Method for producing purified dichloroacetic acid
By purifying dichloroacetic acid to controlled molar ratios of formaldehyde and anhydride using distillation and arylalkylamines, the method addresses inefficient nucleic acid synthesis, enhancing yield and efficiency.
Patent Information
- Application Number
- JP2023551520
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-09-28
- Filing Date
- 2022-09-27
- Publication Date
- 2026-06-22
- Estimated Expiration
- 2042-09-27
AI Technical Summary
The yield of nucleic acid molecules synthesized using conventional dichloroacetic acid solutions is unsatisfactory due to impurities such as formaldehyde and dichloroacetic anhydride, leading to inefficient synthesis.
A method for producing purified dichloroacetic acid by controlling the molar ratios of formaldehyde and dichloroacetic anhydride to below specific levels, involving distillation with aliphatic alcohols, amines, or water, and using aprotic inert solvents to reduce impurities, followed by analysis with arylalkylamines to convert anhydride to amides for HPLC detection.
The method enhances the yield of nucleic acid molecules by reducing impurities, thereby improving the efficiency of nucleic acid synthesis.
Smart Images

Figure 0007877340000034 
Figure 0007877340000001 
Figure 0007877340000002
Abstract
Description
[Technical Field]
[0001] This application claims priority and benefits thereof to Japanese Patent Application No. 2021-158346, filed on 28 September 2021, the entire contents of which are incorporated herein by reference. The present invention relates to a method for producing purified dichloroacetic acid, a method for analyzing the same, and a method for synthesizing nucleic acid molecules using the amidite method with purified dichloroacetic acid. [Background technology]
[0002] In recent years, there has been growing interest in the medical applications of nucleic acid molecules. Examples include antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are collectively known as nucleic acid drugs.
[0003] Nucleic acid molecules can be synthesized by solid-phase synthesis. In this method, nucleic acid molecules are synthesized by extending nucleic acids on a solid support, then cleaved from the support, and in the case of nucleic acid molecules containing ribose, the protecting group at the 2' position of the hydroxyl group of ribose is deprotected and removed to produce the desired nucleic acid molecule. In solid-phase synthesis, phosphoramidites of nucleosides (hereinafter referred to as "amidites") are used as raw materials, and it is known that the protecting group at the 5' position is deprotected using a dichloroacetic acid solution. However, the yield of nucleic acid molecules synthesized using a dichloroacetic acid solution is not always satisfactory, and the synthesis was not efficient (Patent Document 1). [Prior art documents] [Patent Documents]
[0004] [Patent Document 1] International Publication No. 99 / 43694 [Overview of the Initiative] [Problems that the invention aims to solve]
[0005] The present invention aims to provide an efficient method for producing nucleic acid molecules. [Means for solving the problem]
[0006] As a result of diligent research to achieve the above objective, the present inventors provide an efficient method for producing nucleic acid molecules using a purified dichloroacetic acid solution with a formaldehyde and dichloroacetic acid anhydride content below a certain level when synthesizing nucleic acid molecules, or a method for analyzing the dichloroacetic acid after improving its quality.
[0007] The present invention includes, but is not limited to, the following embodiments. 1. The molar ratio of formaldehyde to dichloroacetic acid is 81 × 10⁻⁶. ―5 The following conditions apply, and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10 ―5 A method for producing purified dichloroacetic acid, the following: Dichloroacetic acid in which the content of both or one of formaldehyde and dichloroacetic anhydride exceeds the aforementioned ratio, A method for producing purified dichloroacetic acid (hereinafter referred to as the present invention's purification method), comprising contacting a compound having a lower boiling point than dichloroacetic acid with at least one compound selected from the group consisting of aliphatic alcohols, aliphatic amines, and water, and then distilling off the fraction containing the solvent from the resulting mixture in the presence of an aprotic inert solvent having a lower boiling point than dichloroacetic acid. 2. The manufacturing method according to paragraph 1, wherein the aprotic inert solvent is an aprotic inert solvent having a boiling point of 181°C or lower. 3. The production method according to item 1 or 2 above, wherein the aprotic inert solvent is dichloromethane, acetonitrile, or an aromatic organic solvent. 4. The manufacturing method described in item 3 above, wherein the aromatic organic solvent is toluene. 5. The manufacturing method according to any one of paragraphs 1 to 4 above, wherein the aliphatic alcohol is a C1-C6 aliphatic alcohol. 6. The purified dichloroacetic acid has a molar ratio of formaldehyde to dichloroacetic acid of 41 × 10⁻⁶.―5 The production method according to any one of items 1 to 5 of the preceding paragraph, as follows. 7. The purified dichloroacetic acid has a molar ratio of dichloroacetic anhydride to dichloroacetic acid of 10×10 ―5 The production method according to any one of items 1 to 6 of the preceding paragraph, as follows. 8. The purified dichloroacetic acid has a molar ratio of formaldehyde to dichloroacetic acid of 81×10 ―6 The production method according to any one of items 1 to 7 of the preceding paragraph, as follows. 9. The purified dichloroacetic acid has a molar ratio of dichloroacetic anhydride to dichloroacetic acid of 50×10 ―6 The production method according to any one of items 1 to 8 of the preceding paragraph, as follows. 10. A method for producing a nucleic acid molecule by the amidite method, wherein the molar ratio of formaldehyde to dichloroacetic acid is 81×10 ―5 as follows, and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20×10 ―5 A step of preparing purified dichloroacetic acid as follows, and a step of reacting the purified dichloroacetic acid with a nucleic acid molecule having a protected hydroxyl group at the 5'-end to remove the protecting group of the hydroxyl group, a method for producing a nucleic acid molecule. 11. The production method according to item 10 above, wherein the preparation step is the method according to any one of items 1 to 9 of the preceding paragraph. 12. The nucleic acid molecule having a protected hydroxyl group at the 5'-end has the formula (1):
Chemical formula
[0008] This invention provides a method for producing purified dichloroacetic acid and an efficient method for producing nucleic acid molecules using the same. The production method of this invention is expected to improve the yield of the nucleic acid molecules produced. [Brief explanation of the drawing]
[0009] [Figure 1]Figure 1 shows scheme A, a typical example of producing a nucleic acid molecule represented by formula (5) from a nucleic acid molecule represented by formula (1). In the figure, G1 can be used without particular limitation as long as it can function as a protecting group for the hydroxyl group removed by dichloroacetic acid, and a wide range of known protecting groups used in amidite compounds can be used. Also, G3 independently represents an alkyl group, either the same or different in nature, or two G3s may be bonded to each other to form a cyclic structure. Preferably, G3 independently represents an alkyl group, such as a methyl group, an ethyl group, a propyl group, or an isopropyl group, and more preferably both are isopropyl groups. Other symbols are as described above. [Modes for carrying out the invention]
[0010] The molar ratio of formaldehyde to dichloroacetic acid is 81 × 10⁻⁶. ―5 The following conditions apply, and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10 ―5 The following describes a method for producing purified dichloroacetic acid.
[0011] Examples of dichloroacetic acid used in the above-mentioned method for producing purified dichloroacetic acid that exceeds the aforementioned ratio include commercially available dichloroacetic acid reagents or those produced by known methods. The amounts of formaldehyde and dichloroacetic acid anhydride contained in these dichloroacetic acid reagents can be analyzed and used.
[0012] The dichloroacetic acid used in the purification of the present invention is 1) a formaldehyde molar ratio of 81 × 10⁻¹⁰ dichloroacetic acid. ―5 The molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10 ―5 1) Dichloroacetic acid exceeding 2) The molar ratio of formaldehyde to dichloroacetic acid is 81 × 10 ―5 The following conditions apply, and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10 ―53) Dichloroacetic acid exceeding 81 × 10⁻¹⁰, 3) Molar ratio of formaldehyde to dichloroacetic acid is 81 × 10⁻¹⁰ ―5 The molar ratio of dichloroacetic anhydride to dichloroacetic acid exceeds 20 × 10 ―5 The following are examples of dichloroacetic acid. According to the purification method of the present invention, these dichloroacetic acids can be purified to reduce the content of formaldehyde and dichloroacetic anhydride to a range of desired ratios according to the purification method of the present invention.
[0013] The purification method of the present invention may involve adding at least one compound selected from the group consisting of aliphatic alcohols, aliphatic amines, and water, which has a lower boiling point than dichloroacetic acid, to dichloroacetic acid in which the content of both or one of formaldehyde and dichloroacetic acid anhydride exceeds the aforementioned ratio, and then adding an aprotic inert solvent having a lower boiling point than dichloroacetic acid; or, an aprotic inert solvent having a lower boiling point than dichloroacetic acid may be added to the dichloroacetic acid reagent to be produced beforehand, and then at least one compound selected from the group consisting of aliphatic alcohols, aliphatic amines, and water, which has a lower boiling point than dichloroacetic acid, may be added.
[0014] Examples of aliphatic alcohols and aliphatic amines having lower boiling points than dichloroacetic acid include C1-C6 aliphatic alcohols and C1-C6 aliphatic amine compounds. Examples of C1-C6 aliphatic alcohols include methanol, ethanol, n-propanol, i-propanol, n-butanol, i-butanol, sec-butanol, t-butanol, n-pentanol, and n-hexanol. Examples of aliphatic amines having lower boiling points than dichloroacetic acid include C1-C6 aliphatic amine compounds. Specifically, examples include methylamine, ethylamine, propylamine, butylamine, pentylamine, and hexylamine.
[0015] The amounts used for the aliphatic alcohol, the aliphatic amine, and water or mixtures thereof are not particularly limited, as long as they are effective in reducing the dichloroacetic anhydride to the desired range. The amount of dichloroacetic anhydride can be analyzed by the following analytical method for dichloroacetic anhydride contained in the dichloroacetic acid reagent, and an effective amount can be determined.
[0016] Examples of aprotic inert solvents having a lower boiling point than dichloroacetic acid include aprotic inert solvents with a boiling point of 181°C or lower. Specifically, examples include aromatic organic solvents (e.g., toluene, xylene, monochlorobenzene, and o-dichlorobenzene), acetonitrile, and dichloromethane. The amount of such solvent used is not particularly limited, but is typically about 0.5 to 20 times the weight of dichloroacetic acid.
[0017] The bath temperature during distillation is usually between 20°C and 120°C, and can be under atmospheric pressure or reduced pressure. Distillation of the low-boiling point components, mainly the solvent, does not require the complete removal of the solvent; partial removal is sufficient. Distillation is typically carried out in an amount of 50% to 75% of the solvent added and used. In this way, a purified dichloroacetic acid solution with the desired amounts of dichloroacetic anhydride and formaldehyde is obtained.
[0018] In nucleic acid molecule synthesis using the amidite method, the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 10 × 10⁻¹⁰ ―5 The following is preferable, where the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 50 × 10 ―6 The following are more preferable. As purified dichloroacetic acid, the molar ratio of formaldehyde to dichloroacetic acid is 41 × 10⁻⁶. ―5 The following is preferable, where the molar ratio of formaldehyde to dichloroacetic acid is 81 × 10⁻⁶. ―6 The following are preferable.
[0019] This document describes the analytical method for dichloroacetic anhydride contained in dichloroacetic acid reagent. The aforementioned analytical method is carried out by reacting a predetermined amount of a dichloroacetic acid reagent containing dichloroacetic anhydride with an arylalkylamine in an inert solvent, converting the dichloroacetic anhydride to the corresponding 2,2-dichloro-N-arylalkylacetamide, and then analyzing the resulting amide by high-performance liquid chromatography (HPLC).
[0020] Examples of arylalkylamines include the compound of formula (I), and examples of the resulting 2,2-dichloro-N-arylalkylacetamide include the compound of formula (II).
[0021] In equations (I) and (II), R 10 , R 20 , R 30 or X 10 C1-C6 alkyl groups are preferred as the alkyl group in this case, and methyl groups are more preferred. 10 In this case, a C1-C6 alkoxy group is preferred, and a methoxy group is more preferred. 10 , R 20 , R 30 or X 10 Preferably, is a hydrogen atom and n=1. Benzylamine is preferred as the arylalkylamine.
[0022] The amount of arylalkylamine used is typically 0.01 to 3.0 moles, preferably 0.05 to 2.0 moles, and more preferably 0.08 to 1.1 moles, per mole of dichloroacetic acid.
[0023] The reaction of dichloroacetic acid reagents containing dichloroacetic anhydride with arylalkylamines is typically carried out using acetonitrile as the solvent.
[0024] HPLC analysis of 2,2-dichloro-N-arylalkylacetamide is typically performed using an ODS column. For example, a gradient is used with formic acid aqueous solution as mobile phase A and acetonitrile as mobile phase B. The UV detection wavelength is typically 254 nm.
[0025] Next, a method for producing nucleic acid molecules by the amidite method, wherein the molar ratio of formaldehyde to dichloroacetic acid is 81 × 10⁻⁶. ―5 The following conditions apply, and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20 × 10 ―5 The following describes a method for producing nucleic acid molecules, which includes the steps of preparing purified dichloroacetic acid and reacting the purified dichloroacetic acid with a nucleic acid molecule in which the hydroxyl group at the 5' end is protected to remove the protecting group.
[0026] The purified dichloroacetic acid used is prepared by the process described above. If it can be obtained by methods other than those described above, it may be selected from among them.
[0027] The following G groups are used as protecting groups for the hydroxyl group at the 5' position of nucleic acid molecules. 5 Examples of groups represented by are shown. An example of a nucleic acid compound in which the hydroxyl group at the 5' position is protected is the nucleic acid compound of formula (1) above. An example of a nucleic acid compound produced by reacting the purified dichloroacetic acid solution is the nucleic acid compound shown in formula (2) above. In formulas (1) and (2) above, the compounds that represent Q', which are independently identical or distinct, a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose, specifically include the structures shown in formula (7) as LNA-1, LNA-2, or LNA-3.
[0028] [ka] (In the formula, B a (This represents a nucleic acid base that may be protected.)
[0029] A more specific example of a group having a structure represented by Z, consisting of a solid support and a linking group that connects the solid support to the oxygen atom of the hydroxyl group at the 2' or 3' position of the ribose at the 3' end of the nucleic acid molecule, is the structure shown in formula (8) below. [ka] In equation (8), Sp represents a spacer. Examples of spacers (Sp) include those having the structural formula shown in equation (9) below.
[0030] [ka]
[0031] The Linker may have, for example, the structure shown in formula (10) below, or a structure in formula (10) that does not have a hexamethyleneamino group portion, but in which the aminopropyl group is bonded to Si. Alternatively, the Linker may have the structure shown in formula (11) below. [ka] (In the formula, A may be a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include methoxy and ethoxy groups. Examples of alkyl groups include methyl, ethyl, isopropyl, and n-propyl groups. (Si indicates bonding to the oxygen of the hydroxyl group on the support surface.) Examples of solid supports include inorganic porous supports and organic resin supports. An example of an inorganic porous support is controlled porous glass (CPG). An example of an organic resin support is a support made of polystyrene.
[0032] Examples of nucleosides (ribose and deoxyribose) contained within nucleic acid molecules used in the present invention include DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the aforementioned LNA, but the nucleosides are not limited to these.
[0033] A method for synthesizing nucleic acid molecules by solid-phase synthesis, which includes the deprotection step with the purified dichloroacetic acid solution described above, typically comprises the following steps: (1) A step of deprotecting the hydroxyl group at the 5' position of a nucleoside that is bonded to a solid support via a linker, (2) A step of obtaining a phosphite triester compound by coupling the hydroxyl group at the 5' position generated in the above step with a phosphoramidite compound. (3) A step of producing an extended nucleic acid molecule by oxidizing the phosphite triester produced in the above step to convert it to phosphate triester, or any step of converting it to thiophosphate triester, (4) A step of synthesizing nucleic acid molecules on a solid support by repeating a series of reaction cycles consisting of steps (1) to (3) above, namely, a step of deprotecting the hydroxyl group at the 5' position of the generated nucleic acid molecule, a step of coupling the hydroxyl group at the 5' position with an amidite compound, and a step of oxidizing the generated phosphite triester, any number of times, and (5) A step to produce nucleic acid molecules from which the protecting group has been removed, by subjecting the nucleic acid molecules on the solid support generated in step (4) to a cleavage and deprotection step to release them from the solid support. However, the method for synthesizing nucleic acid molecules may include a step of capping the hydroxyl group at the 5' position in which the coupling reaction with the phosphoramidite compound did not proceed, following step (2) or (3), and the capping step may be added in between any of the steps of the series of reaction cycles that constitute step (4).
[0034] The step in (5) is carried out more specifically by subjecting the nucleic acid molecule on the solid support generated in step (4) to the reactions in steps (5-1) and (5-2) in that order, and then to the reaction in step (5-3). Here, the reaction in step (5-1) may be carried out at will, and the reaction in step (5-2) may be carried out using the method described in Japanese Patent Publication No. 4705716. As a result, nucleic acid molecules from which the protecting group has been removed from the nucleic acid molecule released from the solid support, or nucleic acid molecules in which the hydroxyl group at the 5' end is protected can be produced. (5-1) Reaction to deprotect the protecting group of the hydroxyl group at the 5' end of a nucleic acid molecule. (5-2) Reactions that cleave nucleic acid molecules from a solid support and release them, (5-3) A reaction to deprotect the hydroxyl group at the 2' or 3' end of ribose, which constitutes a nucleic acid molecule.
[0035] The scheme of steps (1) to (5) is shown in Figure 1. The deprotection reaction in step (1) or step (4) shown in Figure 1 is carried out using the purified dichloroacetic acid solution. The definitions of substituents in the chemical formula in scheme A are as defined above.
[0036] The nucleic acid compound of formula (1) can be further extended to any desired chain length using a nucleotide-type or non-nucleotide-type linker by the amidite method and used to produce the nucleic acid compound represented by formula (3). Alternatively, the nucleic acid compound can be cleaved from the nucleic acid compound bound to the solid support of formula (3), and then deprotected to obtain the nucleic acid molecule represented by formula (5). The substituents in each formula will be described in more detail below.
[0037] B a nucleic acid bases and B which may be protected by a protecting group shown in . cThe nucleic acid base represented by is not particularly limited. Examples of such nucleic acid bases include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudracil. Furthermore, the nucleic acid base may be substituted with substituents. Examples of such substituents include halogen atoms such as fluoro, chloro, bromo, and iodo groups; acyl groups such as acetyl groups; alkyl groups such as methyl and ethyl groups; arylalkyl groups such as benzyl groups; alkoxy groups such as methoxy groups; alkoxyalkyl groups such as methoxyethyl groups; cyanoalkyl groups such as cyanoethyl groups; hydroxyl groups; hydroxyalkyl groups; acyloxymethyl groups; amino groups; monoalkylamino groups; dialkylamino groups; carboxyl groups; cyano groups; and nitro groups, as well as combinations of two or more substituents thereof.
[0038] B a The protecting groups of nucleic acid bases that may be protected by the protecting groups shown are not particularly limited, and any protecting groups used in known nucleic acid chemistry can be used. Examples of such protecting groups include benzoyl group, 4-methoxybenzoyl group, 4-methylbenzoyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, phenylacetyl group, phenoxyacetyl group, 4-tert-butylphenoxyacetyl group, 4-isopropylphenoxyacetyl group, and (dimethylamino)methylene group, as well as combinations of two or more of these protecting groups.
[0039] B a More specifically, [ka]
[0040] (In the above formula, R 4 This represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group. R 5 This represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group. R 6 This represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group. R 7 This represents a 2-cyanoethyl group, R 8 This represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, and, R 9 (This represents a dimethylaminomethylene group.) It represents a base that can be represented by any of the following.
[0041] B c More specifically, as mentioned above, B a Examples include groups from which the protecting group has been removed.
[0042] G 1 and G 5 Preferably, the following groups: [ka] (In the formula, R 1 , R 2 and R 3 Each of these independently represents a hydrogen atom or an alkoxy group, either identical or distinct.
[0043] R 1 , R 2 and R 3 Preferably, one of the atoms is a hydrogen atom, and the remaining two are identical or different (preferably identical) alkoxy groups, with methoxy groups being particularly preferred as the alkoxy groups. More preferably, G 5 This is a 4,4'-dimethoxytrityl group (DMTr group).
[0044] G 2As such, any protecting group that can function as a hydroxyl group protecting group can be used without particular restriction, and a wide range of known protecting groups used in amidite compounds can be used. 2 Examples of these include alkyl groups, alkenyl groups, alkynyl groups, cycloalkyl groups, haloalkyl groups, aryl groups, heteroaryl groups, arylalkyl groups, cycloalkenyl groups, cycloalkylalkyl groups, cyclylalkyl groups, hydroxyalkyl groups, aminoalkyl groups, alkoxyalkyl groups, heterocyclylalkenyl groups, heterocyclylalkyl groups, heteroarylalkyl groups, silyl groups, silyloxyalkyl groups, mono, di, or trialkylsilyl groups, mono, di, or trialkylsilyloxyalkyl groups, and these may be substituted with one or more electron-withdrawing groups.
[0045] G 2 Preferably, the element is an alkyl group substituted with an electron-withdrawing group. Examples of such electron-withdrawing groups include cyano groups, nitro groups, alkylsulfonyl groups, halogen atoms, arylsulfonyl groups, trihalomethyl groups, and trialkylamino groups, with cyano groups being preferred.
[0046] G 2 The following groups are particularly preferable: [ka]
[0047] The aforementioned R 1 , R 2 , R 3 and G 2In the definition of alkyl groups, the alkyl group may be linear or branched, preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Examples of specific alkyl groups include, for example, methyl group, ethyl group, n-propyl group, isopropyl group, n-butyl group, isobutyl group, tert-butyl group, n-pentyl group, isopentyl group, and hexyl group. The alkyl group portion constituting the alkoxy group in the definition of substituents has the same definition as the alkyl group defined herein.
[0048] Furthermore, in the method of the present invention, the amidite compound can be used in a free state or in a salt state. Examples of salts of the amidite compound include base addition salts and acid addition salts, but are not particularly limited. Examples of base addition salts include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Examples of acid addition salts include mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acid addition salts with acidic amino acids such as aspartic acid and glutamic acid. Amidite compounds also exist in forms such as salts, hydrates, solvates, and crystalline polymorphs.
[0049] R preferably represents a protected hydroxyl group. The protecting group when R represents a protected hydroxyl group, or the protecting group for the hydroxyl group represented by V, may be any that can be used in the amidite method. For example, in addition to the 2'-tert-butyldimethylsilyl (TBS) group, 2'-bis(2-acetoxy)methyl (ACE) group, 2'-(triisopropylsilyloxy)methyl (TOM) group, 2'-(2-cyanoethoxy)ethyl (CEE) group, 2'-(2-cyanoethoxy)methyl (CEM) group, 2'-para-toluenesulfonyl ethoxymethyl (TEM) group, 2'-EMM group (International Publication No. WO2006 / 022323), those described in International Publication No. WO2013 / 027843 and International Publication No. WO2019 / 208571 can be used. V is preferably a 2'-tert-butyldimethylsilyl (TBS) group. Also, when the nucleic acid molecule produced by the method of the present invention is ribonucleic acid (RNA), that is, when ribose is contained in the nucleic acid molecule, the protecting group for the 2'-hydroxyl group of the ribose is preferably exemplified by the protecting group represented by the above formula (6). More preferably, E W Examples of the protecting group represented by formula (12) having a cyano group as an electron-withdrawing group represented by are shown. [Chemical formula] (In the formula, q, R a and R b are synonymous with the definitions in the above formula (6).) [[ID=十六]] [[ID=十七]]More preferably, in the group represented by formula (12), q is 1, and R a and R b are simultaneously hydrogen atoms, and groups where q is 1, and either R a or R b is a methyl group and the other is a hydrogen atom are exemplified.
[0050] The protecting group represented by formula (12) can be synthesized, for example, according to the descriptions in International Publication No. WO2013 / 027843 and International Publication No. WO2019 / 208571, and an amidite compound having such a protecting group can be used in the production of nucleic acid compounds. For the nucleic acid elongation reaction, the amidite compound of formula (13) described in Scheme A of FIG. 1 is used.
[0051] Examples of the non-nucleotide linker include a linker composed of an amino acid skeleton (for example, the linker composed of an amino acid skeleton described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specifically, as non-limiting examples, for example, linkers represented by formula (A14-1) or (A14-2) or (A14-3) (for example, described in International Publication No. 2019 / 074110) are exemplified. In addition to these linkers, linkers described in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008, or International Publication No. 2019 / 074110 are exemplified.
Chemical formula
[0052] Nucleotides and amidites in which the R group in formula (13) and the R' group in formula (5) are substituents other than a hydroxyl group can also be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226 and the like, International Publication No. 2001 / 053528, or Japanese Patent Application Laid-Open No. 2014-221817 and known methods cited therein. Furthermore, using commercially available ones, they can be produced according to the methods described in the examples below or methods with appropriate modifications to these methods.
[0053] G 4This represents a hydrogen atom, alkali metal ion, ammonium ion, alkylammonium ion, or hydroxyalkylammonium ion. Examples of alkali metal ions include sodium ions and lithium ions. Examples of alkylammonium ions include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl groups, but more specifically, diethylammonium ions, triethylammonium ions, tetrabutylammonium ions, hexylammonium ions, and dibutylammonium ions. Examples of hydroxyalkylammonium ions include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl, but more specifically, trishydroxymethylammonium ions. 4 Preferably, represents a hydrogen atom.
[0054] G 5 represents a hydrogen atom or a protecting group for the hydroxyl group, and when representing a protecting group, G is used. 1 G represents the same protecting group. 5 When deprotected, it is a hydrogen atom, and in that case, the nucleotide compound is also subjected to a series of nucleic acid elongation reactions.
[0055] Y is preferably an oxygen atom.
[0056] Preferably, W1 represents an OZ group and X1 represents an R group.
[0057] Preferably, W2 represents a hydroxyl group and X2 represents an R group.
[0058] Preferably, W3 and X3 each independently represent a hydroxyl group.
[0059] R' is preferably a hydroxyl group.
[0060] The synthesis of nucleic acid compounds by the amidite method described in steps (1) to (5) above can be carried out by generally known methods (for example, the methods described in the aforementioned Japanese Patent Publication No. 5157168 or Japanese Patent Publication No. 5554881), except for the deprotection step related to the present invention in step (1) or step (5) in the scheme of Figure 1. Each step will be described below.
[0061] (Nucleic acid elongation reaction) In this specification, "nucleic acid elongation reaction" refers to a reaction in which an oligonucleotide is elongated by sequentially linking nucleotides via phosphodiester bonds. The nucleic acid elongation reaction can be carried out according to the procedure of a general phosphoramidite method. The nucleic acid elongation reaction may also be carried out using an automated nucleic acid synthesizer employing the phosphoramidite method.
[0062] The chain length of nucleic acid molecules may be, for example, 20 mer or more (i.e., n≧19), 40 mer or more (i.e., n≧39), 50 mer or more (i.e., n≧49), 60 mer or more (i.e., n≧59), 80 mer or more (i.e., n≧79), 100 mer or more (i.e., n≧99), 2 to 200 mer (i.e., 1≦n≦199), 10 to 150 mer (i.e., 9≦n≦149), or 15 to 110 mer (i.e., 14≦n≦109).
[0063] Step (1), the deprotection step, is a step in which the protecting group of the 5' hydroxyl group at the end of the oligonucleotide chain supported on the solid phase support is deprotected. Common protecting groups used include the 4,4'-dimethoxytrityl group (DMTr group), the 4-monomethoxytrityl group, and the 4,4',4”-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.
[0064] The condensation step in step (2) is a reaction in which a nucleoside phosphoramidite represented by the following formula (13) as shown in scheme A of Figure 1 is attached to the 5' hydroxyl group at the end of the oligonucleotide chain that has been deprotected in the deprotection step. Examples of phosphoramidites used for nucleic acid elongation include formula (13), uridine EMM amidite described in Example 2 of Japanese Patent No. 5554881, cytidine EMM amidite described in Example 3, adenosine EMM amidite described in Example 4, and guanosine EMM amidite described in Example 5, as well as uridine PMM amidite, cytidine PMM amidite, adenosine PMM amidite, and guanosine PMM amidite described in International Publication No. 2019 / 208571. Other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl group, 2'-O-methoxyethyl group, 2'-bis(2-acetoxy)methyl (ACE) group, 2'-(triisopropylsilyloxy)methyl (TOM) group, 2'-(2-cyanoethoxy)ethyl (CEE) group, 2'-(2-cyanoethoxy)methyl (CEM) group, 2'-p-toluylsulfonylethoxymethyl (TEM) group, 2'-H, and 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl group. The nucleoside phosphoramidite used is one in which the 5'-hydroxyl group is protected with a protecting group (e.g., DMTr group). The condensation step can be carried out using an activator or condensing agent that activates the nucleoside phosphoramidite. Examples of activators or condensing agents include 5-benzylthio-1H-tetrazole (BTT) (also known as 5-benzylmercapto-1H-tetrazole), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), or 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.
[0065] The nucleoside phosphoramidite (hereinafter referred to as amidite) shown in formula (13) in scheme A of Figure 1 is as follows: formula: [ka] (In the formula, G 1 , G 2 , G 3 B a , and R are as described above. ) The compound represented by ).
[0066] After the condensation step, unreacted 5'-hydroxyl groups may be capped as appropriate. Capping can be carried out using known capping solutions such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.
[0067] The oxidation step (3) is a step in which the phosphite group formed in the condensation step is converted into a phosphate group or a thiophosphate group. This step is a reaction that converts trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting an oxidizing agent with an oligonucleotide derivative supported on a solid support. When converting phosphite groups to phosphate groups, iodine can be used as an "oxidizing agent," for example. The oxidizing agent can be prepared and used at a concentration of 0.005 to 2 M. Water can be used as the oxygen source for oxidation, and pyridine, N-methylimidazole (NMI), N-methylmorpholine, or triethylamine can be used as the base to carry out the reaction. The solvent is not particularly limited as long as it does not participate in the reaction, but examples include acetonitrile, tetrahydrofuran (THF), or a mixture of these in any proportion. For example, iodine / water / pyridine / acetonitrile, or iodine / water / pyridine, or iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is usually appropriate to be 1 to 30 minutes. The amount of reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, per 1 mol of the compound supported on the solid support.
[0068] When converting phosphite triester groups to thiophosphate triester groups, for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazoline-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazoline-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS) can be used as "oxidizing agents." These oxidizing agents can be used after diluting them with a suitable solvent to a concentration of 0.001 to 2 M. The solvent used in the reaction is not particularly limited as long as it does not participate in the reaction, but examples include dichloromethane, acetonitrile, pyridine, or a mixture of these in any proportion. The oxidation step may be performed after the capping operation, or conversely, after the oxidation step; the order is not limited.
[0069] In step (5-1), the protecting group of the hydroxyl group at the 5' position of the nucleotide introduced at the end of extension may be used for column purification tagging the protecting group of the hydroxyl group at the 5' position after cleavage from the solid support and deprotection of the protecting group as described later, and the protecting group of the hydroxyl group at the 5' position may be deprotected after column purification.
[0070] In step (5-2), the step of deprotecting the phosphate protecting group involves treating the nucleic acid having the desired sequence with an amine compound after the synthesis is complete to deprotect the protecting group of the phosphate moiety. Examples of amine compounds include diethylamine, as described in Japanese Patent Publication No. 4705716.
[0071] In step (5-2), the cleavage of nucleic acid molecules that have been extended to the desired chain length on the solid support is usually carried out using concentrated ammonia water as the cleavage agent.
[0072] Furthermore, oligonucleotide chains are cleaved and recovered from the solid support using ammonia or an amine compound, for example. Examples of amine compounds include methylamine, ethylamine, isopropylamine, ethylenediamine, or diethylamine.
[0073] In step (5-3), the protecting group of the hydroxyl group at the 2' or 3' position of the ribose of the nucleic acid compound (4) cleaved from the solid support in step (5-2) can be removed according to the method described in International Publication No. 2006 / 022323), International Publication No. 2013 / 027843, or International Publication No. 2019 / 208571 to obtain a deprotected nucleic acid molecule (5).
[0074] Nucleic acid molecules that can be produced using the production method of the present invention include, but are not limited to, nucleic acid molecules in which the nucleoside contained within the nucleic acid molecule is RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, 2'-F, and LNA. For example, various examples of nucleosides are described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558. Preferably, the nucleic acid molecule produced by the method of the present invention is RNA.
[0075] Typical examples of nucleic acid molecules that can be used in the manufacturing method of the present invention are shown below, in addition to the examples described in the examples, but are not limited to these. In the following sequence descriptions, U represents uridine, C represents cytidine, A represents adenosine, and G represents guanosine. Examples of nucleic acid molecules having the following sequences (A) and (B) are described in International Publication No. 2019 / 060442. Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3'(Antisense)(Sequence ID 1)21mer Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3'(Sense)(Sequence ID 2)21mer In sequences (A) and (B), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine. Nucleic acid molecules described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553) are examples. A typical example is a nucleic acid molecule having the following sequence (C). Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3'(Sequence ID 3)36mer Examples include nucleic acid molecules described in Japanese Patent Publication No. 4965745. A typical example is a nucleic acid molecule having the following sequence (D). Sequence (D): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3'(Sequence IDs 4,5)49mer In array (D), "P" is represented by the substructure separated by a wavy line in the following equation (A5). Note that the entry for Sequence ID No. 4 in the sequence listing indicates the base sequence of the following sequence (D1) from the 5' end of sequence (D) to before "P", and the entry for Sequence ID No. 5 indicates the base sequence of the following sequence (D2) from after "P" to the 3' end of sequence (D). Sequence (D1): 5'-CCAUGAGAAGUAUGACAACAGCC-3'(Sequence ID 4)23mer Sequence (D2): 5'-GGCUGUUGUCAUACUUCUCAUGGUU-3'(Sequence ID 5)25mer Nucleic acid molecules having the following sequence (E) are listed in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (E): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3'(Sequence ID 6)67mer Examples of nucleic acid molecules having the following sequence (F) are described on page 173 of Japanese Patent Publication No. 2015-523856. Sequence (F): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3'(Sequence ID 7)94mer Nucleic acid molecules described in Japanese Patent Publication No. 2017-537626 are examples. Typical examples include nucleic acid molecules having the following sequences (G), (H), (K), and (J). Sequence (G): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3'(Sequence ID 8)100mer Sequence (H): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3'(Sequence ID 9)113mer Array (K): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3'(Sequence ID 10)113mer In sequence (K), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine. Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsUmsU-3'(Sequence ID 11)113mer In sequence (J), Um represents 2'-O-methyluridine, Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents phosphorothioate modification. [Examples]
[0076] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples. <Measurement method> First, the various measurement methods used in the following tests are shown below. The purity of the oligonucleotide was measured using HPLC. The HPLC measurement conditions are shown in Table 1 below. (Measurement method 1: Measurement of oligonucleotide purity) [Table 1]
[0077] (Measurement method 2: Measurement of oligonucleotide yield) OD of the crude product 260 OD was measured. 260 This represents the absorbance at UV260nm per 10mm optical path length in a 1mL solution (pH=7.5). Generally, it is known that 1OD = 40μg for RNA, so the above OD 260 The yield was calculated based on the measured values.
[0078] (Measurement method 3: Measurement of formaldehyde concentration) One method for measuring the formaldehyde concentration in a dichloroacetic acid solution is high-performance liquid chromatography (HCM). In HCM, formaldehyde is reacted with acetylacetone, and the amount of 3,5-diacetyl-1,4-dihydrolutidine obtained is measured to calculate the formaldehyde concentration. The HPLC measurement conditions are shown in Table 2 below. [Table 2]
[0079] (Measurement method 4: Measurement of dichloroacetic anhydride concentration) High-performance liquid chromatography (HPLC) is a method for measuring the concentration of dichloroacetic anhydride in a dichloroacetic acid solution. In HPLC, dichloroacetic anhydride is reacted with benzylamine, and the amount of N-benzyl-2,2-dichloroacetamide obtained is measured to calculate the concentration of dichloroacetic anhydride. The HPLC measurement conditions are shown in Table 3 below. [Table 3]
[0080] <Preparation of dichloroacetic acid solution> The dichloroacetic acid solutions used in Examples 4 to 6 below had a molar ratio of dichloroacetic acid to formaldehyde (formaldehyde mol / dichloroacetic acid mol) of 16 × 10⁻⁶. ―4 Furthermore, the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 25 × 10 ―5 Commercially available dichloroacetic acid was treated as described in Examples 1 to 3, and toluene was added to the resulting dichloroacetic acid to prepare the solution. The molar ratio of dichloroacetic acid to formaldehyde (formaldehyde mol / dichloroacetic acid mol) and the molar ratio of dichloroacetic acid anhydride to dichloroacetic acid in the toluene solution of the prepared dichloroacetic acid are shown in Table 5. The number of moles of dichloroacetic acid was calculated based on the amount of reagent weighed. It was confirmed by GC-MS that no chloral was present. For reference, the molar ratios of formaldehyde and dichloroacetic acid anhydride for other commercially available dichloroacetic acids are shown in the table below. [Table 4]
[0081] Example 1 92.4 g of the aforementioned commercially available dichloroacetic acid was mixed with 1.17 g of methanol and 51.2 g of toluene. The mixture was stirred at 40°C for 2 hours, and then the pressure was reduced to 33 hPa using an evaporator to remove the low-boiling components. Toluene was added to the resulting dichloroacetic acid to prepare a 3 v / v% dichloroacetic acid solution. This solution was used in Example 4. The formaldehyde (mol) / dichloroacetic acid (mol) and dichloroacetic acid anhydride (mol) / dichloroacetic acid (mol) ratios are shown in Table 5.
[0082] Comparative Example 1 93.1 g of the aforementioned commercially available dichloroacetic acid was mixed with 1.17 g of methanol and 1687 g of toluene to prepare a 3 v / v% dichloroacetic acid solution, which was left to stand at room temperature. This solution was used in Comparative Example 4.
[0083] Example 2 92.7 g of the aforementioned commercially available dichloroacetic acid was mixed with 1.17 g of water and 50.6 g of toluene. The mixture was stirred at 40°C for 2 hours, and then the pressure was reduced to 33 hPa using an evaporator to remove the low-boiling components. Toluene was added to the resulting dichloroacetic acid to prepare a 3 v / v% dichloroacetic acid solution. This solution was used in Example 5.
[0084] Comparative Example 2 92.5 g of the aforementioned commercially available dichloroacetic acid was mixed with 1.17 g of water and 1687 g of toluene to prepare a 3 v / v% dichloroacetic acid solution, which was left to stand at room temperature. This solution was used in Comparative Example 5.
[0085] Example 3 To 92.0 g of the aforementioned commercially available dichloroacetic acid, 1.17 g of propylamine and 52.3 g of toluene were added and stirred at 40°C for 2 hours. The mixture was then reduced to 33 hPa using an evaporator, and the low-boiling components were removed by distillation. Toluene was added to the obtained dichloroacetic acid to prepare a 3 v / v% dichloroacetic acid solution. This solution was used in Example 6.
[0086] Comparative Example 3 217.0 g of the aforementioned commercially available dichloroacetic acid was heated in an oil bath at 120°C and distilled at 40 hPa until the fraction exceeded 50%. Toluene was added to the resulting residue to prepare a 3 v / v% dichloroacetic acid solution. This solution was used in Comparative Example 6.
[0087] <Solid-phase synthesis of 50-mer oligonucleotides> Array (I): 5'-AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3'(Sequence ID 12) In the sequence (I) above, "A" is represented by the substructure separated by the wavy line in the following formula (A1). "C" is represented by the substructure separated by the wavy line in the following formula (A2). "G" is represented by the substructure separated by the wavy line in the following formula (A3). U is represented by the substructure separated by the wavy line in the following formula (A4). Note that the "U" at the 3' end is represented by the substructure separated by the wavy line in the following formula (A8). Also, in the sequence (I), the "A" at the 5' end is represented by the substructure separated by the wavy line in the following formula (A7).
[0088] [ka]
[0089] [ka]
[0090] [ka]
[0091] [ka]
[0092] [ka]
[0093] [ka]
[0094] [ka]
[0095] For the synthesis, uridine PMM amidite, cytidine PMM amidite, adenosine PMM amidite, and guanosine PMM amidite, as described in the aforementioned International Publication No. 2019 / 208571, were used.
[0096] In the following examples and comparative examples, the uridine derivatives refer to the compounds shown in the following structural formulas. The circles shown in the following structural formulas schematically represent CPGs.
[0097] [ka]
[0098] (Example 4) Nucleic acid molecules were automatically synthesized from the 3' to the 5' end using Controlled Pore Glass (CPG) supporting 1.0 μmol of uridine derivative and PMM amidites with NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The automated synthesis procedure was as follows: First, a 3% toluene dichloroacetate solution prepared in Example 1 was delivered to the CPG to deprotect the trityl protecting group at the 5' position. Next, various amidites and 5-benzyl mercapto-1H-tetrazole as a coupling agent were delivered to the CPG to allow a coupling reaction to proceed at the hydroxyl group at the 5' position. Subsequently, an oxidation solution containing 50 mM iodine was delivered to convert the phosphite group to a phosphate group. Finally, 0.1 M phenoxyacetic anhydride acetonitrile solution and 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap reaction sites where coupling did not proceed. After repeating these steps a total of 49 times, the protecting group (DMTr group) at the 5' end of the base was deprotected with a 3% toluene dichloroacetate solution to synthesize nucleic acid oligonucleotides on a CPG support. Subsequently, 1.5 mL of 28% aqueous ammonia and 0.5 mL of ethanol were added to the CPG support loaded with 1.0 μmol of oligonucleotide, and the mixture was incubated at 40°C for 4 hours to release the nucleic acid molecules from the solid support. The solvent was then removed by concentration. Next, the free oligonucleotide was dissolved in 1.5 mL of dimethyl sulfoxide, followed by the addition of 1.0 mL of acetonitrile, 20 μL of nitromethane, and a stirrer. Then, 2.08 mL of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF), which had been dehydrated using molecular sieve 4A, was added at room temperature under stirring with a stirrer, and the mixture was incubated at 33°C for 4 hours to deprotect the 2' protecting group. The nucleic acid molecule product was then obtained by precipitation. The purity of the oligonucleotide in the obtained product was measured using the method described in Measurement Method 1, and the purity was found to be 67%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and the yield was 6068 μg. The results are shown in Table 5.
[0099] (Comparative Example 4) In the experiment of Example 4, nucleic acid molecules were obtained in the same manner as in Comparative Example 1, except that the 3% toluene dichloroacetate solution prepared in Comparative Example 1 was used as the 3% toluene dichloroacetate solution. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the purity of the product was found to be 51%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and the yield was 5303 μg. The results are shown in Table 5.
[0100] (Example 5) In the experiment of Example 4, nucleic acid molecules were obtained in the same manner as in Example 2, except that the 3% toluene dichloroacetate solution prepared in Example 2 was used as the 3% toluene dichloroacetate solution. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the purity of the product was found to be 70%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and the yield was 6034 μg. The results are shown in Table 5.
[0101] (Comparative Example 5) In the experiment of Example 4, nucleic acid molecules were obtained in the same manner as in Comparative Example 2, except that the 3% toluene dichloroacetate solution prepared in Comparative Example 2 was used as the 3% toluene dichloroacetate solution. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the purity of the product was found to be 37%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and the yield was 4003 μg. The results are shown in Table 5.
[0102] (Example 6) In the experiment of Example 4, nucleic acid molecules were obtained in the same manner as in Example 3, except that the 3% toluene dichloroacetate solution prepared in Example 3 was used as the 3% toluene dichloroacetate solution. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the purity of the product was found to be 65%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and the yield was 6144 μg. The results are shown in Table 5.
[0103] (Comparative Example 6) In the experiment of Example 4, nucleic acid molecules were obtained in the same manner as in Comparative Example 3, except that the 3% toluene dichloroacetate solution prepared in Comparative Example 3 was used as the 3% toluene dichloroacetate solution. The purity of the oligonucleotide was measured using the method described in Measurement Method 1, and the purity of the product was found to be 43%. Furthermore, the yield of the oligonucleotide was measured using the method described in Measurement Method 2, and the yield was 4492 μg. The results are shown in Table 5.
[0104] [Table 5]
[0105] As shown in Table 5 above, in Examples 4-6 using the dichloroacetic acid of the present invention, nucleic acid molecules were obtained in higher yield and higher purity compared to the cases using dichloroacetic acid in Comparative Examples 4-6. [Industrial applicability]
[0106] This invention provides a method for producing purified dichloroacetic acid and an efficient method for producing nucleic acid molecules using the same. Furthermore, it is expected that the yield of nucleic acid molecules produced according to this method will be improved. [Sequence Listing Free Text]
[0107] Sequence IDs 1 to 12 in the sequence listing represent the base sequences of oligonucleotides produced according to the manufacturing method of the present invention.
Claims
1. A method for producing purified dichloroacetic acid, wherein the molar ratio of formaldehyde to dichloroacetic acid is 81 × 10⁻⁶ or less, and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 50 × 10⁻⁶ or less, Dichloroacetic acid in which the content of both or one of formaldehyde and dichloroacetic anhydride exceeds the aforementioned ratio, A method for producing purified dichloroacetic acid, comprising contacting a compound having a lower boiling point than dichloroacetic acid with at least one compound selected from the group consisting of aliphatic alcohols, aliphatic amines, and water, and distilling off the fraction containing the solvent from the resulting mixture in the presence of an aprotic inert solvent having a lower boiling point than dichloroacetic acid, The aliphatic alcohol is methanol, ethanol, n-propanol, i-propanol, n-butanol, i-butanol, sec-butanol, t-butanol, n-pentanol, or n-hexanol. The aliphatic amine is methylamine, ethylamine, propylamine, butylamine, pentylamine, or hexylamine. A method for producing a product, wherein the aprotic inert solvent is toluene, xylene, monochlorobenzene, o-dichlorobenzene, acetonitrile, or dichloromethane.
2. The manufacturing method according to claim 1, wherein the aprotic inert solvent is dichloromethane, acetonitrile, or toluene.
3. A method for producing nucleic acid molecules by the amidite method, comprising the steps of: preparing purified dichloroacetic acid by the production method described in claim 1, wherein the molar ratio of formaldehyde to dichloroacetic acid is 81 × 10⁻⁶ or less, and the molar ratio of dichloroacetic acid anhydride to dichloroacetic acid is 50 × 10⁻⁶ or less; and reacting the purified dichloroacetic acid with a nucleic acid molecule in which the hydroxyl group at the 5' end is protected to remove the protecting group of the hydroxyl group.
4. A nucleic acid molecule with a protected hydroxyl group at the 5' end is given by formula (1): 【Chemistry 1】 (In the formula, G 2 This indicates a protecting group for hydroxyl groups. B a Each of these independently represents a nucleic acid base that may be protected by a protecting group, either identical or distinct. R 1 , R 2 and R 3 Each of these independently, identically or distinctly, represents a hydrogen atom or an alkoxy group. Each R independently represents a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group, either identical or distinct. Q' independently represents a methylene group, an ethylene group, or an ethylidene group bonded to the carbon atom at the 4' position of ribose, either identically or distinctly. Each Y independently represents either the same or different oxygen or sulfur atom. n represents any integer between 1 and 200. W 1 represents an OZ group, and X 1 This represents an R group, or W 1 represents an OV group and X 1 represents an OZ group V represents the protecting group for the hydroxyl group. Z is a group having a structure consisting of a solid support and a linking group. Furthermore, when n is an integer greater than or equal to 2, the nucleic acid molecule represented by equation (1) may have non-nucleotide linkers incorporated between each nucleotide. This is a nucleic acid molecule represented by The deprotected nucleic acid molecule is given by formula (2): 【Chemistry 2】 (In the formula, G 2 , B a , R, Y, X 1 , W 1 And n are as described above, and, As defined in formula (1), non-nucleotide linkers may be incorporated between nucleotides. The method for producing a nucleic acid molecule as shown in claim 3.
5. The process described in claim 4, further comprising the steps of removing the group represented by Z from the nucleic acid molecule represented by formula (2) produced in the said process, and removing the hydroxyl group and the protecting group of the nucleic acid base, wherein formula (2'): 【Transformation 3】 (In the formula, Y and n are as described above. B c Each of these independently, identically or distinctly, represents a nucleic acid base. G 4 Each of these independently represents a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion, either identical or distinct in phase. Each R' independently represents, either identical or distinct, a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group. Q' is as stated above, and, X 3 and W 3 Each of these independently represents a hydroxyl group, or X 3 represents an R' group, and W 3 This represents a hydroxyl group. And, As defined in formula (1), non-nucleotide linkers may be incorporated between nucleotides. A method for producing nucleic acid molecules as shown.
6. The method for producing a nucleic acid molecule according to any one of claims 3, 4, and 5, wherein the nucleic acid molecule is a nucleic acid molecule containing ribonucleic acid (RNA).
7. The manufacturing method according to claim 6, wherein the nucleic acid molecule is ribonucleic acid (RNA), and the protecting group of the hydroxyl group at the 2' position of the ribose is the protecting group shown in formula (6). Formula (6): 【Chemistry 4】 (In the formula, q represents an integer between 0 and 5. R a and R b Each of these independently represents a methyl group, an ethyl group, or a hydrogen atom, either identical or distinct. The asterisk (*) indicates the bond point between the oxygen atom and the hydroxyl group at the 2' position of ribose, and, E W (This represents an electron-withdrawing group.)
8. R a Or R b Either one of them is a methyl group, and the other is a hydrogen atom, and E w The manufacturing method according to claim 7, wherein is a cyano group.
9. The method for producing according to any one of claims 3, 4, and 5, wherein the nucleic acid molecule is an oligomer with a chain length of 40 or more.
10. The method for producing according to any one of claims 3, 4, and 5, wherein the nucleic acid molecule is an oligomer with a chain length of 50 or more.
11. The method for producing according to any one of claims 3, 4, and 5, wherein the nucleic acid molecule is an oligomer with a chain length of 60 or more.
12. The method for producing according to any one of claims 3, 4, and 5, wherein the nucleic acid molecule is an oligomer with a chain length of 80 or more.
13. The method for producing according to any one of claims 3, 4, and 5, wherein the nucleic acid molecule is an oligomer with a chain length of 100 or more.
Citation Information
Patent Citations
JP1972030165B
Improved methods for synthesis of oligonucleotides
WO1999043694A1