Functionalized tetrahydrofuran intermediate and synthesis thereof

Abstract

Disclosed herein are compounds and compositions useful for synthesizing splice-switching oligonucleotides comprising one or more spacers, and methods of preparing thereof.

Description

Attorney Docket No. QRL-022WO FUNCTIONALIZED TETRAHYDROFURAN INTERMEDIATE AND SYNTHESIS THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No.63 / 470,639, filed June 2, 2023, which is hereby incorporated by reference in its entirely for all purposes. BACKGROUND

[0002] Antisense oligonucleotides are nucleic acid-based compounds that can be used to inhibit expression of certain genes that are linked to diseases. Although antisense oligonucleotides can be generally designed to hybridize with target genes, conventional antisense oligonucleotides often exhibit poor efficacy. There is a need to develop compounds (i.e., building blocks) useful for synthesizing splice-switching oligonucleotides (e.g., splice- switching oligonucleotides comprising one or more spacers) and methods of preparing such compounds, in order to develop modified antisense oligonucleotides that exhibit improved performance and efficacy for preventing, ameliorating, and treating diseases. SUMMARY

[0003] Disclosed herein is a process for preparing a compound of Formula (A): comprising:protecting a compound of Formula (I): , thereby producing a1 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein R1is –Me, –Et,– each of R2and R3is independently H or C1-C6 alkyl.

[0004] Additionally disclosed herein is a process for preparing a compound of Formula (A): comprising:reductively cleaving a compound of Formula (II): , thereby producing a.

[0005] Additionally discloseda compound of Formula (A): 2 IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising:alkylating a : , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0006] Additionally disclosed herein is a process for preparing a compound of Formula (A): comprising:3 IPTS / 128585648.1Attorney Docket No. QRL-022WO deprotecting a compound of Formula (IV): , thereby producing a, whereinR1is –Me, –Et, or –

[0007] Additionally disclosed herein is a process for preparing a compound of Formula (A): comprising:protecting a compound of Formula (V): , thereby producing a, IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3

[0008] Additionally disclosed herein is a process for preparing a compound of Formula (A): comprising:installing a phosphoramidite group on a compound of Formula (VI): , thereby producing.

[0009] Additionallya compound of Formula (A): 5 IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising:protecting a : , thereby producing a, reductively cleavingproducing a compound of Formula (III): , alkylating thea compound of Formula (IV): , IPTS / 128585648.1Attorney Docket No. QRL-022WO deprotecting the compound of Formula (IV), thereby producing a compound of Formula (V): , protecting a compound of a compound of Formula (VI):, installing a Formula (VI), therebyproducing the compound of Formula (A), wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0010] Disclosed herein is a process for preparing a compound of Formula (VI): , comprising:protecting a compound of Formula (I): , thereby producing a7 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein R1is –Me, –Et,– each of R2and R3is independently H or C1-C6 alkyl.

[0011] Additionally disclosed herein is a process for preparing a compound of Formula (VI): comprising:reductively cleaving a compound of Formula (II): , thereby producing a.

[0012] Additionally discloseda compound of Formula (VI): 8 IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising:alkylating a : , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0013] Additionally disclosed herein is a process for preparing a compound of Formula (VI): , comprising:deprotecting a compound of Formula (IV): 9 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing a, whereinR1is –Me, –Et, or –

[0014] Additionally disclosed herein is a process for preparing a compound of Formula (VI): , comprising:protecting a compound of Formula (V): , thereby producing awherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0015] Additionally disclosed herein is a process for preparing a compound of Formula (VI): , IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising: protecting a compound of Formula (I): , thereby producing a, reductively cleaving producing a compound ofFormula (III): , alkylating thea compound of Formula (IV): , deprotecting theproducing a compound of Formula (V): , protecting a compound ofa compound of Formula (VI), wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and 11 IPTS / 128585648.1Attorney Docket No. QRL-022WO each of R2and R3is independently H or C1-C6alkyl.

[0016] Disclosed herein is a process for preparing a compound of Formula (V): (V), comprising:protecting a compound of Formula (I):(I), thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

[0017] Additionally disclosed herein is a process for preparing a compound of Formula (V): (V), comprising:reductively cleaving a compound of Formula (II): , thereby producing a12 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0018] Additionally disclosed a compound of Formula (V):, comprising:alkylating a compound of : , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0019] Additionally disclosed herein is a process for preparing a compound of Formula (V): , comprising:deprotecting a compound of Formula (IV): 13 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing the whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0020] Additionally disclosed herein is a process for preparing a compound of Formula (V): (V), comprising:protecting a compound of Formula (I): , thereby producing a, reductively cleavingproducing a compound of Formula (III): , alkylating thea compound of Formula (IV): 14 IPTS / 128585648.1Attorney Docket No. QRL-022WO , deprotecting the producing a compound of Formula (V),wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

[0021] Disclosed herein is a process for preparing a compound of Formula (IV): , comprising:protecting a compound of Formula (I): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0022] Additionally disclosed herein is a process for preparing a compound of Formula (IV): 15 IPTS / 128585648.1Attorney Docket No. QRL-022WO , comprising: reductively cleaving a, thereby producing a.

[0023] Additionally discloseda compound of Formula (IV): , comprising:alkylating a compound of Formula (III): , thereby producing awherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0024] Additionally disclosed herein is a process for preparing a compound of Formula (IV): 16 IPTS / 128585648.1Attorney Docket No. QRL-022WO , comprising: protecting a, thereby producing a, reductively cleaving producing a compound ofFormula (III): , alkylating thea compound of Formula (IV), wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0025] Disclosed herein is a process for preparing a compound of Formula (III): , IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising: protecting a compound of Formula (I): , thereby producing a, wherein 1R is –Me, –Et, or – each of R2and R3is independently H or C1-C6 alkyl.

[0026] Additionally disclosed herein is a process for preparing a compound of Formula (III): , comprising:reductively cleaving a compound of Formula (II): , thereby producing awherein each of R2and R3is independently H or C1-C6alkyl.

[0027] Additionally disclosed herein is a process for preparing a compound of Formula (III): 18 IPTS / 128585648.1Attorney Docket No. QRL-022WO , comprising: protecting a compound, thereby producing a, reductively cleaving producing a compound ofFormula (III), wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

[0028] Disclosed herein is a process for preparing a compound of Formula (II): , comprising:protecting a compound of Formula (I): , thereby producing awherein 19 IPTS / 128585648.1Attorney Docket No. QRL-022WO R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0029] Disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers, comprising: protecting a compound of Formula (I): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0030] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers, comprising: reductively cleaving a compound of Formula (II): , thereby producing a.

[0031] Additionally discloseda splice-switching oligonucleotide comprising one or more spacers, comprising: alkylating a compound of Formula (III): 20 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing a, wherein 1R is –Me, –Et, or –

[0032] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers, comprising: deprotecting a compound of Formula (IV): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0033] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers, comprising: protecting a compound of Formula (V): , thereby producing a21 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein 1R is –Me, –Et, or –

[0034] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers, comprising: installing a phosphoramidite group on a compound of Formula (VI): , thereby producing, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0035] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers, comprising: protecting a compound of Formula (I): 22 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing a, reductively cleaving producing a compound ofFormula (III): , alkylating the a compound of Formula(IV): , deprotecting theproducing a compound of Formula (V): , protecting a compound ofa compound of Formula (VI): 23 IPTS / 128585648.1Attorney Docket No. QRL-022WO , installing a Formula (VI), thereby producing the compound of: , whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

[0036] Disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers comprising any of the processes described herein, or a combination thereof.

[0037] Disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers using a compound of Formula (A). Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers using a compound of Formula (I). Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers using a compound of Formula (II). Additionally disclosed herein is a process for preparing a splice- switching oligonucleotide comprising one or more spacers using a compound of Formula (III). Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers using a compound of Formula (IV). Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers using a compound of Formula (V). Additionally disclosed 24 IPTS / 128585648.1Attorney Docket No. QRL-022WO herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers using a compound of Formula (VI).

[0038] In some embodiments, the splice-switching oligonucleotide comprising one or more spacers is any splice-switching oligonucleotide comprising one or more spacers described in PCT Publication No. WO 2021 / 247800, which is hereby incorporated by reference in its entirety.

[0039] Disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , comprising:protecting a compound of Formula (I): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; each of R2and R3is independently H or C1-C6alkyl; and each of symbol represents the point of connection to an internucleoside linkage.

[0040] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): 25 IPTS / 128585648.1Attorney Docket No. QRL-022WO , comprising: reductively cleaving a, thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; each of R2and R3is independently H or C1-C6 alkyl; and each of symbol represents the point of connection to an internucleoside linkage.

[0041] disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , comprising:alkylating a compound of Formula (III): 26 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing a, wherein 1R is –Me, –Et, or – each of symbol represents the point of connection to an internucleoside linkage.

[0042] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , comprising:deprotecting a compound of Formula (IV): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and 27 IPTS / 128585648.1Attorney Docket No. QRL-022WO each of symbol represents the point of connection to an internucleoside linkage.

[0043] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , comprising:protecting a compound of : , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of symbol represents the point of connection to an internucleoside linkage.

[0044] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , comprising:installing a phosphoramidite group on a compound of Formula (VI): 28 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of symbol represents the point of connection to an internucleoside linkage.

[0045] disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , comprising:protecting a compound of Formula (I): , thereby producing a29 IPTS / 128585648.1Attorney Docket No. QRL-022WO , reductively cleaving producing a compound of Formula (III):, alkylating the a compound of Formula(IV): , deprotecting theproducing a compound of Formula (V): , protecting a compound ofa compound of Formula (VI): , installing aFormula (VI), thereby producing the compound of Formula (A): 30 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein 1R is –Me, –Et, or – each of R2and R3is independently H or C1-C6alkyl; and each of symbol represents the point of connection to an internucleoside linkage.

[0046] Disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , comprising any of the processesthereof, wherein each of symbol represents the point of connection to an internucleoside linkage. In some embodiments, the process further comprises: reductively cleaving a compound of Formula (II): , thereby producing a31 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0048] In some embodiments, alkylating a compound, thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0049] In some embodiments, the process further comprises: deprotecting a compound of Formula (IV): , thereby producing a(V), whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0050] In some embodiments, the process further comprises: 32 IPTS / 128585648.1Attorney Docket No. QRL-022WO protecting a compound of Formula (V): , thereby producing a, wherein 1R is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0051] In some embodiments, the process further comprises: installing a phosphoramidite group on a compound of Formula (VI): , thereby producing.

[0052] In some(I) comprises contacting the compound of Formula (I) with a first base. In some embodiments, the first base is an 33 IPTS / 128585648.1Attorney Docket No. QRL-022WO inorganic base. In some embodiments, the first base is a hydride base. In some embodiments, the first base is NaH. In some embodiments, protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with Bn-X1, wherein X1is a leaving group. In some embodiments, X1is halo. In some embodiments, X1is –Cl, –Br, or –I. In some embodiments, X1is –Br. In some embodiments, protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with a first solvent. In some embodiments, the first solvent is a polar solvent. In some embodiments, the first solvent is tetrahydrofuran (THF). In some embodiments, protecting a compound of Formula (I) comprises elevating reaction temperature to reflux. In some embodiments, protecting a compound of Formula (I) comprises elevating reaction temperature to about 65 °C.

[0053] In some embodiments, reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with an activating agent. In some embodiments, the activating agent comprises a trialkylsilyl cation. In some embodiments, the activating agent comprises a trimethylsilyl cation. In some embodiments, the activating agent is trimethylsilyl trifluoromethanesulfonate (TMSOTf). In some embodiments, reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with a reducing agent. In some embodiments, the reducing agent is an organosilyl reducing agent. In some embodiments, the reducing agent is a trialkylsilane. In some embodiments, the reducing agent is triethylsilane. In some embodiments, reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with a second solvent. In some embodiments, the second solvent is a halogenated solvent. In some embodiments, the second solvent is dichloromethane (DCM) or dichloroethane (DCE). In some embodiments, the second solvent is dichloromethane (DCM). In some embodiments, reductively cleaving a compound of Formula (II) comprises lowering reaction temperature below about 0 °C. In some embodiments, reductively cleaving a compound of Formula (II) comprises lowering reaction temperature to about -18 °C. In some embodiments, alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with a second base.

[0054] In some embodiments, the second base is an inorganic base. In some embodiments, the second base is a hydride base. In some embodiments, the second base is NaH. In some embodiments, alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with an alkylating agent. In some embodiments, the alkylating agent is R1– X2, wherein X2is a leaving group. In some embodiments, X2is halo. In some embodiments, X2is –Cl, –Br, or –I. In some embodiments, X2is –Br. In some embodiments, X2is –I. In 34 IPTS / 128585648.1Attorney Docket No. QRL-022WO some embodiments, alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with a third solvent. In some embodiments, the third solvent is a polar solvent. In some embodiments, the third solvent is tetrahydrofuran (THF). In some embodiments, alkylating a compound of Formula (III) comprises lowering reaction temperature below about 10 °C. In some embodiments, alkylating a compound of Formula (III) comprises lowering reaction temperature to about -10 °C to about 10 °C. In some embodiments, alkylating a compound of Formula (III) comprises lowering reaction temperature to about 0 °C.

[0055] In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with a first catalyst. In some embodiments, the first catalyst is a palladium catalyst. In some embodiments, the first catalyst is a palladium (0) catalyst. In some embodiments, the first catalyst is a palladium on carbon. In some embodiments, the first catalyst is about 5% by weight palladium on carbon. In some embodiments, the first catalyst is about 10% by weight palladium on carbon. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with about 30 mol% of the first catalyst. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas at atmospheric pressure. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with a fourth solvent. In some embodiments, the fourth solvent is a protic solvent. In some embodiments, the fourth solvent is methanol or ethanol. In some embodiments, the fourth solvent is methanol. In some embodiments, deprotecting a compound of Formula (IV) comprises reaction temperature of about 23 °C.

[0056] In some embodiments, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a third base. In some embodiments, the third base is an organic base. In some embodiments, the third base is an amine base. In some embodiments, the third base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, 2,6- dimethylpyridine (lutidine), 2,4,6-trimethylpyridine, 2,6-di-isopropylpyridine, or 2,6-di-tert- butylpyridine. In some embodiments, the third base is 2,6-dimethylpyridine (lutidine). 35 IPTS / 128585648.1Attorney Docket No. QRL-022WO

[0057] In some embodiments, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a second catalyst. In some embodiments, the second catalyst is an organic catalyst. In some embodiments, the second catalyst is an amine catalyst. In some embodiments, the second catalyst is 4-dimethylaminopyridine (DMAP). In some embodiments, deprotecting a compound of Formula (V) comprises contacting the compound of Formula (V) with about 50 mol% of the second catalyst. In some embodiments, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with DMT- X3, wherein X3is a leaving group. In some embodiments, X3is halo. In some embodiments, X3is –Cl, –Br, or –I. In some embodiments, X3is –Cl. In some embodiments, protecting a compound of Formula (V) comprises lowering reaction temperature below about 10 °C. In some embodiments, protecting a compound of Formula (V) comprises lowering reaction temperature to about -10 °C to about 10 °C. In some embodiments, protecting a compound of Formula (V) comprises lowering reaction temperature to about 0 °C. In some embodiments, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a third base. In some embodiments, the third base is an organic base. In some embodiments, the third base is an amine base. In some embodiments, the third base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, 2,6-dimethylpyridine (lutidine), 2,4,6-trimethylpyridine, 2,6-di-isopropylpyridine, or 2,6-di-tert-butylpyridine. In some embodiments, the third base is 2,6-dimethylpyridine (lutidine). In some embodiments, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a second catalyst. In some embodiments, the second catalyst is an organic catalyst. In some embodiments, the second catalyst is an amine catalyst. In some embodiments, the second catalyst is 4-dimethylaminopyridine (DMAP). In some embodiments, deprotecting a compound of Formula (V) comprises contacting the compound of Formula (V) with about 50 mol% of the second catalyst.

[0058] In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a fourth base. In some embodiments, the fourth base is an organic base. In some embodiments, the fourth base is an amine base. In some embodiments, the fourth base is triethylamine (TEA) or N,N- diisopropylethylamine (DIPEA). In some embodiments, the fourth base is N,N- diisopropylethylamine (DIPEA). In some embodiments, installing a phosphoramidite group 36 IPTS / 128585648.1Attorney Docket No. QRL-022WO on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a phosphoramidite reagent.

[0059] In some embodiments, the phosphoramidite , wherein X5is a leaving group. In some embodiments, X5is halo. is –Cl, – Br, or –I. In some embodiments, X5is –Cl. In somereagent is 2-cyanoethyl N,N-diisopropylchlorophosphoramidite. In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a fifth solvent. In some embodiments, the fifth solvent is a halogenated solvent. In some embodiments, the fifth solvent is dichloromethane (DCM) or dichloroethane (DCE). In some embodiments, the fifth solvent is dichloromethane (DCM). In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature lowering reaction temperature below about 10 °C. In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature to about -10 °C to about 10 °C. In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature to about 0 °C.

[0060] Disclosed herein is a compound of Formula (A): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0061] Additionally disclosed herein is a compound of Formula (I): 37 IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein each of R2and R3is

[0062] Additionally disclosed herein is a compound of Formula (II): wherein 23each of R and R is or

[0063] Additionally disclosed herein is a compound of Formula (III): .

[0064] Additionally disclosed(IV): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0065] Additionally disclosed herein is a compound of Formula (V): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0066] Additionally disclosed herein is a compound of Formula (VI): 38 IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein 1R is –Me, –Et, or –

[0067] Disclosed herein is a composition comprising a compound of Formula (A): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0068] Additionally disclosed herein is a composition comprising a compound of Formula (I): whereineach of R2and R3is independently H or C1-C6alkyl.

[0069] Additionally disclosed herein is a composition comprising a compound of Formula (II): 39 IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein each of R2and R3is

[0070] Additionally disclosed herein is a composition comprising a compound of Formula (III): .

[0071] Additionally disclosed a compound of Formula(IV): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0072] Additionally disclosed herein is a composition comprising a compound of Formula (V): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0073] Additionally disclosed herein is a composition comprising a compound of Formula (VI): 40 IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein 1R is –Me, –Et, or –

[0074] In some embodiments, R1is –Me. In some embodiments, R1is –Et. In some embodiments, R1is –CH2OCH3. In some embodiments, R1is –(CH2)2OCH3.

[0075] In some embodiments, R2is H or C1-C3alkyl. In some embodiments, R2is H, –Me, – Et, or –nPr. In some embodiments, R2is –Me.

[0076] In some embodiments, R3is H or C1-C3alkyl. In some embodiments, R3is H, –Me, – Et, or –nPr. In some embodiments, R3is –Me.

[0077] In some embodiments, the compound of Formula (A) is a compound of Formula (A1): .

[0078] In somea compound of Formula (I-a): .

[0079] In some embodiments,(A) is a compound of Formula (II- a): 41 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0080] In some a compound of Formula (III- a):.

[0081] In some embodiments, is a compound of Formula (IV-a): .

[0082] In someis a compound of Formula (V- a): .

[0083] In some embodiments, the(A) is a compound of Formula (VI- a): a).

[0084] Disclosed herein isoligonucleotide comprising one or more spacers of Formula (B): 42 IPTS / 128585648.1Attorney Docket No. QRL-022WO , using a compound of Formula, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of symbol represents the point of connection to an internucleoside linkage.

[0085] disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , using a compound of Formula (I), whereineach of R2and R3is independently H or C1-C6 alkyl; and each of symbol represents the point of connection to an internucleoside linkage.

[0086] disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): 43 IPTS / 128585648.1Attorney Docket No. QRL-022WO , using a compound of Formula, wherein 23each of R and R is or each of symbol represents the point of connection to an internucleoside linkage.

[0087] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , to an internucleoside linkage.

[0088] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): 44 IPTS / 128585648.1Attorney Docket No. QRL-022WO , using a compound of Formula, whereinR1is –Me, –Et, or – each of symbol represents the point of connection to an internucleoside linkage.

[0089] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , using a compound of Formula, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of symbol represents the point of connection to an internucleoside linkage.

[0090] Additionally disclosed herein is a process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): 45 IPTS / 128585648.1Attorney Docket No. QRL-022WO , using a compound of Formula, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of symbol represents the point of connection to an internucleoside linkage. DETAILED DESCRIPTION

[0091] The features and other details of the disclosure will now be more particularly described. Certain terms employed in the specification, examples and appended claims are collected here. These definitions should be read in light of the remainder of the disclosure and understood as by a person of skill in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art.

[0092] Methods or processes disclosed herein are useful for synthesizing or preparing compounds useful for synthesizing splice-switching oligonucleotides. Methods or processes disclosed herein are useful for synthesizing or preparing splice-switching oligonucleotides (e.g., splice-switching oligonucleotides comprising one or more spacers). Futher methods or processes disclosed herein are useful for synthesizing or preparing compounds or compositions (e.g., compounds of Formula (A), Formula (I), Formula (II), Formula (III), Formula (IV), Formula (V), and Formula (VI) and subformulas thereof, and compositions comprising compounds of Formula (A), Formula (I), Formula (II), Formula (III), Formula (IV), Formula (V), and Formula (VI) and subformulas thereof) useful for synthesizing splice- 46 IPTS / 128585648.1Attorney Docket No. QRL-022WO switching oligonucleotides comprising one or more spacers), wherein each variable (i.e., R1, R2, and R3) is as defined and described herein. Definitions

[0093] As used herein, the term “alkyl” refers to a radical of a straight-chain or branched saturated hydrocarbon group having from 1 to 6 carbon atoms (“C1-C6alkyl”). Common alkyl abbreviations include –Me (–CH3), –Et (–CH2CH3), –iPr (–CH(CH3)2), –nPr (– CH2CH2CH3), –nBu (–CH2CH2CH2CH3), –iBu (–CH2CH(CH3)2), or –tBu (–C(CH3)).

[0094] As used herein, the term “antisense oligonucleotide” or “AON” or “splice-switching oligonucleotide” encompass any of a parent oligonucleotide, an oligonucleotide variant, an oligonucleotide comprising one or more spacers, or an oligonucleotide variant comprising one or more spacers. Examples of antisense oligonucleotides include oligonucleotides comprising a sequence of any one of antisense oligonucleotide comprising any one of sequences described in described in any of PCT Publication No. WO 2021 / 247800, which is hereby incorporated by reference in its entirety.

[0095] As used herein, “internucleoside linkage” refers to the covalent linkage between adjacent nucleosides in an oligonucleotide.

[0096] As used herein, the term “leaving group” is given its ordinary meaning in the art of synthetic organic chemistry and refers to an atom or a group capable of being displaced by a nucleophile. Examples of suitable leaving groups include, but are not limited to, halo (i.e., – F, –Cl, –Br, or –I) and sulfonic acid esters, such as toluenesulfonate (tosylate, –OTs), methanesulfonate (mesylate, –OMs), or trifluoromethanesulfonate (triflate, –OTf).

[0097] As used herein, “2’-O-(2-methoxyethyl)” (also 2’-MOE and 2’-O(CH2)2OCH3 and MOE) refers to an O-methoxyethyl modification of the 2’ position of a furanose ring. A 2’-O- (2-methoxyethyl) is used interchangeably as “2’-O-methoxyethyl” in the present disclosure. A sugar moiety in a nucleoside modified with 2’-MOE is a modified sugar.

[0098] As used herein, “nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, non-coding RNA, small interfering ribonucleic acids (siRNA), short-hairpin RNA (shRNA), and microRNAs (miRNA).

[0099] As used herein, “nucleobase” means a heterocyclic moiety capable of base pairing with a base of another nucleic acid. 47 IPTS / 128585648.1Attorney Docket No. QRL-022WO

[0100] As used herein, “modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. Examples of a modified nucleobase include 5-methyl cytosine, pseudouridine, or 5-methoxyuridine. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0101] As used herein, a “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and / or modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. Modified nucleosides include abasic nucleosides, which lack a nucleobase. However, modified nucleosides do not include spacers or other groups that are incapable of linking a nucleobase.

[0102] As used herein, “oligonucleotide” means a polymer of one or more segments of linked nucleosides each of which can be modified or unmodified, independent one from another.

[0103] The term “oligonucleotide comprising one or more spacers” or “oligonucleotide comprising a spacer” refers to an oligonucleotide with at least one spacer. An oligonucleotide comprising one or more spacers can, in various embodiments, include one spacer, two spacers, three spacers, four spacer, five spacers, six spacers, seven spacers, eight spacers, nine spacers, or ten spacers. Generally, oligonucleotides comprising one or more spacers are described in reference to a corresponding parent oligonucleotide or a corresponding oligonucleotide variant. Example oligonucleotides comprising one or spacers are described in PCT Publication No. WO 2021 / 247800, which is hereby incorporated by reference in its entirety.

[0104] The terms “preparing”, “synthesizing”, and “generating” are used interchangeably herein.

[0105] The terms “process” and “method” are used interchangeably herein.

[0106] As used herein, a “spacer” refers to a nucleoside-replacement group (e.g., a non- nucleoside group that replaces a nucleoside present in a parent oligonucleotide). The spacer is characterized by lack of a nucleoside base and by the replacement of the nucleoside sugar moiety with a non-sugar substitute. The non-sugar substitute group of one or more spacers lacks an aldehyde, ketone, acetal, ketal, hemiacetal or hemiketal group. The non-sugar substitute group of one or more spacers is thus capable of connecting to the 3’ and 5’ positions of the nucleosides adjacent to the spacer through an internucleoside linker as described herein, but not capable of forming a covalent bond with a nucleotide base (i.e., not capable of linking a nucleobase to another group, such as an internucleoside linkage, 48 IPTS / 128585648.1Attorney Docket No. QRL-022WO conjugate group, or terminal group in an oligonucleotide). Generally, an oligonucleotide comprising one or more spacers is described in relation to a parent oligonucleotide, wherein the spacer replaces a nucleoside of the parent oligonucleotide.

[0107] The disclosure also embraces fluorescently labeled compounds of the disclosure. The disclosure also embraces isotopically labeled compounds of the disclosure, which are identical to those recited herein, except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number abundantly found in nature. Examples of isotopes that can be incorporated into compounds of the disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine, such as2H,3H,11C,13C,14C,15N,18O,17O,31P,32P,33P,35S,18F, and36Cl, respectively. Compounds and Compositions

[0108] Compounds and compositions disclosed herein are useful for synthesizing splice- switching oligonucleotides (e.g., splice-switching oligonucleotides comprising one or more spacers).

[0109] Disclosed herein is a compound of Formula (A): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0110] Additionally disclosed herein is a compound of Formula (I): whereineach of R2and R3is independently H or C1-C6 alkyl. 49 IPTS / 128585648.1Attorney Docket No. QRL-022WO

[0111] Additionally disclosed herein is a compound of Formula (II): wherein each of R2and R3isor

[0112] Additionally disclosed herein is a compound of Formula (III): .

[0113] Additionally disclosed (IV):whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0114] Additionally disclosed herein is a compound of Formula (V): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0115] Additionally disclosed herein is a compound of Formula (VI): 50 IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein R1is –Me, –Et,–

[0116] Disclosed herein is a composition comprising a compound of Formula (A): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0117] Additionally disclosed herein is a composition comprising a compound of Formula (I): whereineach of R2and R3is independently H or C1-C6 alkyl.

[0118] Additionally disclosed herein is a composition comprising a compound of Formula (II):Attorney Docket No. QRL-022WO wherein each of R2and R3is independently H or C1-C6alkyl.

[0119] Additionally disclosed herein is a composition comprising a compound of Formula (III): .

[0120] Additionally disclosed a compound of Formula(IV): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0121] Additionally disclosed herein is a composition comprising a compound of Formula (V): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0122] Additionally disclosed herein is a composition comprising a compound of Formula (VI): wherein52 IPTS / 128585648.1Attorney Docket No. QRL-022WO R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0123] In some embodiments, the compound of Formula (A) is a compound of Formula (A1): .

[0124] In some a compound of Formula (I-a):.

[0125] In some embodiments, is a compound of Formula (II-a): .

[0126] In someis a compound of Formula (III- a): a).

[0127] In some embodiments,is a compound of Formula (IV- a): 53 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0128] In some is a compound of Formula (V- a):. (VI) is a compound of Formula (VI-: .R1is –CH2OCH3or – (CH2)2OCH3. In some embodiments, R1is –Me. In some embodiments, R1is –Et. In some embodiments, R1is –CH2OCH3. In some embodiments, R1is –(CH2)2OCH3.

[0131] In some embodiments, R2is H or C1-C3 alkyl. In some embodiments, R2is H, –Me, – Et, or –nPr. In some embodiments, R2is –Me, –Et, or –nPr. In some embodiments, R2is – Me. In some embodiments, R2is –Et. In some embodiments, R2is –nPr.

[0132] In some embodiments, R3is H or C1-C3 alkyl. In some embodiments, R3is H, –Me, – Et, or –nPr. In some embodiments, R3is –Me, –Et, or –nPr. In some embodiments, R3is – Me. In some embodiments, R3is –Et. In some embodiments, R3is –nPr.

[0133] In some embodiments, R2is –Me and R3is –Me.

[0134] In some embodiments, the compound of Formula (A) is: 54 IPTS / 128585648.1Attorney Docket No. QRL-022WO O .

[0135] In some embodiments, (A) or Formula (A1) is:.

[0136] In some embodiments,(A) is: .

[0137] In some embodiments,(A) or Formula (A1) is: 55 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0138] In some embodiments, (A) is:O .

[0139] In someFormula (A1) is: O .

[0140] In some56 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0141] In some Formula (A1) is:.

[0142] In some.

[0143] In some embodiments,(IV) or Formula (IV-a) is: .

[0144] In some embodiments,(IV) is: 57 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0145] In some embodiments, (IV) or Formula (IV-a) is:.

[0146] In some embodiments,(IV) is: .

[0147] In someor Formula (IV-a) is: .

[0148] In someis: .

[0149] In someor Formula (IV-a) is: . IPTS / 128585648.1Attorney Docket No. QRL-022WO

[0150] In some embodiments, the compound of Formula (V) is: HO O .

[0151] In some embodiments, the (V) or Formula (V-a) is:.

[0152] In some embodiments, the (V) is:.

[0153] In some embodiments, the(V) or Formula (V-a) is: .

[0154] In some embodiments, the(V) is: .

[0155] In some embodiments,(V) or Formula (V-a) is: .

[0156] In some embodiments,(V) is: .

[0157] In some embodiments,(V) or Formula (V-a) is: 59 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0158] In some embodiments, (VI) is:.

[0159] In some embodiments,(VI) or Formula (VI-a) is: .

[0160] In some embodiments,(VI) is: .

[0161] In some embodiments,(VI) or Formula (VI-a) is: .

[0162] In some embodiments,(VI) is: 60 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0163] In some or Formula (VI-a) is:.

[0164] In someis: .

[0165] In someFormula (VI-a) is: .

[0166] Disclosed hereinof Formula (A) or any subformulas thereof. Additionally disclosed herein is are compositions comprising compounds of Formula (I) or any subformulas thereof. Additionally disclosed herein is are 61 IPTS / 128585648.1Attorney Docket No. QRL-022WO compositions comprising compounds of Formula (II) or any subformulas thereof. Additionally disclosed herein is are compositions comprising compounds of Formula (III) or any subformulas thereof. Additionally disclosed herein is are compositions comprising compounds of Formula (IV) or any subformulas thereof. Additionally disclosed herein is are compositions comprising compounds of Formula (V) or any subformulas thereof. Additionally disclosed herein is are compositions comprising compounds of Formula (VI) or any subformulas thereof. Additionally disclosed herein is are compositions comprising compounds Formula (A), Formula (I), Formula (II), Formula (III), Formula (IV), Formula (V), Formula (VI), or any subformulas thereof, or any combinations thereof. Synthetic Methods

[0167] Disclosed herein are methods or processes for synthesizing or preparing a splice- switching oligonucleotide comprising one or more spacers. Additionally disclosed herein is are methods or processes for synthesizing or preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of symbol represents the point of connection to an internucleoside linkage.

[0168] In some embodiments, the spacer of Formula (B) is: .

[0169] In some embodiments, the(B) is: . IPTS / 128585648.1Attorney Docket No. QRL-022WO

[0170] In some embodiments, the spacer of Formula (B) is: .

[0171] In some embodiments,.

[0172] In some embodiments,a spacer of Formula (B1), wherein: whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of symbol represents the point of connection to an internucleoside linkage.

[0173] Inthe spacer of Formula (B) or Formula (B1) is: .

[0174] In some embodiments, the(B) or Formula (B1) is: .

[0175] In some embodiments, the(B) or Formula (B1) is: 63 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0176] In some embodiments, Formula (B1) is:.

[0177] In some synthesizing or preparing asplice-switching oligonucleotide comprising one or more spacers of Formula (B) comprises one or more of the following synthetic steps: benzyl protection; reductive cleavage; alkylation; benzyl deprotection; DMT protection; and phosphoramidite installation.

[0178] In some embodiments, the methods or processes for synthesizing or preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B) comprises one or more of the following synthetic steps: protecting a compound of Formula (I); reductively cleaving a compound of Formula (II); alkylating a compound of Formula (III); deprotecting a compound of Formula (IV); protecting a compound of Formula (V); and installing a phosphoramidite group on a compound of Formula (VI), thereby producing a compound of Formula (A), wherein each variable (i.e., R1, R2, and R3) is as defined and described herein.

[0179] In various embodiments, the methods or processes for synthesizing or preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B) comprises the use of one or more of the following compounds: a compound of Formula (I); a compound of Formula (II); a compound of Formula (III); a compound of Formula (IV); a compound of Formula (V); a compound of Formula (VI); and a compound of Formula (A), wherein each variable (i.e., R1, R2, and R3) is as is as defined and described herein.

[0180] Disclosed herein are methods or processes for synthesizing or preparing a compound of Formula (A), or a composition comprising a compound of Formula (A), wherein each variable (i.e., R1) is as defined and described herein. Disclosed herein are methods or processes for synthesizing or preparing a compound of Formula (VI), or a composition comprising a compound of Formula (VI), wherein each variable (i.e., R1) is as defined and 64 IPTS / 128585648.1Attorney Docket No. QRL-022WO described herein. Disclosed herein are methods or processes for synthesizing or preparing a compound of Formula (V), or a composition comprising a compound of Formula (V), wherein each variable (i.e., R1) is as defined and described herein. Disclosed herein are methods or processes for synthesizing or preparing a compound of Formula (IV), or a composition comprising a compound of Formula (IV), wherein each variable (i.e., R1) is as defined and described herein. Disclosed herein are methods or processes for synthesizing or preparing a compound of Formula (III), or a composition comprising a compound of Formula (III). Disclosed herein are methods or processes for synthesizing or preparing a compound of Formula (II), or a composition comprising a compound of Formula (II), wherein each variable (i.e., R2and R3) is as defined and described herein..

[0181] Disclosed herein is a process for preparing a compound of Formula (A): comprising:protecting a compound of Formula (I): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl. 65 IPTS / 128585648.1Attorney Docket No. QRL-022WO

[0182] Additionally disclosed herein is a process for preparing a compound of Formula (A): comprising:reductively cleaving a : , thereby producing a.

[0183] Additionally discloseda compound of Formula (A): comprising:alkylating a compound of Formula (III): 66 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing a, wherein 1R is –Me, –Et, or –

[0184] Additionally disclosed herein is a process for preparing a compound of Formula (A): comprising:deprotecting a compound of Formula (IV): , thereby producing a, wherein67 IPTS / 128585648.1Attorney Docket No. QRL-022WO R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0185] Additionally disclosed herein is a process for preparing a compound of Formula (A): comprising:protecting a : , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3

[0186] Additionally disclosed herein is a process for preparing a compound of Formula (A): 68 IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising:installing a group on a Formula (VI): , thereby producing.

[0187] Additionallya compound of Formula (A): 69 IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising:protecting a : , thereby producing a, reductively cleavingproducing a compound of Formula (III): , alkylating thea compound of Formula (IV): , IPTS / 128585648.1Attorney Docket No. QRL-022WO deprotecting the compound of Formula (IV), thereby producing a compound of Formula (V): , protecting a compound of a compound of Formula (VI):, installing a Formula (VI), therebyproducing the compound of Formula (A), wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0188] Disclosed herein is a process for preparing a compound of Formula (VI): , comprising:protecting a compound of Formula (I): , thereby producing a71 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein R1is –Me, –Et,– each of R2and R3is independently H or C1-C6 alkyl.

[0189] Additionally disclosed herein is a process for preparing a compound of Formula (VI): comprising:reductively cleaving a compound of Formula (II): , thereby producing a.

[0190] Additionally discloseda compound of Formula (VI): 72 IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising:alkylating a : , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0191] Additionally disclosed herein is a process for preparing a compound of Formula (VI): , comprising:deprotecting a compound of Formula (IV): 73 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing a, whereinR1is –Me, –Et, or –

[0192] Additionally disclosed herein is a process for preparing a compound of Formula (VI): , comprising:protecting a compound of Formula (V): , thereby producing awherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0193] Additionally disclosed herein is a process for preparing a compound of Formula (VI): , IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising: protecting a compound of Formula (I): , thereby producing a, reductively cleaving producing a compound ofFormula (III): , alkylating thea compound of Formula (IV): , deprotecting theproducing a compound of Formula (V): , protecting a compound ofa compound of Formula (VI), wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and 75 IPTS / 128585648.1Attorney Docket No. QRL-022WO each of R2and R3is independently H or C1-C6alkyl.

[0194] Disclosed herein is a process for preparing a compound of Formula (V): (V), comprising:protecting a compound of Formula (I):(I), thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

[0195] Additionally disclosed herein is a process for preparing a compound of Formula (V): (V), comprising:reductively cleaving a compound of Formula (II): , thereby producing a76 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

[0196] Additionally disclosed a compound of Formula (V):, comprising:alkylating a compound of : , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0197] Additionally disclosed herein is a process for preparing a compound of Formula (V): , comprising:deprotecting a compound of Formula (IV): 77 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing the whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0198] Additionally disclosed herein is a process for preparing a compound of Formula (V): (V), comprising:protecting a compound of Formula (I): , thereby producing a, reductively cleavingproducing a compound of Formula (III): , alkylating thea compound of Formula (IV): 78 IPTS / 128585648.1Attorney Docket No. QRL-022WO , deprotecting the producing a compound of Formula (V),wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

[0199] Disclosed herein is a process for preparing a compound of Formula (IV): , comprising:protecting a compound of Formula (I): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0200] Additionally disclosed herein is a process for preparing a compound of Formula (IV): 79 IPTS / 128585648.1Attorney Docket No. QRL-022WO , comprising: reductively cleaving a, thereby producing a.

[0201] Additionally discloseda compound of Formula (IV): , comprising:alkylating a compound of Formula (III): , thereby producing awherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0202] Additionally disclosed herein is a process for preparing a compound of Formula (IV): 80 IPTS / 128585648.1Attorney Docket No. QRL-022WO , comprising: protecting a, thereby producing a, reductively cleaving producing a compound ofFormula (III): , alkylating thea compound of Formula (IV), wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0203] Disclosed herein is a process for preparing a compound of Formula (III): , IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising: protecting a compound of Formula (I): , thereby producing a, wherein 1R is –Me, –Et, or – each of R2and R3is independently H or C1-C6 alkyl.

[0204] Additionally disclosed herein is a process for preparing a compound of Formula (III): , comprising:reductively cleaving a compound of Formula (II): , thereby producing awherein each of R2and R3is independently H or C1-C6alkyl.

[0205] Additionally disclosed herein is a process for preparing a compound of Formula (III): 82 IPTS / 128585648.1Attorney Docket No. QRL-022WO , comprising: protecting a compound, thereby producing a, reductively cleaving producing a compound ofFormula (III), wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

[0206] Disclosed herein is a process for preparing a compound of Formula (II): , comprising:protecting a compound of Formula (I): , thereby producing awherein 83 IPTS / 128585648.1Attorney Docket No. QRL-022WO R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

[0207] In any of the embodiments described herein, the methods or processes comprise: protecting a compound of Formula (I): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

[0208] In some embodiments, protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with a first base.

[0209] In some embodiments, the first base is an inorganic base. Exemplary inorganic bases include, but are not limited to, carbonate bases, hydride bases, and hydroxide bases. In some embodiments, the first base is a carbonate base, a hydride base, or a hydroxide base. Exemplary carbonate bases include, but are not limited to, Li2CO3, Na2CO3, K2CO3, and Cs2CO3. Exemplary hydride bases include, but are not limited to, NaH, LiH, and KH. Exemplary hydroxide bases include, but are not limited to, NaOH, LiOH, KOH, and CsOH. In some embodiments, the first base is a hydride base. In some embodiments, the first base is NaH, LiH, or KH. In some embodiments, the first base is NaH.

[0210] In some embodiments, protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with Bn-X1, wherein X1is a leaving group. Exemplary leaving groups include, but are not limited to, halo and sulfonic acid esters. Exemplary leaving groups include, but are not limited to, –Cl, –Br, –I, –OTs, –OMs, or –OTf. In some embodiments, X1is halo. In some embodiments, X1is –Cl, –Br, or –I. In some embodiments, X1is –Cl. In some embodiments, X1is –Br. In some embodiments, X1is –I. In some embodiments, X1is sulfonic acid ester. In some embodiments, X1is OTs, –OMs, or –OTf. 84 IPTS / 128585648.1Attorney Docket No. QRL-022WO

[0211] In some embodiments, protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with a first solvent. In some embodiments, the first solvent is a polar solvent. Exemplary polar solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), and tetrahydrofuran (THF). In some embodiments, the first solvent is an aprotic solvent. Exemplary aprotic solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), dioxane, and tetrahydrofuran (THF). In some embodiments, the first solvent is acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), dioxane, or tetrahydrofuran (THF). In some embodiments, the first solvent is tetrahydrofuran (THF).

[0212] In some embodiments, contacting the compound of Formula (I) with the first solvent comprises dissolving the compound of Formula (I) in the first solvent.

[0213] In some embodiments, protecting a compound of Formula (I) comprises elevating reaction temperature to reflux. In some embodiments, protecting a compound of Formula (I) comprises elevating reaction temperature to above about 23 °C (e.g., about 23 °C, about 25 °C, about 27 °C, about 29 °C, about 30 °C, about 32 °C, about 34 °C, about 36 °C, about 38 °C, about 40 °C, about 42 °C, about 44 °C, about 46 °C, about 48 °C, about 50 °C, about 55 °C, about 60 °C, about 65 °C, about 70 °C, about 75 °C, about 80 °C, about 85 °C, about 90 °C, about 95 °C, about 100 °C, about 110 °C, about 120 °C, or about 130 °C). In some embodiments, protecting a compound of Formula (I) comprises elevating reaction temperature to about 50 °C, about 55 °C, about 60 °C, about 65 °C, about 70 °C, or about 75 °C. In some embodiments, protecting a compound of Formula (I) comprises elevating reaction temperature to about 65 °C.

[0214] In any of the embodiments described herein, the methods or processes comprise: reductively cleaving a compound of Formula (II): , thereby producing a85 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein R1is –Me, –Et,– each of R2and R3is independently H or C1-C6 alkyl.

[0215] In some embodiments, reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with an activating agent. In some embodiments, the activating agent comprises a trialkylsilyl cation. Exemplary alkyl groups for trialkylsilyl cations include methyl, ethyl, and propyl groups. In some embodiments, the activating agent comprises a trimethylsilyl cation. In some embodiments, the activating agent comprises a leaving group (e.g., halo or sulfonic acid ester). In some embodiments, the activating agent comprises a trimethylsilyl cation and a leaving group (e.g., halo or sulfonic acid ester). Exemplary activating agents comprising a trimethylsilyl cation include, but are not limited to, trimethylsilyl chloride (TMSCl) and trimethylsilyl trifluoromethanesulfonate (TMSOTf). In some embodiments, the activating agent is trimethylsilyl chloride (TMSCl) or trimethylsilyl trifluoromethanesulfonate (TMSOTf). In some embodiments, the activating agent is trimethylsilyl trifluoromethanesulfonate (TMSOTf).

[0216] In some embodiments, reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with a reducing agent. In some embodiments, the reducing agent is an organosilyl reducing agent. In some embodiments, the reducing agent is a silane. In some embodiments, the reducing agent is a trialkylsilane. Exemplary alkyl groups for trialkylsilanes include methyl, ethyl, and propyl groups. In some embodiments, the reducing agent is triethylsilane.

[0217] In some embodiments, reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with a second solvent. In some embodiments, the second solvent is a halogenated solvent. Exemplary halogenated solvents include, but are not limited to, dichloromethane (DCM), dibromomethane, 1,1-dichloroethane, 1,2- dichloroethane, cis-1,2-dichloroethene, trans-1,2-dichloroethene, 1,2-dichloropropane, 1,1,1- trichloroethane, 1,1,2-trichloroethane, 1,1,2,2-tetrachloroethane, and tetrachloromethane. In some embodiments, the second solvent is dichloromethane (DCM) or dichloroethane (DCE). 86 IPTS / 128585648.1Attorney Docket No. QRL-022WO In some embodiments, the second solvent is dichloromethane (DCM) or 1,2-dichloroethane. In some embodiments, the second solvent is dichloromethane (DCM).

[0218] In some embodiments, contacting the compound of Formula (II) with the second solvent comprises dissolving the compound of Formula (II) in the second solvent.

[0219] In some embodiments, reductively cleaving a compound of Formula (II) comprises lowering reaction temperature below about 0 °C (e.g., about -40 °C, about -38 °C, about -36 °C, about -34 °C, about -32 °C, about -30 °C, about -28 °C, about -26 °C, about -24 °C, about -22 °C, about -20 °C, about -18 °C, about -16 °C, about -14 °C, about -12 °C, about -10 °C, about -8 °C, about -6 °C, about -4 °C, or about -2 °C). In some embodiments, reductively cleaving a compound of Formula (II) comprises lowering reaction temperature to about -28 °C, about -26 °C, about -24 °C, about -22 °C, about -20 °C, about -18 °C, about -16 °C, about -14 °C, about -12 °C, about -10 °C, or about -8 °C. In some embodiments, reductively cleaving a compound of Formula (II) comprises lowering reaction temperature to about -18 °C.

[0220] In any of the embodiments described herein, the methods or processes comprise: alkylating a compound of Formula (III): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0221] In some embodiments, alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with a second base. In some embodiments, the second base is an inorganic base. Exemplary inorganic bases include, but are not limited to, carbonate bases, hydride bases, and hydroxide bases. In some embodiments, the first base is a carbonate base, a hydride base, or a hydroxide base. Exemplary carbonate bases include, but are not limited 87 IPTS / 128585648.1Attorney Docket No. QRL-022WO to, Li2CO3, Na2CO3, K2CO3, and Cs2CO3. Exemplary hydride bases include, but are not limited to, NaH, LiH, and KH. Exemplary hydroxide bases include, but are not limited to, NaOH, LiOH, KOH, and CsOH. In some embodiments, the second base is a hydride base. In some embodiments, the first base is NaH, LiH, or KH. In some embodiments, the second base is NaH.

[0222] In some embodiments, alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with an alkylating agent. In some embodiments, the alkylating agent is R1–X2, wherein X2is a leaving group. Exemplary leaving groups include, but are not limited to, halo and sulfonic acid esters. Exemplary leaving groups include, but are not limited to, –Cl, –Br, –I, –OTs, –OMs, or–OTf. In some embodiments, X2is halo. In some embodiments, X2is –Cl, –Br, or –I. In some embodiments, X2is –Cl. In some embodiments, X2is –Br. In some embodiments, X2is –I. In some embodiments, X2is sulfonic acid ester. In some embodiments, X2is OTs, –OMs, or –OTf.

[0223] In some embodiments, alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with a third solvent. In some embodiments, the third solvent is a polar solvent. Exemplary polar solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), and tetrahydrofuran (THF). In some embodiments, the third solvent is an aprotic solvent. Exemplary aprotic solvents include, but are not limited to, acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), dioxane, and tetrahydrofuran (THF). In some embodiments, the third solvent is acetonitrile, dimethylformamide (DMF), dimethylsulfoxide (DMSO), dioxane, or tetrahydrofuran (THF). In some embodiments, the third solvent is tetrahydrofuran (THF).

[0224] In some embodiments, contacting the compound of Formula (III) with the third solvent comprises dissolving the compound of Formula (III) in the third solvent.

[0225] In some embodiments, alkylating a compound of Formula (III) comprises lowering reaction temperature below about 10 °C (e.g., about -40 °C, about -38 °C, about -36 °C, about -34 °C, about -32 °C, about -30 °C, about -28 °C, about -26 °C, about -24 °C, about -22 °C, about -20 °C, about -18 °C, about -16 °C, about -14 °C, about -12 °C, about -10 °C, about -8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8 °C, or about 10 °C). In some embodiments, alkylating a compound of Formula (III) comprises lowering reaction temperature to about -10 °C to about 10 °C (e.g., about -10 °C, about -8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 88 IPTS / 128585648.1Attorney Docket No. QRL-022WO 6 °C, about 8 °C, or about 10 °C). In some embodiments, alkylating a compound of Formula (III) comprises lowering reaction temperature to about 0 °C.

[0226] In any of the embodiments described herein, the methods or processes comprise: deprotecting a compound of Formula (IV): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0227] In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with a first catalyst. In some embodiments, the first catalyst is a palladium catalyst. In some embodiments, the first catalyst is a palladium (0) catalyst. In some embodiments, the first catalyst is a palladium on carbon. In some embodiments, the first catalyst is about 5% by weight palladium on carbon. In some embodiments, the first catalyst is about 10% by weight palladium on carbon.

[0228] In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with about 1 mol%, about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol%, about 6 mol%, about 7 mol%, about 8 mol%, about 9 mol%, about 10 mol%, about 12 mol%, about 15 mol%, about 18 mol%, about 20 mol%, about 25 mol%, 30 mol%, about 35 mol%, about 40 mol%, about 45 mol%, or about 50 mol% of the first catalyst. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with about 30 mol% of the first catalyst.

[0229] In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas at atmospheric pressure. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with 89 IPTS / 128585648.1Attorney Docket No. QRL-022WO hydrogen gas at about 0.9 atm, about 0.91 atm, about 0.92 atm, about 0.93 atm, about 0.94 atm, about 0.95 atm, about 0.96 atm, about 0.97 atm, about 0.98 atm, about 0.99 atm, about 1 atm, about 1.01 atm, about 1.02 atm, about 1.03 atm, about 1.04 atm, about 1.05 atm, about 1.06 atm, about 1.07 atm, about 1.08 atm, about 1.09 atm, or about 1.1 atm. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas at about 1 atm. In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas at a pressure of about 0.5 megapascal (MPa) to about 1.5 megapascal (MPa) (e.g., about 0.5 MPa, about 0.6 MPa, about 0.7 MPa, about 0.8 MPa, about 0.9 MPa, about 1.0 MPa, about 1.1 MPa, about 1.2 MPa, about 1.3 MPa, about 1.4 MPa, or about 1.5 MPa).

[0230] In some embodiments, deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with a fourth solvent. In some embodiments, the fourth solvent is a protic solvent. Exemplary protic solvents include, but are not limited to, alcoholic solvents, such as methanol and ethanol. In some embodiments, the fourth solvent is methanol or ethanol. In some embodiments, the fourth solvent is methanol.

[0231] In some embodiments, contacting the compound of Formula (IV) with the fourth solvent comprises dissolving the compound of Formula (IV) in the fourth solvent.

[0232] In some embodiments, deprotecting a compound of Formula (IV) comprises reaction temperature of room temperature. In some embodiments, deprotecting a compound of Formula (IV) comprises reaction temperature of ambient temperature. In some embodiments, deprotecting a compound of Formula (IV) comprises reaction temperature of about 20 °C, about 21 °C, about 22 °C, about 23 °C, about 24 °C, about 25 °C, or about 26 °C. In some embodiments, deprotecting a compound of Formula (IV) comprises reaction temperature of about 23 °C.

[0233] In any of the embodiments described herein, the methods or processes comprise: protecting a compound of Formula (V): (V), thereby producing a(VI): 90 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein 1R is –Me, –Et, or –

[0234] In some embodiments, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a third base. In some embodiments, the third base is an organic base. In some embodiments, the third base is an amine base. In some embodiments, the third base is triethylamine (TEA), N,N-diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the third base is pyridine, 2,6- dimethylpyridine (lutidine), 2,4,6-trimethylpyridine, 2,6-di-isopropylpyridine, or 2,6-di-tert- butylpyridine. In some embodiments, the third base is 2,6-dimethylpyridine (lutidine).

[0235] In some embodiments, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a second catalyst. In some embodiments, the second catalyst is an organic catalyst. In some embodiments, the second catalyst is an amine catalyst. In some embodiments, the second catalyst is 4-dimethylaminopyridine (DMAP).

[0236] In some embodiments, deprotecting a compound of Formula (V) comprises contacting the compound of Formula (V) with about about 10 mol%, about 11 mol%, about 12 mol%, about 13 mol%, about 14 mol%, about 15 mol%, about 16 mol%, about 17 mol%, about 18 mol%, about 19 mol%, about 20 mol%, about 22 mol%, about 24 mol%, about 25 mol%, about 27 mol%, about 29 mol%, about 30 mol%, about 32 mol%, about 34 mol%, about 35 mol%, about 37 mol%, about 39 mol%, about 40 mol%, about 42 mol%, about 44 mol%, about 45 mol%, about 48 mol%, about 50 mol%, about 55 mol%, or about 60 mol% of the second catalyst. In some embodiments, deprotecting a compound of Formula (V) comprises contacting the compound of Formula (V) with about 50 mol% of the second catalyst.

[0237] In some embodiments, protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with DMT-X3, wherein X3is a leaving group. Exemplary leaving groups include, but are not limited to, –Cl, –Br, –I, –OTs, –OMs, or–OTf. In some embodiments, X3is halo. In some embodiments, X3is –Cl, –Br, or –I. In some embodiments, 91 IPTS / 128585648.1Attorney Docket No. QRL-022WO X3is –Cl. In some embodiments, X3is –Br. In some embodiments, X3–I. In some embodiments, X3is sulfonic acid ester. In some embodiments, X3is OTs, –OMs, or –OTf.

[0238] In some embodiments, protecting a compound of Formula (V) comprises lowering reaction temperature below about 10 °C (e.g., about -40 °C, about -38 °C, about -36 °C, about -34 °C, about -32 °C, about -30 °C, about -28 °C, about -26 °C, about -24 °C, about -22 °C, about -20 °C, about -18 °C, about -16 °C, about -14 °C, about -12 °C, about -10 °C, about -8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8 °C, or about 10 °C). In some embodiments, protecting a compound of Formula (V) comprises lowering reaction temperature to about -10 °C to about 10 °C (e.g., about -10 °C, about -8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8 °C, or about 10 °C). In some embodiments, protecting a compound of Formula (V) comprises lowering reaction temperature to about 0 °C.

[0239] In any of the embodiments described herein, the methods or processes comprise: installing a phosphoramidite group on a compound of Formula (VI): , thereby producing, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

[0240] In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a fourth base. In some 92 IPTS / 128585648.1Attorney Docket No. QRL-022WO embodiments, the fourth base is an organic base. In some embodiments, the fourth base is an amine base. In some embodiments, the fourth base is triethylamine (TEA), N,N- diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the fourth base is pyridine, dialkylpyridine, or trialkylpyridine. In some embodiments, the fourth base is pyridine, 2,6-dimethylpyridine (lutidine), 2,4,6- trimethylpyridine, 2,6-di-isopropylpyridine, or 2,6-di-tert-butylpyridine. In some embodiments, the fourth base is triethylamine (TEA) or N,N-diisopropylethylamine (DIPEA). In some embodiments, the fourth base is N,N-diisopropylethylamine (DIPEA).

[0241] In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a phosphoramidite reagent.

[0242] In some embodiments, the phosphoramidite , wherein X5is a leaving group. Exemplary leaving groups include, andsulfonic acid esters. Exemplary leaving groups include, but are not limited to, –Cl, –Br, –I, – OTs, –OMs, or–OTf. In some embodiments, X5is halo. In some embodiments, X5is –Cl, – Br, or –I. In some embodiments, X5is –Cl. In some embodiments, X5is –Br. In some embodiments, X5is –I.. In some embodiments, X5is sulfonic acid ester. In some embodiments, X5is OTs, –OMs, or –OTf. In some embodiments, the phosphoramidite reagent is 2-cyanoethyl N,N-diisopropylchlorophosphoramidite.

[0243] In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a fifth solvent. In some embodiments, the fifth solvent is a halogenated solvent. Exemplary halogenated solvents include, but are not limited to, dichloromethane (DCM), dibromomethane, 1,1- dichloroethane, 1,2-dichloroethane, cis-1,2-dichloroethene, trans-1,2-dichloroethene, 1,2- dichloropropane, 1,1,1-trichloroethane, 1,1,2-trichloroethane, 1,1,2,2-tetrachloroethane, and tetrachloromethane. In some embodiments, the fifth solvent is dichloromethane (DCM) or dichloroethane (DCE). In some embodiments, the fifth solvent is dichloromethane (DCM) or 1,2-dichloroethane. In some embodiments, the fifth solvent is dichloromethane (DCM).

[0244] In some embodiments, contacting the compound of Formula (V) with the fifth solvent comprises dissolving the compound of Formula (V) in the fifth solvent.

[0245] In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature lowering reaction temperature below about 10 93 IPTS / 128585648.1Attorney Docket No. QRL-022WO °C (e.g., about -40 °C, about -38 °C, about -36 °C, about -34 °C, about -32 °C, about -30 °C, about -28 °C, about -26 °C, about -24 °C, about -22 °C, about -20 °C, about -18 °C, about -16 °C, about -14 °C, about -12 °C, about -10 °C, about -8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8 °C, or about 10 °C). In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature to about -10 °C to about 10 °C (e.g., about -10 °C, about -8 °C, about -6 °C, about -4 °C, about -2 °C, about 0 °C, about 2 °C, about 4 °C, about 6 °C, about 8 °C, or about 10 °C). In some embodiments, installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature to about 0 °C. EXAMPLES

[0246] The disclosure is further illustrated by the following examples, which are provided for illustrative purposes only. The following examples are not to be construed as limiting the scope of the disclosure in any way. Example 1. UNC13A Antisense Oligonucleotides

[0247] Several UNC13A antisense oligonucleotides with one or more spacers of: were evaluated in iPSC derived. The cells were seeded in 96- well plates at a density of 40,000 cells / well. Antisense oligonucleotide (AON) to TDP43 was transfected with Endoporter (Gene Tools, Philomath, OR, USA) to decrease expression of the full length UNC13A transcript and increase expression of UNC13A cryptic exon. Vehicle control consisted of motor neuron treatment with Endoporter alone. Positive controls included cells that were treated with TDP43 AON alone (“AON TDP43” or “TDP43 AON”).

[0248] TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry: 5’ A*A*G*G*C*T*T*C*A*T*A*T*T*G*T*A*C*T*T*T 3’ (SEQ ID NO: 13) where * = phosphorothioate, underlined = DNA, other=2’-MOE RNA;each “C”is 5-MeC.

[0249] To evaluate UNC13A AON ability to reduce UNC13A cryptic exon levels, antisense oligonucleotides to UNC13A were co-incubated with TDP43 AON in Endoporter in media before addition to the cells. After 72 hours, antisense oligonucleotides and Endoporter were 94 IPTS / 128585648.1Attorney Docket No. QRL-022WO washed out and replaced with fresh media alone. After six additional days, RNA was collected from the 96-well plates for RT-qPCR. RNA was isolated, cDNA generated and multiplexed RT-qPCR assay performed with Taqman probes for UNC13A cryptic exon, and reference GAPDH quantification.

[0250] Transcript levels (e.g., UNC13A cryptic exon, and TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, RT-qPCR was performed for detecting GAPDH using Thermofisher® TaqMan Gene Expression Assay Hs03929097_g1. UNC13a cryptic exon was detected using custom sequences. UNC13a Cryptic Exon: Forward Primer: ATTGTTCTGCACGTCGGT (SEQ ID NO: 1) Reverse Primer: GTCTGGGTATGTCTCTTCCAG (SEQ ID NO: 2) Probe Sequence: AGTTCTTTCCAGGAAACCCAGGCA (SEQ ID NO: 3)

[0251] To evaluate UNC13A AON ability to reduce UNC13A correctly spliced (CS)exon junction 20 / 21 levels, antisense oligonucleotides to UNC13A were co-incubated with TDP43 AON in Endoporter in media before addition to the cells. After 72 hours, antisense oligonucleotides and Endoporter were washed out and replaced with fresh media alone. After six additional days, RNA was collected from the 96-well plates for RT-qPCR. RNA was isolated, cDNA generated and multiplexed RT-qPCR assay performed with Taqman probes for UNC13A CS exon 20 / 21 junction, and reference GAPDH quantification.

[0252] Transcript levels (e.g., UNC13A exon junction 20 / 21, and TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, RT-qPCR was performed for detecting GAPDH using Thermofisher® TaqMan Gene Expression Assay Hs03929097_g1. UNC13a exon 20 / 21 junction was detected using TaqMan Gene Expression Assay Hs01000584_m1.

[0253] RT-qPCR was performed on Applied Biosystems® 7500 Real-time PCR systems. One cycle of reverse transcription was performed at a temperature of 50℃ for 5 min. One cycle of RT inactivation / initial denaturation was performed at a temperature of 95℃ for 20 seconds. Forty five cycles of amplification were performed at a temperature of 95℃ for 1 second followed by 60℃ for 20 seconds.

[0254] UNC13A-cryptic (Ct) was normalized to GAPDH (deltaCt). To visualize the quantitative changes (e.g., % decrease of UNC13A-cryptic), the normalized UNC13A-cryptic signal was further normalized to the vehicle (treated with Endoporter alone, deltadeltaCt). Relative quantity (RQ) of transcript level was calculated using the equation RQ=2-deltadeltaCt95 IPTS / 128585648.1Attorney Docket No. QRL-022WO and is used to describe the treatment condition comparison to normal, healthy levels (1.0). RQ values for UNC13A cryptic were normalized using the following formula: (((RQAON − RQendo) / (RQTDP43- RQendo))∗100

[0255] As shown in Table 1, Table 2, and Table 3, UNC13A AONs (e.g., UNC13A oligonucleotides without spacers or with one or two spacers) were tested for their ability to reduce UNC13A transcripts with a cryptic exon. In some cases, UNC13A AONs with spacers reduced UNC13A cryptic exon levels. In some cases, UNC13A AONs without spacers reduced UNC13A cryptic exon levels. Specific AON sequences are labeled according to their corresponding SEQ ID NO.

[0256] Correctly spliced UNC13A (Ct) was also normalized to GAPDH (deltaCt). To visualize the quantitative changes (e.g., % increase of correctly spliced UNC13A), the normalized correctly spliced UNC13A signal was further normalized to the vehicle (treated with Endoporter alone, deltadeltaCt).

[0257] Relative quantity (RQ) of transcript level was calculated using the equation RQ=2^(- deltadeltaCt) and is used to describe the treatment condition comparison to normal, healthy levels (1.0). RQ values for UNC13A corrected splicing were normalized using the following formula: (((RQAON − RQTDP43) / (RQendo−RQTDP43))∗100

[0258] Table 1. Exemplary UNC13A AONs evaluated in human derived iPSC motor neurons Table 1. Exemplary UNC13A AONs (including UNC13A oligonucleotides with spacers) SEQ ID NO: Oligonucleotide Sequence*(5’ to 3’)wn in Table 1 are modified nucleosides with 2 -O-(2-methoxyethyl) (2 -MOE) sugar moieties, each “C” is replaced with a 5-methylcytosine (5-MeC), and all internucleoside linkages are phosphorothioate linkages. A spacer, as indicated by S#, is not a nucleoside. 96 IPTS / 128585648.1Attorney Docket No. QRL-022WO S# represents a spacer of the following structure: . Table 2. AONs evaluatedin human derived iPSC motor neurons UNC13A Corrected Splicing Normalized Rqr moieties, each “C” is replaced with a 5-methylcytosine (5-MeC), and all internucleoside linkages are phosphorothioate linkages. A spacer, as indicated by S#, is not a nucleoside. S# represents a spacer of the following structure: .Table 3. Performance of Exemplary UNC13A AONs evaluated in human derived iPSC motor neurons UNC13A Cryptic SplicingIPTS / 128585648.1Attorney Docket No. QRL-022WO 4 GAGACAT(S#)CCCAGAC(S#)CAAACGG 40.47 25.79 143.30 44.64 5 GACATAC(S#)CAGACAC(S#)AACGGCC 67.02 35.41 83.55 61.27 2moieties, each C is replaced with a 5-methylcytosine (5-MeC), and all internucleoside linkages are phosphorothioate linkages. A spacer, as indicated by S#, is not a nucleoside. S# represents a spacer of the following structure: . Example 2. Synthesis of 2’-Attorney Docket No. QRL-022WO Step 1: Benzyl protection HO BnO OBnBr, NaHO( [2,3-

[0259] To a solution of 1,2-O-isopropylidene-D-ribofuranose (8.00 g, 41.2 mmol) in THF (240 mL) was added sodium hydride (60% dispersion in mineral oil, 5.77 g, 144 mmol) and the mixture was allowed to stir at rt for 10 min. Benzyl bromide (32.5 mL, 268 mmol) was then added and the reaction was stirred at rt for 10 min then at 65 °C for 8h. TLC showed complete consumption of starting material. The reaction was then quenched with saturated aqueous ammonium chloride and extracted with ethyl acetate (x3). The organic layers were further washed with brine, then dried over sodium sulfate and concentrated in vacuo. The crude product was purified by silica gel column chromatography (5 – 65% ethyl acetate in hexanes) to give compound 2 (15.0 g, 98% yield) as a pale-yellow oil. Calculated mass for C22H26O5 = 370.18; found = 388.3 (M+NH4)+.

[0260] 1H NMR (400 MHz, CDCl3): δ 7.37 – 7.23 (m, 10H), 5.75 (d, J = 3.7 Hz, 1H), 4.73 (d, J = 12.0 Hz, 1H), 4.59 – 4.46 (m, 4H), 4.18 (ddd, J = 9.1, 3.8, 2.1 Hz, 1H), 3.86 (dd, J = 9.1, 4.4 Hz, 1H), 3.76 (dd, J = 11.2, 2.0 Hz, 1H), 3.56 (dd, J = 11.2, 3.9 Hz, 1H), 1.59 (s, 3H), 1.36 (s, 3H).

[0261] LCMS: CSH C18 AMB (3 min): RT= 1.73 min. Step 2: Reductive acetonide cleavageol (3)

[0262] To a solution of compound 2 (1.00 g, 2.70 mmol) in dry dichloromethane (13 mL) was added triethylsilane (6.97 mL, 43.2 mmol) and the mixture was cooled to -18 °C. Trimethylsilyl trifluoromethanesulfonate (5.92 mL, 32.4 mmol) was then added dropwise and the reaction was stirred at -18 °C for 3h. LCMS showed complete consumption of starting 99 IPTS / 128585648.1Attorney Docket No. QRL-022WO material. The reaction was then quenched with saturated aqueous sodium bicarbonate and extracted with dichloromethane (x2). The organic layers were further washed with brine, then dried over sodium sulfate and concentrated in vacuo. The crude product was purified by silica gel column chromatography (10 – 60% ethyl acetate in heptane) to give compound 3 (665 mg, 78% yield) as a colorless oil. Calculated mass for C19H22O4 = 314.15; found = 332.0 (M+NH4)+.

[0263] 1H NMR (400 MHz, CDCl3): δ 7.38 – 7.26 (m, 10H), 4.61 – 4.47 (m, 4H), 4.26 – 4.19 4.08 – 4.01 3.99 – 3.94 3.79 J = 4.0 3.60

[0265] To a solution of compound 3 (332 mg, 1.06 mmol) in THF (6.64 mL) was added sodium hydride (60% dispersion in mineral oil, 127 mg, 3.17 mmol) at rt and the mixture was stirred for 10 min. The mixture was then cooled to 0 °C and iodomethane (66.4 µL, 1.06 mmol) was added to the reaction mixture. The temperature was then slowly allowed to attain rt and the reaction was continued for 3h. LCMS showed complete consumption of starting material. The reaction was then quenched with saturated aqueous ammonium chloride and extracted with ethyl acetate (x 2). The organic layers were further washed with brine, then dried over sodium sulfate and concentrated in vacuo. The crude product was purified by reverse-phase column chromatography (10 – 50% acetonitrile in 10 mM aqueous ammonium formate buffer) to give compound 4 (264 mg, 76% yield) as a colorless oil. Calculated mass for C22H27NO5 = 328.40; found = 346.0 (M+NH4)+. Note: some starting material compound 3 was also recovered from the purification.

[0266] 1H NMR (400 MHz, CDCl3): δ 7.37 – 7.26 (m, 10H), 4.61 (app dd, J = 38.0, 12.0 Hz, 2H), 4.54 (app dd, J = 28.9, 12.0 Hz, 2H), 4.12 – 4.07 (m, 1H), 3.99 (dd, J = 9.7, 4.7 Hz, 1H), 3.97 – 3.89 (m, 2H), 3.81 (m, 1H), 3.63 (dd, J = 10.7, 3.3 Hz, 1H), 3.51 (dd, J = 10.7, 4.3 Hz, 1H), 3.40 (s, 3H). 100 IPTS / 128585648.1Attorney Docket No. QRL-022WO

[0267] LCMS: CSH C18 AmF (3 min): RT= 1.57 min. Step 4: Hydrogenolysis(2R,3S,4S)-2-(hydroxymethyl)-4-methoxytetrahydrofuran-3-ol (5)

[0268] To a solution of compound 4 (264 mg, 804 µmol) in methanol (2.07 mL) degassed and back-filled with nitrogen (x 3) was added Pd / C (257 mg, 241 µmol) and the mixture was stirred at rt under a hydrogen atmosphere (balloon) for 16 h. LCMS and TLC showed complete consumption of staring material. The reaction mixture was then purged with nitrogen and filtered through a pad of celite, washing with methanol. The filtrate was concentrated in vacuo to give compound 5 (118 mg). The crude product was used in the following step without further purification.

[0269] 1H NMR (400 MHz, CDCl3): δ 4.14 – 4.07 (m, 1H), 4.04 (dd, J = 9.8, 4.6 Hz, 1H), 3.91 – 3.81 (m, 3H), 3.80 – 3.74 (m, 1H), 3.71 – 3.63 (m, 1H), 3.45 (s, 3H), 2.67 (d, J = 8.1 Hz, 1H), 1.89 (dd, J = 7.7, 4.9 Hz, 1H). Step 5: DMT-protectionmethoxytetrahydrofuran-3-ol (6)

[0270] To a suspension of compound 5 (118 mg, 796 µmol) and 4Å molecular sieves (17 mg) in lutidine (3.27 mL) and dichloromethane (1.63 mL) was added 4- dimethylaminopyridine (49.1 mg, 398 µmol) followed by a solution of 4,4′-dimethoxytrityl 101 IPTS / 128585648.1Attorney Docket No. QRL-022WO chloride (358 mg, 1.04 mmol) in dichloromethane (1.5 mL) at 0 °C. The temperature was allowed to slowly attain rt and the reaction was stirred for 2h. LCMS and TLC showed the reaction was complete, therefore heptane (2 mL) and methanol (2 mL) were added, and the mixture was concentrated in vacuo. The residue was then dissolved in ethyl acetate and washed with saturated aqueous copper sulfate (x2) followed by brine, then dried over sodium sulfate and concentrated in vacuo. The crude residue was purified by silica gel column chromatography (50 – 100% ethyl acetate in heptane) to give compound 6 (220 mg, 59 % yield over two steps) as a pale-yellow oil. Calculated mass for C29H33NO7= 450.52; found = 472.8 (M+Na)+.

[0271] 1H NMR (400 MHz, CDCl3): δ 7.47 – 7.42 (m, 2H), 7.36 – 7.31 (m, 4H), 7.31 – 7.27 (m, 2H), 7.23 – 7.15 (m, 1H), 6.85 – 6.79 (m, 4H), 4.15 – 4.08 (m, 2H), 3.96 – 3.86 (m, 3H), 3.79 (s, 6H), 3.45 (s, 3H), 3.31 (dd, J = 10.1, 3.5 Hz, 1H), 3.13 (dd, J = 10.1, 4.8 Hz, 1H), 2.63 (d, J = 6.9 Hz, 1H).

[0272] LCMS: CSH C18 AmB (3 min): RT = 1.66 min. Step 6: Phosphoramidite installation3- yl (2-cyanoethyl) diisopropylphosphoramidite (7)

[0273] To a suspension of compound 6 (220 mg, 488 µmol) in dry dichloromethane (5.29 mL) was added N,N-diisopropylethylamine (743 µL, 4.24 mmol) and the resulting solution was cooled to 0 °C under a nitrogen atmosphere.2-Cyanoethyl N,N- diisopropylchlorophosphoramidite (229 µL, 977 µmol) was then added dropwise and the resulting solution was allowed to attain rt and stir for 16 h. LCMS showed the reaction was complete. The reaction mixture was then cooled to 0 °C, diluted with dichloromethane and washed with cold saturated aqueous sodium bicarbonate, followed by brine, then dried over sodium sulfate and concentrated in vacuo. The crude product was then purified by silica gel 102 IPTS / 128585648.1Attorney Docket No. QRL-022WO column chromatography (5% triethylamine in ethyl acetate and hexanes, 5 – 80%) to give after lyophilization, compound 7 ((2R,3S,4S)-2-((bis(4- methoxyphenyl)(phenyl)methoxy)methyl)-4-methoxytetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite) (100 mg, 31% yield) as a colourless oil (mixture of diastereomers at PIII). Calculated mass for C36H47N2O7P = 650.31; found = 651.5 (M+H)+.

[0274] 1H NMR (400 MHz, DMSO-d6) (mixture of diastereomers): δ 7.46 – 7.38 (m, 2H), 7.34 – 7.24 (m, 6H), 7.24 – 7.17 (m, 1H), 6.93 – 6.84 (m, 4H), 4.27 – 4.11 (m, 1H), 4.03 – 3.92 (m, 2H), 3.92 – 3.84 (m, 1H), 3.82 – 3.74 (m, 2H), 3.74 – 3.71 (m, 6H), 3.59 – 3.42 (m, 3H), 3.40 – 3.30 (m, 3H), 3.27 – 3.16 (m, 1H), 2.97 (td, J = 9.7, 5.2 Hz, 1H), 2.76 (t, J = 5.7 Hz, 1H), 2.55 (t, J = 5.9 Hz, 1H), 1.17 – 1.04 (m, 9H), 0.93 (d, J = 6.7 Hz, 3H).

[0275] 31P NMR (162 MHz, DMSO-d6) (mixture of diastereomers): δ 149.23, 149.11.

[0276] LCMS (mixture of diastereomers): CSH C18 AMB (3 min): RT = 2.14 & 2.15 min. Example 3. Synthesis of 2’-MOE Building Block HO BnO BnO O BnBr, NaHOEt3SiH, TMSOTf O OHStep 1: Benzyl protection 103 IPTS / 128585648.1Attorney Docket No. QRL-022WO HO BnO O BnBr, NaHO( [2,3-d][1,3]dioxole (2)

[0277] To a solution of 1,2-O-isopropylidene-D-ribofuranose (8.00 g, 41.2 mmol) in THF (240 mL) was added sodium hydride (60% dispersion in mineral oil, 5.77 g, 144 mmol) and the mixture was allowed to stir at rt for 10 min. Benzyl bromide (32.5 mL, 268 mmol) was then added and the reaction was stirred at rt for 10 min then at 65 °C for 8h. TLC showed complete consumption of starting material. The reaction was then quenched with saturated aqueous ammonium chloride and extracted with ethyl acetate (x3). The organic layers were further washed with brine, then dried over sodium sulfate and concentrated in vacuo. The crude product was purified by silica gel column chromatography (5 – 65% ethyl acetate in hexanes) to give compound 2 (15.0 g, 98% yield) as a pale-yellow oil. Calculated mass for C22H26O5= 370.18; found = 388.3 (M+NH4)+.

[0278] 1H NMR (400 MHz, CDCl3): δ 7.37 – 7.23 (m, 10H), 5.75 (d, J = 3.7 Hz, 1H), 4.73, 4.18 (ddd, J = 9.1, 3.8, 2.1 Hz, 1H), 3.86 (dd, J = 9.1, 4.4 Hz, 1H), 3.76 (dd, J = 11.2, 2.0 Hz, 1H), 3.56 (dd, J = 11.2, 3.9 Hz, 1H), 1.59 (s, 3H), 1.36 (s, 3H).

[0279] LCMS: CSH C18 AMB (3 min): RT = 1.73 min. Step 2: Reductive acetonide cleavageol (3)

[0280] To a solution of compound 2 (1.00 g, 2.70 mmol) in dry dichloromethane (13 mL) was added triethylsilane (6.97 mL, 43.2 mmol) and the mixture was cooled to -18 °C. Trimethylsilyl trifluoromethanesulfonate (5.92 mL, 32.4 mmol) was then added dropwise and the reaction was stirred at -18 °C for 3h. LCMS showed complete consumption of starting material. The reaction was then quenched with saturated aqueous sodium bicarbonate and 104 IPTS / 128585648.1Attorney Docket No. QRL-022WO extracted with dichloromethane (x2). The organic layers were further washed with brine, then dried over sodium sulfate and concentrated in vacuo. The crude product was purified by silica gel column chromatography (10 – 60% ethyl acetate in heptane) to give compound 3 (665 mg, 78% yield) as a colorless oil. Calculated mass for C19H22O4= 314.15; found = 332.0 (M+NH4)+.

[0281] 1H NMR (400 MHz, CDCl3): δ 7.38 – 7.26 (m, 10H), 4.61 – 4.47 (m, 4H), 4.26 – 4.19 (m, 1H), 4.08 – 4.01 (m, 2H), 3.99 – 3.94 (m, 1H), 3.79 (dd, J = 9.7, 4.0 Hz, 1H), 3.60 (dd, J = 10.5, 3.7 Hz, 1H), 3.51 (dd, J = 10.5, 4.3 Hz, 1H), 2.67 (br s, 1H).

[0282] LCMS: CSH C18 AmF (3 min): RT = 1.42 min. Step 3: Alkylation (2R,3S,4S)(4)

[0283] To a solution of compound 3 (332 mg, 1.06 mmol) in THF (6.64 mL) was added sodium hydride (60% dispersion in mineral oil, 127 mg, 3.17 mmol) at rt and the mixture was stirred for 10 min. The mixture was then cooled to 0 °C and 2-bromoethyl methyl ether (205 µL, 2.11 mmol) was added to the reaction mixture. The reaction mixture was then allowed to raise to rt and monitored by LCMS and TLC. After a while, no reaction was observed, so the reaction mixture was heated at 40 °C and monitored by LCMS. Heating was continued overnight at 40 °C. LCMS at this point (reaction time = 19h) indicated 60% conversion to desired product, with 40% remaining starting material. Temperature was increased to 60 °C and reaction was monitored by LCMS. Impurities are generated after 2h, therefor the reaction was stopped and cooled to rt. The mixture was then quenched with saturated aqueous ammonium chloride and extracted with ethyl acetate (x 2). The organic layers were further washed with brine, then dried over sodium sulfate and concentrated in vacuo. The crude product was purified by reverse-phase column chromatography (10 – 75% acetonitrile in 10 mM aqueous ammonium formate buffer) to give compound 4 (250 mg, 64% yield) as a colorless oil. Calculated mass for C22H28O5 = 372.45; found = 372.9 (M+H)+. Note: 100 mg (30%) of starting material compound 3 was also recovered from the purification. 105 IPTS / 128585648.1Attorney Docket No. QRL-022WO

[0284] 1H NMR (400 MHz, CDCl3): δ 7.36 – 7.27 (m, 10H), 4.61 (app dd, J = 49.3, 11.9 Hz, 2H), 4.54 (app q, J = 12.1 Hz, 2H), 4.15 – 4.09 (m, 1H), 4.06 – 4.00 (m, 2H), 3.95 – 3.89 (m, 2H), 3.70 – 3.59 (m, 3H), 3.59 – 3.55 (m, 2H), 3.51 (dd, J = 10.6, 4.4 Hz, 1H), 3.38 (s, 3H).

[0285] LCMS: CSH C18 AmF (3 min): RT = 1.58 min. Step 4: Hydrogenolysisol (5)

[0286] To a solution of compound 4 (250 mg, 671 µmol) in methanol (1.72 mL) degassed and back-filled with nitrogen (x 3) was added Pd / C (71.4 mg, 67.1 µmol) and the mixture was stirred at rt under a hydrogen atmosphere (balloon) for 16 h. LCMS and TLC showed conversion was incomplete, therefore additional Pd / C (150 mg, 141 µmol) was added and the mixture was stirred under a hydrogen atmosphere overnight. LCMS and TLC showed conversion was now complete, therefore the reaction mixture was purged with nitrogen and filtered through a pad of celite, washing with methanol. The filtrate was concentrated in vacuo to give compound 5 (125 mg, 97% yield). The crude product was used in the following step without further purification.

[0287] 1H NMR (400 MHz, CDCl3): δ 4.12 – 4.01 (m, 2H), 4.01 – 3.92 (m, 1H), 3.89 – 3.76 (m, 4H), 3.73 – 3.62 (m, 2H), 3.62 – 3.49 (m, 2H), 3.49 – 3.40 (m, 2H), 3.40 – 3.31 (m, 3H). 106 IPTS / 128585648.1Attorney Docket No. QRL-022WO Step 5: DMT-protectionmethoxyethoxy)tetrahydrofuran-3-ol (6)

[0288] To a suspension of compound 5 (125 mg, 650 µmol) and 4Å molecular sieves (17 mg) in lutidine (2.67 mL) and dichloromethane (1.33 mL) was added 4- dimethylaminopyridine (40.1 mg, 325 µmol) followed by a solution of 4,4′-dimethoxytrityl chloride (292 mg, 845 µmol) in dichloromethane (1 mL) at 0 °C. The temperature was allowed to slowly attain rt and the reaction was stirred for 2h. LCMS and TLC showed the reaction was complete, therefore heptane (2 mL) and methanol (2 mL) were added, and the mixture was concentrated in vacuo. The residue was then dissolved in ethyl acetate and washed with saturated aqueous copper sulfate (x2) followed by brine, then dried over sodium sulfate and concentrated in vacuo. The crude residue was purified by silica gel column chromatography (0-20% Acetone (in solution with 30% MeOH) in heptane) to give compound 6 (160 mg, 48 % yield) as a pale-yellow oil. Calculated mass for C29H34O7 = 494.58; found = 516.7 (M+Na)+.

[0289] 1H NMR (400 MHz,CDCl3): δ 7.46 – 7.43 (m, 2H), 7.36 – 7.31 (m, 4H), 7.30 – 7.27 (m, 2H), 7.22 – 7.16 (m, 1H), 6.84 – 6.80 (m, 4H), 4.18 – 4.12 (m, 1H), 4.11 – 4.06 (m, 2H), 4.00 – 3.95 (m, 1H), 3.88 – 3.81 (m, 2H), 3.79 (s, 6H), 3.71 – 3.64 (m, 1H), 3.62 – 3.56 (m, 1H), 3.55 – 3.49 (m, 1H), 3.40 (s, 3H), 3.33 – 3.27 (m, 2H), 3.10 (dd, J = 10.1, 4.7 Hz, 1H).

[0290] LCMS: CSH C18 AmF (3 min): RT = 1.68 min. INCORPORATION BY REFERENCE

[0291] All publications and patents mentioned herein are hereby incorporated by reference in their entirety for all purposes as if each individual publication or patent was specifically and individually incorporated by reference. In case of conflict, the present application, including any definitions herein, will control. 107 IPTS / 128585648.1Attorney Docket No. QRL-022WO EQUIVALENTS

[0292] While specific embodiments of the subject disclosure have been discussed, the above specification is illustrative and not restrictive. Many variations of the present disclosure will become apparent to those skilled in the art upon review of this specification. The full scope of the disclosure should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

[0293] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments described herein. Such equivalents are intended to be within the scope of the following claims. 108 IPTS / 128585648.1

Claims

Attorney Docket No. QRL-022WO CLAIMS What is claimed is:

1. A process for preparing a compound of Formula (A): comprising:protecting a compound of Formula (I): (I), thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

2. The process of claim 1, wherein the process further comprises: reductively cleaving a compound of Formula (II): , IPTS / 128585648.1Attorney Docket No. QRL-022WO thereby producing a compound of Formula (III): , wherein each of R2and R3is3. The process of claim 1 or 2, wherein the process further comprises: alkylating a compound of Formula (III): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

4. The process of any one of claims 1-3, wherein the process further comprises: deprotecting a compound of Formula (IV): , thereby producing a110 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein R1is –Me, –Et,– 5. The process of any one of claims 1-4, wherein the process further comprises: protecting a compound of Formula (V): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

6. The process of any one of claims 1-5, wherein the process further comprises: installing a phosphoramidite group on a compound of Formula (VI): , thereby producing111 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein 1R is –Me, –Et, or – 7. A process for preparing a compound of Formula (A): comprising:reductively cleaving a compound of Formula (II): , thereby producing a, wherein112 IPTS / 128585648.1Attorney Docket No. QRL-022WO R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6alkyl.

8. The process of claim 7, wherein the process further comprises: alkylating a compound of Formula (III): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

9. The process of claim 7 or 8, wherein the process further comprises: deprotecting a compound of Formula (IV): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

10. The process of any one of claims 7-9, wherein the process further comprises: protecting a compound of Formula (V): 113 IPTS / 128585648.1Attorney Docket No. QRL-022WO ,or – 11. The process of any one of claims 7-10, wherein the process further comprises: installing a phosphoramidite group on a compound of Formula (VI): , thereby producing, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3. 114 IPTS / 128585648.1Attorney Docket No. QRL-022WO 12. The process of any one of claims 7-11, wherein the process further comprises: protecting a compound of Formula (I): (I), thereby producing a :, wherein 1R is –Me, –Et, or – each of R2and R3is independently H or C1-C6 alkyl.

13. A process for preparing a compound of Formula (A): comprising:alkylating a compound of Formula (III): , thereby producing a115 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein R1is –Me, –Et,– 14. The process of claim 13, wherein the process further comprises: deprotecting a compound of Formula (IV): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

15. The process of claim 13 or 14, wherein the process further comprises: protecting a compound of Formula (V): , thereby producing a, IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

16. The process of any one of claims 13-15, wherein the process further comprises: installing a phosphoramidite group on a compound of Formula (VI): , thereby producing, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

17. The process of any one of claims 13-16, wherein the process further comprises: protecting a compound of Formula (I): , thereby producing a, IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

18. The process of any one of claims 13-17, wherein the process further comprises: reductively cleaving a compound of Formula (II): , thereby :, whereineach of R2and R3is independently H or C1-C6alkyl.

19. A process for preparing a compound of Formula (A): comprising:deprotecting a compound of Formula (IV): 118 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing a, wherein 1R is –Me, –Et, or – 20. The process of claim 19, wherein the process further comprises: protecting a compound of Formula (V): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

21. The process of claim 19 or 20, wherein the process further comprises: installing a phosphoramidite group on a compound of Formula (VI): 119 IPTS / 128585648.1Attorney Docket No. QRL-022WO , thereby producing, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

22. The process of any one of claims 19-21, wherein the process further comprises: protecting a compound of Formula (I): , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

23. The process of any one of claims 19-22, wherein the process further comprises: 120 IPTS / 128585648.1Attorney Docket No. QRL-022WO reductively cleaving a compound of Formula (II): , thereby :, whereineach of R2and R3is independently H or C1-C6 alkyl.

24. The process of any one of claims 19-23, wherein the process further comprises: alkylating a compound of Formula (III): , thereby: , whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

25. A process for preparing a compound of Formula (A): 121 IPTS / 128585648.1Attorney Docket No. QRL-022WO comprising:protecting a : , thereby producing a, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

26. The process of claim 25, wherein the process further comprises: installing a phosphoramidite group on a compound of Formula (VI): , thereby producing122 IPTS / 128585648.1Attorney Docket No. QRL-022WO .

27. The process of claimcomprises: protecting a compound of Formula (I): ,R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl.

28. The process of any one of claims 25-27, wherein the process further comprises: reductively cleaving a compound of Formula (II): , thereby: 123 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein each of R2and R3is29. The process of any one of claims 25-28, wherein the process further comprises: alkylating a compound of Formula (III): , thereby :, whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

30. The process of any one of claims 25-29, wherein the process further comprises: deprotecting a compound of Formula (IV): , thereby: (V), IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

31. A process for preparing a compound of Formula (A): comprising:installing a phosphoramidite group on a compound of Formula (VI): , thereby producingwherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

32. The process of claim 31, wherein the process further comprises: protecting a compound of Formula (I): , thereby producing a125 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein R1is –Me, –Et,– each of R2and R3is independently H or C1-C6 alkyl.

33. The process of claim 31 or 32, wherein the process further comprises: reductively cleaving a compound of Formula (II): , thereby :, whereineach of R2and R3is independently H or C1-C6 alkyl.

34. The process of any one of claims 31-33, wherein the process further comprises: alkylating a compound of Formula (III): , thereby: 126 IPTS / 128585648.1Attorney Docket No. QRL-022WO , wherein R1is –Me, –Et,– 35. The process of any one of claims 31-34, wherein the process further comprises: deprotecting a compound of Formula (IV): , thereby :(V), whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

36. The process of any one of claims 31-35, wherein the process further comprises: protecting a compound of Formula (V): (V), thereby producing(VI): , IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

37. A process for preparing a compound of Formula (A): comprising:protecting a compound of Formula (I): , thereby producing a, reductively cleavingproducing a compound of Formula (III): , alkylating thea compound of Formula (IV): 128 IPTS / 128585648.1Attorney Docket No. QRL-022WO , deprotecting the producing a compound of Formula (V):, protecting a compound of a compound of Formula(VI): , installing aFormula (VI), thereby producing the compound of Formula (A), wherein R1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3; and each of R2and R3is independently H or C1-C6 alkyl 38. A process for preparing a splice-switching oligonucleotide comprising one or more spacers, comprising any one of the processes of claims 1-22.

39. A process for preparing a splice-switching oligonucleotide comprising one or more spacers of Formula (B): , comprising any one of the129 IPTS / 128585648.1Attorney Docket No. QRL-022WO wherein each of symbol represents the point of connection to an internucleoside linkage.

40. The process of any one of claims 1-39, wherein protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with a first base.

41. The process of claim 40, wherein the first base is an inorganic base.

42. The process of claim 40, wherein the first base is a hydride base.

43. The process of claim 40, wherein the first base is NaH.

44. The process of any one of claims 1-43, wherein protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with Bn-X1, wherein X1is a leaving group.

45. The process of claim 44, wherein X1is halo.

46. The process of claim 44, wherein X1is –Cl, –Br, or –I.

47. The process of claim 44, wherein X1is –Br.

48. The process of any one of claims 1-47 wherein protecting a compound of Formula (I) comprises contacting the compound of Formula (I) with a first solvent.

49. The process of claim 48, wherein the first solvent is a polar solvent.

50. The process of claim 48, wherein the first solvent is tetrahydrofuran (THF).

51. The process of any one of claims 1-49 wherein protecting a compound of Formula (I) comprises elevating reaction temperature to reflux.

52. The process of any one of claims 1-49, wherein protecting a compound of Formula (I) comprises elevating reaction temperature to about 65 °C.

53. The process of any one of claims 1-52, wherein reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with an activating agent.

54. The process of claim 53, wherein the activating agent comprises a trialkylsilyl cation. 130 IPTS / 128585648.1Attorney Docket No. QRL-022WO 55. The process of claim 53, wherein the activating agent comprises a trimethylsilyl cation.

56. The process of claim 53, wherein the activating agent is trimethylsilyl trifluoromethanesulfonate (TMSOTf).

57. The process of any one of claims 1-56, wherein reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with a reducing agent.

58. The process of claim 57, wherein the reducing agent is an organosilyl reducing agent.

59. The process of claim 57, wherein the reducing agent is a trialkylsilane.

60. The process of claim 57, wherein the reducing agent is triethylsilane.

61. The process of any one of claims 1-60, wherein reductively cleaving a compound of Formula (II) comprises contacting the compound of Formula (II) with a second solvent.

62. The process of claim 61, wherein the second solvent is a halogenated solvent.

63. The process of claim 61, wherein the second solvent is dichloromethane (DCM) or dichloroethane (DCE).

64. The process of claim 61, wherein the second solvent is dichloromethane (DCM).

65. The process of any one of claims 1-64, wherein reductively cleaving a compound of Formula (II) comprises lowering reaction temperature below about 0 °C.

66. The process of any one of claims 1-64, wherein reductively cleaving a compound of Formula (II) comprises lowering reaction temperature to about -18 °C.

67. The process of any one of claims 1-66, wherein alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with a second base.

68. The process of claim 67, wherein the second base is an inorganic base.

69. The process of claim 67, wherein the second base is a hydride base.

70. The process of claim 67, wherein the second base is NaH. 131 IPTS / 128585648.1Attorney Docket No. QRL-022WO 71. The process of any one of claims 1-70, wherein alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with an alkylating agent.

72. The process of claim 71, wherein the alkylating agent is R1–X2, wherein X2is a leaving group.

73. The process of claim 71, wherein X2is halo.

74. The process of claim 71, wherein X2is –Cl, –Br, or –I.

75. The process of claim 71, wherein X2is –Br.

76. The process of claim 71, wherein X2is –I.

77. The process of any one of claims 1-76, wherein alkylating a compound of Formula (III) comprises contacting the compound of Formula (III) with a third solvent.

78. The process of claim 77, wherein the third solvent is a polar solvent.

79. The process of claim 77, wherein the third solvent is tetrahydrofuran (THF).

80. The process of any one of claims 1-79, wherein alkylating a compound of Formula (III) comprises lowering reaction temperature below about 10 °C.

81. The process of any one of claims 1-79, wherein alkylating a compound of Formula (III) comprises lowering reaction temperature to about -10 °C to about 10 °C.

82. The process of any one of claims 1-79, wherein alkylating a compound of Formula (III) comprises lowering reaction temperature to about 0 °C.

83. The process of any one of claims 1-82, wherein deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with a first catalyst.

84. The process of claim 83, wherein the first catalyst is a palladium catalyst.

85. The process of claim 83, wherein the first catalyst is a palladium (0) catalyst.

86. The process of claim 83, wherein the first catalyst is a palladium on carbon. 132 IPTS / 128585648.1Attorney Docket No. QRL-022WO 87. The process of claim 83, wherein the first catalyst is about 5% by weight palladium on carbon.

88. The process of claim 83, wherein the first catalyst is about 10% by weight palladium on carbon.

89. The process of claim 83, wherein deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with about 30 mol% of the first catalyst.

90. The process of any one of claims 1-89, wherein deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas.

91. The process of claim 90, wherein deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with hydrogen gas at atmospheric pressure.

92. The process of any one of claims 1-91, wherein deprotecting a compound of Formula (IV) comprises contacting the compound of Formula (IV) with a fourth solvent.

93. The process of claim 92, wherein the fourth solvent is a protic solvent.

94. The process of claim 92, wherein the fourth solvent is methanol or ethanol.

95. The process of claim 92, wherein the fourth solvent is methanol.

96. The process of any one of claims 1-95, wherein deprotecting a compound of Formula (IV) comprises reaction temperature of about 23 °C.

97. The process of any one of claims 1-96, wherein protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a third base.

98. The process of claim 97, wherein the third base is an organic base.

99. The process of claim 97, wherein the third base is an amine base.

100. The process of claim 97, wherein the third base is triethylamine (TEA), N,N- diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine. 133 IPTS / 128585648.1Attorney Docket No. QRL-022WO 101. The process of claim 97, wherein the third base is pyridine, dialkylpyridine, or trialkylpyridine.

102. The process of claim 97, wherein the third base is pyridine, 2,6-dimethylpyridine (lutidine), 2,4,6-trimethylpyridine, 2,6-di-isopropylpyridine, or 2,6-di-tert-butylpyridine.

103. The process of claim 97, wherein the third base is 2,6-dimethylpyridine (lutidine).

104. The process of any one of claims 1-103, wherein protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a second catalyst.

105. The process of claim 104, wherein the second catalyst is an organic catalyst.

106. The process of claim 104, wherein the second catalyst is an amine catalyst.

107. The process of claim 104, wherein the second catalyst is 4-dimethylaminopyridine (DMAP).

108. The process of claim 104, wherein protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with about 50 mol% of the second catalyst.

109. The process of any one of claims 1-108, wherein protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with DMT-X3, wherein X3is a leaving group.

110. The process of claim 109, wherein X3is halo.

111. The process of claim 109, wherein X3is –Cl, –Br, or –I.

112. The process of claim 109, wherein X3is –Cl.

113. The process of any one of claims 1-112, wherein protecting a compound of Formula (V) comprises lowering reaction temperature below about 10 °C.

114. The process of any one of claims 1-112, wherein protecting a compound of Formula (V) comprises lowering reaction temperature to about -10 °C to about 10 °C.

115. The process of any one of claims 1-112, wherein protecting a compound of Formula (V) comprises lowering reaction temperature to about 0 °C. 134 IPTS / 128585648.1Attorney Docket No. QRL-022WO 116. The process of any one of claims 1-115, wherein protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a third base.

117. The process of claim 116, wherein the third base is an organic base.

118. The process of claim 116, wherein the third base is an amine base.

119. The process of claim 116, wherein the third base is triethylamine (TEA), N,N- diisopropylethylamine (DIPEA), pyridine, dialkylpyridine, or trialkylpyridine.

120. The process of claim 116, wherein the third base is pyridine, dialkylpyridine, or trialkylpyridine.

121. The process of claim 116, wherein the third base is pyridine, 2,6-dimethylpyridine (lutidine), 2,4,6-trimethylpyridine, 2,6-di-isopropylpyridine, or 2,6-di-tert-butylpyridine.

122. The process of claim 116, wherein the third base is 2,6-dimethylpyridine (lutidine).

123. The process of any one of claims 1-122, wherein protecting a compound of Formula (V) comprises contacting the compound of Formula (V) with a second catalyst.

124. The process of claim 123, wherein the second catalyst is an organic catalyst.

125. The process of claim 123, wherein the second catalyst is an amine catalyst.

126. The process of claim 123, wherein the second catalyst is 4-dimethylaminopyridine (DMAP).

127. The process of claim 123, wherein deprotecting a compound of Formula (V) comprises contacting the compound of Formula (V) with about 50 mol% of the second catalyst.

128. The process of any one of claims 1-127, wherein installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a fourth base.

129. The process of claim 128, wherein the fourth base is an organic base.

130. The process of claim 128, wherein the fourth base is an amine base. 135 IPTS / 128585648.1Attorney Docket No. QRL-022WO 131. The process of claim 128, wherein the fourth base is triethylamine (TEA) or N,N- diisopropylethylamine (DIPEA).

132. The process of claim 128, wherein the fourth base is N,N-diisopropylethylamine (DIPEA).

133. The process of any one of claims 1-132, wherein installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a phosphoramidite reagent.

134. The process of claim 133, wherein the phosphoramidite reagent is , wherein X5is a leaving group.of claim 134, wherein X5is halo.

136. The process of claim 134, wherein X5is –Cl, –Br, or –I.

137. The process of claim 134, wherein X5is –Cl.

138. The process of claim 133, wherein the phosphoramidite reagent is 2-cyanoethyl N,N- diisopropylchlorophosphoramidite.

139. The process of any one of claims 1-138, wherein installing a phosphoramidite group on a compound of Formula (VI) comprises contacting the compound of Formula (VI) with a fifth solvent.

140. The process of claim 139, wherein the fifth solvent is a halogenated solvent.

141. The process of claim 139, wherein the fifth solvent is dichloromethane (DCM) or dichloroethane (DCE).

142. The process of claim 139, wherein the fifth solvent is dichloromethane (DCM).

143. The process of any one of claims 1-142, wherein installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature lowering reaction temperature below about 10 °C. 136 IPTS / 128585648.1Attorney Docket No. QRL-022WO 144. The process of any one of claims 1-142, wherein installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature to about -10 °C to about 10 °C 145. The process of any one of claims 1-142, wherein installing a phosphoramidite group on a compound of Formula (VI) comprises lowering reaction temperature to about 0 °C.

146. The process of any one of claims 1-145, wherein R1is –Me.

147. The process of any one of claims 1-145, wherein R1is –Et.

148. The process of any one of claims 1-145, wherein R1is –CH2OCH3.

149. The process of any one of claims 1-145, wherein R1is –(CH2)2OCH3.

150. The process of any one of claims 1-149, wherein R2is H or C1-C3 alkyl.

151. The process of any one of claims 1-150, wherein R2is H, –Me, –Et, or –nPr.

152. The process of any one of claims 1-151, wherein R2is –Me.

153. The process of any one of claims 1-152, wherein R3is H or C1-C3alkyl.

154. The process of any one of claims 1-153, wherein R3is H, –Me, –Et, or –nPr.

155. The process of any one of claims 1-154, wherein R3is –Me.

156. A compound of Formula (A): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3. 137 IPTS / 128585648.1Attorney Docket No. QRL-022WO 157. A compound of Formula (IV): wherein 1R is –Me, –Et, or – 158. A compound of Formula (V): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

159. A compound of Formula (VI): whereinR1is –Me, –Et, –CH2OCH3, or –(CH2)2OCH3.

160. The compound of any one of claims 156-159, wherein R1is –Me.

161. The compound of any one of claims 156-159, wherein R1is –Et.

162. The compound of any one of claims 156-159, wherein R1is –CH2OCH3.

163. The compound of any one of claims 156-159, wherein R1is –(CH2)2OCH3. 138 IPTS / 128585648.1

Images