacaattaatacgagcaagacgagaaagagagtaaagactagacaagtaaacgtatatttaccatgtgggcataatcactacaagaaaaagccttacgcagtcaattcgacaacaaggacggcgaagtgatattaaaattttattagggactaaaacactggtgtcacgcttgactttaattaaatcataaattagacgagccagaacaaatatatgaggaatacatagataccgttagcgactgaaatgagaagataacgccaccaagagcattgaaaacagtagcgctaaaaacatatggtcgataaatatgactaacttgacggacgattaaaatcctcaaactcaatgagaccagggaaccgaaaataccaattgagatgtcaacacggataacgcattgtttgcccgactacgaaaacgcaccacataatcctaacgacactgaacgtattcaactttgagtgaaactaacaaggtcattaacagggtaaaatatgaaatgaatcggatttcattaaagtcaacgaagaccacaatcgtacgatgatcacaaaaagaatataaaaaattatatcctggcatgtaaccgcaccagacccacaaaaaattgtttgatgtaacttcaaggttacttccaagaactatcagccgaac t c a c g a a g c g a a c g g a g t a a t c c a a g a a c a a c c a g g a043acggctaccggtccgggtcctacatcaaagagaaccgccgcccgtgcggcacctacagccaggtggtcgacgacctccggagcaacaacctgagcaaggagcacatcgaagagatgatcgcgctctacgtcgtcgaggaggacacgttgttgctccccgacaacaccgacagcaacatcatcaacatgatggtcggcccggccgagatcgtggcgcacaacggggagctgaacgatctcagcgacgggtaggtctaagtcgagaactagtatgaccaggacgaagagctggagtagaggctagacaagtagacgtacatctacgttgtcgggcacaatcactacaaaaagaagccgtacaacccggacttcgacaacaaggacggtgacgttatattatagtacttgctggggactaagaggatcgtaccgcgttgcatggacaactagatcatcaacaaaacgagacagaacagcctctacgaggagcacatcgacactgtcagcgactgggagcaggaggacaacgctacgaagaccatcgagaacaagaacaactacaaccacatggtcgactagtatgactatatgaggagcacgattaacatcctcaaactcaacgatacggaggtgaccgagaataccaactgcgacgtcaacacggacgaggaaatcgtctccccgaccacgaagacgcaccacaggaacgccaacgactccgagcgcatacagctctgggtgatgaagaataaggttatcaacagggtgaagcacgagaaagtgaaggacttcatcaaggtcaaggaggaccacaacaccgtcgacgaccacaagaagaacatgaagaactagatcaaagagatgtaaccacatcacagccacaagaagttatccagactcaacttcaaggttaccagcaacaactaccag c t c a g g c t c a c g a a g c g g a c c g a g a a g t c c a a g a a c a a-9saCd4a6SPdeze )d2ie-Vi tocnS-mi eleLSNLtp cuqNo(unescccagagaacagcaagtacaagaggtccatgagagacatccactacagctagtag g g a t AYPISK QF E KY t c a a g g t g g t c a a c a g g g a a c g a L MLIWKKtcQ FEDL a t g t t g c a g a a g g t c a a g ga t c g t g GNVg L t c t IIG VD HHKRRK I VR t a g c c a g g t g a a g a a c a t ga c t a tD M YYAD g c a a g g a g c a c c a c a g c c ag g cR Pc c c c t YGSV SL L KKFLFH K NT g t c g a g g a g g t c a c c a g c atI L GIAR c a g c a a c a t c a c c g a g a a gg t c g a t NLEG I IT SD t c g t g g c g c a g g g g g t c a tg a a g g a R R KE TKILKDL IGS g g g t a g g t c t t c g a c c t g ga c c a c g KESDHKK H E M g g a g c t g g a g g a c g t c IYSFGQHQYYV a g cg c a g t t A R NGS a c g t c g t c g g g g c g t a g a ac a a c t t ADTLR R L V a a c c g g g a c t a g a t c t g c gt g a g c t P R YIKGL L SNPITTIQDPFR EAE g t a g a a c t t g a a c c g g a a ga a g a a c VL ER K I g c a t g g a c a a c a c c a a c a tg a a c g a G K AD S F D YRSG c g c c t c t a c g t c a g g c g c cg c a g t g HNYQL N K EH KN g g a g c a g g a g a g g a t c g t g a c I L M ESS VI Hcc t cPLKK a g a a c a a c t a c a g c g t g a at a g g g a GDE E K A Y GSKK YL a t g a g g a g c a g c a a c t a c aa c a a a g VL Kt a K a a c t RLL V W TLY E TYV Q DYLEM SD QL KNKg g a g g t g a c c a a c t g c a t ca t g aFa c g a g g a c a t g a t g a c c t ag aL LNAQ a g g a a c g c c a a g a t g c g c at a a a c c KKK K R F N E V G g a t g a a g a a c c a c c g c g a gc g g a c t K E I I P N TKEVPVK G A a c g t g a a g g a c a t c a c g g tg a t g g c KKV E D I T V E I K a c c g t c g a c g t g a g c a a g gt t g a c g P L K E R R IS NR V K a a a g g a g a t g a a g t c g a a gc c g a a c ARQ A W E N F E K R T c c a g g c t c a a c g a g c g c a g c c a g g a M I K G I G Y P NSY A c t c a g g c t c a t g g a c a c g a -2- v29vsaC4di9sd6 c)a4 ed)a P aec Cd 6P itoec-S SiV- on ne-aS V-elneLniSiLmuqSiLniSLcuuqN m Na(esN m Nn(esaggaacttctacttcagccgcaaccgctactagtcccgcaggagccgcaccacgaa a g a a c t a g a t g c t g g c c a g t c a a g t a a a g a a t a t g a ac a a g a a g t t g t t c g a c g g c c a g g a a c a a c a t a c a t a c aa c a a c t a c c a g c c g a a c g t c g a a g a c g t a a c t t c c a a tt c c a a g a a c a a c c a a g a t a g t a a a a t c a c c g a g t a c t cc g a c a t c t g c g a c g a t g t a g t a g c t c a a g g g g t a a t c gg g t a g a a g a t c g c c a g t g g g t a a g t t t t t g a c c t c g g ag a g g t g t a g a c c c a a a g g g a t c t a g a g g a a g t c a g t g ag a a g g t g a t g g a g t c a a a t g t c g t t g g g g c c t a g c a g aa c g t c c t c c t g a g g g g c a a t c g g g a a t a g a t a t g c g a ca a g g t g c t g g a c a t g g g a t a t a a c t t a a a t c c a c a g a ac g a g a t c a a c c a g c a g g g t a t t g a t a a a a c t t a g a t t ga g c g g c c g a a c a a c c t c a g c c t t t a c g t t a c t c g a c a ca t g a t g c a g g a g a a c c t g g a a c a a g a g a g a t t t g t t a tg c a c c a c a t g a t c a g g c a a a a a a a a t a c a g t g t g a a g cg g g a c a a g g t c g a c g t g a t a a g t a c a a g c a a c t a t a g aa a c c c g a a g c g c g g c a t g g a g g t a t c c a a a t c g a t t c ag a c c a a g a t c a g c g c t a a t g a g g a t a t g a t t t c c t a g aa g a g c g a c g a c g a g g a c a g t a a t g c t a a a a t a c g t a a gg a g a a c a t g a t c a t g g a g a t c a a g a a c c a t c g t g a c g ag a a c a c g a a g a t g c a g g a c g t c a a g g a a a t t c c g g t a aa g g a c c a g a a g a t c a t c a c t g t t g a a g t g a g t a a a g a ga g c t g c g t c a a g a t a c t a a a g g a t a t g a a g t c a a a c a gg t t g g g c g a g a t c a a t c c a a g a c t t a a c g a a c g g a g g t a g a a g a a c a t g g a c a a c c t a a g c c t t a t a g a a a c g c a g -2v9sa4 )Cd 6 de ea Pzid 1itec-S SiV-LniS mio nLteplecuuqN m No( nesacatcagaaacttcagaaattatacgaaatagactactcctcactacttttagagga a c t a t a t g c t g g c c a g c c a g g t g a a g a a c a t g a a g aa g a a a t t a t t g g a c g g c a a g g a g c a c c a c a g c c a c a a ga a t t a t c a g t c g a a c g t c g a g g a g g t t a c c a g c a a c a at a a g a a c a a t c a g g a g a g c a a c a t c a c c g a g a a c t c c aa c a t c t c a g a c g a t g t c g t g g c g c a g g g g g t c a t c g a ct a a a a g t t c g c t a c a g g g t a g g t c t t c g a c c t a g g g t aa g t c t a g a c t c a g t c a g a g c t g g a g g a c g t c a g t g a g ga g g t g a t t g a g t c t t a c g t t g t c g g g g c g t a a a a g a a gg t c c t t c t g a g t g g c a a c c c g g a c t a g a t c t g c g a c g tg g t g t t a g a t c t g g g a t a g t a c t t g a a c c g g a a c a a a ga g a t g a a t c a g c a t g g c a t g g a c a a c a c c a a c a t c g a ac g g c c g a a c a a t c t g a g c c t c t a c g t c a g g c g c c a g c gg a t g c a a g a t a a g c t g g a g c a g g a g a g a a t t g t c a t g aa c c a c a t t a t c a g g t a g a a c a a c t a c a g c g t g a a t c a cg a g a a a g t c g a a g t g a t g a g g a g c a g c a a c t a c a g g g ag c c g a a t c c t g g c a t a g a g g t g a c c a a c t g c a t c c a c cc c a a g a t t t g t g c c a a c g a g g a a a t a a t g a c c t a g a c ca g t g a c g a a g a t g a t a g g a a c g c c a a g a t a c g c a a g a gg a a c a t g a t c a t g g a g a t g a a g a a c c a c c g c g a g g a g aa t a c g a a g a t g c a g g a a g t g a a g g a c a t c a c g g t g a a cg a a c a g a a a a t t a t g a c c g t c g a c g t g a g t a a g g a g g ac t g t g t t a a a a t g t t a a a a g a g a t g a a g t c a a a a a g c tt g g c t g a c a t c a a c c c c a g a c t c a a c g a g c g c a g a t t g a a a t a g a t a g a c a a t c t c a g g c t c a t a g a c a c g a a g a a -2v9sa4 )Cd 6 de ea Pzid 2itec-S SiV-LniS mio nLteplecuuqN m No( nesaagaaaccgctagacgaagtcccacccgaagaagaagacgaacttgtgcaagagctt g a t g a c t a c c a c a a c a t g t t c g a c t a g c c a a g t a ga t c g a c g a c a t g g a c t a c g a g c g g g a g t c a g g a g c a cc a c g t t g t g g t t g g t g a a c a t c a c c g g t g g a g g a c g at t a a c a t g a g c a a g a a c a t g c a c g a t a a g c a a t a t c aa a t g g g g a g t t c a a g c a c t a g t a g g a t c g t a g c t c a cg g t c g a g a g g a g c a t a g c g a a g t c g g g g g t a t g t c t aa g a g g c t g c a c a t g c a g c a t g a g c t t a g a t c t c g a g tc a c a a c c a g a t g t g g g a c a c c g a g t t a c g t t g t c g g gc g a c a a c a t g t a c c a g a a c g g c a g a c a a c c g a g a t t tt a g g g a c c c g t g a c a t a t a a g g g a c c g t a g a a c t t a ct a g a t c a t g c a c g c a a a c t a c c a a g c g a a t c g a c a a tg g a g c a c a t g g c g a a t a a g g a c a a c g a g c c t t t a t g aa c a a t g c c c g c g a c a t c g t g a a t a a t a g a a c a g g a g ga a c c a c a t c c c g a c g a c c g a c t t c g a a t a a a a a t t a tg a t c a a c a a g g a t t t g t a c g t c a g t g a t a a g g a g g a ca g a a t a c c a t c c t c c t c g g t a c c g c g a g a a g t a a c c gg t c t c c c c g c a g a a g c a c g a g a g g g c a t g a g g a a a t tc g a c t c c g t t a a c t a g t c t t a c a a g t a g t a a t g c t a aa c g t c a t c a t c a a g a a g a a c a t g a g t g a t a a a g a a c at t c a t c a a g t c a c t c a a c a g c a a a c g a a g t t a a a g a ct c a c a a g a t c g a g c a g a t c t t c c a a g a c c g t t g a t g aa c c c g c a c c g t g a c g t c a a g a a c a g t a a a a g a c a t a tt t c a a g g t c a t g a c t c c c g a g g c c g t g c c a g g c t c a a a a a a g c g a a g c a a c a a a a a g a t c a t c c t c t c a g g c t t a c -4v9sa4 )Cd 6 de ea Pzid 1itec-S SiV-LniS mio nLteplecuuqN m No( nesaagaaaacgttaaacaaagttgcaaccaaagaagaagacgaacttttgcaagagtta g a t g a t t a t c a t a a c t t g t t c g a c c a g c c a g g t g ga t a g a c g a c a t g g a t t a c g a c c c t g a g c a a g g a g c a ct a c g t t c t g g t t g g t a a a c a t c t c t g g t c g a g g a g g at t a a c a t g a g t a a a a a c a t a c a c g a t g a g c a a c a t c aa a t g g g g a g t t t a a c c a g t a a t a c g a t c g t g g c g c a cg g t t g a c a g a a c c a t a g c g a a g t c t g g g g t a g g t c t aa g a g a c t a c a c t t g c a a c a a g a g c t g g g a g c t g g a g tc a t a a t c a g a t a t g a g a c a c c g a a c t a c g t t g t c g g gc g a c a a g a t c t a t a a g a a t g g g a g a c a a c c c g g a c t tt a g c t a c c c g c g a t a t a t a a g g a a c c a t a g t a c t t g ct a g t t c a t c c a g g c a a a c t a c a a a g c g c a t g g a c a a ca g a a c a c a t a g c g a a t a a t g a t a a c g a g c c t c t a c g aa t a a c g c a c g c g a a a t c g t g a a t a a t a g a g c a g g a g ga a a c a t a t c a c a a c t a c c g a t t t t g a a g a a c a a c t a ca a t t a a t a a g g a a t t g t a c g t t a g t g a t g a g g a g c a ca a a a a a c t a t t c t c c t t g g c a c c g c t a g a g g t g a c c gg t t t c c c c g c a g a a g t a g g a a a g g g c a c g a g g a a a t ct g a t t c t g t c a a c t a a t c c t a t a a a t a g g a a c g c c a aa t g t a a t c a t g a a g a a a a a t a t g a g t a a t g a a g a a c at t c a t t a a g t c g c t c a a c a g a a a g a g a a g t g a a g g a cc c a t a a a a t t g a g t a g a t c t t t c a c g a c c g t c g a c g aa a c c a c a t t g t g a g g t t a a g a a c a g t c a a a g a g a t g tt t c a a g g t t a t a a c t c c c g a g g c t g t g c c a g a c t c a a c g a a g c g a a g a a a c a a a a a g a t a a t c c t c t c a g g c t c a c -4v9sa4 )Cd 6 de ea Pzid 2itec-S SiV-LniS mio nLteplecuuqN m No( nesgaggaaccgttagacgaagtcccacccaaagaaaaagacgaatttgtgcaagaga t a c a g g c t a c t a c g g c a t c g c c t t Ac a c c a c c g a g a c c g a c g g g c a g a c c t LYa c g a c t a c c a c a a c a t g t t c g a t GPISKVYGKKY K P I PDt c gD Sa t c g a c g a c a t g g a c t a c g a g c g c g a LNIG VKNVLP V R D KGc a c g t t g t g g t t g g t g a a c a t c a c t g I t YGR P R Lt c a a c a t g a g c a a g a a c a t g c a t g aV SRHNL DMg g a a t t c a a g c a c t a g t a c g a NSLE KN Na a c g gE S Dg t c g a g a g g a g c a t g g c g a a g t c g g RL GIYK MgK ELa t a g c a c g a g c t a KEt g t g g g a c a c c g a a c t AS KR HK DV N a g a g a c t a a a c a tD K Da c a a t c a g aYT EcF GFc a t a t a c a a g a a c g g a a g c c AHg g a c c c g c g a a a t g t a g g g g a c g PDKTLR R RK YV L t g a c a aD Dt g g RWKKFQE F Y K EDt a g a t c a t g a a c g c g a a c t a c a a g g c VL ERDYLg g a g c a c a t a g c g a a c a a g g a c a a t g G KR MRAa c a a t g c t c g c g a c a t c g t g a a t a a t HL LRKIV YDa c a t c a c a a g g a g c g a c t t t g a IN QLIGa a c cL LTAg a t t a a c a a g g a c a t g a a c g t c a g c g GYL MFHKN IRc c t c g g c a c c g c c VDE E A YKD D a g a a c a c c a t c c tS LGt c t c c c c g c a g a a g c a c g a g a g g g g KT KL IgF I St g a c t c c g t c a a c t a g t c c t a c a a a a RLV W Y EFt t a t c a t c a a g a a g a a c a t g a g g KG QHQY Y M V NGa g gL St t c a t c a a g t c g c t c a a c a g c a a g a g KKK K E IGN P D V TTQAt c a c a a g a t c g a g c a g a t c t t c c a c g KKg PVF E E DEa c c c g c a a c g c g a c g t c a a g a a a a gRL KIS I P R I F D Y RSG t t c a a g g t c a t g a c c c c c g a g g c c g t g AQA W K I H P N K g a a t c g g a g a a a c a a g a a g a t c a t c c t M I K G V E H K L K -5v9saC4dd 6ic)a P aoec-S SiV-n neLniSiLmuqN m Na(es053acggctaccggtccgggtcctacatcaaggagaaccgacgaccctgaggcacctat a g c c a g g t g a t c g a g c a g a t c t t c c a a g a a g t c a a gg c a a g g a g c a c c g c g a c g t c a a g a a c a g t g t c a a g a gg t c g a g g a g g t c a t g a c c c c c g a g g c c g t g g t c g a a g ac a g c a a c a t c a g c a a c a a g a a g a t c a t c c t g a g t a a c at c g t g g c g c a g g c c g t c a a g g t c c t g a c g c t g g t a g c tg g g t a g g t c t t g a t c a a c a t g c g c a a c t t g g g g t a a g tg g a g c t g g a g g g c a t g g a g c t c a a g a t t a t a g a g c t t ga c g t c g t c g g g a t g t a c g a c c a c g t c a g c a a c g t c g t ca a c c g g g a c t a c t t g c a g c a c t a c a g g g a c a a t t c g g ag t a g a a c t t g a c c c t c a a c t a g a a c a a c g a c t a c t a t tg c a t g g a c a a c a g c a a c a a c c t g a a c c g t g g a a t g g a tc g c c t c t a c g t c g c g c t c t a c g t g a c c a t g c g t c t t t ag g a g c a g g a g a c c g a c a a c a c c g a g g c c c t g g a g c a a ga g a a c a a c t a c g g c c c g g c c g a g a t c c c c c a g a a a a a ca t g a g g a g c a g c g a c c t c a g c g a c g t c g a c a t a a g c a gg g a g g t g a c c a a c g a c c a g g a c g a g a a g g a g g a g g t g aa c g a g g a c a t g t a g a c g t a c a t c t a c c a t g a t g a g g a ga g g a a c g c c a a g a a g a a g c c g t a c g c g g t c a c a a a t g cg a t g a a g a a c c g c g a c a t c a t g t t c a a c t t g t t t a a g aa c g t g a a g g a c a t c g t g c c g c g c t t g a c t t a c g t t a a aa c c g t c g a c g t g a c g a g c c a g a a c a a g t a t a c t g t t g aa a a g g a g a t g a a c g t c a g c g a c t g g a a a g a a a a a g a g ac c a g g c t c a a c a g c a t c g a g a a c a g c a g t g c a a g g c t c c t c a g g c t c a t c a a g t a c g a c t a c a t c g a t c t a a g c t t -5- v59vs9aC4d6e sd)aC46 d)e e1Pit ePz die-aVS Si - oSecln daVi tocnce-Si -mi eleLnNi L uuqSLniS tp cuqm Nn(eLsN m No(unesggtaggcttccctctcggaagagggccaggaagcatcatacaggaagcccagaggt g a t c g a g t a g a t c t t t c a c g c a g c c a g g t g a t c g a gt a c c c c g a a g t g a a g a a g a g t g c a a g g a g c a c c g c g ag g t t t t g a c c t c c g a g g c c g t g g t c g a g g a g g t c a t g at t a g a a a a a a g a a g a t t a t c c t g a g c a a c a t c a g a a a cc a t g c a g t t a a t g t a t t g a g g c t c g t g g c g c a g g c c g tt t t a a t t a a c a t g c c c a a c a t g g g g t a g g t c t t a a t c aa g g g c a t a g a a c t c t a g a t t a t a g a g c t g g a g g g c a t gg g a a t t t a c g a c t a c g t a a g t a a c g t t g t c g g g a t g t at t a c t t g c a g c a t t a t a c a g a c a a c c c g g a c t a a t t g ct g a c a c t c a a t t a g a a c t a t g a a t a g t a c t t g a c c c t ta a c a g c a a a a a c c t t a a a c c c g g c a t g g a c a a a a g c a ac g t c g c a c t c t a g g t g a c a t t c a g c c t c t a c g t c g c g ca g a c a g a g a a c a c c g a c g c t c t a g a g c a g g a g a c c g a ct a a g g c c c g g c g g a g a t t c c c c a g a a c a a c t a c g g c c cc a c c g a t c t c a g t g a t g t c g a c a t g a g g a g c a g c g a t cc t t a c g a c t a g g a c g a g a a a g a a g a g g t g a c c a a c g a ca t a t a a a c a t a a a t c t a a c a t g a c g a g g a a a t a t a g a ct a a g a a g a a t c c c t a c g c g g t t a g g a a c g c c a a a a a g aa t c g c g a c a t g a t g t t a a a c t t g a t g a a g a a c c g a g a cg a c c t t g t a c c a c g t t t g a c c t a a g t g a a g g a c a t c g tc g t a a c g a g t c a a c a c a a a t a t a c c g t c g a c g t g a c g at a a a c g t c c g c g a t t g a a a c g a c a a a g a g a t g a a c g t ca a c a g t a t c g a g a a c a g a a g c g c c a g a c t c a a c a g c a t c a t a a a t t a c g a c t a a a t t g a c c t c a g g c t c a t c a a g t -5v9sa4 )Cd 6 de ea Pzid 2itec-S SiV-LniS mio nLteplecuuqN m No( nesa a g t c c a a c aa t c t g c g a c g a c g C G C C G C a a gg a a a a t c g c c a g c C T A A C C C G c c a g tt g t a g a c c c a c a g G T C C G T T C a c a g gg t g a t t g a a t c t a T T G T T G T T c t t c gc c t c c t a a g g g g g T C G G T C C T t c a g gt g c t g g a c a t a g g G G A T C T C C t a t t ta t c a a t c a g c a g g T G C C C A C T t c c c cg c c a a c a a c c t c t A T T C G C T G a c t c cc c c a c a a c g g g a a c a g c a g g a a a g a a c a c g a c a t gt c a a c a g c a a g a g c a g a t c t t c c a c gaa c g A T T G C G A C C t c t ac g t c a a g a a a a g glc c c c c g a g g c c g t guga a g a a g a t c a t c c tgC T G T C G C C C t c a g a e A C G C C T C C C c a a g cc a a g g t c c t g a g g crT G T G C T G T T g g a t ga c a t g c g c a a c a t glT T C T C G T T C a t a a t A C C T T T T C T c g t t gg a g c t c a a g a t c a tat g a c c a c g t c a g t anG G T T T C G C A g c t a g aa g c a c t a c a g g g a t G C A G T Ga a t t a g a a c a a c g aoiT T G t g c a g gc a a c c t g a a t c g g gtT A A T C G G T G t t c t t gt c t a c g t g a c t a t al piC T A G G C T C C a c c c g t T A T T C T C C T t a t c g ca a c a c c g a g g c t c tac g c c g a g a t c c c c tn rcC G A C T C C A G t c a t g gt c a g c g a c g t c g a cgi secC G T A T G G G A t t c g g a A T G C T G C G G g t g t g ac a g g a c g a g a a g g asnaneA G T G C G T C C t t g t g cg t a c a t c t a c c a c g ano rtuC T T T A G C G A t t t c a c g c c g t a c g c g g t c a t t a t a t t c a a c t tia c c g c g c t t g a g c tt-g c c a g a a c a a g a a tats qeT A C G G A G A G c t g c g a A T C T G C T C A a t g g g aa g c g a c t g a a a c g azioSA C T G G A C C C a t g a t gc g a g a a t a g c a g t gla c g a c t a t a t c g a ca pco ylrraalsieptitl tne )le acmp anue meoim0tel4noiAtphnto)it Apn x aH p=E NiEsual 04walH ”.tkcrcyr riyV or yG7nSe euhscno )vnataE n edS(lgenn no edb(lLl md s reo u ttlsugRPai aylan a ammrylanNblorio emi o g“aTEW VP RW( S pisuhohopgist t t g t t t t t a a t c g a c t c g g a c c a g t a c g t a c g g a c c t t a gg t t t g c g a acg a a a t a g c a AGc t ct c a ct ct gGTT Tt t g t c t g a tAT gacc gtaaatt cc gtggA tAGT TTCCG t a g c t t t a tTAa cc ggacga a cc gg g C TGg c g t a t t c g AT at gata a tg gatgAGAGTt c t t c t c g g ATaattgg ca g tttgcTTCGt a c t g a c g a g c g a a t a t g AAGatgaa gta tg gagt TAC CCa t t a g a a t gGGTGcatttggt tcgtgatatattggta T TG cgAC TCCg t t c t a a a tT T T ttc tggaa attgGGTTTc t a c t g c c t AAg t gtggt c ac ct gt gGC Tc g a t c t t a tTgtata t a gt aat gt T CGAAc g a g c c t c a AA t g c t g t g g gT accc cggc tcc ac cACAc g c c g t a t t AAGaGGCtatga gcttatta gactc ga gcgtaCTTTGTTCCc c c g g t t a tT tc a cg cat ca cta c C T AAAg a t t a a c a cC Ca g c t a t g t g Acc cg atat a c c ggC T TGc a c c g t a c gAt g g t t a g g aTAT Aga gctt gttac agt a gaacattt gttacACGA GTC c a g t a a a a g AAG AAgt gtat aagaat atcagagat aagACCaatC TCGAc t t t t a a c a A g g t c t t g a t t g c g a t t a g AAAat ctttcggaa agt atacgctt ggaa TACGCC CTGG c t c c t t a a aATATAtTgtcgaggaa tgcatt gacacgagcaa ATTT GCG c t a t a a a c a AAtct ta a gat att ta a T CGt t c c g t a g c A c t c g g g g t t A A Aaa gtcaaagac ttctt t gtcaaagAgGTGTACTT ni n )boolitgaA- lpȕ yGxn B2- ninlll ne l3adha(lmy a1P1Pmiu0fuEul ngR RAp4m VH0G4 fV HRGPhopisNsNs F S b S bWQ E5Q6Q7 8S63ES63ES6363t t ta g a g a A g t c c c A g c c g t A c a g a g G t c g c c T g t a g t T c a g ca T g g c t a A c g g g a G c g c a a C c a g c c A g g c t g T c a g c g A c g t c a T g a c g a A g c t g c C C a g c c a G A g c t g a T G t g c g T T G c c c g a T A a g c c t A A c a t c c T A t g c c a A G c c a g t C G g g c t c T T c a c t t T G t g g t a C T c c g c a C T g g t g g T C c a t g a T T t g g g c A A c t a ceca G T g g g c a T A c a g cnea A T g c t gug C A c t a cqgeC T g c g aetcC T t c t gscnT T c g gde sc t T Cleg g a c c T G a cofaut c A Gcc c c gftqe naeccg asT T C Teg c c c g g c tsna g e t ar eetcnC Cue G Tqeecna c c g c t a gAuA g G T t cous eg g a a GuNqeqT t g t g a gRSt g g gmoeSA A Rqc t G GT eSc g a g c t c a c agrp Iyry yar rla al eplp3l pecnmomcneuexdlmPee qoe6 xuqesEffxUE.a8c e E h r.esRTele s c. ln9bmAe ele a et 01RITdmmi o eleIt noaaNuqNRgebaanimorbmaasriceT s TN Mp TNF STable 11. Mouse SCN2A targeting gRNA sequences

[0123] The disclosure will be further clarified by the following examples, which are intended to be purely exemplary of the disclosure and in no way limiting. EXAMPLES Example 1. Screening of mouse SCN2A promoter-targeting guides

[0124] Mouse SCN2A promoter-targeting guides (see Table 11) were screened in a luciferase assay system. Briefly, the SCN2A promoter region was cloned upstream of the Luciferase reporter cassette. Targeting of SCN2A promoter with sgRNA and upregulation of the luciferase reporter with dCas-VP64 activator was screened on this construct. Chemiluminescence fold change was measured by normalizing luciferase activity with a Renilla reporter. Results are shown in FIG.1. Luciferase signals were normalized to the expression of negative control gRNA sequences NC01, NC02, and NC03. sgRNA sequences 201-01, 201-02, 201-05, 201-11, 201-12, 205-07, A6, A7, and A9 were selected for further screening.

[0125] In vitro screening of mouse SCN2A targeting with co-transfection of U6-gRNA- and dCas9-VP64-containing plasmids into mouse neuro-2A cells was performed. Transfected cells were selected for with 4 μg / mL puromycin. SCN2A expression was assessed using Sybr-based qRT-PCR and normalized to the expression of beta-actin. Results are shown in FIG. 2. Fold change (FC) in SCN2A expression was assessed relative to the negative control guide sequence NC01. Example 2. Screening of human SCN2A promoter-targeting guides

[0126] Human SCN2A promoter-targeting guides (see Table 2) were screened in a luciferase assay system. Results are shown in FIG. 3A. Luciferase signals were normalized to the expression of negative control gRNA sequences.

[0127] In vitro screening with co-transfection of U6-gRNA- and dCas9-VP64- containing plasmids into Kelly cells (a human neuroblastoma cell line) was performed. Results are shown in FIG.3B. SCN2A expression was assessed using Sybr-based qRT-PCR and normalized to the expression of beta-actin. Fold change was assessed relative to the negative control guide sequences. NUMBERED EMBODIMENTS

[0128] Notwithstanding the appended claims, the disclosure sets forth the following numbered embodiments:

[0129] Embodiment 1. A vector comprising: (a) a transgene polynucleotide sequence encoding a sequence-specific DNA- targeting module (DTM) fused to a transactivator; (b) a regulatory element polynucleotide sequence that specifically restricts expression of the transgene to sodium voltage-gated channel alpha subunit 2 (SCN2A)- expressing cells in the brain; and (c) a promoter polynucleotide sequence.

[0130] Embodiment 2. The vector of embodiment 1, wherein the SCN2A-expressing cells are excitatory pyramidal neurons.

[0131] Embodiment 3. The vector of embodiment 1, wherein the SCN2A-expressing cells are cerebellar granule cells.

[0132] Embodiment 4. The vector of any one of embodiments 1-3, wherein the DTM comprises a nuclease-deficient CRISPR-associated protein.

[0133] Embodiment 5. The vector of embodiment 4, wherein the vector further comprises a polynucleotide sequence encoding a guide RNA (gRNA).

[0134] Embodiment 6. The vector of embodiment 5, wherein the gRNA targets the SCN2A gene.

[0135] Embodiment 7. The vector of embodiment 5 or 6, wherein the gRNA specifically hybridizes to a regulatory region of the SCN2A gene.

[0136] Embodiment 8. The vector of embodiment 7, wherein the regulatory region of the SCN2A gene is a promoter or an enhancer.

[0137] Embodiment 9. The vector of any one of embodiments 5-8, wherein the gRNA specifically hybridizes to an enhancer region of the SCN2A gene comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14.

[0138] Embodiment 10. The vector of any one of embodiments 5-8, wherein the gRNA specifically hybridizes to a promoter region of the SCN2A gene comprising the nucleotide sequence set forth in SEQ ID NO: 15 or 16.

[0139] Embodiment 11. The vector of any one of embodiments 5-10, wherein the gRNA is operatively linked to a promoter recognized by RNA polymerase III.

[0140] Embodiment 12. The vector of any one of embodiments 5-11, wherein the gRNA is operatively linked to a human U6 polymerase III promoter.

[0141] Embodiment 13. The vector of embodiment 12, wherein the human U6 polymerase III promoter comprises the sequence of SEQ ID NO: 366.

[0142] Embodiment 14. The vector of any one of embodiments 5-13, wherein the vector further comprises a polynucleotide sequence encoding a second gRNA targeting the SCN2A gene.

[0143] Embodiment 15. The vector of any one of embodiments 5-14, wherein the gRNA comprises a spacer sequence encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in any one of SEQ ID Nos: 17-313.

[0144] Embodiment 16. The vector of any one of embodiments 5-14, wherein the gRNA comprises a spacer encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in any one of SEQ ID NOs: 374-402.

[0145] Embodiment 17. The vector of any one of embodiments 5-16, wherein the gRNA comprises a scaffold sequence encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO: 365.

[0146] Embodiment 18. The vector of any one of embodiments 5-17, wherein the nuclease-deficient CRISPR-associated protein is a nuclease-deficient Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas11, Cas12, Cas13, CasX, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or another Cas ortholog.

[0147] Embodiment 19. The vector of any one of embodiments 5-18, wherein the nuclease-deficient CRISPR-associated protein is dCas9.

[0148] Embodiment 20. The vector of embodiment 19, wherein the dCas9 is Staphylococcus aureus dCas9, Streptococcus pyogenes dCas9 or Campylobacter jejuni dCas9 or a dCas9 from an orthologous bacterial species.

[0149] Embodiment 21. The vector of embodiment 19, wherein the dCas9 is encoded by the nucleotide sequence of SEQ ID NO: 326, 327, 328, or 329.

[0150] Embodiment 22. The vector of embodiment 19, wherein the dCas9 is encoded by a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 326, 327, 328, or 329.

[0151] Embodiment 23. The vector of any one of embodiments 1-3, wherein the DTM comprises (a) a zinc finger transcription factor or a portion of a zinc finger transcription factor; or (b) a DNA binding domain of a zinc finger transcription factor.

[0152] Embodiment 24. The vector of embodiment 23, wherein the zinc finger transcription factor is a C2H2 zinc finger transcription factor.

[0153] Embodiment 25. The vector of embodiment 24, wherein the C2H2 zinc finger transcription factor comprises the DNA binding domain of a Zif268 zinc finger transcription factor or another humanized C2H2 zinc finger transcription factor, or a sequence derived from said DNA binding domain.

[0154] Embodiment 26. The vector of embodiment 25, wherein the DNA binding domain of a Zif268 zinc finger transcription factor targets the SCN2A gene.

[0155] Embodiment 27. The vector of any one of embodiments 1-3, wherein the DTM comprises (a) a transcription activator-like protein effector (TALE) protein or a portion of a TALE protein; or (b) a DNA binding domain of a TALE protein.

[0156] Embodiment 28. The vector of embodiment 27, wherein the DNA binding domain of a TALE protein targets the SCN2A gene.

[0157] Embodiment 29. The vector of any one of embodiments 1-28, wherein the promoter is a minimal promoter.

[0158] Embodiment 30. The vector of any one of embodiments 1-28, wherein the promoter is recognized by RNA polymerase II.

[0159] Embodiment 31. The vector of any one of embodiments 1-28, wherein the promoter is a chicken beta-actin (CBA) promoter, a GUSB240 promoter, a GUSB379 promoter, a HSVTK promoter, a CMV promoter, a SV40 early promoter, a SV40 late promoter, a metallothionein promoter, a murine mammary tumor virus (MMTV) promoter, a Rous sarcoma virus (RSV) promoter, a polyhedrin promoter, an EF-1 alphapromoter, a dihydrofolate reductase (DHFR) promoter or a phosphoglycerol kinase (PGK) promoter.

[0160] Embodiment 32. The vector of any one of embodiments 1-31, wherein the transactivator is VP16, VP32, VP48, VP64, VPR, a MS2-SAM system, p65, Rta, the CITE-D domains of p300 or a SunTag.

[0161] Embodiment 33. The vector of any one of embodiments 1-31, wherein the transactivator is encoded by the nucleotide sequence of SEQ ID NO: 330, 331, 332, 333, 334, 335, or 336 or a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 330, 331, 332, 333, 334, 335, or 336.

[0162] Embodiment 34. The vector of any one of embodiments 1-33, where the regulatory element polynucleotide sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, or 325.

[0163] Embodiment 35. The vector of any one of embodiments 1-33, where the regulatory element polynucleotide sequence comprises or consists of a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, or 325.

[0164] Embodiment 36. The vector of any one of embodiments 1-35, comprising in 5'- 3' order: (a) the promoter polynucleotide sequence; (b) the regulatory element polynucleotide sequence; and (c) the transgene polynucleotide sequence.

[0165] Embodiment 37. The vector of any one of embodiments 1-35, comprising in 5'- 3' order: (a) the regulatory element polynucleotide sequence; (b) the promoter polynucleotide sequence; and (c) the transgene polynucleotide sequence.

[0166] Embodiment 38. The vector of any one of embodiments 1-37, wherein (a) the transgene polynucleotide sequence encodes the amino acid sequence of SEQ ID NO: 337, 341, 345, or 349; or an amino acid sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about98% or about 99% identical to the amino acid sequence of SEQ ID NO: 337, 341, 345, or 349; or (b) the transgene polynucleotide sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 338, 339, 340, 342, 343, 344, 346, 347, 348, 350, 351, or 352, or a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 338, 339, 340, 342, 343, 344, 346, 347, 348, 350, 351, or 352.

[0167] Embodiment 39. The vector of any one of embodiments 1-38, further comprising an artificial intron.

[0168] Embodiment 40. The vector of any one of embodiments 1-39, further comprising a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE), a hepatitis B virus posttranscriptional regulatory element (HBVPRE), a RNA transport element (RTE), a WPRE3 or a wsl3 regulatory element.

[0169] Embodiment 41. The vector of embodiment 40, wherein the WPRE comprises the sequence of SEQ ID NO: 353.

[0170] Embodiment 42. The vector of embodiment 40, wherein the WPRE3 comprises the sequence of SEQ ID NO: 364.

[0171] Embodiment 43. The vector of any one of embodiments 1-42, further comprising a polyadenylation signal sequence.

[0172] Embodiment 44. The vector of embodiment 43, wherein the polyadenylation signal sequence is a SV40 polyadenylation signal (SV40pA) sequence.

[0173] Embodiment 45. The vector of embodiment 44, wherein the SV40pA sequence comprises the sequence of SEQ ID NO: 354.

[0174] Embodiment 46. The vector of embodiment 43, wherein the polyadenylation signal sequence is a human growth hormone polyA signal (bGHpA) sequence.

[0175] Embodiment 47. The vector of embodiment 46, wherein the bGHpA sequence comprises the sequence of SEQ ID NO: 355.

[0176] Embodiment 48. The vector of embodiment 43, wherein the polyadenylation signal sequence is a human ȕ-globin polyA signal (hBGpA)sequence.

[0177] Embodiment 49. The vector of embodiment 48, wherein the hBGpA sequence comprises the sequence of SEQ ID NO: 356.

[0178] Embodiment 50. The vector of embodiment 43, wherein the polyadenylation signal sequence is a soluble form of Neuropilin-1 (sNRP1) sequence.

[0179] Embodiment 51. The vector of embodiment 50, wherein the sNRP1 sequence comprises or is encoded by the sequence of SEQ ID NO: 357.

[0180] Embodiment 52. The vector of embodiment 43, wherein the polyadenylation signal sequence is a sNRP1-2x sequence.

[0181] Embodiment 53. The vector of embodiment 52, wherein the sNRP1-2x sequence comprises or is encoded by the sequence of SEQ ID NO: 358.

[0182] Embodiment 54. The vector of embodiment 43, wherein the polyadenylation signal sequence is a Furin polyadenylation signal (FpA) sequence.

[0183] Embodiment 55. The vector of embodiment 54, wherein the FpA sequence comprises or is encoded by the sequence of SEQ ID NO: 359.

[0184] Embodiment 56. The vector of embodiment 43, wherein the polyadenylation signal sequence is a SV40min sequence.

[0185] Embodiment 57. The vector of embodiment 56, wherein the SV40min sequence comprises or is encoded by the sequence of SEQ ID NO: 360.

[0186] Embodiment 58. The vector of embodiment 43, wherein the polyadenylation signal sequence is a bGHmin sequence.

[0187] Embodiment 59. The vector of embodiment 58, wherein the bGHmin sequence comprises or is encoded by the sequence of SEQ ID NO: 361.

[0188] Embodiment 60. The vector of embodiment 43, wherein the polyadenylation signal sequence is a SV40full sequence.

[0189] Embodiment 61. The vector of embodiment 60, wherein the SV40full sequence comprises or is encoded by the sequence of SEQ ID NO: 362.

[0190] Embodiment 62. The vector of embodiment 43, wherein the polyadenylation signal sequence is a bGHfull sequence.

[0191] Embodiment 63. The vector of embodiment 62, wherein the bGHfull sequence comprises or is encoded by the sequence of SEQ ID NO: 363.

[0192] Embodiment 64. The vector of any one of embodiments 1-63, wherein the vector is a viral vector.

[0193] Embodiment 65. The vector of embodiment 64, wherein the viral vector is an adeno-associated virus (AAV) vector.

[0194] Embodiment 66. The vector of embodiment 65, wherein the AAV vector comprises a first AAV inverted terminal repeat (ITR) located upstream of the promoter polynucleotide sequence and a second AAV ITR located downstream of the transgene polynucleotide sequence.

[0195] Embodiment 67. The vector of embodiment 66, wherein the first AAV ITR is an AAV2 ITR and the second AAV ITR is an AAV2 ITR.

[0196] Embodiment 68. The vector of embodiment 67, wherein the first AAV ITR comprises the sequence of SEQ ID NO: 367 and the second AAV ITR comprises the sequence of SEQ ID NO: 368.

[0197] Embodiment 69. The vector of any one of embodiments 64-68, comprising in 5'-3' order: (a) a 5' ITR; (b) a RNA polymerase III promoter; (c) a polynucleotide sequence encoding a gRNA; (d) the regulatory element polynucleotide sequence; (e) a minimal promoter; (f) an artificial intron; (g) the transgene polynucleotide sequence; (h) a WPRE; (i) a polyadenylation signal sequence; and (j) a 3' ITR.

[0198] Embodiment 70. The vector of any one of embodiments 64-68, comprising in 5'-3' order: (a) a 5' ITR; (b) a RNA polymerase III promoter; (c) a polynucleotide sequence encoding a gRNA; (d) a minimal promoter; (e) the regulatory element polynucleotide sequence; (f) an artificial intron; (g) the transgene polynucleotide sequence; (h) a WPRE; (i) a polyadenylation signal sequence; and (j) a 3' ITR.

[0199] Embodiment 71. The vector of any one of embodiments 1-70, wherein the vector is suitable for delivery via a non-viral delivery system.

[0200] Embodiment 72. The vector of embodiment 71, wherein the non-viral delivery system is a lipid nanoparticle or an exosome.

[0201] Embodiment 73. A viral particle comprising the vector of any one of embodiments 64-70.

[0202] Embodiment 74. The viral particle of embodiment 73, wherein the viral particle is a recombinant AAV (rAAV) particle.

[0203] Embodiment 75. The viral particle of embodiment 74, wherein the rAAV particle is an AAV9, AAV-PHP.eB, AAV-DJ or AAV2 serotype particle.

[0204] Embodiment 76. A population of viral particles comprising a plurality of viral particles of any one of embodiments 73-75.

[0205] Embodiment 77. A pharmaceutical composition comprising the vector of any one of embodiments 1-72, the viral particle of any one of embodiments 73-75 or the population of embodiment 76, and a pharmaceutically acceptable carrier, vehicle or diluent.

[0206] Embodiment 78. A cell comprising the vector of any one of embodiments 1-72 or the viral particle of any one of embodiments 73-75.

[0207] Embodiment 79. The cell of embodiment 78, wherein the cell is a mammalian cell or an insect cell.

[0208] Embodiment 80. A method of producing a rAAV particle, the method comprising: (i) culturing the cell of embodiment 78 or 79 under conditions allowing for packaging the rAAV particle; and (ii) harvesting the cultured host cell or culture medium for collection of the rAAV particle.

[0209] Embodiment 81. The method of embodiment 80, wherein the rAAV particle comprises an AAV9, AAV-PHP.eB, AAV-DJ or AAV2 capsid protein.

[0210] Embodiment 80. A method for treating neurological disorder related to SCN2A- haploinsufficiency in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the vector of any one of embodiments 1-72, the viral particle of any one of embodiments 73-75, the population of embodiment 76 or the pharmaceutical composition of embodiment 77.

[0211] Embodiment 83. A method for treating or reducing the risk, severity, frequency or length of seizures in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the vector of any one of embodiments 1-72, the viral particle of any one of embodiments 73-75, the population of embodiment 76 or the pharmaceutical composition of embodiment 77.

[0212] Embodiment 84. A method for treating or preventing autism spectrum disorder (ASD) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the vector of any one of embodiments 1-72, the viral particle of any one of embodiments 73-75, the population of embodiment 76 or the pharmaceutical composition of embodiment 77.

[0213] Embodiment 85. The method of any one of embodiments 82-84, wherein the subject is between about 2 years old and about 18 years old.

[0214] Embodiment 86. The method of any one of embodiments 82-84, wherein the subject is older than 18 years.

[0215] Embodiment 87. The method of any one of embodiments 82-86, wherein the vector, viral particle, population or pharmaceutical composition is administered to the subject via intracerebroventricular injection, intrathecal injection, intracarotid artery injection, or intraparenchymal injection.

[0216] Embodiment 88. The method of any one of embodiments 82-87, wherein the vector, viral particle, population or pharmaceutical composition is administered to the subject in a single dose.

[0217] Embodiment 89. The method of embodiment 88, wherein the single dose comprises from about 10E+9 to about 10E+14 viral particles.

[0218] Embodiment 90. A method for increasing levels of SCN2A expression in SCN2A-expressing cells in the brain, the method comprising contacting the cells with the vector of any one of embodiments 1-72, the viral particle of any one of embodiments 73-75, the population of embodiment 76 or the pharmaceutical composition of embodiment 77.

[0219] Embodiment 91. The method of embodiment 90, wherein the SCN2A- expressing cells comprise a loss-of-function mutation in one copy of the SCN2A gene.

[0220] Embodiment 92. The method of embodiment 90 or 91, wherein the SCN2A- expressing cells are excitatory pyramidal neurons.

[0221] Embodiment 93. The method of embodiment 90 or 91, wherein the SCN2A- expressing cells are cerebellar granule cells.

[0222] Embodiment 94. The vector of any one of embodiments 1-72, the viral particle of any one of embodiments 73-75, the population of embodiment 76 or the pharmaceutical composition of embodiment 77, for use as a medicament.

Claims

CLAIMS 1. A vector comprising: (a) a transgene polynucleotide sequence encoding a sequence-specific DNA- targeting module (DTM) fused to a transactivator; (b) a regulatory element polynucleotide sequence that specifically restricts expression of the transgene to sodium voltage-gated channel alpha subunit 2 (SCN2A)- expressing cells in the brain; and (c) a promoter polynucleotide sequence.

2. The vector of claim 1, wherein the SCN2A-expressing cells are excitatory pyramidal neurons.

3. The vector of claim 1, wherein the SCN2A-expressing cells are cerebellar granule cells.

4. The vector of any one of claims 1-3, wherein the DTM comprises a nuclease- deficient CRISPR-associated protein.

5. The vector of claim 4, wherein the vector further comprises a polynucleotide sequence encoding a guide RNA (gRNA).

6. The vector of claim 5, wherein the gRNA targets the SCN2A gene.

7. The vector of claim 5 or 6, wherein the gRNA specifically hybridizes to a regulatory region of the SCN2A gene.

8. The vector of claim 7, wherein the regulatory region of the SCN2A gene is a promoter or an enhancer.

9. The vector of any one of claims 5-8, wherein the gRNA specifically hybridizes to an enhancer region of the SCN2A gene comprising the nucleotide sequence set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14.

10. The vector of any one of claims 5-8, wherein the gRNA specifically hybridizes to a promoter region of the SCN2A gene comprising the nucleotide sequence set forth in SEQ ID NO: 15 or 16.

11. The vector of any one of claims 5-10, wherein the gRNA is operatively linked to a promoter recognized by RNA polymerase III.

12. The vector of any one of claims 5-11, wherein the gRNA is operatively linked to a human U6 polymerase III promoter.

13. The vector of claim 12, wherein the human U6 polymerase III promoter comprises the sequence of SEQ ID NO:

366.

14. The vector of any one of claims 5-13, wherein the vector further comprises a polynucleotide sequence encoding a second gRNA targeting the SCN2A gene.

15. The vector of any one of claims 5-14, wherein the gRNA comprises a spacer encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in any one of SEQ ID NOs: 17-313.

16. The vector of any one of claims 5-14, wherein the gRNA comprises a spacer encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in any one of SEQ ID NOs: 374-402.

17. The vector of any one of claims 5-16, wherein the gRNA comprises a scaffold encoded by a sequence that is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identical to the sequence set forth in SEQ ID NO:

365.

18. The vector of any one of claims 5-17, wherein the nuclease-deficient CRISPR- associated protein is a nuclease-deficient Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas11, Cas12, Cas13, CasX, Csyl, Csy2, Csy3, Csel, Cse2,Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or another Cas ortholog.

19. The vector of any one of claims 5-18, wherein the nuclease-deficient CRISPR- associated protein is dCas9.

20. The vector of claim 19, wherein the dCas9 is Staphylococcus aureus dCas9, Streptococcus pyogenes dCas9 or Campylobacter jejuni dCas9 or a dCas9 from an orthologous bacterial species.

21. The vector of claim 19, wherein the dCas9 is encoded by the nucleotide sequence of SEQ ID NO: 326, 327, 328, or 329.

22. The vector of claim 19, wherein the dCas9 is encoded by a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 326, 327, 328, or 329.

23. The vector of any one of claims 1-3, wherein the DTM comprises (a) a zinc finger transcription factor or a portion of a zinc finger transcription factor; or (b) a DNA binding domain of a zinc finger transcription factor.

24. The vector of claim 23, wherein the zinc finger transcription factor is a C2H2 zinc finger transcription factor.

25. The vector of claim 23, wherein the C2H2 zinc finger transcription factor comprises the DNA binding domain of a Zif268 zinc finger transcription factor or another humanized C2H2 zinc finger transcription factor, or a sequence derived from said DNA binding domain.

26. The vector of claim 25, wherein the DNA binding domain of a Zif268 zinc finger transcription factor targets the SCN2A gene.

27. The vector of any one of claims 1-3, wherein the DTM comprises (a) a transcription activator-like protein effector (TALE) protein or a portion of a TALE protein; or (b) a DNA binding domain of a TALE protein.

28. The vector of claim 27, wherein the DNA binding domain of a TALE protein targets the SCN2A gene.

29. The vector of any one of claims 1-28, wherein the promoter is a minimal promoter.

30. The vector of any one of claims 1-28, wherein the promoter is recognized by RNA polymerase II.

31. The vector of any one of claims 1-28, wherein the promoter is a chicken beta- actin (CBA) promoter, a GUSB240 promoter, a GUSB379 promoter, a HSVTK promoter, a CMV promoter, a SV40 early promoter, a SV40 late promoter, a metallothionein promoter, a murine mammary tumor virus (MMTV) promoter, a Rous sarcoma virus (RSV) promoter, a polyhedrin promoter, an EF-1 alpha promoter, a dihydrofolate reductase (DHFR) promoter or a phosphoglycerol kinase (PGK) promoter.

32. The vector of any one of claims 1-31, wherein the transactivator is VP16, VP32, VP48, VP64, VPR, a MS2-SAM system, p65, Rta, the CITE-D domains of p300 or a SunTag.

33. The vector of any one of claims 1-31, wherein the transactivator is encoded by the nucleotide sequence of SEQ ID NO: 330, 331, 332, 333, 334, 335, or 336 or anucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 330, 331, 332, 333, 334, 335, or 336.

34. The vector of any one of claims 1-33, where the regulatory element polynucleotide sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, or 325.

35. The vector of any one of claims 1-33, where the regulatory element polynucleotide sequence comprises or consists of a nucleotide sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, or 325.

36. The vector of any one of claims 1-35, comprising in 5'-3' order: (a) the promoter polynucleotide sequence; (b) the regulatory element polynucleotide sequence; and (c) the transgene polynucleotide sequence.

37. The vector of any one of claims 1-35, comprising in 5'-3' order: (a) the regulatory element polynucleotide sequence; (b) the promoter polynucleotide sequence; and (c) the transgene polynucleotide sequence.

38. The vector of any one of claims 1-37, wherein (a) the transgene polynucleotide sequence encodes the amino acid sequence of SEQ ID NO: 337, 341, 345, or 349; or an amino acid sequence at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the amino acid sequence of SEQ ID NO: 337, 341, 345, or 349; or (b) the transgene polynucleotide sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 338, 339, 340, 342, 343, 344, 346, 347, 348, 350, 351, or 352, or a nucleotide sequence at least about 90%, about 91%, about 92%, about93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to the nucleotide sequence of SEQ ID NO: 338, 339, 340, 342, 343, 344, 346, 347, 348, 350, 351, or 352.

39. The vector of any one of claims 1-38, further comprising an artificial intron.

40. The vector of any one of claims 1-39, further comprising a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE), a hepatitis B virus posttranscriptional regulatory element (HBVPRE), a RNA transport element (RTE), a WPRE3, or a wsl3 regulatory element.

41. The vector of claim 40, wherein the WPRE comprises or is encoded by the sequence of SEQ ID NO:

353.

42. The vector of claim 40, wherein the WPRE3 comprises or is encoded by the sequence of SEQ ID NO:

364.

43. The vector of any one of claims 1-42, further comprising a polyadenylation signal sequence.

44. The vector of claim 43, wherein the polyadenylation signal sequence is a Simian virus 40 polyadenylation signal (SV40pA) sequence.

45. The vector of claim 44, wherein the SV40pA sequence comprises or is encoded by the sequence of SEQ ID NO:

354.

46. The vector of claim 43, wherein the polyadenylation signal sequence is a human growth hormone polyadenylation signal (bGHpA) sequence.

47. The vector of claim 46, wherein the bGHpA sequence comprises or is encoded by the sequence of SEQ ID NO: 355.

48. The vector of claim 43, wherein the polyadenylation signal sequence is a human ȕ-globin polyadenylation signal (hBGpA) sequence.

49. The vector of claim 48, wherein the hBGpA sequence comprises or is encoded by the sequence of SEQ ID NO:

356.

50. The vector of claim 43, wherein the polyadenylation signal sequence is a soluble form of Neuropilin-1 (sNRP1) sequence.

51. The vector of claim 50, wherein the sNRP1 sequence comprises or is encoded by the sequence of SEQ ID NO:

357.

52. The vector of claim 43, wherein the polyadenylation signal sequence is a sNRP1-2x sequence.

53. The vector of claim 52, wherein the sNRP1-2x sequence comprises or is encoded by the sequence of SEQ ID NO:

358.

54. The vector of claim 43, wherein the polyadenylation signal sequence is a Furin polyadenylation signal (FpA) sequence.

55. The vector of claim 54, wherein the FpA sequence comprises or is encoded by the sequence of SEQ ID NO:

359.

56. The vector of claim 43, wherein the polyadenylation signal sequence is a SV40min sequence.

57. The vector of claim 56, wherein the SV40min sequence comprises or is encoded by the sequence of SEQ ID NO: 360.

58. The vector of claim 43, wherein the polyadenylation signal sequence is a bGHmin sequence.

59. The vector of claim 58, wherein the bGHmin sequence comprises or is encoded by the sequence of SEQ ID NO:

361.

60. The vector of claim 43, wherein the polyadenylation signal sequence is a SV40full sequence.

61. The vector of claim 60, wherein the SV40full sequence comprises or is encoded by the sequence of SEQ ID NO:

362.

62. The vector of claim 43, wherein the polyadenylation signal sequence is a bGHfull sequence.

63. The vector of claim 62, wherein the bGHfull sequence comprises or is encoded by the sequence of SEQ ID NO:

363.

64. The vector of any one of claims 1-63, wherein the vector is a viral vector.

65. The vector of claim 64, wherein the viral vector is an adeno-associated virus (AAV) vector.

66. The vector of claim 65, wherein the AAV vector comprises a first AAV inverted terminal repeat (ITR) located upstream of the promoter polynucleotide sequence and a second AAV ITR located downstream of the transgene polynucleotide sequence.

67. The vector of claim 66, wherein the first AAV ITR is an AAV2 ITR and the second AAV ITR is an AAV2 ITR.

68. The vector of claim 67, wherein the first AAV ITR comprises the sequence of SEQ ID NO: 367 and the second AAV ITR comprises the sequence of SEQ ID NO:

368.

69. The vector of any one of claims 64-68, comprising in 5'-3' order: (a) a 5' ITR; (b) a RNA polymerase III promoter; (c) a polynucleotide sequence encoding a gRNA; (d) the regulatory element polynucleotide sequence; (e) a minimal promoter; (f) an artificial intron; (g) the transgene polynucleotide sequence; (h) a WPRE; (i) a polyadenylation signal sequence; and (j) a 3' ITR.

70. The vector of any one of claims 64-68, comprising in 5'-3' order: (a) a 5' ITR; (b) a RNA polymerase III promoter; (c) a polynucleotide sequence encoding a gRNA; (d) a minimal promoter; (e) the regulatory element polynucleotide sequence; (f) an artificial intron; (g) the transgene polynucleotide sequence; (h) a WPRE; (i) a polyadenylation signal sequence; and (j) a 3' ITR.

71. The vector of any one of claims 1-70, wherein the vector is suitable for delivery via a non-viral delivery system.

72. The vector of claim 71, wherein the non-viral delivery system is a lipid nanoparticle or an exosome.

73. A viral particle comprising the vector of any one of claims 64-70.

74. The viral particle of claim 73, wherein the viral particle is a recombinant AAV (rAAV) particle.

75. The viral particle of claim 74, wherein the rAAV particle is an AAV9, AAV- PHP.eB, AAV-DJ, AAV2, AAV1, AAV5, AAV6, AAV8, AAV-PHP.A, AAV-PHP.B, AAV-PHP-S, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN serotype particle.

76. A population of viral particles comprising a plurality of viral particles of any one of claims 73-75.

77. A pharmaceutical composition comprising the vector of any one of claims 1-72, the viral particle of any one of claims 73-75 or the population of claim 76, and a pharmaceutically acceptable carrier, vehicle or diluent.

78. A cell comprising the vector of any one of claims 1-72 or the viral particle of any one of claims 73-75.

79. The cell of claim 78, wherein the cell is a mammalian cell or an insect cell.

80. A method of producing a rAAV particle, the method comprising: (i) culturing the cell of claim 78 or 79 under conditions allowing for packaging the rAAV particle; and (ii) harvesting the cultured host cell or culture medium for collection of the rAAV particle.

81. The method of claim 80, wherein the rAAV particle comprises an AAV9, AAV- PHP.eB, AAV-DJ, AAV2, AAV1, AAV5, AAV6, AAV8, AAV-PHP.A, AAV-PHP.B, AAV-PHP-S, AAV-CAP.B10, AAV2-r3.45, AAV2-LSS, AAV2PFG, AAV2-PPS, AAV2-TLH, or AAV2-GMN capsid protein.

82. A method for treating a neurological disorder related to SCN2A- haploinsufficiency in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the vector of any one of claims 1- 72, the viral particle of any one of claims 73-75, the population of claim 76 or the pharmaceutical composition of claim 77.

83. A method for treating or reducing the risk, severity, frequency or length of seizures in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the vector of any one of claims 1-72, the viral particle of any one of claims 73-75, the population of claim 76 or the pharmaceutical composition of claim 77.

84. A method for treating or preventing autism spectrum disorder (ASD) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the vector of any one of claims 1-72, the viral particle of any one of claims 73-75, the population of claim 76 or the pharmaceutical composition of claim 77.

85. The method of any one of claims 82-84, wherein the subject is between about 2 years old and about 18 years old.

86. The method of any one of claims 82-84, wherein the subject is older than 18 years.

87. The method of any one of claims 82-86, wherein the vector, viral particle, population or pharmaceutical composition is administered to the subject via intracerebroventricular injection, intrathecal injection, intracarotid artery injection, or intraparenchymal injection.

88. The method of any one of claims 82-87, wherein the vector, viral particle, population or pharmaceutical composition is administered to the subject in a single dose.

89. The method of claim 88, wherein the single dose comprises from about 10E+9 to about 10E+14 viral particles.

90. A method for increasing levels of SCN2A expression in SCN2A-expressing cells in the brain, the method comprising contacting the cells with the vector of any one of claims 1-72, the viral particle of any one of claims 73-75, the population of claim 76 or the pharmaceutical composition of claim 77.

91. The method of claim 90, wherein the SCN2A-expressing cells comprise a loss- of-function mutation in one copy of the SCN2A gene.

92. The method of claim 90 or 91, wherein the SCN2A-expressing cells are excitatory pyramidal neurons.

93. The method of claim 90 or 91, wherein the SCN2A-expressing cells are cerebellar granule cells.

94. The vector of any one of claims 1-72, the viral particle of any one of claims 73- 75, the population of claim 76 or the pharmaceutical composition of claim 77, for use as a medicament.

Images