A useful composition for the treatment of CDKL5 deficiency (CDD)

The rAAV vector delivers functional CDKL5 protein to treat CDKL5 deficiency, addressing the underlying cause and improving symptoms and progression in animal models.

JP7862321B2Active Publication Date: 2026-05-19THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2022565789
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-11-04
Filing Date
2021-04-26
Publication Date
2026-05-19
Estimated Expiration
2041-04-26

AI Technical Summary

Technical Problem

There is no cure for CDKL5 deficiency (CDD), a severe neurodevelopmental disorder caused by mutations in the CDKL5 gene, leading to early-onset seizures and cognitive impairment, with current treatments focusing on symptom alleviation rather than addressing the underlying cause.

Method used

A recombinant adeno-associated virus (rAAV) vector is developed to deliver a functional human CDKL5 protein to central nervous system cells, using specific regulatory sequences and capsids like AAV9 or AAVhu68 to express CDKL5, potentially alleviating symptoms and slowing disease progression.

Benefits of technology

The rAAV vector effectively expresses functional CDKL5 protein in animal models, improving symptoms and delaying disease progression, as shown by behavioral and physiological improvements in treated mice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007862321000001
    Figure 0007862321000001
  • Figure 0007862321000002
    Figure 0007862321000002
  • Figure 0007862321000003
    Figure 0007862321000003
Patent Text Reader

Abstract

Recombinant adeno-associated viruses (rAAVs) are provided, which have an AAV capsid and a vector genome that includes a nucleic acid sequence encoding functional CDKL5 (hCDKLK5). Also provided are production systems useful for producing the rAAVs, pharmaceutical compositions that include the rAAVs, and methods for treating a subject with CDD, or ameliorating the symptoms of CDD, or slowing the progression of CDD by administering an effective amount of the rAAV to a subject in need thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[Background technology]

[0001] CDKL5 deficiency (CDD) is a serious neurodevelopmental disorder that affects young children. The underlying cause is a lack of CDKL5 protein expression due to mutations in the X-linked cyclin-dependent kinase-like gene, CDKL5 (Mendelian Inheritance in Man, MIM:300203, formerly known as STK9), and is associated with EIEE2 (MIM:300672), an early form of infantile epileptic encephalopathy [Bahi-Buisson, N. et al. Key clinical features to identify girls with CDKL5 mutations. Brain 131, 2647-2661, doi:10.1093 / brain / awn197 (2008)], and infantile spasms [Fehr, S. et al. Eur J Hum Genet 21, 266-273, doi:10.1038 / ejhg.2012.156 (2013), Kalscheuer, V. et al., American Journal of Human This results in a range of phenotypes, including those described in Genetics, 72, 1401-1411, doi:10.1086 / 375538 (2003), Tao, J. et al. American Journal of Human Genetics 75, 1149-1154, doi:10.1086 / 426460 (2004), and Weaving, L. Set al. American Journal of Human Genetics 75, 1079-1093, doi:10.1086 / 426462 (2004). In addition to characteristic early-onset seizures, the phenotype may also include several other features such as typical hand movements, severe psychomotor retardation, and general hypotonicity. The early postnatal onset of symptoms indicates that CDKL5 plays a crucial role in brain development. CDKL5 is also expressed in the mature adult nervous system. CDKL5 is expressed throughout cells, including the nucleus, as well as the cytoplasm and dendrites of the cell body.

[0002] CDKL5 gene mutations are the cause of most cases of CDD, a progressive neurodevelopmental disorder and one of the most common causes of cognitive impairment in women. Men with the gene mutation that causes CDD are devastated. Most of them die prenatally or in early infancy. See, for example, ninds.nih.gov / Disorders / Patient-Caregiver-Education / Fact-Sheets / Rett-Syndrome-Fact-Sheet and omim.org / entry / 312750.

[0003] Currently, there is no cure for CDD, and treatment focuses on alleviating disease symptoms. Because seizures are often poorly controlled, there is an urgent medical need to find new therapeutic approaches. [Overview of the Initiative]

[0004] This specification provides recombinant adeno-associated virus (rAAV) useful for treating CDKL5 deficiency (CDD) in subjects requiring treatment for CDD. The rAAV comprises a vector genome containing inverted terminal repeats (ITRs) and a novel nucleic acid sequence encoding a functional human CDKL5 protein under the control of a regulatory sequence that directs hCDKL5 expression in target cells.

[0005] In certain embodiments, recombinant adeno-associated virus (rAAV) useful for treating CDD is provided. The rAAV comprises (a) an AAV capsid and (b) a vector genome packaged in the AAV capsid of (a), the vector genome containing inverted terminal repeats (ITRs) and directing human CDKL5 (hCDKLK5) expression in central nervous system cells. The functional hCDKL5 coding sequence comprises a nucleic acid sequence encoding functional hCDKL5 under the control of a regulatory sequence, wherein the hCDKL5 coding sequence is at least approximately 95% identical to nt699-3581 of SEQ ID NO: 3 (or SEQ ID NO: 22) or nt699-3581 of SEQ ID NO: 3 (or SEQ ID NO: 22). In certain embodiments, the functional hCDKL5 has the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the regulatory sequence comprises a ubiquitin C (UbC) promoter. In some embodiments, the regulatory sequence comprises a WPRE element.

[0006] In certain embodiments, recombinant adeno-associated virus (rAAV) useful for treating CDD is provided, wherein the functional human CDKL5 (hCDKLK5) is hCDKL5 isoform 2. In certain embodiments, recombinant adeno-associated virus (rAAV) useful for treating CDD is provided, wherein the functional human CDKL5 (hCDKLK5) is hCDKL5 isoform 3. In certain embodiments, recombinant adeno-associated virus (rAAV) useful for treating CDD is provided, wherein the functional human CDKL5 (hCDKLK5) is hCDKL5 isoform 4.

[0007] In certain embodiments, the rAAV useful for treating CDD comprises the AAV9 capsid. In some embodiments, the rAAV useful for treating CDD comprises the AAVhu68 capsid. In other embodiments, the rAAV useful for treating CDD comprises the AAVrh91 capsid.

[0008] In certain embodiments, the CDKL5-2GS coding sequence is at least 95% identical to the sequence encoding sequence number 24 or sequence number 6. In certain embodiments, the CDKL5-3GS coding sequence is at least 95% identical to the sequence encoding sequence number 25 or sequence number 8. In certain embodiments, the CDKL5-4GS coding sequence is at least 95% identical to the sequence encoding sequence number 26 or sequence number 10.

[0009] In certain embodiments, the vector genome includes at least two tandem repeats of dorsal root ganglion (DRG) specific miRNA target sequences in the 3' untranslated region of hCDKL5, wherein the at least two tandem repeats include at least a first miRNA target sequence and at least a second miRNA target sequence which may be the same or different and targets miR183 or miR182.

[0010] In certain embodiments, vectors other than rAAV are used to deliver the expression cassette described herein. The vector may be a recombinant parvovirus, recombinant lentivirus, recombinant retrovirus, or recombinant adenovirus; or a non-viral vector selected from naked DNA, naked RNA, inorganic particles, lipid particles, polymer-based vectors, or chitosan-based formulations.

[0011] In certain embodiments, compositions are provided that include a stock of rAAV or other viral vectors described herein and an aqueous suspension medium.

[0012] In certain embodiments, a method for treating CDD is provided, comprising administering an effective amount of the rAAV or other vector described herein to a subject in need thereof.

[0013] In certain embodiments, an rAAV production system useful for producing the vectors described herein is provided.

[0014] In certain embodiments, a vector comprising an expression cassette is provided, which comprises a nucleic acid sequence encoding functional hCDKL5 under the control of a regulatory sequence directing human CDKL5-co1 (hCDKL5) expression, the hCDKL5 coding sequence being sequence number 22, or The sequence is at least approximately 95% identical to sequence number 22. In certain embodiments, a vector is provided that includes an expression cassette, which includes a nucleic acid sequence encoding functional hCDKL5-2GS under the control of a regulatory sequence that directs human CDKL5-2GS (hCDKL5-2GS) expression, wherein the hCDKL5-2GS coding sequence is at least approximately 95% identical to sequence number 24. In certain embodiments, a vector is provided that includes an expression cassette, which includes a nucleic acid sequence encoding functional hCDKL5-3GS under the control of a regulatory sequence that directs human CDKL5-3GS (hCDKL5-3GS) expression, wherein the hCDKL5-3GS coding sequence is at least approximately 95% identical to sequence number 25. In certain embodiments, the vector comprises an expression cassette, the expression cassette comprising a nucleic acid sequence encoding functional hCDKL5-4GS under the control of a regulatory sequence that directs human CDKL5-4GS (hCDKL5-4GS) expression, wherein the hCDKL5-4GS coding sequence is sequence number 26, or at least about 95% identical to sequence number 26.

[0015] In certain embodiments, the vector genome further comprises at least two tandem repeats of dorsal root ganglion (DRG)-specific miRNA target sequences. In certain embodiments, rAAV or a composition comprising rAAV may be administered to subjects in need to improve the symptoms of CDD and / or slow the progression of CDD.

[0016] In a further embodiment, a composition comprising an rAAV or vector and an aqueous suspension medium as described herein is provided herein.

[0017] In another embodiment, a method is provided for treating a subject having CDD, alleviating the symptoms of CDD, or delaying the progression of CDD. This method involves administering an effective amount of the rAAV or vector described herein to a subject in need. In certain embodiments, the vector or rAAV can be administered to the patient via intracisor macroinjection (ICM).

[0018] These and other aspects of the present invention will become apparent from the following detailed description of the invention. [Brief explanation of the drawing]

[0019] [Figure 1A] This shows the AAV vector design for the AAV CDKL5 vector genome, including an expression cassette containing a 5'AAV inverted terminal repeat (ITR), a neuron promoter, an engineered human CDKL5 DNA coding sequence, an enhancer, and polyA, as well as an AAV 3'ITR. [Figure 1B] This shows the AAV vector design for the AAV CDKL5 vector genome, which includes an expression cassette containing a 5'AAV ITR, a ubiquitin C (UbC) promoter, an engineered human CDKL5 DNA coding sequence, drg detargeting miRNA, polyA, and an AAV 3'ITR. [Figure 1C] This shows the AAV vector design for the AAV CDKL5 vector genome, which includes an expression cassette containing a 5'AAV ITR, a chicken β-actin hybrid promoter (CBh), an engineered human CDKL5 DNA coding sequence, a drg-targeted miRNA, poly(A), and an AAV 3'ITR. [Figure 2A-2B] This shows the analysis of mouse hippocampi evaluated with an anti-CDKL5 antibody (S957D, University of Dundee, UK). Mice were treated with 5 × 10¹⁰ GC AAV-hSyn-CDKL5-1co.WPRE by neonatal intracerebroventricular injection. Figure 2A shows CDKL5 expression by Western blotting, charting CDKL5 / tubulin levels in PBS-injected wild-type mice, PBS-injected KO mice, and treated KO mice. Figure 2B shows CDKL5 activity as determined using pS222EB2 (Baltussen et al, 2018) levels in PBS-injected wild-type mice, PBS-injected KO mice, and treated KO mice. [Figure 3]This report provides graphs of mouse maturation and survival after injection of AAV-hSyn-hCDKL5-1co.WPRE in a CDD mouse model. All injected mice survived and gained weight after treatment. The mice showed no apparent signs of adverse outcomes. [Figure 4] This report provides results from behavioral assessments in CDD mice receiving AAV-hSyn-CDKL5-1co.WPRE. The figure shows the results of an Elevated Zero Maze, which assesses the balance between risk-taking, curiosity, and anxiety. The first bar represents wt mice receiving PBS. Wt mice are curious but cautious and spend limited time in the open. The middle bar represents Cdkl5-ko mice receiving only PBS, which show reduced anxiety and more time spent in the open; these mice entered the open zone more frequently. After AAV-CDKL5 treatment, the behavior of Cdkl5-ko mice reverted to that of wt mice (in terms of time spent in the open zone and entry from the closed zone to the open zone). [Figure 5A-5B] We provide results from behavioral evaluations in CDD mice receiving AAV-hSyn-CDKL5-1co.WPRE. Figure 5A shows the exploratory activity of mice in an open field arena, plotted as beam break / bin versus time (minutes). Dotted lines indicate wt mice that are curious but explore the arena within 10 minutes and remain calm. Long dashed lines indicate that Cdkl5-ko mice spend a long time exploring but eventually settle down. Dashed and dotted lines indicate that the activity of Cdkl5-ko mice is reduced after AAV-CDKL5 treatment, and their overall activity levels are similar to those of wt mice. Figure 5B shows cumulative activity data for total beam breaks obtained by the mice, which confirms the results in Figure 5A. [Figure 6]This graph shows the measured time to fall (seconds) in mice over three consecutive days during motor activity and agility assessments (rotarod). Wild-type mice are observed to improve their performance through learning over time. Cdkl5-ko mice show improved performance compared to wt mice, which is likely due to the previously observed initial hyperactivity. After treatment with AAV-hSyn-CDKL5-1co.WPRE, the behavior of Cdkl5-ko mice does not revert to that of wt mice. [Figures 7A-7B] The results of hippocampal learning and memory (Y-maze) are shown. Figure 7A shows the percentage of spontaneous change in the test group and the two control groups. Figure 7B shows the distance traveled (m) in the test group and the two control groups. wt mice show a strong tendency to explore maze arms they have not recently visited (spontaneous change behavior). [Figures 8A-8D] Figure 8A shows the CDKL5 expression or activity levels of the AAV.CDLK5 vector construct for expression isoform 1, isoform 2, isoform 3, or isoform 4. Figure 8A shows the quantified expression levels of CDKL5 isoforms 1, 2, 3, and 4 in knockout mice injected with the AAV vector (5 × 10¹⁰ GC, neonatal ICV) compared with vehicle-injected wild-type mice and vehicle-injected knockout mice. Figure 8B shows CDKL5 activity as determined from the quantified signal of pS222EB2 from Western blot analysis of tissues from treated wild-type mice (injected with vehicle (PBS)) and knockout mice (injected with vehicle or AAV.CDKL5-1co). Figure 8C shows CDKL5 activity as determined from the quantified signal of pS222EB2 from Western blot analysis of tissues from treated wild-type mice (injected with vehicle (PBS)) and knockout mice (injected with vehicle, or AAV.CDKL5-isoform 1, 2, 3, or 4 (from Figure 8A)). Figure 8D shows the quantified CDKL5 expression levels of isoform 1 in KO mice (from Figure 8B). [Figures 9A-9F]This study demonstrates the therapeutic efficacy of AAV.CDKL5 gene therapy in a mouse study comparing different vector doses (5×10¹⁰GC, 2.5×10¹⁰GC, 1×10¹⁰GC, and 6×10⁹GC) in knockout and wild-type mice. Figure 9A shows the 10-week weight gain (g) in mice treated with AAV.CDKL5 at doses of 5×10¹⁰GC or PBS. Figure 9B shows the 10-week weight gain (g) in mice treated with AAV.CDKL5 at doses of 2.5×10¹⁰GC or PBS. Figure 9C shows the dose-dependent results of the hindlimb clasping test in the AAV.CDKL5-treated group at a dose of 5×10¹⁰GC compared to untreated Cdkl5-ko mice. Figure 9D shows the dose-dependent results of the hindlimb clasping test in the AAV.CDKL5-treated group at a dose of 2.5 × 10¹⁰ GC compared to untreated Cdkl5-ko mice. Figure 9E shows the dose-dependent results of the hindlimb clasping test in the AAV.CDKL5-treated group at a dose of 1 × 10¹⁰ GC compared to untreated Cdkl5-ko mice. Figure 9F shows the dose-dependent results of the hindlimb clasping test in the AAV.CDKL5-treated group at a dose of 6 × 10⁹ GC compared to untreated Cdkl5-ko mice. WT mice showed no clasping, while KO mice showed significant clasping. After treatment, KO mice showed a significant reduction in clasping. Injected WT mice were unaffected. [Figure 10A-10E]This study demonstrates the therapeutic efficacy of AAV.CDL5 gene therapy in CDD ko mice. Figure 10A shows the results in nest construction (nest quality / score) in the AAV.CDKL5-treated group at a dose of 5 × 10¹⁰ GC compared to untreated Cdkl5-ko mice. Figure 10B shows the results from the glass sphere twirl task, showing a tendency towards normalization in the AAV.CDLK5-treated group at a dose of 5 × 10¹⁰ GC compared to WT and Cdkl5-ko mice. Figure 10C shows the results in nest construction (nest quality / score) in the AAV.CDKL5-treated group at a dose of 2.5 × 10¹⁰ GC compared to untreated Cdkl5-ko mice. Figure 10D shows the results from the glass sphere twirl task, showing a tendency towards normalization in the AAV.CDLK5-treated group at a dose of 2.5 × 10¹⁰ GC compared to WT and Cdkl5-ko mice. Figure 10E shows the results in nest construction (nest quality / score) in the AAV.CDKL5-treated group at a dose of 1 × 10¹⁰ GC compared to untreated Cdkl5-ko mice. [Figures 11A-11F] The correction of hyperactivity in AAV.CDKL5-treated ko mice was evaluated in the open-field activity test. Figure 11A shows walking activity / bin-to-bin time (30 minutes at 5-minute intervals) in AAV.CDKL5-treated ko mice at a dose of 5 × 10¹⁰ GC. Figure 11B shows total activity in AAV.CDKL5-treated ko mice at a dose of 5 × 10¹⁰ GC. Figure 11C shows walking activity / bin-to-bin time (30 minutes at 5-minute intervals) in AAV.CDKL5-treated ko mice at a dose of 2.5 × 10¹⁰ GC. Figure 11D shows total activity in AAV.CDKL5-treated ko mice at a dose of 2.5 × 10¹⁰ GC. Figure 11E shows walking activity / bin-to-bin time (30 minutes at 5-minute intervals) in AAV.CDKL5-treated ko mice at a dose of 6 × 10⁹ GC. Figure 11F shows total activity in AAV.CDKL5-treated ko mice at a dose of 6 × 10⁹ GC. In AAV.CDKL5-treated ko mice, normalization of increased risk-taking was observed in the elevated zero maze, and normalization of hippocampal learning deficit was seen in the Y maze. [Figure 12]This study demonstrates that the expression of CDKL5 isoforms 2-4 provides a significant correction of the hindlimb clasping phenotype in ko mice when evaluated at a dose of 5 × 10¹¹ GC. [Figures 13A-13D] A strong tendency towards correction is observed in KO mice treated with AAV.CDKL5-isoform 1. Figure 13A shows elevated activity in KO mice treated with AAV.CDKL5-isoform 1 at a dose of 5 × 10¹⁰ GC. Figure 13B shows elevated activity in KO mice treated with AAV.CDKL5-isoform 1 at a dose of 2.5 × 10¹⁰ GC. Figure 13C shows activity in the Y-maze in KO mice treated with AAV.CDKL5-isoform 1 at a dose of 5 × 10¹⁰ GC. Figure 13D shows activity in the Y-maze in KO mice treated with AAV.CDKL5-isoform 1 at a dose of 2.5 × 10¹⁰ GC. [Figure 14A-14C] This report shows sex-specific results in hindlimb clasping after treatment with AAV.CDKL5-isoform 1 knockout mice. Figure 14A shows hindlimb clasping after treatment with AAV.CDKL5-isoform 1 in male knockout mice. Figure 14B shows hindlimb clasping after treatment with AAV.CDKL5-isoform 1 in female knockout mice. In Cdkl5-ko mice, both hemizygous males and heterozygous females showed hindlimb clasping, which was significantly reduced after treatment. None of the WT groups showed clasping. Figure 14C shows walking activity at a high dose (5 × 10¹⁰ GC, neonatal ICV) with significant improvement in female heterozygous mice. [Figures 15A-15B]This report presents sex-specific results for open-field walking activity in open-field evaluation. Figure 15A shows the results of walking activity in open-field evaluation in male (KO) mice treated with AAV.CDKL5-isoform 1, plotted as X,Y axis beam breaks over time. Figure 15B shows the results of walking activity in open-field evaluation in female (ht) mice treated with AAV.CDKL5-isoform 1, plotted as X,Y axis beam breaks over time. Full correction to wild-type is observed at multiple time points in both male (KO) and female (ht) mice treated with AAV.CDKL5-isoform 1. [Figures 16A-16B] This shows sex differences in ko mice treated with the AAV.CDKL5-isoform 1 vector. Figure 16A shows the results of open-field walking activity with elevated zero-maze evaluation in male (KO) mice treated with AAV.CDKL5-isoform 1, plotted as time spent in the open zone (seconds). Figure 16B shows the results of open-field walking activity with elevated zero-maze evaluation in female (ht) mice treated with AAV.CDKL5-isoform 1, plotted as time spent in the open zone (seconds). Risk-prone behaviors are corrected, and the size effect is more pronounced in males. [Figure 17] This graph provides vector distribution in various tissue samples from NHP studies (representative of 1 × 10¹⁴ GC doses). The graph shows rAAV.CDKL5 in gc / diploid genomes of various non-neuronal tissues, spinal cord tracks, and brain tissues. Strong transduction is observed in dorsal root ganglia (DRGs). Moderate to low transduction is observed in brain tissues, with some leakage into non-neuronal tissues. [Figure 18] This report provides quantitative results of hCDKL5 expression (measured by RT-qPCR) in NHP studies in the cerebellum, frontal cortex, occipital cortex, parietal cortex, and temporal cortex. [Figures 19A-19B]The results of a dose-escalation study measuring behavioral changes after CDKL5 gene therapy administration to wild-type mice are shown. Figure 19A shows no significant change in hindlimb clasp severity score in wild-type mice injected with 7.5 × 10¹⁰ GC and 1 × 10¹¹ GC of AAV compared to control mice treated with PBS. Figure 19B shows no significant change in gait activity in wild-type mice injected with 7.5 × 10¹⁰ GC and 1 × 10¹¹ GC of AAV compared to control mice treated with PBS. [Modes for carrying out the invention]

[0020] Compositions and methods for treating CDD are provided herein. An effective amount of recombinant adeno-associated virus (rAAV), having an AAV capsid (e.g., AAVhu68 or AAV-PHP.B) and packaging therein a vector genome encoding a functional human cyclin-dependent kinase-like 5 (hCDKL5), is delivered to a subject in need.

[0021] I. Human CDKL5 The cyclin-dependent kinase-like gene 5 (CDKL5, also known as CFAP247, serine / threonine kinase 9, STK9; Uniprot#076039) is natively located on the short (p) arm at positions 22 and 13 of the X chromosome. The N-terminus of the CDKL5 protein acts as a kinase, an enzyme that alters the activity of other proteins. Several direct substrates of CDKL5 have been identified (Baltussen et al, 2018, Munoz et al, 2018). The function of the C-terminus of CDKL5 is unknown.

[0022] As used herein, functional hCDKL5 protein refers to an isoform, native variant, variant, polymorph, or cleavage of the CKDL5 protein not associated with CDD, and / or its delivery or expression may alleviate or delay the progression of CDD symptoms in animal models or patients. See OMIM#300203, each webpage incorporated herein in its entirety by reference. In certain embodiments, functional hCDKL5 has the amino acid sequence of SEQ ID NO: 2 (isoform 1), or an amino acid sequence identical to it by at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%). In certain embodiments, the functional hCDKL5 protein has the amino acid sequence of SEQ ID NO: 19 (isoform 2), or an amino acid sequence identical to it by at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%). In certain embodiments, the functional hCDKL5 protein has the amino acid sequence of SEQ ID NO: 20 (isoform 3), or an amino acid sequence identical to it by at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%). In certain embodiments, the functional hCDKL5 protein has the amino acid sequence of SEQ ID NO: 21 (isoform 4), or an amino acid sequence identical to it by at least about 90% (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%). In certain embodiments, the functional hCDKL5 is cleaved hCDKL5 containing a methyl-CpG binding domain (MBD) and an NCoR / SMRT interaction domain (NID) having a sequence. See WO2018 / 172795A1 (which is incorporated herein in its entirety by reference).

[0023] In certain embodiments, functional hCDKL5 protein improves or slows the progression of CDD symptoms in animal models. One example animal model is the CDKL5-ko mouse. Other suitable models are described herein.

[0024] The symptoms or progression of CDD may be evaluated using a variety of assays / methods, including but not limited to survival plots (e.g., Kaplan-Meier survival plots), body weight monitoring, and observation of behavioral changes (e.g., hindlimb clasping, open field assay (motor function), elevated zone maze (anxiety / risk vs. exploration), Y-maze (learning and memory / hippocampus), glass sphere hiding assay (innate behavior and movement), nest building (innate social behavior), and rotarod assay (motor function, coordination). In certain embodiments, administration or expression of functional hCDKL5 protein in animal models may be performed in corresponding wild-type animals. This leads to an improvement in CDD symptoms or a delay in CDD progression, as indicated by assay results that are at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, or greater than 100% of the obtained amount. In certain embodiments, administration or expression of functional hCDKL5 protein in a CDD animal model leads to an improvement in CDD symptoms or a delay in CDD progression, as indicated by improved assay results that are at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, or greater than 100% of the obtained amount from the corresponding untreated CDD animals.

[0025] This specification provides nucleic acid sequences encoding a functional hCDKL5 protein, referred to as hCDKL5 coding sequences or CDKL5 coding sequences. In certain embodiments, the hCDKL5 coding sequence is sequence number 3, or a sequence that is at least about 95% identical to sequence number 3. In certain embodiments, the hCDKL5 coding sequence is sequence number 2 (referred to as CDKL5, CDKL5co, CDKL5-1, or CDKL5-1co), or an NCBI reference sequence encoding amino acid sequence NP_001032420.1 (sequence number 19). A nucleic acid sequence is selected from the following: reference sequence NM_001037343.1 (referred to as CDKL5 or CDKL5e1, SEQ ID NO: 16), NM_001323289.2 (SEQ ID NO: 17) encoding amino acid sequence NP_001310218.1 (SEQ ID NO: 20), and NM_003159.2 (SEQ ID NO: 18) encoding amino acid sequence NP_003150.1 (SEQ ID NO: 21), or a nucleic acid sequence that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to them. Each of the NCBI reference sequences is incorporated herein by reference in its entirety. In certain embodiments, the hCDKL5 coding sequence is modified or manipulated (hCDKL5 or hCDKL5co or CDKL5-1 or CDKL5-1co). The modified or manipulated sequence shares less than approximately 70% identity with the NCBI reference sequence (e.g., approximately 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%).

[0026] In certain embodiments, the hCDKL5 coding sequence is a nucleic acid sequence identical to sequence number 22, or at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%). In certain embodiments, the hCDKL5 coding sequence is a nucleic acid sequence identical to sequence number 24, or at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%). In certain embodiments, the hCDKL5 coding sequence is a nucleic acid sequence identical to sequence number 25, or at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%). In certain embodiments, the hCDKL5 coding sequence is a nucleic acid sequence identical to sequence number 26, or at least about 70% (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.9%).

[0027] In certain embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 37, or at least about 95% identical to sequence number 37. In certain embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 38, or at least about 95% identical to sequence number 38. In certain embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 39, or at least about 95% identical to sequence number 39. In certain embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 40, or at least about 95% identical to sequence number 40. In certain embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 41, or at least about 95% identical to sequence number 41. In certain embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 42, or at least about 95% identical to sequence number 42. In certain embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 43, or at least about 95% identical to sequence number 43. In certain embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 44, or a sequence that is at least about 95% identical to sequence number 44. In certain embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 45, or a sequence that is at least about 95% identical to sequence number 45. In certain embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 46, or a sequence that is at least about 95% identical to sequence number 46. In specific embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 47, or a sequence that is at least about 95% identical to sequence number 47. In specific embodiments, the hCDKL5 code sequence is the operational sequence of sequence number 48, or a sequence that is at least about 95% identical to sequence number 48.

[0028] The term "nucleic acid" as used herein may be RNA, DNA, or modifications thereof, and may be single-stranded or double-stranded. For example, nucleic acids, oligonucleotides, and nucleic acid analogs that encode a target protein may be selected from the group including, for example, peptide nucleic acids (PNA), pseudocomplementary PNA (pc-PNA), locked nucleic acids (LNA), etc. Such nucleic acid sequences include, but are not limited to, nucleic acid sequences that encode proteins, such as transcription repressors, antisense molecules, ribozymes, and low-inhibitory nucleic acid sequences, such as, but not limited to, RNAi, shRNAi, siRNA, microRNAi (mRNAi), and antisense oligonucleotides.

[0029] In the context of nucleic acid sequences, the terms "percent (%) identity," "sequence identity," "percent sequence identity," or "percent identical" refer to residues in two sequences that are identical when aligned to a corresponding degree. The length of the sequence identity comparison may be the full length of the genome, the full length of the gene coding sequence, or, if desired, a fragment of at least approximately 500 to 5000 nucleotides. However, identity between smaller fragments of, for example, at least approximately 9 nucleotides, typically at least approximately 20 to 24 nucleotides, at least approximately 28 to 32 nucleotides, or at least approximately 36 or more nucleotides may also be desired.

[0030] Percent identity can be readily determined for the amino acid sequence over the full length of a protein, polypeptide, approximately 32 amino acids, approximately 330 amino acids, or a peptide fragment thereof, or for the corresponding nucleic acid sequence encoding the sequence. A suitable amino acid fragment may be at least approximately 8 amino acids long and up to approximately 700. Generally, when referring to “identity,” “homology,” or “similarity” between two different sequences, “identity,” “homology,” or “similarity” is determined by reference to an “aligned” sequence. An “aligned” sequence or “alignment” refers to multiple nucleic acid sequences or protein (amino acid) sequences that, compared to a reference sequence, often include corrections for missing or additional bases or amino acids.

[0031] Alignment is performed using various publicly available or commercially available multiple sequence alignment programs. Sequence alignment programs are available for amino acid sequences and include, for example, the "Clustal X," "Clustal Omega," "MAP," "PIMA," "MSA," "BLOCKMAKER," "MEME," and "Match-Box" programs. Generally, one of these programs is used with its default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can use other algorithms or computer programs that provide at least a level of identity or alignment, as provided by the algorithms and programs referenced. See, for example, JDThomson et al, Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments," 27(13):2682-2690 (1999).

[0032] Multiple sequence alignment programs are also available for nucleic acid sequences. Examples of such programs include "Clustal W," "Clustal Omega," "CAP Sequence Assembly," "BLAST," "MAP," and "MEME," which are accessible via web servers on the internet. Other sources of the program are known to those skilled in the art. Alternatively, the Vector NTI utility can also be used. In addition, several algorithms known in the art exist and can be used to measure nucleotide sequence identity, including those included in the program described above. As another example, polynucleotide sequences can be compared using Fasta®, a program from GCG version 6.1. Fasta® uses a query sequence and a search sequence. It provides the best alignment of overlapping regions and percent sequence identity between sequences. For example, percent sequence identity between nucleic acid sequences can be determined using Fasta® with its default parameters (word size 6 and NOPAM factor for the scoring matrix), as provided in GCG version 6.1 (incorporated herein by reference).

[0033] II. Expression Cassette This specification provides nucleic acid sequences comprising an hCDKL5 coding sequence under the control of a regulatory sequence that directs hCDKL5 expression in target cells, also referred to as an expression cassette. As used herein, “expression cassette” refers to a nucleic acid molecule comprising a coding sequence (e.g., a CDKL5 coding sequence) and a regulatory sequence operably ligated thereto. In certain embodiments, a vector genome comprises two or more expression cassettes. The term “transgene” refers to a DNA sequence from an exogenous source inserted into a target cell, and typically, a transgene codes for a product (e.g., CDKL5). Typically, such an expression cassette, packaged in a viral vector, includes a coding sequence for the gene product described herein, adjacent to the packaging signal of the viral genome, and other expression regulatory sequences, such as those described herein. The required regulatory sequences are operably ligated to the hCDKL5 coding sequence in a manner that allows their transcription, translation, and / or expression in the target cell. As used herein, “operably linked” sequences include sequences that regulate transcription, translation, and / or expression in conjunction with the hCDKL5 coding sequence, as well as regulatory sequences that act trans or asynchronously to control the hCDKL5 coding sequence. The expression cassette may contain, among other elements, one or more upstream (5'~) regulatory sequences of the gene sequence, e.g., promoters, enhancers, introns, etc., and one or more downstream (3'~) regulatory sequences of the gene sequence, e.g., enhancers, or 3' untranslated regions (3'UTR) containing polyadenylation sites. Such regulatory sequences typically include one or more of, for example, promoters, enhancers, introns, Kozak sequences, polyadenylation sequences, and TATA signals. In certain embodiments, the promoter is a tissue-specific promoter, e.g., a CNS-specific or neuron-specific promoter. In certain embodiments, the promoter is a human synapsin promoter (SEQ ID NO: 23).In certain embodiments, additional or alternative neuron-specific promoter sequences may be selected from neuron-specific enolase (NSE) promoters (Andersen et al., (1993) Cell.Mol.Neurobiol., 13:503 15), neuronal filament light chain gene promoters (Piccioli et al., (1991) Proc.Natl.Acad.Sci.USA, 88:5611 5), neuron-specific vgf gene promoters (Piccioli et al., (1995) Neuron, 15:373 84), and / or others.

[0034] In certain embodiments, the human synapsin promoter has the sequence of SEQ ID NOs: 1, 3, 5, 7, 9 or SEQ ID NO: 23 (also referred to herein as hSyn or Syn) (e.g., nt213~nt678).

[0035] In other embodiments, the promoter is a constitutive promoter, such as a chicken β-actin promoter with a cytomegalovirus enhancer (CB7) promoter, a human elongation initiation factor 1α promoter (EF1a) promoter, or a human ubiquitin C (UbC) promoter. ) is a promoter. In certain embodiments, the regulatory element directs the expression of hCDKL5 in central nervous system (CNS) cells.

[0036] In certain embodiments, the target cells may be central nervous system cells. In certain embodiments, the target cells may be one or more of the following: excitatory neurons, inhibitory neurons, glial cells, cortical cells, prefrontal cortical cells, cerebral cortical cells, and spinal cord cells. In certain embodiments, the target cells may be peripheral nervous system (PNS) cells, such as retinal cells. Cells other than those derived from the nervous system may also be selected as target cells, such as monocytes, B lymphocytes, T lymphocytes, NK cells, lymph node cells, tonsillar cells, bone marrow mesenchymal cells, stem cells, bone marrow stem cells, cardiac cells, epithelial cells, esophageal cells, gastric cells, fetal transection cells, colon cells, rectal cells, liver cells, kidney cells, lung cells, salivary gland cells, thyroid cells, adrenal cells, mammary gland cells, pancreatic cells, islet cells of Langerhans, gallbladder cells, prostate cells, bladder cells, skin cells, uterine cells, cervical cells, testicular cells, or any other cells expressing functional CDKL5 protein in subjects without CDD.

[0037] In certain embodiments, the expression regulatory sequence (control sequence) may include, for example, an additional or alternative promoter sequence located between a selected 5'ITR sequence and the coding sequence. Constitutive promoters, regulated promoters [see, e.g., WO2011 / 126808 and WO2013 / 04943], tissue-specific promoters, or promoters responsive to physiological hints may be used in the vectors described herein. The promoter can be selected from different sources, such as the human cytomegalovirus (CMV) early enhancer / promoter, SV40 early enhancer / promoter, JC polymomavirus promoter, myelin basic protein (MBP) or collagen fiber acidic protein (GFAP) promoter, herpes simplex virus (HSV-1) latent-associated promoter (LAP), Roussarcoma virus (RSV) long-terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet-derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and chicken β-actin promoter.

[0038] In addition to the promoter, the vector may include one or more other suitable transcription start sequences, transcription termination sequences, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (poly-A) signals; sequences that stabilize cytoplasmic mRNA (e.g., WPRE); sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and, if necessary, sequences that enhance the secretion of the encoded product. An example of a suitable enhancer is the CMV enhancer. Other suitable enhancers include those appropriate for the desired target tissue indication. In one embodiment, the regulatory sequence includes one or more expression enhancers. In one embodiment, the regulatory sequence includes two or more expression enhancers. These enhancers may be the same or different from one another. For example, the enhancer may include a CMV pre-initial enhancer. This enhancer may be present in two copies located adjacent to each other. Alternatively, the duplicate copies of the enhancer may be separated by one or more sequences. In yet another embodiment, the expression cassette further contains an intron, for example, a chicken β-actin intron. In a particular embodiment, the intron is a chimeric intron (CI), which is a hybrid intron consisting of a human β-globin splice donor and an immunoglobulin G (IgG) splice acceptor element. Other suitable introns include those known in the art and described, for example, in WO2011 / 126808. Examples of suitable polyA sequences include, for example, rabbit globin polyA, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyA. Optionally, one or more sequences may be selected to stabilize the mRNA. An example of such a sequence is a modified WPRE sequence, which can be manipulated upstream of the polyA sequence and downstream of the coding sequence (e.g., MA Za See nta-Boussif, et al, Gene Therapy (2009) 16:605-619. In certain embodiments, the WPRE sequence is absent.

[0039] In certain embodiments, the expression cassette refers to a nucleic acid molecule having the sequence nt213-4439 of SEQ ID NO: 1, which encodes the amino acid sequence of hCDKL5 (isoform 1, SEQ ID NO: 2). In certain embodiments, the expression cassette refers to a nucleic acid molecule having the sequence nt213-4562 of SEQ ID NO: 5, which encodes the amino acid sequence of hCDKL5 (isoform 2 or 2GS, SEQ ID NO: 6). In certain embodiments, the expression cassette refers to a nucleic acid molecule having the sequence nt213-4388 of SEQ ID NO: 7, which encodes the amino acid sequence of hCDKL5 (isoform 3 or 3GS, SEQ ID NO: 8). In certain embodiments, the expression cassette refers to a nucleic acid molecule having the sequence nt213-4511 of SEQ ID NO: 9, which encodes the amino acid sequence of hCDKL5 (isoform 4 or 4GS, SEQ ID NO: 10). In certain embodiments, the expression cassette is selected from SEQ ID NOs. 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, or 48 and includes an engineered nucleic acid sequence encoding the amino acid sequence of hCDKL5 (isoform 1, SEQ ID NO. 2). In certain embodiments, the expression cassette refers to a nucleic acid molecule having the sequence nt213-4555 of SEQ ID NO. 3, comprising miRNA 183 (SEQ ID NO. 11), which encodes the amino acid sequence of hCDKL5 (isoform 1, SEQ ID NO. 4). In certain embodiments, these expression cassettes further include one, two, three, four, or more drg detargeting sequences (i.e., miRNAs). See, for example, PCT / US19 / 67872, filed December 20, 2019, and currently published as WO2020 / 132455.

[0040] III.rAAV This specification provides recombinant adeno-associated viruses (rAAVs) useful for treating CDD. The rAAV comprises (a) an AAV capsid and (b) a vector genome packaged in the AAV capsid of (a). Preferably, the selected AAV capsid targets the cells to be treated. In certain embodiments, the capsid is derived from clade F. However, in certain embodiments, a different AAV capsid source may be selected. The vector genome comprises a nucleic acid sequence encoding functional human cyclin-dependent kinase-like 5 (hCDKL5) under the control of inverted terminal repeats (ITRs) and regulatory sequences directing hCDKL5 expression. In certain embodiments, CDKL5 may refer to CDKL5 or hCDKL5, CDKL5-2GS or hCDKL5-2GS, CDKL5-3GS or hCDKL5-3GS, and CDKL5-4GS or hCDKL5-4GS. In certain embodiments, the hCDKL5 coding sequence is at least about 95% identical to SEQ ID NO: 22 (SEQ ID NO: 2, which codes for the amino acid sequence of CDKL5-1 or hCDKL5-1). In certain embodiments, the hCDKL5 coding sequence is at least about 95% identical to SEQ ID NO: 24 (SEQ ID NO: 6, which codes for the amino acid sequence of CDKL5-2GS or hCDKL5-2GS). In certain embodiments, the hCDKL5 coding sequence is at least about 95% identical to SEQ ID NO: 25 (SEQ ID NO: 8, which codes for the amino acid sequence of CDKL5-3GS or hCDKL5-3GS). In certain embodiments, the hCDKL5 coding sequence is at least about 95% identical to SEQ ID NO: 26 (SEQ ID NO: 10, which codes for the amino acid sequence of CDKL5-4GS or hCDKL5-4GS). In certain embodiments, the hCDKL5 coding sequence is less than 80% identical to any one of the hCDKL5 transcriptional variants 1 to 3 (NM_001037343.1 having SEQ ID NO: 16 and encoding the amino acid sequence NP_001032420.1 having SEQ ID NO: 19; NM_001323289.2 having SEQ ID NO: 17 and encoding the amino acid sequence NP_001310218.1 having SEQ ID NO: 20; NM_003159.2 having SEQ ID NO: 18 and encoding the amino acid sequence NP_003150.1 having SEQ ID NO: 21).In certain embodiments, the hCDKL5 code sequence is sequence numbers 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, and 47, or is at least about 95% identical thereto (CDKL5-1 or h). SEQ ID NO: 2 encodes the amino acid sequence of CDKL5-1. In certain embodiments, functional hCDKL5 has the amino acid sequence of SEQ ID NO: 2 (CDKL5-1 or hCDKL5-1). In certain embodiments, functional hCDKL5 has the amino acid sequence of SEQ ID NO: 6 (CDKL5-2GS or hCDKL5-2GS). In certain embodiments, functional hCDKL5 has the amino acid sequence of SEQ ID NO: 8 (CDKL5-3GS or hCDKL5-3GS). In certain embodiments, functional hCDKL5 has the amino acid sequence of SEQ ID NO: 10 (CDKL5-4GS or hCDKL5-4GS). In certain embodiments, the regulatory sequence directs hCDKL5 expression in central nervous system cells. In certain embodiments, the regulatory sequence includes a human synapsin promoter (hSyn) or a CB7 promoter. In certain embodiments, the regulatory element comprises one or more of the following: Kozak sequences, polyadenylated sequences, introns, enhancers, and TATA signals. In certain embodiments, the vector genome further comprises at least two tandem repeats of dorsal root ganglion (DRG) specific miRNA target sequences, the at least two tandem repeats comprising at least a first miRNA target sequence and at least a second miRNA target sequence which may be the same as or different from the first. In certain embodiments, the vector genome is a nucleic acid sequence identical to nt1-nt4634 of SEQ ID NO: 1, or nt1-nt4750 of SEQ ID NO: 3, or nt1-nt4757 of SEQ ID NO: 5, or nt1-nt4583 of SEQ ID NO: 7, or nt1-nt4706 of SEQ ID NO: 9, or at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%).

[0041] In certain embodiments, the vector genome refers to a nucleic acid molecule containing SEQ ID NO: 1, which encodes the amino acid sequence of hCDKL5 (isoform 1, SEQ ID NO: 2). In certain embodiments, the vector genome refers to a nucleic acid molecule containing SEQ ID NO: 5, which encodes the amino acid sequence of hCDKL5 (isoform 2 or 2GS, SEQ ID NO: 6). In certain embodiments, the vector genome refers to a nucleic acid molecule containing SEQ ID NO: 7, which encodes the amino acid sequence of hCDKL5 (isoform 3 or 3GS, SEQ ID NO: 8). In certain embodiments, the vector genome refers to a nucleic acid molecule containing SEQ ID NO: 9, which encodes the amino acid sequence of hCDKL5 (isoform 4 or 4GS, SEQ ID NO: 10). In certain embodiments, the vector genome refers to a nucleic acid molecule containing SEQ ID NO: 3, which encodes the amino acid sequence of hCDKL5 (isoform 1, SEQ ID NO: 4), and which contains miRNA183 (SEQ ID NO: 11).

[0042] In certain embodiments, in addition to the hCDKL5 coding sequence, another non-AAV coding sequence may be included, e.g., the peptide, polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product. Useful gene products include miRNA. miRNA and other small interfering nucleic acids regulate gene expression through cleavage / degradation of target RNA transcripts or translational repression of target messenger RNA (mRNA). miRNAs are typically expressed naturally as the final 19–25 untranslated RNA product. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated region (UTR) of target mRNA. These endogenously expressed miRNAs form hairpin precursors, which are subsequently processed into miRNA double-stranded molecules and further into “mature” single-stranded miRNA molecules. This mature miRNA induces the multiprotein complex miRISC, which, based on complementarity with the mature miRNA, identifies, for example, a target site on the target mRNA within the 3' UTR region.

[0043] As used herein, “miRNA target sequence” is a sequence (5' to 3') located on the DNA plus strand and is at least partially complementary to the miRNA sequence containing the miRNA seed sequence. The miRNA target sequence is exogenous to the untranslated region of the encoded transgene product and is designed to be specifically targeted by the miRNA in cells where repression of transgene expression is desired. The term refers to a target sequence that responds to one or more members of the miR183 cluster (or family), including miR-183, -96, and -182 (as incorporated herein by reference by Dambal, S. et al. Nucleic Acids Res 43:7173-7188, 2015).

[0044] Typically, a miRNA target sequence is at least 7 to about 28 nucleotides long, at least 8 to about 28 nucleotides long, 7 to 28 nucleotides, 8 to 18 nucleotides long, about 12 to about 28 nucleotides long, about 20 to about 26 nucleotides, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides, and contains at least one continuous region (e.g., 7 or 8 nucleotides) that is complementary to the miRNA seed sequence. In certain embodiments, the target sequence includes a sequence that has exact complementarity (100%) to the miRNA seed sequence, or a sequence that has partial complementarity with the miRNA seed sequence, including some mismatches. In certain embodiments, the target sequence includes at least 7 to 8 nucleotides that are 100% complementary to the miRNA seed sequence. In certain embodiments, the target sequence consists of a sequence that is 100% complementary to the miRNA seed sequence. In certain embodiments, the target sequence includes multiple copies (e.g., 2 or 3 copies) of a sequence that is 100% complementary to the seed sequence. In certain embodiments, the 100% complementary region comprises at least 30% of the length of the target sequence. In certain embodiments, the remainder of the target sequence has at least about 80% to about 99% complementarity with respect to the miRNA. In certain embodiments, in an expression cassette containing a DNA plus strand, the miRNA target sequence is the reverse complement of the miRNA.

[0045] As used herein, “miRNA target sequence” is a sequence (5' to 3') located on the DNA plus strand and is at least partially complementary to a miRNA sequence containing a miRNA seed sequence. The miRNA target sequence is exogenous to the untranslated region of the encoded transgene product and is designed to be specifically targeted by the miRNA in cells where repression of transgene expression is desired. The term “miR183 cluster target sequence” refers to a target sequence that responds to one or more members of the miR183 cluster (or family), including miR-183, -96, and -182 (described by Dambal, S. et al. Nucleic Acids Res 43:7173-7188, 2015, incorporated herein by reference). While not intended to be constrained by theory, the messenger RNA (mRNA) of a transgene (encoding the gene product) is present in the cell type to which the expression cassette containing miRNA is delivered. As a result, the specific binding of miRNA to the target sequence of the 3'UTR miRNA leads to mRNA silencing and cleavage, thereby reducing or eliminating transgene expression only in cells expressing miRNA.

[0046] Typically, a miRNA target sequence is at least 7 to about 28 nucleotides long, at least 8 to about 28 nucleotides long, 7 to 28 nucleotides, 8 to 18 nucleotides long, about 12 to about 28 nucleotides long, about 20 to about 26 nucleotides, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides, and contains at least one continuous region (e.g., 7 or 8 nucleotides) that is complementary to the miRNA seed sequence. In certain embodiments, the target sequence includes a sequence that has exact complementarity (100%) to the miRNA seed sequence, or a sequence that has partial complementarity with the miRNA seed sequence, including some mismatches. In certain embodiments, the target sequence includes at least 7 to 8 nucleotides that are 100% complementary to the miRNA seed sequence. In certain embodiments, the target sequence consists of a sequence that is 100% complementary to the miRNA seed sequence. In certain embodiments, the target sequence includes multiple copies (e.g., 2 or 3 copies) of a sequence that is 100% complementary to the seed sequence. In certain embodiments, the 100% complementary region includes at least 30% of the length of the target sequence. In certain embodiments, the remaining portion of the target sequence The part has at least about 80% to about 99% complementarity with the miRNA. In certain embodiments, in an expression cassette containing a DNA plus strand, the miRNA target sequence is the reverse complement of the miRNA.

[0047] In certain embodiments, the miRNA target sequences of at least one first and / or at least one second miRNA target sequence of the expression cassette mRNA or DNA plus strand are selected from (i) ATGAATTCTACCAGTGCCATA (miR183, SEQ ID NO: 11), (ii) AGCAAAAATGTGCTAGTGCCAAA (miR-96, SEQ ID NO: 12), and (iii) AGTGTGAGTTCTACCATTGCCAAA (miR182, SEQ ID NO: 13). In other embodiments, AGGGATTCCTGGGAAAACTGGAC (SEQ ID NO: 14) is selected.

[0048] In certain embodiments, the vector genome or expression cassette includes at least one miRNA target sequence which is the target sequence of miR-183. In certain embodiments, the vector genome or expression cassette includes a miR-183 target sequence including ATGAATTCTACCAGTGCCATA (SEQ ID NO: 11), where the sequence complementary to the miR-183 seed sequence is GTGCCAT. In certain embodiments, the vector genome or expression cassette includes two or more copies (e.g., two or three copies) of a sequence that is 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence is about 7 to about 28 nucleotides long and includes at least one region that is at least 100% complementary to the miR-183 seed sequence. In certain embodiments, the miR-183 target sequence includes a sequence that is partially complementary to SEQ ID NO: 11, and therefore has one or more mismatches when aligned to SEQ ID NO: 11. In certain embodiments, the miR-183 target sequence, when aligned with sequence number 11, includes sequences having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches, the mismatches may be discontinuous. In certain embodiments, the miR-183 target sequence includes a 100% complementary region and also includes at least 30% of the length of the miR-183 target sequence. In certain embodiments, the 100% complementary region includes sequences that are 100% complementary to the miR-183 seed sequence. In certain embodiments, the remainder of the miR-183 target sequence is at least about 80% to about 99% complementary to miR-183. In certain embodiments, the expression cassette or vector genome includes a miR-183 target sequence containing a cleaved SEQ ID NO: 11 (i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either the 5' or 3' end of SEQ ID NO: 1, or both). In certain embodiments, the expression cassette or vector genome includes the transgene and one miR-183 target sequence. In yet another embodiment, the expression cassette or vector genome includes at least two, three, or four miR-183 target sequences.(i)AGTGAATTCTACCAGTGCCATA(miR183, Sequence ID 11), (ii)AGCAAAAATGTGCTAGTGCCAAA(miR-96, Sequence ID 12).

[0049] In certain embodiments, the vector genome or expression cassette includes at least one miRNA target sequence which is the target sequence of miR-182. In certain embodiments, the vector genome or expression cassette includes a miR-182 target sequence which includes AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 13). In certain embodiments, the vector genome or expression cassette includes more than one copy (e.g., two or three copies) of a sequence that is 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence is about 7 to about 28 nucleotides long and includes at least one region that is at least 100% complementary to the miR-182 seed sequence. In certain embodiments, the miR-182 target sequence includes a sequence that is partially complementary to SEQ ID NO: 13 and therefore has one or more mismatches when aligned with SEQ ID NO: 13. In certain embodiments, the miR-183 target sequence, when aligned with SEQ ID NO: 13, has at least 1, 2, 3, 4, 5, 6 The sequence includes 7, 8, 9, or 10 mismatches, the mismatches may be discontinuous. In certain embodiments, the miR-182 target sequence includes a 100% complementary region, which also includes at least 30% of the length of the miR-182 target sequence. In certain embodiments, the 100% complementary region includes a sequence that is 100% complementary to the miR-182 seed sequence. In certain embodiments, the remainder of the miR-182 target sequence is at least about 80% to about 99% complementary to miR-182. In certain embodiments, the expression cassette or vector genome includes the miR-182 target sequence, which includes a cleaved SEQ ID NO: 13 (i.e., a sequence lacking at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at either the 5' or 3' end or both of the SEQ ID NO: 13). In certain embodiments, the expression cassette or vector genome includes the transgene and one miR-182 target sequence. In yet another embodiment, the expression cassette or vector genome includes at least two, three, or four miR-182 target sequences.

[0050] The term “tandem repeat” is used herein to refer to the presence of two or more consecutive miRNA target sequences. These miRNA target sequences may be consecutive, that is, the 3' end of one sequence may be immediately upstream of the 5' end of the next sequence, or vice versa, and so on. In another embodiment, two or more of the miRNA target sequences are separated by a short spacer sequence.

[0051] As used herein, “spacer” is any selected nucleic acid sequence of, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, located between two or more consecutive miRNA target sequences. In certain embodiments, the spacer is 1–8 nucleotides, 2–7 nucleotides, 3–6 nucleotides, 4 nucleotides, 4–9 nucleotides, 3–7 nucleotides, or longer. Preferably, the spacer is a non-coding sequence. In certain embodiments, the spacer may be four (4) nucleotides. In certain embodiments, the spacer is GGAT. In certain embodiments, the spacer is six (6) nucleotides. In certain embodiments, the spacer is CACGTG or GCATGC.

[0052] In certain embodiments, the tandem repeat includes two, three, four or more identical miRNA target sequences. In certain embodiments, the tandem repeat includes at least two different miRNA target sequences, at least three different miRNA target sequences, or at least four different miRNA target sequences. In certain embodiments, the tandem repeat may include two or three identical miRNA target sequences and a different fourth miRNA target sequence.

[0053] In certain embodiments, the expression cassette may contain at least two different sets of tandem repeats. For example, the 3'UTR may contain the transgene, a tandem repeat immediately downstream of the UTR sequence, and two or more tandem repeats near the 3' end of the UTR. In another example, the 5'UTR may contain one or more miRNA target sequences. In yet another example, the 3' may contain tandem repeats, and the 5'UTR may contain at least one miRNA target sequence.

[0054] In certain embodiments, the expression cassette comprises two, three, four or more tandem repeats and begins within approximately 0 to 20 nucleotides of the stop codon of the transgene. In other embodiments, the expression cassette comprises miRNA tandem repeats of at least 100 to approximately 4000 nucleotides from the stop codon of the transgene.

[0055] In certain embodiments, the spacers between miRNA target sequences are the same. As used herein, CDKL5 or hCDKL5 are isoforms unless otherwise specified. This refers to 1. Isoforms 2-4 can be designated as CDKL5-2GS or hCDKL5-2GS, CDKL5-3GS or hCDKL5-3GS, and CDKL5-4GS or hCDKL5-4GS. Expression cassettes and vector genomes having these isoforms can be constructed as described for isoform 1.

[0056] See also PCT / US19 / 67872 (now WO2020 / 132455) filed on 20 December 2019, and U.S. Provisional Patent Application No. 63 / 023,593 filed on 12 May 2020, U.S. Provisional Patent Application No. 63 / 038,488 filed on 12 June 2020, U.S. Provisional Patent Application No. 63 / 043,562 filed on 24 June 2020, and U.S. Provisional Patent Application No. 63 / 079,299 filed on 16 September 2020, and U.S. Provisional Patent Application No. 63 / 152,042 filed on 22 February 2011, which are incorporated herein by reference.

[0057] In certain embodiments, the clade F AAV capsid is selected from AAVhu68 capsid, AAV9 capsid, AAVhu31 capsid, AAVhu32 capsid, or an engineered variant of one of these capsids (e.g., AAV-PHP.B). The nucleic acid sequence encoding the AAVhu68 capsid protein is used in the following examples for the production of AAV.hCDKL5 recombinant AAV (rAAV) having a vector genome. Additional details related to AAVhu68 or AAV-PHP.B are provided in WO2018 / 160582 and US2015 / 0079038, each of which is incorporated herein by reference in whole. The clade F vector described herein is particularly suitable for delivering the vector genome containing the hCDKL5 coding sequence to cells in the central nervous system, including the brain, hippocampus, motor cortex, cerebellum, and motor neurons. These vectors can be used to target other cells within the central nervous system (CNS), as well as certain other tissues and cells outside the CNS.

[0058] In certain embodiments, the AAV capsid for the compositions and methods described herein is selected based on target cells. In certain embodiments, the AAV capsid transduces CNS cells and / or PNS cells. In certain embodiments, the AAV capsid is selected from cy02 capsid, rh43 capsid, AAV8 capsid, rh01 capsid, AAV9 capsid, rh8 capsid, rh10 capsid, bb01 capsid, hu37 capsid, rh02 capsid, rh20 capsid, rh39 capsid, rh64 capsid, AAV6 capsid, AAV1 capsid, hu44 capsid, hu48 capsid, cy05 capsid, hu11 capsid, hu32 capsid, pi2 capsid, or variations thereof. In certain embodiments, the AAV capsid is a clade F capsid such as AAV9 capsid, AAVhu68 capsid, hu31 capsid, hu32 capsid, or a variation thereof. See, for example, WO2005 / 033321, WO2018 / 160582, and US2015 / 0079038, published on April 14, 2015 (each of these is incorporated herein by reference in whole). In certain embodiments, the AAV capsid is a non-clade F capsid, e.g., a clade A, B, C, D, or E capsid. In certain embodiments, the non-clade F capsid is AAV1 or a variation thereof. In certain embodiments, the AAV capsid transduces target cells other than neural cells. In certain embodiments, the AAV capsid is a clade A capsid (e.g., AAV1, AAV6, AAVrh91), a clade B capsid (e.g., AAV2), a clade C capsid (e.g., hu53), a clade D capsid (e.g., AAV7), or a clade E capsid (e.g., rh10). In certain embodiments, the AAV capsid is a clade A capsid such as the AAVrh91 capsid (nucleic acid sequences of SEQ ID NOs. 33 and 35). See PCT / US20 / 030266 filed April 29, 2020, WO2020 / 223231 (incorporated herein by reference), and U.S. Provisional Patent Application No. 63 / 065 filed April 29, 2019. See also U.S. Provisional Patent Application No. 616 (incorporated herein by reference). See also U.S. Provisional Patent Application No. 63 / 065,616, filed August 14, 2020, and U.S. Provisional Patent Application No. 63 / 109,734, filed November 4, 2020 (incorporated herein by reference). Nevertheless, other AAV capsids may be selected.

[0059] As used herein, the term “clade” in relation to a group of AAVs refers to a group of AAVs that are systematically related to one another and are determined using a neighbor-joining algorithm based on the alignment of AAV vp1 amino acid sequences, with at least 75% bootstrap values ​​(out of at least 1000 replicates) and Poisson-corrected distance measurements of 0.05 or less. The neighbor-joining algorithm is described in the literature. For example, see Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000)). A computer program is available that can be used to implement this algorithm. For example, the MEGA v2.1 program implements the modified Nei-Gojobori method. Using these techniques and computer programs, as well as the sequences of AAV vp1 capsid proteins, those skilled in the art can easily determine whether a selected AAV belongs to one of the lineage groups (clades) specified herein, another lineage group, or outside of these lineage groups. For example, see G Gao, et al, J Virol 2004 Jun;78(10):6381-6388, which identifies clades A, B, C, D, E, and F and provides nucleic acid sequences of novel AAVs (GenBank acceptance numbers AY530553~AY530629). Also see WO2005 / 033321.

[0060] rAAV consists of an AAV capsid and a vector genome. The AAV capsid is a collection of heterogeneous populations of vp1, vp2, and vp3 proteins. As used herein, when used to refer to vp capsid proteins, the term “heterogeneous” or any grammatical variation thereof refers to a collection of non-identical elements having, for example, vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences.

[0061] As used herein, when used to refer to vp capsid proteins, the term “heterogeneous” or any grammatical variation thereof refers to a population of non-identical elements having, for example, vp1, vp2, or vp3 monomers (proteins) with different modified amino acid sequences. The term “heterogeneous population” as used in relation to vp1, vp2, and vp3 proteins (alternatively referred to as isoforms) refers to the differences in amino acid sequences of vp1, vp2, and vp3 proteins within the capsid. AAV capsids contain subpopulations within the vp1, vp2, and vp3 proteins that have modifications from the predicted amino acid residues. These subpopulations contain, at a minimum, certain deamidated asparagine (N or Asn) residues. For example, certain subpopulations contain at least one, two, three, or four highly deamidated asparagine(N) positions in the asparagine-glycine pair, and optionally further contain other deamidated amino acids, where deamidation results in amino acid changes and other optional modifications.

[0062] In certain embodiments, an AAV capsid is provided having a heterogeneous population of AAV capsid isoforms (i.e., VP1, VP2, VP3) containing multiple highly deamidated "NG" sites. In certain embodiments, the highly deamidated sites are located at the positions shown below, with reference to the predicted full-length VP1 amino acid sequence. In other embodiments, the capsid gene is modified so that the referenced "NG" is removed, and the mutant "NG" is manipulated to a different position.

[0063] As used herein, the terms “target cells” and “target tissue” may refer to any cells or tissues intended to be transduced by the AAV vector in question. These terms may refer to one or more of the following: muscle, liver, lung, airway epithelium, central nervous system, neurons, eye (visual cells), or heart.

[0064] As used herein, the term “vector genome” refers to a nucleic acid molecule that can be packaged in a viral capsid, e.g., an AAV capsid, and delivered to a host cell or patient cell. In certain embodiments, the vector genome is an expression cassette having inverted terminal repeat (ITR) sequences at its 5' and 3' ends necessary for packaging the vector genome into an AAV capsid, and containing, between them, the CDLK5 gene described herein, operably linked to a sequence that directs expression. In certain embodiments, the vector genome may include, at least, an AAV 5'ITR, a coding sequence, and an AAV 3'ITR from 5' to 3'. In certain embodiments, the ITR may be derived from AAV2 (a different AAV source than the capsid) or other full-length ITRs may be selected. In certain embodiments, the ITR is derived from the same AAV source as the AAV that provides rep function or trans-complementary AAV during production. Further, other ITRs may be used. The vector genome may be referred to herein as a “minigene”.

[0065] As used herein, the term “host cell” may refer to the packaging cell line from which rAAV is produced from the plasmid. Alternatively, the term “host cell” may refer to the target cell from which the transgene expression is desired.

[0066] As shown above, the invention provides an AAV capsid that targets desired cells, and an rAAV having a vector genome comprising at least an AAV ITR, an hCDKL5 coding sequence, and a regulatory sequence that directs expression thereof, which are necessary for packaging the vector genome into the capsid. In certain embodiments, the vector genome is a single-stranded AAV vector genome. In certain embodiments, an rAAV vector comprising a self-complementary (sc)AAV vector genome may be utilized in the invention.

[0067] The AAV sequence of the vector typically contains cis-acting 5' and 3' inverted terminal repeat (ITR) sequences (see, e.g., B.J. Carter, in “Handbook of Parvoviruses”, ed., P. Tijsser, CRC Press, pp. 155-168 (1990)). The ITR sequence is approximately 145 base pairs (bp) in length. Preferably, the entire sequence substantially encoding the ITR is used intramolecularly, although some minor modifications to these sequences are permissible. The ability to modify these ITR sequences is within the scope of the art (see, e.g., Sambrook et al., “Molecular Cloning. A Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory, New York (1989), and K. Fisher et al., J. Virol., 70:520-532 (1996)). An example of such molecules used in the present invention is a “cis-acting” plasmid containing a transgene, in which the selected transgene sequence and associated regulatory elements are adjacent to 5' and 3' AAV ITR sequences. In one embodiment, the ITR is derived from a different AAV than the one supplying the capsid. In one embodiment, the ITR sequence is derived from AAV2. A shortened version of the 5' ITR, referred to as ΔITR, is described, with a deletion of the D sequence and terminal segregation sites (trs). In other embodiments, full-length AAV5' and 3' ITRs are used. In a particular embodiment, the vector genome contains a 130-base pair shortened AAV2 ITR with a deletion of the outer A element. The shortened ITR is reverted to its wild-type length of 145 base pairs during vector DNA amplification using the inner A element as a template. However, ITRs derived from other AAV origins may be selected. If the ITR originates from AAV2 and the AAV capsid originates from another AAV, the resulting vector may be described as pseudotype. However, other configurations of these elements may also be preferable.

[0068] In certain embodiments, a vector genome is constructed comprising a 5'AAV ITR-promoter-optionally selected enhancer-optionally selected intron-hCDKL5 coding sequence-poly-A-3'ITR. In certain embodiments, a vector genome is constructed comprising a 5'AAV ITR-promoter-optionally selected enhancer-optionally selected intron-hCDKL5 coding sequence-optionally selected repeating miR detargeting sequence-poly-A-3'ITR. In certain embodiments, a vector genome is constructed comprising a 5'AAV ITR-promoter-optionally selected intron-hCDKL5 coding sequence-optionally selected enhancer-poly-A-3'ITR. In certain embodiments, a vector genome is constructed comprising a 5'AAV ITR-promoter-optionally selected enhancer-optionally selected intron-hCDKL5 coding sequence-optionally selected enhancer-optionally selected repeating miR detargeting sequence-poly-A-3'ITR. In certain embodiments, the ITR is not derived from AAV2. In certain embodiments, there is one or more promoters. In certain embodiments, enhancers are present in the vector genome. In certain embodiments, there is one or more enhancers. In certain embodiments, introns are present in the vector genome. In certain embodiments, enhancers and introns are present. In certain embodiments, polyA is SV40 polyA (i.e., a polyadenylation (PolyA) signal derived from the late gene of simian virus 40 (SV40)). In certain embodiments, polyA is rabbit β-globin (RBG) polyA. In certain embodiments, the vector genome includes at least a 5'AAV ITR-hSyn promoter-hCDKL5 coding sequence-polyA-3'ITR. In certain embodiments, the vector genome includes a 5'AAV ITR-CB7 promoter-hCDKL5 coding sequence-RBG polyA-3'ITR. In certain embodiments, the drg detargeting sequence is one, two, three, four, or more miR183 sequences described herein and is included in the expression cassette. In certain embodiments, the hCDKL5 coding sequence is for CDKL5. In certain embodiments, the hCDKL5 coding sequence is for CDKL5-2GS.In certain embodiments, the hCDKL5 coding sequence is for CDKL5-3GS. In certain embodiments, the hCDKL5 coding sequence is for CDKL5-4GS. Optionally, one or more of these vector genomes contain a WPRE element.

[0069] As used herein, a vector genome or an rAAV containing a vector genome is exemplified herein as AAV.promoter(optional).Kozak(optional).Intron(optional).CDKL5 coding sequence(e.g., hCDKL5, hCDKL5co, CDKL5, CDKL5co).miRNA(optional).Poly-A(optional).Stuffer(optional). In certain embodiments, an rAAV is exemplified herein as AAV capsid.promoter(optional).Kozak(optional).Intron(optional).CDKL5 coding sequence.miRNA(optional).Poly-A(optional).Stuffer(optional).Optionally, one or more of these vector genomes contain a WPRE element.

[0070] In certain embodiments, the vector genome comprises at least a 5'AAV ITR-ubiquitin C promoter-hCDKL5 coding sequence-1, 2, 3, 4, or more miR183 sequences-RBG poly-A-3'ITR. In certain embodiments, the vector genome comprises at least a 5'AAV ITR-chicken β-actin hybrid promoter-hCDKL5 coding sequence-1, 2, 3, 4, or more miR183 sequences-RBG poly-A-3'ITR. Optionally, one or more of these vector genomes contain a WPRE element.

[0071] Furthermore, this specification provides an rAAV production system useful for producing the rAAV described herein. The production system comprises a cell culture comprising (a) a nucleic acid sequence encoding an AAV capsid protein, (b) a vector genome, and (c) sufficient AAV rep and helper functions to allow the vector genome to be packaged into an AAV capsid. In certain embodiments, the vector genome is SEQ ID NO: 1, 3, 5, 7, 9, 29, or 31. In certain embodiments, the cell culture is a human embryonic kidney 293 cell culture. In certain embodiments, the AAV rep is derived from a different AAV. In certain embodiments, the AAV rep is derived from AAV2. In certain embodiments, the AAV rep coding sequence and the cap gene reside on the same nucleic acid molecule, and optionally, a spacer is present between the rep sequence and the cap gene. In certain embodiments, the spacer is atgacttaaaccaggt (SEQ ID NO: 15).

[0072] For use in the production of AAV virus vectors (e.g., recombinant(r)AAV), the vector genome can be loaded onto any suitable vector, such as a plasmid, to be delivered to a packaging host cell. Plasmids useful in this invention can be engineered to be suitable for in vitro replication and packaging in, among other things, prokaryotic cells, insect cells, and mammalian cells. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by those skilled in the art.

[0073] Methods for generating and isolating AAVs suitable for use as vectors are known in the art. See, for example, Grieger & Samulski, 2005, Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications, Adv. Biochem.Engin / Biotechnol.99:119-145, Buning et al., 2008, Recent developments in adeno-associated virus vector technology, J.Gene Med.10:717-733, and the references cited below (each of which is incorporated herein in whole by reference). As used herein, gene therapy vectors refer to the rAAVs described herein, which are suitable for use in treating patients. To package the gene into a virion, the ITR is the only AAV component required in cis in the same construct as the nucleic acid molecule containing the gene. The cap and rep genes may be supplied trans.

[0074] In one embodiment, selected gene elements may be delivered to AAV-packaged cells by any preferred method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion. Stable AAV-packaged cells can also be produced. Methods used to produce such constructs are known to technicians in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0075] The term “AAV intermediate” or “AAV vector intermediate” refers to an assembled rAAV capsid that lacks the desired genomic sequence it is packaged in. These may be referred to as “empty” capsids. Such capsids may contain no detectable genomic sequence for the expression cassette at all, or only a partially packaged genomic sequence that is insufficient to achieve gene product expression. These empty capsids do not allow the host cell to express the desired gene. It is non-functional in order to implement it.

[0076] The recombinant adeno-associated viruses (AAVs) described herein may be produced using known techniques. See, for example, WO2003 / 042397, WO2005 / 033321, WO2006 / 110689, and US7588772B2. Such methods involve culturing host cells containing a nucleic acid sequence encoding an AAV capsid protein, a functional rep gene, an expression cassette consisting of at least an AAV reverse-terminal repeat (ITR) and a transgene, and sufficient helper function to allow the expression cassette to be packaged into an AAV capsid protein. Methods for producing the capsid, the coding sequence therefor, and methods for producing an rAAV viral vector are described. See, for example, Gao, et al, Proc. Natl. Acad. Sci. USA100(10), 6081-6086(2003) and US2013 / 0045186A1.

[0077] In one embodiment, a production cell culture useful for producing recombinant AAVhu68 or AAVrh91 is provided. Such a cell culture comprises a nucleic acid expressing the AAVhu68 capsid protein in a host cell, a nucleic acid molecule suitable for packaging into the AAVhu68 capsid (e.g., a vector genome containing AAV ITR), and a non-AAV nucleic acid sequence encoding a gene operably linked to a regulatory sequence that directs gene expression in the host cell, as well as sufficient AAV rep and adenovirus helper functions to allow the vector genome to be packaged into the recombinant AAVhu68 or AAVrh91 capsid. In one embodiment, the cell culture consists of mammalian cells (e.g., human embryonic kidney 293 cells in particular) or insect cells (e.g., Spodoptera frugiperda (Sf9) cells). In certain embodiments, a baculovirus provides the helper functions necessary for packaging the vector genome into the recombinant AAVhu68 or AAVrh91 capsid.

[0078] Selectively, the rep function is provided by an AAV other than hu68 or AAV-PHP.B. In certain embodiments, at least a portion of the rep function is derived from AAVhu68 or AAVrh91. In other embodiments, the rep protein is a heterologous rep protein other than AAVhu68rep, and may be, for example, but not limited to, AAV1 rep protein, AAV2 rep protein, AAV3 rep protein, AAV4 rep protein, AAV5 rep protein, AAV6 rep protein, AAV7 rep protein, AAV8 rep protein, or rep78, rep68, rep52, rep40, rep68 / 78, and rep40 / 52, or fragments thereof, or another source. Any of these AAVhu68 or mutant AAV capsid sequences may be under the control of exogenous regulatory sequences that direct their expression in the host cell.

[0079] In one embodiment, cells are prepared in a suitable cell culture (e.g., HEK293 or Sf9) or suspension. Methods for preparing gene therapy vectors as described herein include methods well known in the art, such as the production of plasmid DNA used for gene therapy vector production, vector production, and vector purification. In some embodiments, the gene therapy vector is an AAV vector, and the produced plasmids are the AAV vector genome and an AAV cis-plasmid encoding the gene of interest, an AAV trans-plasmid containing the AAV rep and cap genes, and an adenovirus helper plasmid. The vector production process may include method steps such as initiating cell culture, subculturing cells, seeding cells, transfection of cells with plasmid DNA, changing the medium to serum-free medium after transfection, and recovering the vector-containing cells and culture medium. The recovered vector-containing cells and culture medium are referred to herein as crude cell recoveries. In yet another system, the gene therapy vector is a baculovirus-based It is introduced into insect cells by infection with Kutar. For a review of these production systems, see, for example, Zhang et al., 2009, Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production, Human Gene Therapy 20:922-929, the contents of which are incorporated herein by reference in their entirety. Methods for fabricating and using these and other AAV production systems are also described in the following U.S. Patents, the contents of which are incorporated herein by reference in their entirety: U.S. Patents Nos. 5,139,941, 5,741,683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,951,753, 7,094,604, 7,172,893, 7,201,898, 7,229,823, and 7,439,065.

[0080] The crude cell recovery can then be subjected to method steps such as concentration of the vector recovery, diafiltration of the vector recovery, microfluidization of the vector recovery, nuclease digestion of the vector recovery, filtration of the microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration for the preparation of a bulk vector.

[0081] The vector drug product is purified using two steps of high-salt-concentration affinity chromatography followed by anion-exchange resin chromatography to remove empty capsids. These methods are described in detail in WO2017 / 160360, filed 9 December 2016, and its priority documents, U.S. Patent Application No. 62 / 322,071, filed 13 April 2016, and U.S. Patent Application No. 62 / 226,357, filed 11 December 2015, entitled “Scalable Purification Method for AAV9,” which are incorporated herein by reference. In certain embodiments, the purification of vector pharmaceutical products (e.g., AAVrh91) includes those described in detail in WO2017 / 100674 filed 9 December 2016 and its priority documents, U.S. Provisional Patent Application No. 62 / 266,351 filed 9 December 2015, and U.S. Provisional Patent Application No. 62 / 322,083, titled "Scalable Purification Method for AAV1" (incorporated herein by reference), filed 13 April 2016.

[0082] To calculate the empty and complete particle content, the VP3 band volume for the selected sample (e.g., in the examples herein, the iodixanol gradient - purified preparation, where (GC) = number of particles) is plotted against the loaded GC particles. The resulting linear equation (y = mx + c) is used to calculate the number of particles in the band volume of the test material peak. The number of particles (pt) per 20 μL loaded is then multiplied by 50 to obtain particles (pt) / mL. Pt / mL is divided by GC / mL to obtain the ratio of particles to genome copies (pt / GC). Pt / mL ~ GC / mL gives empty pt / mL. The percentage of empty particles is obtained by dividing empty pt / mL by pt / mL and then multiplying by 100.

[0083] In general, methods for assaying AAV vector particles containing empty capsids and packaged genomes are known in the art. See, for example, Grimm et al., Gene Therapy (1999) 6:1322-1330 and Sommer et al., Molec. Ther. (2003) 7:122-128. To test for denatured capsids, this method involves SDS-polyacrylamide gel electrophoresis using any gel capable of separating three capsid proteins (e.g., a gradient gel containing 3-8% Tris acetate in buffer) to which treated AAVs are subjected. The procedure involves providing a gel, then electrophoresis of the gel until the sample material separates, and blotting the gel onto a nylon or nitrocellulose membrane (preferably nylon). The anti-AAV capsid antibody is then used as a primary antibody that binds to the denatured capsid protein, preferably an anti-AAV capsid monoclonal antibody, most preferably a B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Virol. (2000) 74:9281-9293). A secondary antibody is then used that binds to the primary antibody and includes means for detecting binding to an anti-IgG antibody containing a detection molecule covalently bound to the primary antibody, more preferably to the antibody, most preferably a sheep anti-mouse IgG antibody covalently bound to horseradish peroxidase. To semi-quantitatively determine the binding between the primary and secondary antibodies, a method for detecting binding is used, preferably a detection method capable of detecting radioisotope radiation, electromagnetic radiation, or a colorimetric change, most preferably a chemiluminescence detection kit. For example, in SDS-PAGE, a sample can be taken from the column fraction and heated in an SDS-PAGE packing buffer containing a reducing agent (e.g., DTT), and the capsid protein was degraded in a precast gradient polyacrylamide gel (e.g., Novex). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions, or other suitable staining methods, namely SYPRO ruby ​​or Coomassie staining, may be performed. In one embodiment, the concentration of the AAV vector genome (vg) in the column fraction can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After nuclease inactivation, the sample is further diluted and amplified using a TaqMan® fluorescence-generating probe specific to the DNA sequence between primers and primers. The number of cycles required to reach a specified level of fluorescence (threshold cycle, Ct) is measured for each sample on the Applied Biosystems Prism 7700 sequence detection system.A standard curve for Q-PCR reactions was created using plasmid DNA containing the same sequence as that contained in the AAV vector. The vector genome titer was determined by normalizing the cycle threshold (Ct) value obtained from the sample against the Ct value of the plasmid standard curve. Digital PCR-based endpoint assays can also be used.

[0084] In one embodiment, an optimized q-PCR method utilizing a broad-spectrum serum protease, such as proteinase K (e.g., commercially available from Qiagen), is used. More specifically, the optimized qPCR genomic titer assay is similar to a standard assay, except that after DNase I digestion, the sample is diluted with proteinase K buffer, treated with proteinase K, and subsequently inactivated by heat. Preferably, the sample is diluted with an amount of proteinase K buffer equal to the sample size. The proteinase K buffer may be concentrated to more than 2-fold. Typically, the proteinase K treatment is about 0.2 mg / mL, but can vary from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally carried out at about 55°C for about 15 minutes, but may be carried out at a lower temperature (e.g., about 37°C to about 50°C) for a longer time (e.g., about 20 minutes to about 30 minutes), or at a higher temperature (e.g., up to about 60°C) for a shorter time (e.g., about 5 to 10 minutes). Similarly, thermal inactivation is generally performed at approximately 95°C for about 15 minutes, but the temperature may be lowered (e.g., approximately 70 to 90°C) and the time may be extended (e.g., approximately 20 to 30 minutes). The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described in the standard assay.

[0085] Additionally, or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for measuring single-stranded and self-complementary AAV vector genome titers by ddPCR are described. For example, M. Lock et al., Hu Gene Therapy Methods, Hu Gene Ther Methods. See .2014 Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131.Epub 2014 Feb 14.

[0086] In short, a method for separating rAAVhu68 (or AAVrh91) particles with a packaged genome sequence from a genome-deficient AAVhu68 (or AAVrh91) intermediate involves subjecting a suspension containing recombinant AAVhu68 (or rh91) virus particles and AAVhu68 (or AAVrh91) capsid intermediates to high-performance liquid chromatography, where the AAVhu68 (or AAVrh91) virus particles and AAVhu68 intermediates are bound to a strong anion exchange resin equilibrated at a pH of approximately 10.2 (or approximately 9.8 for AAVrh91) and subjected to a salt gradient while monitoring the eluate for ultraviolet absorbance at approximately 260 nanometers (nm) and approximately 280 nm. Although not optimal for rAAVhu68 and AAVrh91, the pH can be in the range of approximately 10–10.4. In this method, the complete AAV capsid is recovered from the fraction that elutes when the A260 / A280 ratio reaches an inflection point. In one embodiment, for the affinity chromatography step, the diafiltration product may be applied to an affinity resin (Life Technologies) that efficiently captures the AAVhu68 or AAVrh91 serotype. Under these ionic conditions, a significant percentage of residual cellular DNA and proteins flows through the column, and the AAV particles are efficiently captured.

[0087] rAAV.hCDKL5 is suspended in a suitable physiologically compatible composition (e.g., buffered saline). This composition may be frozen for storage, subsequently thawed, and optionally diluted with a suitable diluent. Alternatively, the vector may be prepared as a composition suitable for delivery to the patient without going through the freezing and thawing steps.

[0088] As used herein, the term “NAb titer” is a measure of how much neutralizing antibody (e.g., anti-AAV Nab) is produced that neutralizes the physiological effects of its targeted epitope (e.g., AAV). Anti-AAV NAb titer can be measured, for example, as described in Calcedo, R., et al., Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses. Journal of Infectious Diseases, 2009. 199(3): p.381-390, which is incorporated herein by reference.

[0089] The abbreviation "sc" stands for self-complementary. "Self-complementary AAV" refers to a construct in which the coding region supported by the recombinant AAV nucleic acid sequence is designed to form an intramolecular double-stranded DNA template. During infection, instead of waiting for cell-mediated synthesis of the second strand, the two complementary halves of scAAV associate to form a single double-stranded DNA (dsDNA) unit that is immediately capable of replication and transcription. See, for example, DM McCarty et al, "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248-1254. Self-complementary AAVs are described, for example, in U.S. Patents No. 6,596,535, No. 7,125,717, and No. 7,456,683, each of which is incorporated herein by reference in whole.

[0090] "Replication-deficient virus" or "viral vector" refers to a synthetic or artificial viral particle in which an expression cassette containing the gene of interest is packaged within a viral capsid or envelope, and any virus packaged within the viral capsid or envelope The viral genome sequences are replication-defective; that is, they cannot produce progeny virions but can retain the ability to infect target cells. In one embodiment, the viral vector genome does not contain genes encoding enzymes required for replication (the genome can be engineered to be "gutless," containing only the target genes adjacent to the signals required for amplification and packaging of the artificial genome), but these genes can be supplied during production. Therefore, it is considered safe for use in gene therapy because replication and infection by progeny virions cannot occur without the presence of the viral enzymes required for replication.

[0091] In many cases, rAAV particles are referred to as DNase-resistant. However, in addition to this endonuclease (DNase), other endonucleases and exonucleases may be used in the purification steps described herein to remove contaminating nucleic acids. Such nucleases may be selected to degrade single-stranded DNA and / or double-stranded DNA, and RNA. Such steps may involve a single nuclease or a mixture of nucleases targeted to different targets, and may be endonucleases or exonucleases.

[0092] The term "nuclease resistance" indicates that the AAV capsid is fully constructed around the expression cassette designed to deliver the gene to the host cell, protecting these packaged genomic sequences from degradation (digestion) during the nuclease incubation step, which is designed to remove any contaminating nucleic acids that may be present in the production process.

[0093] IV. Other Vectors This specification provides vectors comprising the expression cassettes described herein. In certain embodiments, the expression cassette comprises a nucleic acid sequence encoding functional human cyclin-dependent kinase-like 5 (hCDKL5) under the control of a regulatory sequence that directs hCDKL5 expression.In certain embodiments, the hCDKL5 coding sequence is the amino acid sequence of [](SEQ ID NO: 2).

[0094] In certain embodiments, the vector is a viral vector selected from recombinant parvovirus, recombinant lentivirus, recombinant retrovirus, or recombinant adenovirus; or a non-viral vector selected from naked DNA, naked RNA, inorganic particles, lipid particles, polymer-based vectors, or chitosan-based formulations. The selected vector may be delivered by any preferred method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion. Methods used to construct such constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.

[0095] "Replication-deficient virus" or "viral vector" refers to synthetic or artificial viral particles. Here, the expression cassette containing the gene of interest is packaged within a viral capsid or envelope, and any viral genome sequences packaged within the viral capsid or envelope are replication-deficient, i.e., they cannot produce progeny virions but can retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be manipulated to be "gutless," containing only the target transgene adjacent to the signals required for amplification and packaging of the artificial genome), but these genes can be supplied during production. Therefore, it is considered safe for use in gene therapy because replication and infection by progeny virions cannot occur without the presence of the viral enzymes required for replication. Such replication-deficient viruses may be adeno-associated viruses (AAVs), adenoviruses, lentiviruses (integrated or unintegrated), or another suitable viral source.

[0096] V. Composition Compositions comprising rAAV or vectors and aqueous suspension media as described herein are provided herein. In certain embodiments, the suspension is formulated for intravenous delivery, intrathecal administration, or intraventricular administration.

[0097] This specification provides compositions comprising at least one rAAV stock, as well as optionally selected carriers, excipients, and / or preservatives. As used herein, “stock” of rAAV refers to a population of rAAVs. Despite heterogeneity of capsid proteins resulting from deamidation, rAAVs within a stock are expected to share the same vector genome. A stock may, for example, comprise a selected AAV capsid protein and rAAVs having capsids with heterogeneous deamidation patterns characteristic of a selected production system. A stock may be produced from a single production system or pooled from multiple runs of a production system. A variety of production systems can be selected, including but not limited to those described herein.

[0098] As used herein, “carrier” includes any and all solvents, dispersion media, vehicles, coatings, diluents, antimicrobial and antifungal agents, isotonic and absorption retardants, buffers, carrier solutions, suspensions, colloids, etc. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients may also be incorporated into the composition. The phrase “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, and vesicles may be used to introduce the compositions of the present invention into suitable host cells. In particular, the rAAV vector delivery vector genome may be formulated for delivery encapsulated in any of the following: lipid particles, liposomes, vesicles, nanospheres, or nanoparticles.

[0099] In one embodiment, the composition comprises a final formulation suitable for delivery to a subject, for example, an aqueous liquid suspension buffered to a physiologically suitable pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition may be transported as a concentrate diluted for administration to a subject. In yet another embodiment, the composition may be lyophilized and reconstituted at the time of administration.

[0100] A suitable surfactant, or combination of surfactants, may be selected from non-toxic nonionic surfactants. In one embodiment, for example, a primary hydroxyl-terminated bifunctional block copolymer surfactant such as Pluronic® F68 [BASF], also known as poloxamer 188, which has a neutral pH and an average molecular weight of 8400, is selected. Other surfactants and other poloxamers, i.e., polyoxyethylene Nonionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) adjacent to two hydrophilic chains of poly(ethylene oxide) (rene), SOLUTOL HS15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycaprylic acid glyceride), polyoxy-10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol may be selected. In one embodiment, the formulation contains poloxamer. These copolymers are generally named with the letter "P" (in the case of poloxamer) followed by a three-digit number, where the first two digits × 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit × 10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. In one embodiment, the surfactant may be present in an amount of up to about 0.0005% to about 0.001% (w / w%, based on weight ratio) of the suspension. In another embodiment, the surfactant may be present in an amount of up to about 0.0005% to about 0.001% (v / v%, based on volume ratio) of the suspension. In yet another embodiment, the surfactant is present in an amount of up to about 0.0005% to about 0.001% of the suspension, where n% represents n grams per 100 mL of suspension.

[0101] In another embodiment, the composition comprises a carrier, a diluent, an excipient and / or an adjuvant. A suitable carrier can be readily selected by those skilled in the art, taking into account the indication to which the introduced virus is directed. For example, one suitable carrier comprises saline and can be formulated with various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier should contain components that prevent rAAV from adhering to the infusion tube but do not interfere with rAAV binding activity in vivo. A suitable surfactant, or combination of surfactants, may be selected from non-toxic nonionic surfactants. In one embodiment, a bifunctional block copolymer surfactant with primary hydroxyl groups at the terminal ends is selected, for example, poloxamer 188 (also known as trade names Pluronic® F68 [BASF], Lutrol® F68, Synperonic® F68, and Kolliphor® P188), which has a neutral pH and an average molecular weight of 8400. Other surfactants and other poloxamers may be selected, namely nonionic triblock copolymers consisting of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) adjacent to two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycapric acid glyceride), polyoxy-oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In one embodiment, the formulation contains poloxamer. These copolymers are generally named with the letter "P" (in the case of poloxamers) followed by a three-digit number, where the first two digits × 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit × 10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. A surfactant may be present in an amount of up to about 0.0005% to about 0.001% of the suspension.

[0102] In certain embodiments, the composition containing rAAV.hCDKL5 is delivered at a pH in the range of 6.8–8, 7.2–7.8, or 7.5–8. For intrathecal delivery, a pH greater than 7.5, for example, 7.5–8, or 7.8 may be desirable.

[0103] In certain embodiments, the formulation may contain a buffered saline solution that does not contain sodium bicarbonate. Such a formulation may contain a buffered saline solution such as Harvard buffer, which contains one or more of the following in water: sodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, and mixtures thereof. The aqueous solution is poloxamer. It may further contain Kolliphor® P188, which is commercially available from BASF and was previously sold under the trade name Lutrol® F68. The aqueous solution may have a pH of 7.2.

[0104] In another embodiment, the formulation may contain a buffered saline solution comprising 1 mM sodium phosphate (Na3PO4), 150 mM sodium chloride (NaCl), 3 mM potassium chloride (KCl), 1.4 mM calcium chloride (CaCl2), 0.8 mM magnesium chloride (MgCl2), and 0.001% poloxamer (e.g., Kolliphor®) 188, pH 7.2. See, for example, harvardapparatus.com / harvard-apparatus-perfusion-fluid.html. In certain embodiments, Harvard buffer is preferred because better pH stability is observed with Harvard buffer.

[0105] In certain embodiments, the formulation buffer is an artificial CSF containing Pluronic F68. In other embodiments, the formulation may contain one or more permeation enhancers. Examples of suitable permeation enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether, or EDTA.

[0106] Optionally, the compositions of the present invention may include other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers, in addition to rAAV and carriers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0107] The compositions according to the present invention may comprise a pharmaceutically acceptable carrier as defined above. Preferably, the compositions described herein comprise one or more AAVs suspended in an effective amount of a pharmaceutically suitable carrier and / or mixed with a suitable excipient designed for delivery to a target via infusion, permeation pump, intrathecal catheter, or by another device or route. In one embodiment, the composition is formulated for intrathecal delivery. In one embodiment, the composition is formulated for intravenous (iv) delivery.

[0108] VI.Use This specification provides a method for treating CDD, comprising administering an effective amount of the rAAV or vector described herein to a subject in need thereof.

[0109] In certain embodiments, “effective amount” as used herein is an amount that achieves improvement in the symptoms of CDD and / or delays the progression of CDD.

[0110] The vector is administered in an amount sufficient to transfect cells and provide a sufficient level of gene transfer and expression to provide a therapeutic effect without undue adverse effects or with a medically acceptable physiological effect, which can be determined by one of ordinary skill in the art. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the desired organ (e.g., brain, CSF, liver (optionally via the hepatic artery), lung, heart, eye, kidney), oral, inhalation, intranasal, intrathecal, intratracheal, intraarterial, intravitreal, intravenous, intramuscular, subcutaneous, intradermal, parenchymal, intrathecal, ICM, lumbar puncture, and other parenteral routes of administration. Routes of administration may be combined if desired.

[0111] The dosage of a viral vector (e.g., rAAV) depends primarily on factors such as the condition being treated, the age, weight, and health status of the patient, and thus may vary among patients. For example, a therapeutically effective human dosage of a viral vector generally ranges from about 1×10 9 to 1×10 16 vector genome copies per milliliter in a solution volume ranging from about 25 to about 1000 microliters to about 100 mL. In certain embodiments, a suspension volume of about 1 mL to about 15 mL, or about 2.5 mL to about 10 mL, or about 5 mL is delivered. In certain embodiments, a suspension volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 mL is delivered. In certain embodiments, a total dosage of about 8.9×10 12 to 2.7×10 14 GC is administered at this volume. In certain embodiments, a dosage of about 1.1×10 10 GC / g brain mass to about 3.3×10 11 GC / g brain mass is administered at this volume. In certain embodiments, about 3.0×10 9 , about 4.0×10 9 , about 5.0×10 9 , about 6.0×10 9 , about 7.0×10 9 , about 8.0×10 9 , about 9.0×10 9 , about 1.0×1010 , about 1.1×10 10 , about 1.5×10 10 , about 2.0×10 10 , about 2.5×10 10 , about 3.0×10 10 , about 3.3×10 10 , about 3.5×10 10 , about 4.0×10 10 , about 4.5×10 10 , about 5.0×10 10 , about 5.5×10 10 , about 6.0×10 10 , about 6.5×10 10 , about 7.0×10 10 , about 7.5×10 10 , about 8.0×10 10 , about 8.5×10 10 , about 9.0×10 10 , about 9.5×10 10 , about 1.0×10 11 , about 1.1×10 11 , about 1.5×10 11 , about 2.0×10 11 , about 2.5×10 11 , about 3.0×10 11 , about 3.3×10 11 , about 3.5×10 11 , about 4.0×10 11 , about 4.5×10 11 , about 5.0×10 11 , about 5.5×10 11 , about 6.0×10 11 , about 6.5×10 11 , about 7.0×10 11 , about 7.5×10 11 , about 8.0×10 11 , about 8.5×10 11 , about 9.0×10 11 The GC dose is administered in this volume.

[0112] The dosage may be adjusted to balance the therapeutic effect with any side effects, and the dosage may vary depending on the therapeutic application in which the recombinant vector is used. The expression level of the transgene can be monitored to determine the frequency of administration that delivers the viral vector (preferably an AAV vector containing a minigene). Optionally, drug regimens similar to those described for therapeutic purposes may be used for immunization using the compositions of the present invention.

[0113] The defective replication virus composition is formulated in dose units, and for human patients, approximately 1.0 × 10⁶ units are used (to treat the target). 9 GC~approx. 1.0×10 16 Includes a quantity of replication-defective viruses within the range of GC, including all integers or fractional quantities within that range, preferably 1.0 × 10 12 GC~1.0×10 14 It may contain GC. In one embodiment, the composition contains all integers or decimals within the range, at least 1 × 10 per dose. 9 , 2×10 9 , 3 x 10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9 The formulation is to include GC. In another embodiment, the composition contains all integers or decimals within the range, at least 1 × 10 per dose. 10 , 2×10 10 , 3 x 10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×10 10 The formulation is to include GC. In another embodiment, the composition contains all integers or decimals within the range, at least 1 × 10 per dose. 11 , 2×10 11 , 3 x 10 11 , 4×10 11 , 5×10 11, 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 GC is formulated to contain. In another embodiment, the composition contains at least 1×10 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 GC is formulated to contain. In another embodiment, the composition contains at least 1×10 13 , 2×10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 GC is formulated to contain. In another embodiment, the composition contains at least 1×10 14 , 2×10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 GC is formulated to contain. In another embodiment, the composition contains at least 1×10 15 , 2×10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 GC is formulated to contain.

[0114] In one embodiment, for human application, the dose is 1 × 10¹⁶ per kg of body weight, including all integers or decimals within the range. 10 ~Approx. 1×10 15 It may be within the GC range. In one embodiment, the effective amount of the vector is about 1 × 10 per kg of body weight, including all integers or decimals within the range. 9 , 2×10 9 , 3 x 10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9 It is GC. In another embodiment, the effective amount of the vector is about 1 × 10 per kg of body weight, including all integers or decimals within the range. 10 , 2×10 10 , 3 x 10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×10 10 It is GC. In another embodiment, the effective amount of the vector is about 1 × 10 per kg of body weight, including all integers or decimals within the range. 11 , 2×10 11 , 3 x 10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 It is GC. In another embodiment, the effective amount of the vector is about 1 × 10 per kg of body weight, including all integers or decimals within the range. 12 , 2×10 12 , 3 x 10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12It is GC. In another embodiment, the effective amount of the vector is about 1 × 10 per kg of body weight, including all integers or decimals within the range. 13 , 2×10 13 , 3 x 10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 It is GC. In another embodiment, the effective amount of the vector is about 1 × 10 per kg of body weight, including all integers or decimals within the range. 14 , 2×10 14 , 3 x 10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 It is GC. In another embodiment, the effective amount of the vector is about 1 × 10 per kg of body weight, including all integers or decimals within the range. 15 , 2×10 15 , 3 x 10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 It is garbage collection.

[0115] In one embodiment, for human application, the dose is 1 × 10¹⁶ per gram (g) of brain mass, including all integers or decimals within the range. 10 ~Approx. 1×10 15 It may be within the GC range. In one embodiment, the effective amount of the vector is about 1 × 10⁻¹⁶ per gram (g) of brain mass, including all integers or decimals within the range. 9 , 2×10 9 , 3 x 10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9It is GC. In another embodiment, the effective amount of the vector is about 1 × 10⁻¹⁶ per gram (g) of brain mass, including all integers or decimals within the range. 10 , 2×10 10 , 3 x 10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×10 10 It is GC. In another embodiment, the effective amount of the vector is about 1 × 10⁻¹⁶ per gram (g) of brain mass, including all integers or decimals within the range. 11 , 2×10 11 , 3 x 10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 It is GC. In another embodiment, the effective amount of the vector is about 1 × 10⁻¹⁶ per gram (g) of brain mass, including all integers or decimals within the range. 12 , 2×10 12 , 3 x 10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 It is GC. In another embodiment, the effective amount of the vector is about 1 × 10⁻¹⁶ per gram (g) of brain mass, including all integers or decimals within the range. 13 , 2×10 13 , 3 x 10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 It is GC. In another embodiment, the effective amount of the vector is about 1 × 10⁻¹⁶ per gram (g) of brain mass, including all integers or decimals within the range. 14 , 2×10 14 , 3 x 10 14 , 4×10 14, 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 It is GC. In another embodiment, the effective amount of the vector is about 1 × 1 per gram (g) of brain mass, including all integers or decimals within the range. 0 15 , 2×10 15 , 3 x 10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 It is garbage collection.

[0116] These above doses may be administered in various volumes of carrier, excipient, or buffer formulations ranging from about 25 to about 1000 microliters, or in higher volumes including all of the above, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient, or buffer is at least about 25 μL. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 75 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 225 μL. In yet another embodiment, the volume is about 250 μL. In yet another embodiment, the volume is about 275 μL. In yet another embodiment, the volume is about 300 μL. In yet another embodiment, the volume is approximately 325 μL. In yet another embodiment, the volume is approximately 350 μL. In yet another embodiment, the volume is approximately 375 μL. In yet another embodiment, the volume is approximately 400 μL. In yet another embodiment, the volume is approximately 450 μL. In yet another embodiment, the volume is approximately 500 μL. In yet another embodiment, the volume is approximately 550 μL. In yet another embodiment, the volume is approximately 600 μL. In yet another embodiment, the volume is approximately 650 μL. In yet another embodiment, the volume is approximately 700 μL. In yet another embodiment, the volume is approximately 700 to 1000 μL.

[0117] In certain embodiments, the dose is approximately 1 x 10 9 GC / g brain mass ~ approx. 1x10 12 The GC / g brain mass may be in the range of GC / g brain mass. In certain embodiments, the dose is about 1 × 10⁻⁶ 10 GC / g brain mass ~ approx. 3×10 11 The GC / g brain mass may be in the range of GC / g brain mass. In certain embodiments, the dose is about 1 × 10⁻⁶ 10 GC / g brain mass ~ approx. 2.5×10 11 The GC / g brain mass may be in the range of GC / g brain mass. In certain embodiments, the dose is approximately 5 × 10⁻⁶ 10 It could be within the range of GC / g brain mass.

[0118] In one embodiment, the virus construct is at least about 1 × 10 9 GC~approx. 1×10 15 , or approximately 1 x 10 11 ~5×10 13 It can be delivered in GC doses. Suitable volumes for delivery of these doses and concentrations can be determined by those skilled in the art. For example, volumes of about 1 μL to 150 mL may be selected, but higher volumes may be selected for adults. Typically, suitable volumes for neonates are about 0.5 mL to about 10 mL, and for older infants, about 0.5 mL to about 15 mL. For toddlers, volumes of about 0.5 mL to about 20 mL may be selected. For children, volumes up to about 30 mL may be selected. For preteens and teens, volumes up to about 50 mL may be selected. In yet another embodiment, the patient can receive intrathecal administration in selected volumes of about 5 mL to about 15 mL, or about 7.5 mL to about 10 mL. Other suitable volumes and dosages may be determined. Doses may be adjusted to balance the therapeutic benefits with any side effects, and such dosages may vary depending on the therapeutic use for which the recombinant vector is utilized.

[0119] The recombinant vectors described above can be delivered to host cells according to the published methods. Preferably, rAAV suspended on a physiologically compatible carrier can be administered to human or non-human mammalian patients. In certain embodiments, for administration to human patients, rAAV is preferably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt, or a mixture of salts. Preferably, the formulation is adjusted to a physiologically acceptable pH range, for example, pH 6-9, or pH 6.5-7.5, pH 7.0-7.7, or pH 7.2-7.8. Since the pH of cerebrospinal fluid is approximately 7.28-7.32, a pH within this range is desirable for intrathecal delivery, and a pH of approximately 6.8-7.2 may be desirable for intravenous delivery. However, other pH ranges within the broadest range, and sub-ranges of these, are also acceptable. It can be selected for the delivery route.

[0120] As used herein, the terms “intrathecal delivery” or “intrathecal administration” refer to the route of drug administration by injection into the spinal canal, more specifically, by injection into the subarachnoid space to reach the cerebrospinal fluid (CSF). Intrathecal delivery may include lumbar puncture, intraventricular (including lateral ventricles (ICV)), suboccipital / cisternal, and / or C1-2 puncture. For example, a material may be introduced by lumbar puncture to diffuse across the subarachnoid space. In another embodiment, the injection may be into the cisterna magna. In certain embodiments, the rAAV, vector, or composition described herein is administered to the target subject via intrathecal administration. In certain embodiments, intrathecal administration is carried out as described in U.S. Patent Publication No. 2018 / 0339065A1, published November 29, 2019, which is incorporated herein by reference in its entirety.

[0121] As used herein, the terms “intracisternal delivery” or “intracisternal administration” refer to a direct route of drug administration into the cerebrospinal fluid of the cisterna magnum of the cerebellum, more specifically, a route of drug administration by suboccipital puncture, direct injection into the cisterna magnum, or a permanently placed tube.

[0122] In certain embodiments, the treatment of the compositions described herein has minimal to mild asymptomatic degeneration of DRG sensory neurons in animals and / or human patients, which is well tolerated with respect to sensory neurotoxicity and asymptomatic sensory neuronal lesions.

[0123] VII. Apparatus and method for delivering pharmaceutical compositions into cerebrospinal fluid In one embodiment, the vectors provided herein may be administered intrathecally via the methods and / or devices provided in this section and described in WO2018 / 160582 (incorporated herein by reference). Alternatively, other devices and methods may be selected. In certain embodiments, the method includes the step of a CT-guided suboccipital injection into the patient's cisterna magna via a spinal needle. As used herein, the term computed tomography (CT) refers to radiography in which a computer constructs a three-dimensional image of a body structure from a series of planar cross-sectional images created along an axis. In certain embodiments, the apparatus is described in U.S. Patent Publication 2018 / 0339065A1, published November 29, 2019, which is incorporated herein by reference in its entirety.

[0124] VIII.CDD As used herein, “patient” or “subject” means a male or female mammal and includes humans, veterinary or agricultural animals, domestic or companion animals, and animals typically used in clinical research. In one embodiment, the subjects of these methods and compositions are human patients. In one embodiment, the subjects of these methods and compositions are male or female humans. In certain embodiments, the subjects of these methods and compositions are diagnosed with CDD and / or symptoms of CDD.

[0125] The methods and compositions may be used to treat any of the stages of CDD. In certain embodiments, the patient is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 months of age, or about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 12, 13, 14, 15, 16, 17, or 18 years of age. In certain embodiments, the patient is an infant, for example, between 18 months and 3 years of age. In certain embodiments, the patient is between 3 and 6 years of age, between 3 and 12 years of age, between 3 and 18 years of age, or between 3 and 30 years of age. In certain embodiments, the patient is over 18 years of age.

[0126] Symptoms of CDD typically include seizures that begin within the first three months of life, and can occur as early as one week after birth. Seizures may also occur. The type of seizure may change with age and may follow a predictable pattern. The most common types are generalized tonic-clonic seizures with loss of consciousness, muscle rigidity, and convulsions; tonic seizures characterized by abnormal muscle contractions; and epileptic seizures with short episodes of muscle jerks. Seizures occur daily in most people with CDKL5 deficiency, but there may be seizure-free periods. Seizures in CDKL5 deficiency are typically resistant to treatment.

[0127] Children with CDKL5 deficiency exhibit developmental disabilities. Most have severe intellectual disabilities and little to no speech. Development of general motor skills such as sitting, standing, and walking is delayed or not achieved. Approximately one-third of affected individuals can walk independently. Fine motor skills, such as picking up small objects with fingers, are impaired, and about half of affected individuals intentionally use their hands. Most individuals with this condition have visual impairment (cortical visual impairment).

[0128] Other common features of CDKL5 deficiency include repetitive hand movements such as clapping, hand licking, and hand sucking (stereotypes), teeth grinding (bruxism), sleep disturbances, difficulty eating, and gastrointestinal disorders including constipation and reflux of acidic stomach contents into the esophagus (gastroesophageal reflux). Some affected individuals also experience episodes of irregular breathing. Characteristic facial features in some people with CDKL5 deficiency include a high, broad forehead, large, sunken eyes, a distinct space between the nose and upper lip (filtram), full lips, widely spaced teeth, and a high palate. Other physical differences may also occur, such as an abnormally small head size (microcephaly), lateral curvature of the spine (scoliosis), and tapered fingers.

[0129] As stated above, “increase,” “decrease,” “reduction,” “improvement,” “enhancement,” “delay,” or any grammatical variation thereof, or any similar term, unless otherwise specified, mean a change of approximately 5 times, 2 times, 1 time, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, and 5% compared to the corresponding reference (e.g., an untreated control or a healthy subject without CDD).

[0130] In certain embodiments, the patient receives medication to control several signs and symptoms associated with CDD, such as seizures, muscle rigidity, or respiratory, sleep, gastrointestinal, or cardiac problems.

[0131] In certain embodiments, diuretics may be used in combination therapy in subjects requiring them. The diuretic used may be acetazolamine (Diamox) or other suitable diuretics. In some embodiments, the diuretic is administered at the time of gene therapy administration. In some embodiments, the diuretic is administered before gene therapy administration. In some embodiments, the diuretic is administered in an injection volume of 3 mL.

[0132] In certain embodiments, combination therapy may be used, including the simultaneous administration of Cdkl5-isoform 1, isoform 2, isoform 3, and / or isoform 4 expression vectors, or various bidirectional or tridirectional combinations thereof. Optionally, the combination therapy may further include the administration of another activator. In certain embodiments, the combination therapy may include enzyme replacement therapy.

[0133] Immunosuppressive combination therapy may be used selectively in the target population where it is needed. Immunosuppressants for such combination therapy include, but are not limited to, glucocorticoids, steroids, antimetabolites, T-cell inhibitors, macrolides (e.g., rapamycin or rapalog), and cell division inhibitors (including alkylating agents, antimetabolites, cytotoxic antibiotics, antibodies, or agents active against immunophilins). Examples of immunosuppressants include nitrogenmagnesium. The following may be included: stard, nitrosourea, platinum compounds, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, anthracycline, mitomycin C, bleomycin, mitramycin, IL-2 receptor (CD25) specific antibody or CD3 specific antibody, anti-IL-2 antibody, cyclosporine, tacrolimus, sirolimus, IFN-β, IFN-γ, opioid, or TNF-α (tumor necrosis factor-α) conjugate. In certain embodiments, immunosuppressive therapy may be initiated 0, 1, 2, 3, 4, 5, 6, or 7 days before or after gene therapy administration. Such immunosuppressive therapy may involve the administration of one, two, or more drugs (e.g., glucocorticoids, prenelisone, mycophenolate mofetil (MMF), and / or sirolimus (i.e., rapamycin)). Such immunosuppressants may be administered to the target individual in the same or adjusted dose, once, twice, or more times. Such therapy may involve the co-administration of two or more drugs (e.g., prednisone, mycophenolate mofetil (MMF), and / or sirolimus (i.e., rapamycin)) on the same day. One or more of these drugs may be continued after gene therapy administration in the same or adjusted dose. Such therapy may last, as needed, about one week (7 days), about 60 days, or longer. In certain embodiments, a regimen that does not include tacrolimus is selected.

[0134] The words “comprise,” “comprises,” and “comprising” should be interpreted comprehensively, not exclusively. The words “consist,” “consisting,” and their variations should be interpreted exclusively, not comprehensively. While various embodiments herein are indicated using the word “comprising,” in other contexts, the relevant embodiments are also intended to be interpreted and described using the words “consisting of” or “consisting essentially of.”

[0135] The term “expression” is used herein in its broadest sense and includes the production of RNA or RNA and proteins. With respect to RNA, the terms “expression” or “translation” are used in particular with respect to the production of peptides or proteins. Expression can be transient or stable.

[0136] It should be noted that the terms "a" or "an" refer to one or more; for example, "an enhancer" is understood to refer to one or more enhancers. Therefore, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably in this specification.

[0137] Throughout this specification, exponents are referred to using the term "e" followed by the number (n). This is equivalent to "×10 n It will be understood that this refers to "3e9". For example, "3e9" means 3 × 10 9 It is the same as "1e13", and "1e13" is 1 × 10 13 It is the same as this.

[0138] As mentioned above, unless otherwise specified, the term "approximately" means a variation of ±10% when used to adjust a number.

[0139] Unless otherwise defined herein, the technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art and by referring to published documents that provide general guidance to those skilled in the art for the many terms used herein. [Examples]

[0140] IX. Examples The following examples are illustrative and not intended to limit the invention.

[0141] Several models for CDD have been developed and may be selected for use in evaluating therapeutic effects. The following models are null for CDKL5 expression: for example, Cdkl5-ko mice with a deletion in exon 6 (Δexon 6) (Wang et al, Proceedings of the National Academy of Sciences Dec 2012, 109(52)21516-21521; DOI:10.1073 / pnas.1216988110); Cdkl5-ko mice with a deletion in exon 4 (Δexon 4) (Amendola et al. (2014) Mapping Pathological Phenotypes in a See Mouse Model of CDKL5 Disorder. PLoS ONE 9(5):e91613.doi.org / 10.1371 / journal.pone.0091613(2014); Cdkl5 (R59X knock-in) model (available from Jackson Laboratory; see Tang et al (2019), Tang S, et al. Altered NMDAR signaling underlies autistic-like features in mouse models of CDKL5 deficiency disorder. Nat Commun. 2019;10(1):2655. Published 2019 Jun 14. doi:10.1038 / s41467-019-10689-w), and Cdkl5 (D471fs) model (Rodney Samaco, Baylor College of Medicine, Houston, TX).

[0142] This study has shown that restoring CDKL5 expression in the CNS of three CDD mouse models (Cdkl5-ko(exon 6), Cdkl5(R59X), and Cdkl5(D471fs)) significantly improves disease symptoms. We developed an AAV gene therapy vector consisting of an AAVhu68 capsid, an expression cassette with a human synapsin promoter, and an engineered human CDKL5 transgene. When the AAV-CDKL5 vector was administered to Cdkl5 knockout mice via injection into the lateral ventricle of neonatal cells, we detected robust expression in up to 50% of neurons throughout the brain. AAV administration and human CDKL5 expression were well tolerated. Human CDKL5 was mostly localized in the cytoplasm, and protein expression and kinase activity persisted for more than 4 months. We subjected a cohort of treated Cdkl5-ko mice to a series of neurobehavioral studies and found significant improvements in behavioral outcomes compared to untreated Cdkl5-ko phenotypes compared to wild-type mice. We then repeated the same study in two different CDD mouse models with patient-derived frameshift mutations (Cdkl5(R59X) and CDKL5(D471fs) models) instead of gene knockout. We obtained very similar results, thus reaffirming the therapeutic benefits of our CDKL5 gene therapy vector.

[0143] CDKL5 is expressed as at least four different isoforms in the human brain. We generated similar AAV gene therapy vectors for three alternately spliced ​​isoforms, all of which were found to express kinase activity in transduced mouse brains.

[0144] To test the expression of our AAV-CDKL5 gene therapy vector in larger animals, we conducted a study using rhesus monkeys. Through injection into the cerebrospinal fluid via the cisterna magna, we were able to achieve vector distribution throughout the brain at 0.1–1 vector copies per diploid genome. Much higher vector transduction was observed in the dorsal root ganglia (DRG). Therefore, in situ hybridization with a human CDKL5 sequence-specific probe showed abundant expression in DRG neurons. In cortical gray matter neurons, expression was much sparser. CDKL5 administration and expression were generally well tolerated in all six rhesus monkeys over 60 days, although we noticed mild axonal damage to the white matter spinal tract.

[0145] In summary, we present promising evidence that CDKL5 gene therapy delivers sustained therapeutic benefits in a mouse model and is well-tolerated in non-human primates. Further optimization of this approach could ultimately provide an option for clinical intervention in children affected by CDD.

[0146] Example 1. Materials and methods. Plasmid. Human brain 1 The amino acid sequences of four CDKL5 (cyclin-dependent kinase-like 5, Uniprot ID O76039) expressed in [location] were back-translated into DNA sequences. The coding sequences were further manipulated by considering, for example, the codon frequencies found in the human genome, coding RNA splice sites, and alternative reading frames. The manipulated sequences were then used in the human synapsin promoter. 2Under control, AAV expression plasmids were cloned. The coding sequence is framed by the Kozak sequence, followed by the WPRE enhancer cassette (woodchuck hepatitis virus post-transcriptional regulatory element), the SV40 polyA sequence, and then the AAV2 inverted terminal repeat (ITR). To suppress expression in the dorsal root ganglion (DRG), in some experiments, the plasmid was modified to include four repeats of the miR183 binding site (agtgaattctaccagtgccata) (SEQ ID NO: 11) immediately after the CDKL5 coding sequence and immediately before the WPRE sequence. CDKL5 vector capsid PHP.B for mouse research 3 Or AAV9hu68 for mouse and non-human primate research 4 It was produced at the University of Pennsylvania Vector Core, either as AAVrh91 or as another compound.

[0147] Mouse studies. All studies involving mice were approved by the University of Pennsylvania IACUC. We obtained Cdkl5-ko mice (B6.129(FVB)-Cdkl5tm1.1Joez / J, strain number 021967) from Jackson Laboratories and mated heterozygous female ko mice with wtC57Bl6 males to obtain littermates with the following genotypes: male hemizygous Cdkl5-ko (also referred to as KO mice or mice), male wt, female heterozygous Cdkl5-ko, and female wt. Mice were administered AAV Cdkl5 vector (dose range 1 × 10) at 18-21 days of age by post-orbital injection in a total volume of 100 μl (dose range 1 × 10⁻¹⁴). 11 GC~5×10 11 The mice received either a GC (Gross Catalytic Corticosteroid) or a vehicle control (sterile phosphate-buffered saline). Alternatively, on the day of birth, the mice received 1 × 10⁻⁶ doses. 10 GC~5×10 10 GC was administered intravenously at a total volume of 2 μl. Mice were housed in mixed genotypes and injection products, weighed, observed at least twice a week, and subjected to behavioral studies. Males were aged to 11 weeks and females to 14 weeks. No treatment-related pathological conditions were observed.

[0148] Western blotting and histological staining. After euthanasia, one cortical hemisphere was rapidly frozen, followed by the preparation of protein lysates using RIPA buffer. Western blotting was performed using antibodies against human CdkL5 (S957D, University of Dundee, UK), EB2 (ab45767, Abcam), or EB2 phospo222 (pab01032-P, Covalab, UK). The other half of the brain was fixed overnight in formalin, embedded in paraffin, and thin sections were treated for immunofluorescence staining using the same CDKL5 antibody.

[0149] Behavioral testing. Mice were tested once per day. The test date, operator, and environment were kept the same (60 dB white noise background and 1000 lumens incandescent indirect lighting). Before each test, mice were acclimated in their home cage for 30 minutes. For open-field assays, a new cage with minimal bedding was used, and an infrared beam array was used. The mice were placed in a cage (MedAssociates, Inc.). One mouse was added to the center of the cage, and the number of beam brakes was automatically recorded over the next 30 minutes, separating them into beam brakes close to the ground (general activity) and beam brakes 3 inches above the ground (household activity). For the Elevated Zero Maze (EZM, Stoelting Co.), an elevated circular platform with two opposing closed arms and two open arms was used to allow continuous exploration. One mouse was placed in the center of an open arm, and its movement was video recorded for 15 minutes. For the Y Maze (Stoelting Co.), a sealed platform containing three identical Y-shaped arms was used. One mouse was placed in the arm closest to the operator, and its movement was video recorded for 5 minutes. For the glass bead cover assay, a new cage was filled with 3 inches of AlphaDri bedding (Shepherd Specialty Papers) and gently pressed down to compress it. Twelve solid blue glass marbles were placed at equal intervals on the bedding, and one mouse was placed in the center of the cage. The number of glass marbles that were at least half covered by the bedding was recorded after 30 minutes.

[0150] Data analysis. Data was graphed and analyzed using GraphPad Prims software. Video files were recorded in mp4 format at 20fps and analyzed using EthoVision XT software (version 14, Noldus Information Technology). For nest construction assays, mice were housed alone overnight in a new cage and supplied with standardized 2x2 inch square nestlets (cotton-based). After 24 hours, nest quality was scored on a scale of 1 to 5, and the remaining untouched nestlet material was weighed.

[0151] Non-human primate experiments. All studies involving non-human primates were approved by the University of Pennsylvania IACUC and conducted in accordance with USDA regulations. Non-human primates (NHPs) of the Macaca mulatta (rhesus macaque) species were obtained from Covance Research Products, Inc. Isolation and animal rearing were carried out in accordance with the gene therapy program SOPs. Throughout the study in the month prior to AAV vector administration, body weight, body temperature, respiratory rate, and heart rate were regularly monitored, and blood and CSF samples were obtained. Whole blood was used for cell counting and differentiation, and a clinical blood chemistry panel was used. CSF samples were used for blood cell counting and differentiation, as well as total protein quantification. For AAV vector delivery to the CSF by cisterna magna puncture, anesthetized monkeys were placed on a treatment table in a lateral decubitus position with the head flexed forward. Using aseptic techniques, a 21-27 gauge, 1-1.5 inch Quincke vertebral needle (Becton Dickinson) was advanced into the suboccipital space until CSF flow was observed. The needle is directed towards the upper cisterna magna to avoid blood contamination and potential brainstem damage. Precise needle placement is confirmed by myelography using fluoroscopy. 1 mL of CSF was collected for baseline analysis before administration. After CSF collection, a Luer access extension catheter was connected to the spinal needle and 1 mL of iohexal (trademark: Omnipaque 180 mg / mL, General Electric Healthcare) contrast medium was injected. After confirming needle placement, a syringe containing the test item (equivalent to 1 mL volume plus dead space volume of syringe and linker) was connected to a flexible linker and injected over 30 ± 5 seconds. The needle was removed and direct pressure was applied to the puncture site. AAVhu68.hSyn.Cdkl5-1co and AAVhu68.hSyn.Cdkl5-1co vectors reached a maximum of 3 × 10⁶ 13The monkeys were injected with GC / NHP at the prescribed dose. Neurological assessments were performed in all rhesus monkeys on days 0, 14, 18, 41, and the final test day for a detailed evaluation of neurological function. Briefly, the assessments included postural and gait evaluation, cranial nerve evaluation, proprioception evaluation, and spinal / nerve reflexes. On day 56, the rhesus monkeys were euthanized and extensive autopsies and necropsies were performed. Twenty-five major tissues were recovered in duplicate from each rhesus monkey for either flash freezing or formalin fixation. DNA or RNA was purified from the flash-frozen tissues and analyzed for vector in vivo distribution or transgene expression, respectively. The vector was used for this purpose. For the in vivo distribution of the vector, genomic copies (GC) per total DNA weight were determined using a TaqMan qPCR assay with a probe that again points to the poly-A region of the transgene cassette and an internal standard. To quantify transgene expression, cDNA was generated using total RNA via first-strand synthesis with poly-T oligonucleotides, followed by the generation of a TaqMan qPCR with a transgene-specific probe that does not cross-react with the endogenous rhesus macaque CDKL5 sequence. For histopathological analysis, macaque tissue was embedded in paraffin, and these sections were stained with H&E solution or CDKL5 antibody, respectively. The same spinal cord sections were incubated with Luxol Fast Blue, and myelin was stained. All stained tissue sections were reviewed by a committee-certified veterinary pathologist, and abnormal findings were verified by peer review. References: 1.Hector,RDet al.Characterization of CDKL5 Transcript Isoforms in Human and Mouse.PloS one 11,e0157758,(2016). 2.Thiel, G., Greengard, P. & Sudhof, TCCharacterization of tissue-specific transcription by the human synapsin I gene promoter.Proc Natl Acad Sci USA 88,3431-3435,(1991). 3. Deverman, BE et al. Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain. Nat Biotechnol 34,204-209,(2016). 4.Hinderer,C.et al.Severe Toxicity in Nonhuman Primates and Piglets Following High-Dose Intravenous Administration of an Adeno-Associated Virus Vector Expressing Human SMN.Human Gene Therapy 29,285-298,(2018).

[0152] Example 2: Gene therapy AAV vector The expression construct between ITRs consists of a human synapsin promoter (SEQ ID NO: 23), an engineered coding sequence for human CDKL5, isoform 1 (SEQ ID NO: 22), a WPRE expression enhancer (SEQ ID NO: 27), and an SV40 polyA sequence (SEQ ID NO: 28) (Figure 1A). Similarly, alternative expression constructs contain engineered coding sequences for human CDKL5, isoform 2 (CDKL5-2GS or hCDKL5-2GS, SEQ ID NO: 24), isoform 3 (CDKL5-3GS or hCDKL5-3GS, SEQ ID NO: 25), or isoform 4 (CDKL5-4GS or hCDKL5-4GS, SEQ ID NO: 26), respectively, instead of isoform 1. All tested plasmids express well in mouse brains and show slight differences in their ability to phosphorylate EB2 (measurement of CDKL5 kinase activity). We found that the WPRE enhancer is necessary to obtain human CDKL5 expression levels in mouse brains similar to wild-type mouse Cdkl5 expression (Figure 2). CDKL5 was fully active, as determined by its ability to phosphorylate its endogenous target protein, EB2 (Figure 2). CDKL5 expression and localization were confirmed via IHC. Alternative expression constructs were also generated by replacing human synapsin with either the human ubiquitin C promoter (Ubc) (Figure 1B) or the chicken β-actin hybrid promoter (Figure 1C). AAV vectors AAVrh91.UbC.CDKL5-1co.miR183 and AAVrh91.CBh.CDKL5-1co.miR183 in AAVrh91 capsid were transmitted via neonatal ICV to Cdkl5-ko mice in 3 × 10⁶ cells. 10 The mice were administered at the GC dose, and autopsies were performed at P14. Western blot analysis of mouse brain tissue was performed using UbC or We confirmed the expression of CDKL5 after transduction using an AAV vector genome containing the CBh promoter. We observed the expression of the CDKL5 transgene in mouse brains after transduction with AAVrh91.UbC.CDKL5-1co.miR183 and AAVrh91.CBh.CDKL5-1co.miR183. After transduction with AAVrh91.UbC.CDKL5-1co.miR183, higher CDKL5 expression per cell was observed in the hippocampus of mouse brains. On the other hand, after transduction with AAVrh91.CBh.CDKL5-1co.miR183, lower CDKL5 expression per cell was observed in the hippocampus of mouse brains. After transduction with AAVrh91.UbC.CDKL5-1co.miR183, higher CDKL5 expression per cell was observed in the cortex of mouse brains. Following transduction with AAVrh91.CBh.CDKL5-1co.miR183, lower CDKL5 expression per cell was observed in the mouse brain cortex. Furthermore, AAVrh91.UbC.CDKL5-1co.miR183 (3 × 10⁻¹⁰ 10 GC, Neonatal ICV) and AAVhu68.hSyn.CDKL5-1co.miR183 (2.5×10 10 CDKL5 expression in the brains of Cdkl5-ko mice after administration of GC was compared. As specified, very similar expression patterns were observed in the mouse brains after administration of AAV. CDKL5 expression was observed in the mouse brains after transduction with either AAVrh91.UbC.CDKL5-1co.miR183 (AAVrh91 capsid, ubiquitin C promoter) or AAVhu68.hSyn.CDKL5-1co.miR183 (AAVhu68 capsid, synapsin promoter). Furthermore, 1 × 10⁻⁶ CDKL5 expression was observed in the mouse brains. 10 GC, 3x10 10 GC, and 6×10 10 We will investigate the behavioral effects of various doses of AAVrh91.UbC.CDKL5-1co.miR183 and AAVrh91.CBh.CDKL5-1co.miR183 in Cdkl5-ko mice using GC.

[0153] The AAV.UbC.CDKL5-1co.miR183 vector demonstrated therapeutic utility in mice, similar to when CDKL5 expression was driven by hSyn. The AAVrh91 capsid, when used with an AAV vector genome containing the manipulated nucleic acid sequence, achieved CDKL5 expression similar to that of AAVhu68. CDKL5 protein levels in mouse brain were higher with the Ubc promoter compared to the hSyn promoter.

[0154] Example 3: Preclinical therapeutic effect of CDKL5 gene therapy in a CDD mouse model To test the therapeutic efficacy of CDKL5 gene therapy in Cdkl5-deficient mice, we administered 5 × 10⁶ Cdkl5-ko (also referred to as KO mice or mice) and wild-type (wt) littermates via reverse orbital IV injection to a cohort. 11 The mice were treated with the GC(5e11gc) AAV9-PHP.B-hSyn-hCDKL5-1co.WPRE vector. All treatment groups continued to grow at the same rate, and no treatment-related deaths were observed. At 10 weeks of age, the mice were subjected to a series of behavioral tests. Robust and statistically significant normalization was observed in the treatment groups in the increased zero maze and open field activity tests. Slight improvements were observed in the same groups in the rotarod and Y maze tests, but no improvement was observed in thermal sensitivity.

[0155] Considering the importance of Cdkl5 in neurodevelopment, we investigated whether early administration of gene therapy could improve treatment outcomes in mice. Next, we administered 6 × 10⁶ Cdkl5 per mouse via intraventricular (ICV) injection. 9 GC~5×10 10 Cohorts of neonatal Cdkl5-ko or wt littermates were treated with the GC AAVhu68-hSyn-hCDKL5-1co.WPRE vector within the specified dose range. Behavioral tests were performed at 10 weeks or 11–14 weeks postnatology (if instructed). Overall observations across all groups showed that the treatment was well tolerated, there were no treatment-related deaths, and normal weight gain (Figures 9A and 9B) and overall development were observed. 5×10 10GC dosage: 2.5 × 10 10 GC dosage, and 1×1 0 10 Dose-dependent expression of the CDKL5 transgene was observed in the brains of Cdkl5-ko mice at GC doses. At 10 weeks of age, KO mice exhibited a characteristic hindlimb clasping phenotype, which was substantially improved in treated ko mice. The therapeutic efficacy of CDKL5 gene therapy was measured by the hindlimb clasping test. Dose-dependent improvement was observed in the severity score of treated CDKL5-ko mice (Figures 9C-9F). Similarly, persistent hyperactivity and the rearing phenotype observed in ko mice were normalized to wild-type activity. Hippocampal learning and memory were greatly improved in treated ko mice in the Y-maze test (spontaneous change index). The therapeutic efficacy of CDKL5 gene therapy was further measured by the open-field activity test, which measures the correction of hyperactivity in KO and AAV-treated mice. Dose-dependent resolution of hyperactivity was observed in treated Cdkl5-ko mice (Figures 11A-11F). KO mice exhibited poor nest building when housed alone in a fresh cage overnight, failing to tear through all nesting material. Treated KO mice showed a significant dose-dependent improvement in nest-building ability (Figures 10A, 10C, 10E). Two additional neurobehavioral assays (glass bead twilight and Y-maze) showed a strong trend toward phenotypic improvement in treated Cdkl5-ko mice (Figures 10B and 10D). The EEG phenotype was rescued in a preliminary collaborative study and may be useful as a translational biomarker. Verification of outcomes for the primary assays (hindlimb clasping, walking activity) will be performed additionally using an independent experimental cohort. A larger cohort size (N=18 / group) yielded more robust statistical significance. Verification of outcomes for the primary assays (hindlimb clasping, walking activity) will also be performed using alternative CDD mouse models (R59X, D471fs). In summary, CDKL5 gene therapy delivers functional CDKL5 protein to the mouse brain and exhibits dose-dependent therapeutic effects on several neurobehavioral outcomes in a male mouse model of CDD.

[0156] After completing behavioral tests, brain samples were collected from mice when they were approximately 3 months old. Western blotting revealed robust expression of human CDKL5 in Cdkl5-ko brains, even 3 months after AAV administration. Finally, human CDKL5 showed robust kinase activity when blotting for phosphorylated EB2 protein.

[0157] Furthermore, the outcomes of CDKL5 gene therapy using an alternative CDD mouse model were investigated. Cdkl5(D471fs) has a patient point mutation that leads to an early stop codon. Similar to patients, CDKL5 protein was not found in the brains of these mice, and very reduced EB phosphorylation levels were observed. Therefore, Cdkl5(D471fs) shares the absence of Cdkl5 protein with the previously used Cdkl5-ko mouse, but the genetic background differs slightly depending on how the mouse model was generated. Neonatal mice were given the same concentration as before (5 × 10⁻¹⁰). 10 Injection with GC (neoICV) resulted in robust hCDKL5 protein expression and EB2 phosphorylation after 3 months. A small pilot cohort was subjected to behavioral studies. AAV treatment was well tolerated, and no pathological conditions were observed. Hindlimb clasping was significantly corrected in treated mutant mice, and similarly, the mutant phenotype in the elevated zero maze test was corrected to wild-type behavior in treated mutant mice (inside the open zone, entering the open zone). Mutant mice exhibited poor interaction and camouflage behavior with glass marbles placed on a grid in a new cage, while wild-type mice typically camouflaged almost everything. Treated mutant mice showed a strong correction of these behaviors compared to wild-type mice. In Cdkl5-ko mice in the treatment group, 5 × 10⁶ 10 Significant improvement was observed with higher doses in GC / mouse.

[0158] Furthermore, the outcomes of CDKL5 gene therapy using an alternative CDD mouse model were investigated. Cdkl5(R59X) has a patient point mutation that introduces an immature stop codon. Similar to patients, CDKL5 protein was not found in the brains of these mice, and very reduced EB phosphorylation levels were observed. Therefore, Cdkl5(R59X) shares the absence of Cdkl5 protein with the previously used Cdkl5-ko mouse, but the mouse model... The genetic background differs slightly depending on the method of production. Newborns receive the same concentration as before (5 × 10 10 Injection with GC (neoICV) resulted in robust hCDKL5 protein expression and EB2 phosphorylation after 3 months. A small pilot cohort was used for behavioral studies. AAV treatment was well tolerated, and no pathological conditions were observed. Hindlimb clasping was significantly corrected in treated mutant mice.

[0159] We also investigated the outcomes of CDKL5 gene therapy using an alternative CDD mouse model in heterozygous female Cdkl5-ko mice. Such models reflect most CDD patients (CDD females). Overall assessment showed that the neurobehavioral phenotype in heterozygous female Cdkl5-ko mice was much milder and developed later, making robust assessment of treatment outcomes more difficult. However, high doses (5 × 10⁻¹⁰) 10 Representative data for hindlimb clasping and walking activity in GC (German Child, Neonatal ICV) show significant improvement (Figures 14B and 14C).

[0160] In addition, we investigated dose escalation of CDKL5 gene therapy in WT mice. WT (C57Bl6 / J) mice were given 7.5 × 10⁶ doses via neonatal ICV. 10 GC and 1 × 10 11 The mice were injected with a large dose (GC) (i.e., 1.5 or 2 times the highest dose previously used). No significant effects were observed on body weight, development, or survival. The mice appeared normal and did not show hindlimb clasping or activity changes. No effects were observed in the pathological review of CNS tissue (Figures 19A and 19B).

[0161] Example 4: Practical human CDKL5 isoforms 2-4 At least four detectable Cdkl5 mRNA splice variants have been shown to exist in human and mouse brains, but it has not been established that isoforms 2-4 exist as stable proteins. Isoform 1 accounts for over 85% of brain CDKL5.

[0162] We codon-optimized the coding sequences of human CDKL4 isoforms 2-4 and cloned the coding sequences into the same AAV vector as before. AAV9-PHP.B vector coding for isoforms 1-4 was tail vein-injected into adult Cdkl5-ko mice and brains harvested 2 weeks later for Western blot analysis. We found all four isoforms expressing and displaying the expected gel shift patterns robustly. For follow-up, we selected engineered sequences that resulted in expression of isoforms 2-4 that closely resembled the expression level of isoform 1. The level of EB2 phosphorylation generated by isoform 2 was slightly higher compared to isoform 1, and those by isoform 3 or 4 were slightly lower.

[0163] Three alternative CDKL5 isoforms were injected into neonatal Cdkl5-ko mice to test how their potential therapeutic effects compare to isoform 1. Figure 12 shows significant correction of the clasping phenotype using treatment with alternative CDKL5 isoforms (2, 3, and 4). Figures 8A-8D provide the CDKL5 expression levels or activities of the AAV.CDLK5 vector constructs for expressing isoform 1, isoform 2, isoform 3, or isoform 4. Figure 8A shows AAV vectors (5×10 10Shows the expression levels in knockout mice injected with GC, neonatal ICV). Figure 8B shows the CDKL5 activity determined using pS222EB2 in wild-type mice injected with vehicle (PBS), knockout mice injected with vehicle, or AAV.CDKL5-1co. Figure 8C shows the CDKL5 activity determined using pS222EB2 for the groups in Figure 8A. Figure 8D shows the CDKL5 expression levels for the groups in Figure 8B.

[0164] In summary, all isoforms are expressed as proteins and have equivalent catalytic activity. The therapeutic outcomes with isoform 2, 3, or 4 in the CDD mouse model are equivalent to those of isoform 1 when head-to-head tests are conducted (5×10 10 GC, neonatal ICV). Overall, CDKL5 gene therapy with CDKL5 isoform 1 is a promising and safe approach in male CDD model mice with significant therapeutic effects.

[0165] Example 5: NHP Pilot Study for Toxicity and Safety Testing of hCDKL5 Gene Therapy We wished to investigate the expression pattern and safety profile of the AAV-hSyn-CDKL5-1co.WPRE construct packaged in the AAVhu68 capsid in NHP. Vectors were generated using the vector genomes described herein and the previously described production methods. See, for example, WO2018 / 160582, which is incorporated herein by reference. A group of 6 rhesus monkeys (4 - 6 years old) was injected via the intracisternal magna (ICM). Different conditions were tested, A. Dose 1×10 14 GC, injected in 1 ml of buffer B. Dose 1×10 14 GC, injected in 3 ml or 5 ml of buffer C. Dose 3×10 14 GC, injected in 3 ml of buffer D. Dose 1×10 14GC injection in 1 ml of buffer solution, followed by 2 days of pretreatment with the diuretic acetazolamine (Diamox®), reduced CSF production.

[0166] In short, toxicity and safety studies of hCDKL5 gene therapy were conducted using the AAVhu68-hSyn-Cdkl5-1co-WPRE vector for non-human primate (NHP) research. Preliminary studies involved three different doses, 3 × 10⁶. 12 GC / Animal, 1×10 13 GC / animal, and 3 x 10 13 GC / animals were evaluated. For the pilot study, 1 × 10 14 We selected GC / animal doses and evaluated the delivery of AAV vectors to cerebrospinal fluid (CSF) via the cisterna magna in two different volumes (3 mL and 5 mL). Other study groups were given a diuretic (e.g., Diamox brand acetazolamide) along with 1 × 10⁶ doses. 14 GC / animal or 3×10 14 GC / Animal(target) was used.

[0167] Furthermore, 2 × 10 12 , 1 x 10 13 , and 3×10 13 The GC / target dose was tested. Treatment with the CDKL5 vector was well tolerated, and no signs of changes in clinical hemochemistry were observed. No changes from baseline were found in observations from neurological examinations on the cage side.

[0168] Autopsies were performed 28 days after injection, followed by molecular analysis, histology, and pathology. Overall, no significant differences in transduction were found in major organs other than the CNS (e.g., liver transduction likely had already reached its maximum). No major differences in transduction were observed in the spinal cord and DRG (remaining at very high transduction rates), but significant changes in brain tissue were revealed depending on the injection parameters. The highest increase in transduction was observed in the cortex. Diamox led to a slight increase in transduction efficiency via the brain.

[0169] Figure 17 shows the vector biodistribution of each NHP across non-nerve tissue, spinal tract tissue, and brain tissue. Figure 18 shows only the vector biodistribution data for the brain. The results indicate strong transduction in the dorsal root ganglia (DRG), moderate to low transduction in brain tissue, and transduction leakage into nerve tissue. Pathological results showed mild axonal damage in the dorsal white matter tract. Slight differences in hCDKL5 mRNA levels were observed. mRNA expression tended to be higher when using a 3 ml injection volume. The distribution of hCDKL5 mRNA by in situ hybridization (ISH) was also visualized. Dorsal root ganglia (DRG) showed very strong mRNA expression across all six NHPs. In the motor cortex, a small number of transduction neurons were observed (<10%). Occasionally, small clusters of transduction neurons were found. This study did not find significant differences in hCDKL5 mRNA-positive neurons in the motor cortex among the NHPs.

[0170] Pathological review revealed no large-scale lesions in the tissues or NHP. NHP receiving the highest dose showed mild signs of inflammatory cell infiltration in the liver. Furthermore, all NHPs exhibited mild to moderate spinal cord axonal damage and DRG satellite satellites.

[0171] Furthermore, we will investigate the vector expression and safety studies of the AAVrh91.UbC.CDKL5-1co.miR183 and AAVrh91.CBh.CDKL5-1co.miR183 vectors in NHP. The vectors will be expressed via the ICM pathway in a 3×1 10 The AAV vector is administered to C. macaques via GC. Pathological analysis and neurological examinations are performed to evaluate the effect of CDKL5 expression after AAV vector administration.

[0172] In conclusion, stable CDKL5 protein expression in neurons can be achieved using the AAV-CDKL5 vector (SEQ ID NO: 1) examined in our study. AAV-CDKL5 gene therapy significantly improved the phenotype of the CDD mouse model. Furthermore, the AAV-CDKL5 vector can be efficiently delivered to non-human primates via the cisterna magna and expressed throughout the CNS. References 1. Bahi-Buisson, N. et al. Key clinical features to identify girls with CDKL5 mutations. Brain 131, 2647-2661, (2008). 2.Fehr,S.et al.The CDKL5 disorder is an independent clinical entity associated with early-onset encephalopathy.Eur J Hum Genet 21, 266-273, (2013). 3.Kalscheuer,VMet al.Disruption of the serine / threonine kinase 9 gene causes severe X-linked infantile spasms and mental retardation.American journal of human Genetics 72, 1401-1411, (2003). 4.Tao,J.et al.Mutations in the X-linked cyclin-dependent kinase-like 5(CDKL5 / STK9)gene are associated with severe neurodevelopmental retardation.American journal of human genetics 75,1149-1154,(2004).5.Weaving,L.S.et al.Mutations of CDKL5 cause a severe neurodevelopmental disorder with infantile spasms and mental retardation.American journal of human genetics 75,1079-1093,(2004). 6.Hector,R.D.et al.Characterization of CDKL5 Transcript Isoforms in Human and Mouse.PloS one 11,e0157758,(2016). 7.Baltussen,L.L.,et al.(2018).“Chemical genetic identification of CDKL5 substrates reveals its role in neuronal microtubule dynamics.”EMBO Journal 37(24). 8.Munoz,I.M.,et al.(2018).“Phosphoproteomic screening identifies physiological substrates of the CDKL5 kinase.”EMBO Journal.

[0173] All documents referenced herein are incorporated herein by reference, as are U.S. Provisional Patent Application No. 63 / 016,036 filed April 27, 2020, U.S. Provisional Patent Application No. 63 / 091,032 filed October 13, 2020, and U.S. Provisional Patent Application No. 63 / 109,608 filed November 4, 2020. The sequence listing filed herein under the name "20-9196PCT_SeqListing_ST25.txt", and the sequences and text therein, are incorporated herein by reference. While the present invention is described with reference to specific embodiments, it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to be within the scope of the appended claims.

Claims

1. A recombinant adeno-associated virus (rAAV) useful for treating CDKL5 deficiency (CDD), wherein the rAAV is (a) AAV capsid and, (b) A vector genome packaged in the AAV capsid of (a), wherein the vector genome includes an hCDKL5 coding sequence which is a nucleic acid sequence encoding functional hCDKL5 under the control of an inverted terminal repeat (ITR) and a regulatory sequence that directs human CDKL5 (hCDKL5) expression in central nervous system cells, wherein the hCDKL5 coding sequence is nt699-3581 of SEQ ID NO: 22, which encodes the amino acid sequence of SEQ ID NO: 2, or a sequence which is at least 95% identical to nt699-3581 of SEQ ID NO:

22. The regulatory sequence includes a human synapsin (hSyn) promoter or a UbC promoter. Recombinant adeno-associated virus (rAAV).

2. A recombinant adeno-associated virus (rAAV) useful for treating CDKL5 deficiency (CDD), wherein the rAAV is (a) AAV capsid and, (b) A vector genome packaged in the AAV capsid of (a), wherein the vector genome includes an hCDKL5 coding sequence which is a nucleic acid sequence encoding functional hCDKL5 under the control of an inverted terminal repeat (ITR) and a regulatory sequence that directs human CDKL5 (hCDKL5) expression in central nervous system cells, wherein the hCDKL5 coding sequence is nt699-3581 of SEQ ID NO: 22, which encodes the amino acid sequence of SEQ ID NO: 2, or a sequence which is at least 95% identical to nt699-3581 of SEQ ID NO:

22. The vector genome further comprises at least two dorsal root ganglion (drg)-specific miRNA183 target sequences operably linked to the hCDKL5 coding sequence. Recombinant adeno-associated virus (rAAV).

3. The rAAV according to claim 1 or 2, wherein the regulatory sequence comprises a human synapsin promoter.

4. The rAAV according to claim 1 or 2, wherein the regulatory sequence includes a UbC promoter.

5. The rAAV according to any one of claims 1 to 4, wherein the regulatory sequence further comprises one or more of the following: a Kozak sequence, an intron, an enhancer, a TATA signal, and a polyA sequence.

6. The rAAV according to claim 5, wherein the regulatory sequence includes a rabbit β-globin (RBG) polyA sequence.

7. The rAAV according to claim 1 or 2, wherein the adjustment array further comprises a WPRE element.

8. The rAAV according to any one of claims 1 to 7, wherein the vector genome further comprises in the 3' untranslated region of hCDKL5 at least a first dorsal root ganglion (drg) specific miRNA target sequence and a second drg specific miRNA target sequence, wherein the at least first miRNA target sequence and the at least second miRNA target sequence may be the same or different, and targets miR183 or miR182.

9. The rAAV according to claim 8, wherein at least one first and / or at least one second miRNA target sequence of the expression cassette mRNA or DNA plus strand is (i) AGTGAATTCTAACCAGTGCCATA (miR183, SEQ ID NO: 11), or (ii) AGCAAAATGTGCTAGTGCCAAAA (SEQ ID NO: 12).

10. The rAAV according to claim 8 or 9, wherein two or more of the miRNA target sequences are separated by spacers, and each spacer is independently selected from one or more of (A) GGAT, (B) CACGTG, or (C) GCATGC.

11. The rAAV according to claim 10, wherein the spacer located between the miRNA target sequences may be located at 3' of the first miRNA target sequence and / or 5' of the last miRNA target sequence.

12. The rAAV according to claim 10 or 11, wherein the spacers between the miRNA target sequences are the same.

13. The rAAV according to any one of claims 1 to 12, wherein the capsid is AAVhu68 capsid, AAV9 capsid, or AAVrh91 capsid.

14. A composition comprising a stock of rAAV according to any one of claims 1 to 13 and an aqueous suspension medium.

15. The composition according to claim 14, wherein the composition is formulated for intravenous, intrathecal, intracisional, or intraventricular administration.

16. A vector comprising an expression cassette, wherein the expression cassette comprises an hCDKL5 coding sequence which is a nucleic acid sequence encoding functional human CDKL5 under the control of a regulatory sequence that directs human hCDKL5 expression, the hCDKL5 coding sequence being sequence number 22, or a sequence identical to sequence number 22 by at least 95%, and the regulatory sequence comprising a human synapsin (hSyn) promoter or a UbC promoter.

17. The aforementioned vector, A viral vector selected from recombinant parvovirus, recombinant lentivirus, recombinant retrovirus, or recombinant adenovirus; or The vector according to claim 16, which is a nonviral vector selected from naked DNA, naked RNA, inorganic particles, lipid particles, polymer-based vectors, or chitosan-based compositions.

18. An rAAV according to any one of claims 1 to 13, a composition according to claim 14 or 15, or a vector according to claim 16 or 17 for use in a method of treating CDKL5 deficiency (CDD), wherein the method comprises administering the rAAV, composition or vector to a subject requiring it.

19. An rAAV production system useful for producing rAAV according to any one of claims 1 to 13, wherein the production system is (a) A nucleic acid sequence encoding the clade F capsid protein, (b) Vector genome and, (c) A cell culture comprising sufficient AAV rep function and helper function to allow the vector genome to be packaged into the clade F capsid, The vector genome is sequence number 1, sequence number 29, or sequence number 3. rAAV production system.

20. The rAAV production system according to claim 19, wherein the cell culture is a human embryonic kidney 293 cell culture.

21. The rAAV production system according to claim 19, wherein the AAV rep is derived from a different AAV.